>Feature sequence01 532 149 gene locus_tag LOCUS_00010 532 149 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_00010 2059 845 gene locus_tag LOCUS_00020 gene hydF 2059 845 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_00020 3542 2094 gene locus_tag LOCUS_00030 gene hydG 3542 2094 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_00030 4794 3727 gene locus_tag LOCUS_00040 gene hydE 4794 3727 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_00040 5101 4847 gene locus_tag LOCUS_00050 5101 4847 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_00050 5431 5622 gene locus_tag LOCUS_00060 5431 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5588 7267 gene locus_tag LOCUS_00070 gene malQ 5588 7267 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_00070 7705 7307 gene locus_tag LOCUS_00080 7705 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8531 7821 gene locus_tag LOCUS_00090 8531 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9847 8621 gene locus_tag LOCUS_00100 9847 8621 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_00100 10393 10211 gene locus_tag LOCUS_00110 10393 10211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10598 10338 gene locus_tag LOCUS_00120 10598 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10809 10885 gene locus_tag LOCUS_t00010 10809 10885 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11283 13280 gene locus_tag LOCUS_00130 gene htpG 11283 13280 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908439.1 protein_id gnl|my_center|LOCUS_00130 14768 13440 gene locus_tag LOCUS_00140 14768 13440 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_00140 17091 15025 gene locus_tag LOCUS_00150 gene ligA 17091 15025 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_00150 19458 17122 gene locus_tag LOCUS_00160 gene pcrA 19458 17122 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992872.1 protein_id gnl|my_center|LOCUS_00160 20702 19524 gene locus_tag LOCUS_00170 20702 19524 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_00170 21318 20749 gene locus_tag LOCUS_00180 21318 20749 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_00180 23060 21333 gene locus_tag LOCUS_00190 gene iorA 23060 21333 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_00190 23540 24211 gene locus_tag LOCUS_00200 23540 24211 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963654.1 protein_id gnl|my_center|LOCUS_00200 24561 24385 gene locus_tag LOCUS_00210 24561 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24840 26891 gene locus_tag LOCUS_00220 gene uvrB 24840 26891 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357634.1 protein_id gnl|my_center|LOCUS_00220 26937 29837 gene locus_tag LOCUS_00230 gene uvrA 26937 29837 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_00230 29869 30756 gene locus_tag LOCUS_00240 29869 30756 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_00240 30802 31248 gene locus_tag LOCUS_00250 gene rnhA 30802 31248 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_00250 31466 32593 gene locus_tag LOCUS_00260 31466 32593 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_00260 33150 32719 gene locus_tag LOCUS_00270 33150 32719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34493 33165 gene locus_tag LOCUS_00280 34493 33165 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000652047.1 protein_id gnl|my_center|LOCUS_00280 35489 34497 gene locus_tag LOCUS_00290 gene miaA 35489 34497 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861408.1 protein_id gnl|my_center|LOCUS_00290 37528 35489 gene locus_tag LOCUS_00300 gene mutL 37528 35489 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101707.1 protein_id gnl|my_center|LOCUS_00300 40225 37583 gene locus_tag LOCUS_00310 gene mutS 40225 37583 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_00310 41759 40287 gene locus_tag LOCUS_00320 gene miaB 41759 40287 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_00320 43338 42010 gene locus_tag LOCUS_00330 43338 42010 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_00330 43526 45352 gene locus_tag LOCUS_00340 gene glmS 43526 45352 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_00340 45438 46748 gene locus_tag LOCUS_00350 45438 46748 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356165.1 protein_id gnl|my_center|LOCUS_00350 46815 47837 gene locus_tag LOCUS_00360 gene queA 46815 47837 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_00360 47941 49059 gene locus_tag LOCUS_00370 gene tgt 47941 49059 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_00370 49056 49583 gene locus_tag LOCUS_00380 gene tsaE 49056 49583 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_00380 49705 50226 gene locus_tag LOCUS_00390 gene tsaB 49705 50226 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_00390 50574 50308 gene locus_tag LOCUS_00400 gene spoIIID 50574 50308 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966143.1 protein_id gnl|my_center|LOCUS_00400 51919 51206 gene locus_tag LOCUS_00410 51919 51206 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_00410 52758 51982 gene locus_tag LOCUS_00420 52758 51982 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_00420 53562 52774 gene locus_tag LOCUS_00430 53562 52774 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463553.1 protein_id gnl|my_center|LOCUS_00430 54198 53659 gene locus_tag LOCUS_00440 54198 53659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54818 54261 gene locus_tag LOCUS_00450 gene efp 54818 54261 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_00450 56046 54979 gene locus_tag LOCUS_00460 56046 54979 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_00460 56527 58896 gene locus_tag LOCUS_00470 gene lon 56527 58896 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460911.1 protein_id gnl|my_center|LOCUS_00470 59718 59131 gene locus_tag LOCUS_00480 59718 59131 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_00480 60206 59715 gene locus_tag LOCUS_00490 60206 59715 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_00490 62295 60541 gene locus_tag LOCUS_00500 62295 60541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 62647 63912 gene locus_tag LOCUS_00510 62647 63912 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_00510 63997 64761 gene locus_tag LOCUS_00520 63997 64761 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_00520 64761 65750 gene locus_tag LOCUS_00530 64761 65750 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_00530 65743 66441 gene locus_tag LOCUS_00540 gene pyrF 65743 66441 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_00540 66517 67185 gene locus_tag LOCUS_00550 gene pyrE 66517 67185 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_00550 67187 68110 gene locus_tag LOCUS_00560 gene pyrB 67187 68110 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_00560 68144 68563 gene locus_tag LOCUS_00570 68144 68563 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052224.1 protein_id gnl|my_center|LOCUS_00570 69721 68765 gene locus_tag LOCUS_00580 69721 68765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 70275 69718 gene locus_tag LOCUS_00590 70275 69718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 71814 70390 gene locus_tag LOCUS_00600 71814 70390 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_00600 74074 72080 gene locus_tag LOCUS_00610 gene tkt 74074 72080 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_00610 75403 75131 gene locus_tag LOCUS_00620 75403 75131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 75438 75764 gene locus_tag LOCUS_00630 75438 75764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 75956 77983 gene locus_tag LOCUS_00640 75956 77983 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_00640 78051 78845 gene locus_tag LOCUS_00650 78051 78845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 80912 78969 gene locus_tag LOCUS_00660 80912 78969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 81445 82896 gene locus_tag LOCUS_00670 81445 82896 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582535.1 protein_id gnl|my_center|LOCUS_00670 83230 83009 gene locus_tag LOCUS_00680 83230 83009 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_00680 83623 84789 gene locus_tag LOCUS_00690 83623 84789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 86000 85089 gene locus_tag LOCUS_00700 86000 85089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 86672 86028 gene locus_tag LOCUS_00710 gene deoC 86672 86028 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933101.1 protein_id gnl|my_center|LOCUS_00710 87907 86723 gene locus_tag LOCUS_00720 gene mnmA 87907 86723 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837714.1 protein_id gnl|my_center|LOCUS_00720 88128 87928 gene locus_tag LOCUS_00730 88128 87928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 88635 88282 gene locus_tag LOCUS_00740 88635 88282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 89536 90762 gene locus_tag LOCUS_00750 89536 90762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 90943 91719 gene locus_tag LOCUS_00760 90943 91719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91734 91913 gene locus_tag LOCUS_00770 91734 91913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 91913 92941 gene locus_tag LOCUS_00780 91913 92941 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_00780 92985 94076 gene locus_tag LOCUS_00790 92985 94076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 95685 94315 gene locus_tag LOCUS_00800 95685 94315 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943178.1 protein_id gnl|my_center|LOCUS_00800 97214 95742 gene locus_tag LOCUS_00810 97214 95742 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_00810 98023 97298 gene locus_tag LOCUS_00820 98023 97298 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_00820 98469 98032 gene locus_tag LOCUS_00830 98469 98032 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048129.1 protein_id gnl|my_center|LOCUS_00830 100900 98516 gene locus_tag LOCUS_00840 100900 98516 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_00840 103145 100935 gene locus_tag LOCUS_00850 103145 100935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 103649 103230 gene locus_tag LOCUS_00860 103649 103230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 104387 104311 gene locus_tag LOCUS_t00020 104387 104311 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 105576 104581 gene locus_tag LOCUS_00870 105576 104581 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_00870 105788 106675 gene locus_tag LOCUS_00880 105788 106675 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_00880 106815 107381 gene locus_tag LOCUS_00890 106815 107381 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_00890 108213 107539 gene locus_tag LOCUS_00900 108213 107539 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_00900 108542 109483 gene locus_tag LOCUS_00910 108542 109483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 109759 110616 gene locus_tag LOCUS_00920 109759 110616 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_00920 110657 112234 gene locus_tag LOCUS_00930 gene pckA 110657 112234 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_00930 112324 112518 gene locus_tag LOCUS_00940 112324 112518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 112714 112472 gene locus_tag LOCUS_00950 gene rpsR 112714 112472 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_00950 113316 112738 gene locus_tag LOCUS_00960 gene ssb 113316 112738 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254001.1 protein_id gnl|my_center|LOCUS_00960 113624 113337 gene locus_tag LOCUS_00970 gene rpsF 113624 113337 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_00970 115156 114011 gene locus_tag LOCUS_00980 115156 114011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 115628 116854 gene locus_tag LOCUS_00990 115628 116854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 116844 117812 gene locus_tag LOCUS_01000 116844 117812 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_01000 118671 117928 gene locus_tag LOCUS_01010 118671 117928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 119644 118760 gene locus_tag LOCUS_01020 gene sdaAA 119644 118760 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_01020 120381 119641 gene locus_tag LOCUS_01030 gene sdaAB 120381 119641 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_01030 120764 120399 gene locus_tag LOCUS_01040 120764 120399 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295200.1 protein_id gnl|my_center|LOCUS_01040 121176 120802 gene locus_tag LOCUS_01050 121176 120802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 122709 121177 gene locus_tag LOCUS_01060 122709 121177 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_01060 123584 122820 gene locus_tag LOCUS_01070 123584 122820 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_01070 125419 124199 gene locus_tag LOCUS_01080 gene arcA 125419 124199 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385506.1 protein_id gnl|my_center|LOCUS_01080 126824 125796 gene locus_tag LOCUS_01090 126824 125796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 128356 127112 gene locus_tag LOCUS_01100 128356 127112 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_01100 129108 128476 gene locus_tag LOCUS_01110 129108 128476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 129503 130438 gene locus_tag LOCUS_01120 129503 130438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence02 951 583 gene locus_tag LOCUS_01130 gene rplL 951 583 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_01130 1534 1004 gene locus_tag LOCUS_01140 gene rplJ 1534 1004 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_01140 2321 1884 gene locus_tag LOCUS_01150 2321 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3885 2536 gene locus_tag LOCUS_01160 gene gdhA 3885 2536 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_01160 5340 4216 gene locus_tag LOCUS_01170 gene glgD 5340 4216 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_01170 6562 5333 gene locus_tag LOCUS_01180 6562 5333 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_01180 11545 7265 gene locus_tag LOCUS_01190 11545 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 11868 11590 gene locus_tag LOCUS_01200 11868 11590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 11931 12722 gene locus_tag LOCUS_01210 gene truA 11931 12722 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_01210 12764 13540 gene locus_tag LOCUS_01220 12764 13540 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_01220 13636 14478 gene locus_tag LOCUS_01230 gene dapF 13636 14478 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_01230 14685 15650 gene locus_tag LOCUS_01240 gene dusB 14685 15650 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048374.1 protein_id gnl|my_center|LOCUS_01240 15739 17196 gene locus_tag LOCUS_01250 15739 17196 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_01250 17473 17294 gene locus_tag LOCUS_01260 17473 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 20037 17701 gene locus_tag LOCUS_01270 20037 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 20836 20288 gene locus_tag LOCUS_01280 gene pyrR 20836 20288 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_01280 22498 20921 gene locus_tag LOCUS_01290 22498 20921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 23723 22608 gene locus_tag LOCUS_01300 23723 22608 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917329.1 protein_id gnl|my_center|LOCUS_01300 24307 23720 gene locus_tag LOCUS_01310 gene lspA 24307 23720 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_01310 24677 25765 gene locus_tag LOCUS_01320 gene gcvT 24677 25765 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_01320 25919 26293 gene locus_tag LOCUS_01330 gene gcvH 25919 26293 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_01330 26491 27855 gene locus_tag LOCUS_01340 gene gcvPA 26491 27855 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_01340 27852 29294 gene locus_tag LOCUS_01350 gene gcvPB 27852 29294 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_01350 30514 29444 gene locus_tag LOCUS_01360 gene tsaD 30514 29444 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_01360 31331 30597 gene locus_tag LOCUS_01370 31331 30597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 32558 31341 gene locus_tag LOCUS_01380 32558 31341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 33787 32858 gene locus_tag LOCUS_01390 33787 32858 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_01390 34466 34143 gene locus_tag LOCUS_01400 34466 34143 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_01400 34906 37503 gene locus_tag LOCUS_01410 gene clpB 34906 37503 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_01410 37926 37738 gene locus_tag LOCUS_01420 37926 37738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 39577 38234 gene locus_tag LOCUS_01430 39577 38234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 41186 39684 gene locus_tag LOCUS_01440 41186 39684 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957021.1 protein_id gnl|my_center|LOCUS_01440 42271 41198 gene locus_tag LOCUS_01450 42271 41198 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_01450 43188 42589 gene locus_tag LOCUS_01460 43188 42589 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_01460 44631 43513 gene locus_tag LOCUS_01470 44631 43513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 45672 44842 gene locus_tag LOCUS_01480 45672 44842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 46333 46953 gene locus_tag LOCUS_01490 46333 46953 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 protein_id gnl|my_center|LOCUS_01490 47011 47421 gene locus_tag LOCUS_01500 47011 47421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 47647 47958 gene locus_tag LOCUS_01510 47647 47958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 48082 48639 gene locus_tag LOCUS_01520 48082 48639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 48752 49327 gene locus_tag LOCUS_01530 48752 49327 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_01530 49324 49827 gene locus_tag LOCUS_01540 49324 49827 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_01540 49835 50632 gene locus_tag LOCUS_01550 49835 50632 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099545.1 protein_id gnl|my_center|LOCUS_01550 50900 50625 gene locus_tag LOCUS_01560 50900 50625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 50960 51727 gene locus_tag LOCUS_01570 50960 51727 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_01570 51781 52626 gene locus_tag LOCUS_01580 51781 52626 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_01580 52639 53505 gene locus_tag LOCUS_01590 52639 53505 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01590 53534 54886 gene locus_tag LOCUS_01600 53534 54886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 54983 56899 gene locus_tag LOCUS_01610 gene mnmG 54983 56899 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_01610 56896 57609 gene locus_tag LOCUS_01620 gene rsmG 56896 57609 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_01620 57726 61082 gene locus_tag LOCUS_01630 gene addB 57726 61082 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_01630 61084 61368 gene locus_tag LOCUS_01640 61084 61368 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_01640 62239 61394 gene locus_tag LOCUS_01650 gene rsmI 62239 61394 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_01650 63023 62229 gene locus_tag LOCUS_01660 63023 62229 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_01660 63742 63038 gene locus_tag LOCUS_01670 63742 63038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 64943 63792 gene locus_tag LOCUS_01680 64943 63792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 65934 65056 gene locus_tag LOCUS_01690 65934 65056 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_01690 66575 67684 gene locus_tag LOCUS_01700 gene dnaN 66575 67684 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_01700 67717 69222 gene locus_tag LOCUS_01710 gene ypwA 67717 69222 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_01710 69233 69766 gene locus_tag LOCUS_01720 gene thpR 69233 69766 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082411.1 protein_id gnl|my_center|LOCUS_01720 69802 71346 gene locus_tag LOCUS_01730 69802 71346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 71439 71996 gene locus_tag LOCUS_01740 gene hpt 71439 71996 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_01740 72134 73150 gene locus_tag LOCUS_01750 gene galE 72134 73150 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_01750 73154 74230 gene locus_tag LOCUS_01760 73154 74230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 74292 75281 gene locus_tag LOCUS_01770 74292 75281 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_01770 75413 76795 gene locus_tag LOCUS_01780 75413 76795 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_01780 76962 77969 gene locus_tag LOCUS_01790 76962 77969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 78070 79215 gene locus_tag LOCUS_01800 78070 79215 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_01800 79279 82797 gene locus_tag LOCUS_01810 gene addA 79279 82797 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989936.1 protein_id gnl|my_center|LOCUS_01810 82964 83443 gene locus_tag LOCUS_01820 gene greA 82964 83443 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102591.1 protein_id gnl|my_center|LOCUS_01820 >Feature sequence03 327 100 gene locus_tag LOCUS_01830 327 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2056 386 gene locus_tag LOCUS_01840 2056 386 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436982.1 protein_id gnl|my_center|LOCUS_01840 2296 2372 gene locus_tag LOCUS_t00030 2296 2372 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2411 2487 gene locus_tag LOCUS_t00040 2411 2487 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2516 2590 gene locus_tag LOCUS_t00050 2516 2590 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2596 2671 gene locus_tag LOCUS_t00060 2596 2671 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2738 2822 gene locus_tag LOCUS_t00070 2738 2822 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2844 2919 gene locus_tag LOCUS_t00080 2844 2919 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3016 3471 gene locus_tag LOCUS_01850 3016 3471 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_01850 3858 4463 gene locus_tag LOCUS_01860 3858 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 4740 5540 gene locus_tag LOCUS_01870 4740 5540 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_01870 5587 6882 gene locus_tag LOCUS_01880 5587 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 7888 7001 gene locus_tag LOCUS_01890 7888 7001 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_01890 8423 8611 gene locus_tag LOCUS_01900 8423 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 9242 8634 gene locus_tag LOCUS_01910 9242 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 11004 9559 gene locus_tag LOCUS_01920 11004 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 11785 11018 gene locus_tag LOCUS_01930 11785 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 12089 13093 gene locus_tag LOCUS_01940 12089 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 13173 15224 gene locus_tag LOCUS_01950 13173 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 17932 15437 gene locus_tag LOCUS_01960 17932 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18417 18492 gene locus_tag LOCUS_t00090 18417 18492 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 19797 18640 gene locus_tag LOCUS_01970 19797 18640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 21282 19963 gene locus_tag LOCUS_01980 21282 19963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 23046 21298 gene locus_tag LOCUS_01990 23046 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 24033 23059 gene locus_tag LOCUS_02000 24033 23059 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_02000 25631 24039 gene locus_tag LOCUS_02010 25631 24039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921891.1 protein_id gnl|my_center|LOCUS_02010 27935 25737 gene locus_tag LOCUS_02020 27935 25737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 28457 28999 gene locus_tag LOCUS_02030 28457 28999 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_02030 29421 30011 gene locus_tag LOCUS_02040 29421 30011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 30065 32149 gene locus_tag LOCUS_02050 30065 32149 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_02050 32295 34055 gene locus_tag LOCUS_02060 32295 34055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 37118 34440 gene locus_tag LOCUS_02070 37118 34440 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909521.1 protein_id gnl|my_center|LOCUS_02070 38388 37609 gene locus_tag LOCUS_02080 38388 37609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 40841 38733 gene locus_tag LOCUS_02090 40841 38733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 41295 40846 gene locus_tag LOCUS_02100 41295 40846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 41344 41787 gene locus_tag LOCUS_02110 41344 41787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 42341 41934 gene locus_tag LOCUS_02120 42341 41934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 43234 42830 gene locus_tag LOCUS_02130 43234 42830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 43876 43295 gene locus_tag LOCUS_02140 43876 43295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 45330 44059 gene locus_tag LOCUS_02150 45330 44059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 46442 45345 gene locus_tag LOCUS_02160 46442 45345 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_02160 48095 46662 gene locus_tag LOCUS_02170 48095 46662 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_02170 48698 48315 gene locus_tag LOCUS_02180 48698 48315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 49652 49005 gene locus_tag LOCUS_02190 49652 49005 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_02190 51000 49693 gene locus_tag LOCUS_02200 51000 49693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 52646 50997 gene locus_tag LOCUS_02210 52646 50997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 53248 53009 gene locus_tag LOCUS_02220 53248 53009 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_02220 54004 53348 gene locus_tag LOCUS_02230 54004 53348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 55010 54099 gene locus_tag LOCUS_02240 55010 54099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 55371 55613 gene locus_tag LOCUS_02250 55371 55613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 57667 55775 gene locus_tag LOCUS_02260 57667 55775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_02260 59445 57670 gene locus_tag LOCUS_02270 59445 57670 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_02270 60189 59911 gene locus_tag LOCUS_02280 60189 59911 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459031.1 protein_id gnl|my_center|LOCUS_02280 61100 61753 gene locus_tag LOCUS_02290 61100 61753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 61793 62389 gene locus_tag LOCUS_02300 61793 62389 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_02300 62614 62402 gene locus_tag LOCUS_02310 62614 62402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 62782 62639 gene locus_tag LOCUS_02320 62782 62639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02320 63753 63052 gene locus_tag LOCUS_02330 63753 63052 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_02330 65644 63746 gene locus_tag LOCUS_02340 65644 63746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 66064 65780 gene locus_tag LOCUS_02350 66064 65780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 66729 66082 gene locus_tag LOCUS_02360 66729 66082 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_02360 68083 66743 gene locus_tag LOCUS_02370 68083 66743 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_02370 68876 68331 gene locus_tag LOCUS_02380 68876 68331 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476576.1 protein_id gnl|my_center|LOCUS_02380 77663 69423 gene locus_tag LOCUS_02390 77663 69423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 78407 78781 gene locus_tag LOCUS_02400 78407 78781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 78774 79280 gene locus_tag LOCUS_02410 78774 79280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence04 27 128 gene locus_tag LOCUS_r00010 27 128 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1042 305 gene locus_tag LOCUS_02420 1042 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 1670 1134 gene locus_tag LOCUS_02430 1670 1134 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774219.1 protein_id gnl|my_center|LOCUS_02430 2443 1706 gene locus_tag LOCUS_02440 2443 1706 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902966.1 protein_id gnl|my_center|LOCUS_02440 3008 2565 gene locus_tag LOCUS_02450 3008 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3521 3030 gene locus_tag LOCUS_02460 3521 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4314 3769 gene locus_tag LOCUS_02470 4314 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 4988 4314 gene locus_tag LOCUS_02480 gene lepB 4988 4314 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_02480 5302 5066 gene locus_tag LOCUS_02490 5302 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 7353 5761 gene locus_tag LOCUS_02500 7353 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 8744 7395 gene locus_tag LOCUS_02510 8744 7395 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_02510 9296 9586 gene locus_tag LOCUS_02520 9296 9586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 12496 9713 gene locus_tag LOCUS_02530 12496 9713 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_02530 13576 12605 gene locus_tag LOCUS_02540 13576 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 14131 13586 gene locus_tag LOCUS_02550 14131 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 15376 14201 gene locus_tag LOCUS_02560 15376 14201 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_02560 16102 15461 gene locus_tag LOCUS_02570 16102 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 18133 16322 gene locus_tag LOCUS_02580 18133 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 18541 20481 gene locus_tag LOCUS_02590 18541 20481 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_02590 20478 21146 gene locus_tag LOCUS_02600 20478 21146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 21143 22663 gene locus_tag LOCUS_02610 21143 22663 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_02610 22749 23336 gene locus_tag LOCUS_02620 22749 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 24542 23514 gene locus_tag LOCUS_02630 gene rsgA 24542 23514 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_02630 24778 24557 gene locus_tag LOCUS_02640 24778 24557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 25143 25937 gene locus_tag LOCUS_02650 25143 25937 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272204.1 protein_id gnl|my_center|LOCUS_02650 26216 26851 gene locus_tag LOCUS_02660 26216 26851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 26821 27162 gene locus_tag LOCUS_02670 26821 27162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 27176 28222 gene locus_tag LOCUS_02680 27176 28222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 28219 28992 gene locus_tag LOCUS_02690 28219 28992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 29869 29222 gene locus_tag LOCUS_02700 29869 29222 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_02700 30429 32048 gene locus_tag LOCUS_02710 30429 32048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 33033 32362 gene locus_tag LOCUS_02720 33033 32362 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_02720 33184 33348 gene locus_tag LOCUS_02730 33184 33348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 33345 34184 gene locus_tag LOCUS_02740 gene mreC 33345 34184 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_02740 34184 34696 gene locus_tag LOCUS_02750 34184 34696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 34807 37338 gene locus_tag LOCUS_02760 34807 37338 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861128.1 protein_id gnl|my_center|LOCUS_02760 37361 38098 gene locus_tag LOCUS_02770 37361 38098 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_02770 38921 38187 gene locus_tag LOCUS_02780 gene sigE 38921 38187 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399432.1 protein_id gnl|my_center|LOCUS_02780 39896 39024 gene locus_tag LOCUS_02790 39896 39024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 40305 41309 gene locus_tag LOCUS_02800 40305 41309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 41788 41540 gene locus_tag LOCUS_02810 41788 41540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 41804 42112 gene locus_tag LOCUS_02820 gene rpsJ 41804 42112 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357250.1 protein_id gnl|my_center|LOCUS_02820 42130 42756 gene locus_tag LOCUS_02830 gene rplC 42130 42756 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_02830 42771 43391 gene locus_tag LOCUS_02840 gene rplD 42771 43391 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_02840 43391 43687 gene locus_tag LOCUS_02850 gene rplW 43391 43687 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_02850 43700 44533 gene locus_tag LOCUS_02860 gene rplB 43700 44533 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_02860 44558 44839 gene locus_tag LOCUS_02870 gene rpsS 44558 44839 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966408.1 protein_id gnl|my_center|LOCUS_02870 44852 45238 gene locus_tag LOCUS_02880 gene rplV 44852 45238 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 protein_id gnl|my_center|LOCUS_02880 45251 45901 gene locus_tag LOCUS_02890 gene rpsC 45251 45901 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966406.1 protein_id gnl|my_center|LOCUS_02890 45916 46347 gene locus_tag LOCUS_02900 gene rplP 45916 46347 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_02900 46351 46545 gene locus_tag LOCUS_02910 gene rpmC 46351 46545 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_02910 46564 46836 gene locus_tag LOCUS_02920 gene rpsQ 46564 46836 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_02920 46854 47222 gene locus_tag LOCUS_02930 gene rplN 46854 47222 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_02930 47235 47576 gene locus_tag LOCUS_02940 gene rplX 47235 47576 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881072.1 protein_id gnl|my_center|LOCUS_02940 47593 48207 gene locus_tag LOCUS_02950 gene rplE 47593 48207 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_02950 48222 48407 gene locus_tag LOCUS_02960 48222 48407 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_02960 48424 48822 gene locus_tag LOCUS_02970 gene rpsH 48424 48822 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357687.1 protein_id gnl|my_center|LOCUS_02970 48964 49503 gene locus_tag LOCUS_02980 gene rplF 48964 49503 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_02980 49522 49890 gene locus_tag LOCUS_02990 gene rplR 49522 49890 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_02990 49903 50412 gene locus_tag LOCUS_03000 gene rpsE 49903 50412 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_03000 50429 50614 gene locus_tag LOCUS_03010 gene rpmD 50429 50614 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_03010 50627 51073 gene locus_tag LOCUS_03020 gene rplO 50627 51073 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421135.1 protein_id gnl|my_center|LOCUS_03020 51066 52415 gene locus_tag LOCUS_03030 gene secY 51066 52415 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_03030 52535 53194 gene locus_tag LOCUS_03040 52535 53194 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048992.1 protein_id gnl|my_center|LOCUS_03040 53272 54042 gene locus_tag LOCUS_03050 gene map 53272 54042 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_03050 54139 54513 gene locus_tag LOCUS_03060 54139 54513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 54593 54814 gene locus_tag LOCUS_03070 gene infA 54593 54814 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_03070 55425 55793 gene locus_tag LOCUS_03080 gene rpsM 55425 55793 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_03080 55814 56221 gene locus_tag LOCUS_03090 gene rpsK 55814 56221 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_03090 56237 56869 gene locus_tag LOCUS_03100 gene rpsD 56237 56869 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_03100 56927 57871 gene locus_tag LOCUS_03110 56927 57871 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_03110 57928 58431 gene locus_tag LOCUS_03120 gene rplQ 57928 58431 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_03120 58781 60313 gene locus_tag LOCUS_03130 58781 60313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_03130 60350 61432 gene locus_tag LOCUS_03140 60350 61432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_03140 61480 62481 gene locus_tag LOCUS_03150 61480 62481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_03150 62791 63675 gene locus_tag LOCUS_03160 62791 63675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 64242 66131 gene locus_tag LOCUS_03170 64242 66131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 66370 66774 gene locus_tag LOCUS_03180 66370 66774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 66816 67730 gene locus_tag LOCUS_03190 66816 67730 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 protein_id gnl|my_center|LOCUS_03190 67806 68396 gene locus_tag LOCUS_03200 67806 68396 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_03200 68486 68974 gene locus_tag LOCUS_03210 68486 68974 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_03210 69392 70246 gene locus_tag LOCUS_03220 69392 70246 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_03220 70248 71663 gene locus_tag LOCUS_03230 gene gltA 70248 71663 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_03230 72076 72552 gene locus_tag LOCUS_03240 gene nuoE 72076 72552 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_03240 72554 74482 gene locus_tag LOCUS_03250 gene nuoF 72554 74482 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_03250 74486 76168 gene locus_tag LOCUS_03260 74486 76168 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_03260 76548 77042 gene locus_tag LOCUS_03270 76548 77042 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397668.1 protein_id gnl|my_center|LOCUS_03270 77112 77927 gene locus_tag LOCUS_03280 77112 77927 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723352.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence05 1242 244 gene locus_tag LOCUS_03290 1242 244 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_03290 3073 1268 gene locus_tag LOCUS_03300 3073 1268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510924.1 protein_id gnl|my_center|LOCUS_03300 4016 3231 gene locus_tag LOCUS_03310 4016 3231 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_03310 4411 5598 gene locus_tag LOCUS_03320 4411 5598 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_03320 6149 8122 gene locus_tag LOCUS_03330 6149 8122 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_03330 8228 9898 gene locus_tag LOCUS_03340 8228 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 9981 11237 gene locus_tag LOCUS_03350 gene hisS 9981 11237 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_03350 12801 11320 gene locus_tag LOCUS_03360 gene spoIVA 12801 11320 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965020.1 protein_id gnl|my_center|LOCUS_03360 13675 13010 gene locus_tag LOCUS_03370 13675 13010 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_03370 15815 13773 gene locus_tag LOCUS_03380 gene metG 15815 13773 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_03380 16461 17027 gene locus_tag LOCUS_03390 16461 17027 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705703.1 protein_id gnl|my_center|LOCUS_03390 17122 17550 gene locus_tag LOCUS_03400 17122 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 17922 19313 gene locus_tag LOCUS_03410 17922 19313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 20140 19478 gene locus_tag LOCUS_03420 20140 19478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 20722 21285 gene locus_tag LOCUS_03430 20722 21285 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975261.1 protein_id gnl|my_center|LOCUS_03430 21408 21710 gene locus_tag LOCUS_03440 21408 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 21923 22699 gene locus_tag LOCUS_03450 21923 22699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 23525 22971 gene locus_tag LOCUS_03460 23525 22971 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_03460 24416 23637 gene locus_tag LOCUS_03470 24416 23637 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_03470 24691 24443 gene locus_tag LOCUS_03480 24691 24443 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_03480 24999 25985 gene locus_tag LOCUS_03490 24999 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 26179 26949 gene locus_tag LOCUS_03500 26179 26949 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_03500 27010 27852 gene locus_tag LOCUS_03510 27010 27852 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_03510 29501 28080 gene locus_tag LOCUS_03520 29501 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 30086 29577 gene locus_tag LOCUS_03530 30086 29577 CDS product DUF6323 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948386.1 protein_id gnl|my_center|LOCUS_03530 30704 31717 gene locus_tag LOCUS_03540 30704 31717 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_03540 31734 32702 gene locus_tag LOCUS_03550 31734 32702 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_03550 32699 33613 gene locus_tag LOCUS_03560 32699 33613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 33706 34413 gene locus_tag LOCUS_03570 33706 34413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_03570 34431 36029 gene locus_tag LOCUS_03580 34431 36029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_03580 37266 36226 gene locus_tag LOCUS_03590 37266 36226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 38659 37370 gene locus_tag LOCUS_03600 38659 37370 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963553.1 protein_id gnl|my_center|LOCUS_03600 40132 38702 gene locus_tag LOCUS_03610 40132 38702 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_03610 40413 41420 gene locus_tag LOCUS_03620 40413 41420 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048302.1 protein_id gnl|my_center|LOCUS_03620 41521 42312 gene locus_tag LOCUS_03630 41521 42312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 42378 42451 gene locus_tag LOCUS_t00100 42378 42451 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 42802 43740 gene locus_tag LOCUS_03640 gene arcC 42802 43740 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869022.1 protein_id gnl|my_center|LOCUS_03640 45110 43959 gene locus_tag LOCUS_03650 45110 43959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 47581 45272 gene locus_tag LOCUS_03660 47581 45272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 47993 49375 gene locus_tag LOCUS_03670 47993 49375 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_03670 50971 49568 gene locus_tag LOCUS_03680 50971 49568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 51636 50968 gene locus_tag LOCUS_03690 51636 50968 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_03690 53577 51817 gene locus_tag LOCUS_03700 53577 51817 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_03700 54229 55029 gene locus_tag LOCUS_03710 gene spo0A 54229 55029 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_03710 55627 57120 gene locus_tag LOCUS_03720 55627 57120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 59016 57250 gene locus_tag LOCUS_03730 59016 57250 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_03730 60540 59149 gene locus_tag LOCUS_03740 gene pepV 60540 59149 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_03740 60831 61517 gene locus_tag LOCUS_03750 60831 61517 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_03750 61782 62285 gene locus_tag LOCUS_03760 61782 62285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 62967 62599 gene locus_tag LOCUS_03770 62967 62599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 63547 63188 gene locus_tag LOCUS_03780 gene rplT 63547 63188 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965656.1 protein_id gnl|my_center|LOCUS_03780 63763 63563 gene locus_tag LOCUS_03790 gene rpmI 63763 63563 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_03790 64292 63786 gene locus_tag LOCUS_03800 gene infC 64292 63786 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 protein_id gnl|my_center|LOCUS_03800 65020 64529 gene locus_tag LOCUS_03810 65020 64529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 65874 65053 gene locus_tag LOCUS_03820 65874 65053 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_03820 66718 65867 gene locus_tag LOCUS_03830 66718 65867 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_03830 67524 66694 gene locus_tag LOCUS_03840 67524 66694 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence06 556 912 gene locus_tag LOCUS_03850 556 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 902 2239 gene locus_tag LOCUS_03860 gene ffh 902 2239 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_03860 2349 2591 gene locus_tag LOCUS_03870 gene rpsP 2349 2591 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_03870 2591 2863 gene locus_tag LOCUS_03880 2591 2863 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_03880 2891 3412 gene locus_tag LOCUS_03890 gene rimM 2891 3412 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_03890 3402 4133 gene locus_tag LOCUS_03900 gene trmD 3402 4133 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_03900 4270 4623 gene locus_tag LOCUS_03910 gene rplS 4270 4623 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_03910 4805 5707 gene locus_tag LOCUS_03920 gene ylqF 4805 5707 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_03920 5694 6353 gene locus_tag LOCUS_03930 gene rnhB 5694 6353 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174721.1 protein_id gnl|my_center|LOCUS_03930 6388 6765 gene locus_tag LOCUS_03940 6388 6765 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_03940 6978 8480 gene locus_tag LOCUS_03950 6978 8480 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963676.1 protein_id gnl|my_center|LOCUS_03950 8492 11242 gene locus_tag LOCUS_03960 8492 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 11396 11947 gene locus_tag LOCUS_03970 11396 11947 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948088.1 protein_id gnl|my_center|LOCUS_03970 12023 13558 gene locus_tag LOCUS_03980 12023 13558 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_03980 13594 14718 gene locus_tag LOCUS_03990 gene dprA 13594 14718 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926825.1 protein_id gnl|my_center|LOCUS_03990 14881 17025 gene locus_tag LOCUS_04000 gene topA 14881 17025 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047858.1 protein_id gnl|my_center|LOCUS_04000 17149 18465 gene locus_tag LOCUS_04010 gene trmFO 17149 18465 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320953.1 protein_id gnl|my_center|LOCUS_04010 18558 19091 gene locus_tag LOCUS_04020 gene hslV 18558 19091 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 protein_id gnl|my_center|LOCUS_04020 19094 20512 gene locus_tag LOCUS_04030 gene hslU 19094 20512 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_04030 20565 21515 gene locus_tag LOCUS_04040 20565 21515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 21671 24157 gene locus_tag LOCUS_04050 21671 24157 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393425.1 protein_id gnl|my_center|LOCUS_04050 25649 24285 gene locus_tag LOCUS_04060 25649 24285 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775347.1 protein_id gnl|my_center|LOCUS_04060 26069 26275 gene locus_tag LOCUS_04070 26069 26275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_04070 27103 26417 gene locus_tag LOCUS_04080 27103 26417 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_04080 27559 27176 gene locus_tag LOCUS_04090 27559 27176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 28577 27903 gene locus_tag LOCUS_04100 gene yihA 28577 27903 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_04100 28986 29759 gene locus_tag LOCUS_04110 gene sigG 28986 29759 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_04110 30053 30427 gene locus_tag LOCUS_04120 30053 30427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 32104 30707 gene locus_tag LOCUS_04130 32104 30707 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_04130 32337 32146 gene locus_tag LOCUS_04140 gene rpmB 32337 32146 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_04140 32652 33182 gene locus_tag LOCUS_04150 32652 33182 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_04150 33401 34495 gene locus_tag LOCUS_04160 gene serC 33401 34495 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_04160 34619 35530 gene locus_tag LOCUS_04170 34619 35530 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948783.1 protein_id gnl|my_center|LOCUS_04170 35782 36084 gene locus_tag LOCUS_04180 35782 36084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 36444 36274 gene locus_tag LOCUS_04190 36444 36274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 36953 39652 gene locus_tag LOCUS_04200 36953 39652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 39719 40396 gene locus_tag LOCUS_04210 39719 40396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_04210 40476 41165 gene locus_tag LOCUS_04220 40476 41165 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_04220 41202 42137 gene locus_tag LOCUS_04230 41202 42137 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434897.1 protein_id gnl|my_center|LOCUS_04230 42312 43214 gene locus_tag LOCUS_04240 42312 43214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 43257 44141 gene locus_tag LOCUS_04250 43257 44141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 44356 45033 gene locus_tag LOCUS_04260 44356 45033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 46711 45137 gene locus_tag LOCUS_04270 46711 45137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 48494 46809 gene locus_tag LOCUS_04280 48494 46809 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_04280 48828 48903 gene locus_tag LOCUS_t00110 48828 48903 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 49975 49097 gene locus_tag LOCUS_04290 gene rsmA 49975 49097 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216869.1 protein_id gnl|my_center|LOCUS_04290 50326 52668 gene locus_tag LOCUS_04300 50326 52668 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966944.1 protein_id gnl|my_center|LOCUS_04300 53565 52696 gene locus_tag LOCUS_04310 53565 52696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 53627 54814 gene locus_tag LOCUS_04320 53627 54814 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_04320 54950 55357 gene locus_tag LOCUS_04330 54950 55357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 55579 56256 gene locus_tag LOCUS_04340 55579 56256 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434895.1 protein_id gnl|my_center|LOCUS_04340 56304 57383 gene locus_tag LOCUS_04350 56304 57383 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963846.1 protein_id gnl|my_center|LOCUS_04350 57595 58278 gene locus_tag LOCUS_04360 57595 58278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963847.1 protein_id gnl|my_center|LOCUS_04360 58275 61049 gene locus_tag LOCUS_04370 58275 61049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 62372 61173 gene locus_tag LOCUS_04380 62372 61173 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_04380 62812 63885 gene locus_tag LOCUS_04390 62812 63885 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_04390 63937 64956 gene locus_tag LOCUS_04400 63937 64956 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027778.1 protein_id gnl|my_center|LOCUS_04400 65021 65290 gene locus_tag LOCUS_04410 65021 65290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence07 1087 902 gene locus_tag LOCUS_04420 gene rpmF 1087 902 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_04420 1615 1091 gene locus_tag LOCUS_04430 1615 1091 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214224.1 protein_id gnl|my_center|LOCUS_04430 2948 1749 gene locus_tag LOCUS_04440 2948 1749 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_04440 3079 4305 gene locus_tag LOCUS_04450 3079 4305 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_04450 4354 5433 gene locus_tag LOCUS_04460 gene ylbJ 4354 5433 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986835.1 protein_id gnl|my_center|LOCUS_04460 6522 5611 gene locus_tag LOCUS_04470 6522 5611 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861943.1 protein_id gnl|my_center|LOCUS_04470 7290 6808 gene locus_tag LOCUS_04480 gene coaD 7290 6808 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_04480 7859 7287 gene locus_tag LOCUS_04490 gene rsmD 7859 7287 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_04490 8621 7986 gene locus_tag LOCUS_04500 8621 7986 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_04500 9821 8658 gene locus_tag LOCUS_04510 9821 8658 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_04510 11416 9869 gene locus_tag LOCUS_04520 11416 9869 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_04520 12217 11456 gene locus_tag LOCUS_04530 12217 11456 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_04530 12881 12282 gene locus_tag LOCUS_04540 12881 12282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 14429 12915 gene locus_tag LOCUS_04550 14429 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 16461 14602 gene locus_tag LOCUS_04560 16461 14602 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_04560 16776 17354 gene locus_tag LOCUS_04570 gene spoVT 16776 17354 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_04570 18228 17434 gene locus_tag LOCUS_04580 18228 17434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 18509 18733 gene locus_tag LOCUS_04590 18509 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 19797 18814 gene locus_tag LOCUS_04600 19797 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 21235 19877 gene locus_tag LOCUS_04610 gene radA 21235 19877 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674860.1 protein_id gnl|my_center|LOCUS_04610 22555 21308 gene locus_tag LOCUS_04620 22555 21308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 22806 24608 gene locus_tag LOCUS_04630 gene pepF 22806 24608 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_04630 24962 25813 gene locus_tag LOCUS_04640 gene cdaA 24962 25813 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_04640 25791 27200 gene locus_tag LOCUS_04650 25791 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 27338 28942 gene locus_tag LOCUS_04660 27338 28942 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_04660 29012 29728 gene locus_tag LOCUS_04670 29012 29728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_04670 29807 30352 gene locus_tag LOCUS_04680 29807 30352 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485423.1 protein_id gnl|my_center|LOCUS_04680 30565 32493 gene locus_tag LOCUS_04690 30565 32493 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_04690 32743 34422 gene locus_tag LOCUS_04700 32743 34422 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948911.1 protein_id gnl|my_center|LOCUS_04700 34460 34813 gene locus_tag LOCUS_04710 34460 34813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 35101 36393 gene locus_tag LOCUS_04720 gene mltG 35101 36393 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617473.1 protein_id gnl|my_center|LOCUS_04720 36571 37260 gene locus_tag LOCUS_04730 36571 37260 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_04730 37312 38559 gene locus_tag LOCUS_04740 37312 38559 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966257.1 protein_id gnl|my_center|LOCUS_04740 40066 38639 gene locus_tag LOCUS_04750 40066 38639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 40924 40193 gene locus_tag LOCUS_04760 40924 40193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 41919 40972 gene locus_tag LOCUS_04770 41919 40972 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_04770 42757 41900 gene locus_tag LOCUS_04780 42757 41900 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221373.1 protein_id gnl|my_center|LOCUS_04780 44705 42765 gene locus_tag LOCUS_04790 gene uvrC 44705 42765 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_04790 45535 45089 gene locus_tag LOCUS_04800 45535 45089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 46787 45813 gene locus_tag LOCUS_04810 46787 45813 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_04810 47372 46863 gene locus_tag LOCUS_04820 47372 46863 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966802.1 protein_id gnl|my_center|LOCUS_04820 47914 47426 gene locus_tag LOCUS_04830 gene mscL 47914 47426 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_04830 48279 48124 gene locus_tag LOCUS_04840 48279 48124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 49574 48315 gene locus_tag LOCUS_04850 49574 48315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 50718 49612 gene locus_tag LOCUS_04860 50718 49612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 52498 50837 gene locus_tag LOCUS_04870 52498 50837 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048527824.1 protein_id gnl|my_center|LOCUS_04870 52772 53638 gene locus_tag LOCUS_04880 52772 53638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 54087 55409 gene locus_tag LOCUS_04890 gene tig 54087 55409 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_04890 55689 56276 gene locus_tag LOCUS_04900 gene clpP 55689 56276 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_04900 56490 57752 gene locus_tag LOCUS_04910 gene clpX 56490 57752 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_04910 57842 58600 gene locus_tag LOCUS_04920 57842 58600 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_04920 58709 60475 gene locus_tag LOCUS_04930 gene rqcH 58709 60475 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_04930 61470 60544 gene locus_tag LOCUS_04940 gene gpr 61470 60544 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_04940 61738 61998 gene locus_tag LOCUS_04950 gene rpsT 61738 61998 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_04950 63044 62238 gene locus_tag LOCUS_04960 63044 62238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence08 631 1293 gene locus_tag LOCUS_04970 631 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 1317 1976 gene locus_tag LOCUS_04980 1317 1976 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_04980 3564 2137 gene locus_tag LOCUS_04990 gene glnA 3564 2137 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_04990 3875 5623 gene locus_tag LOCUS_05000 3875 5623 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_05000 5984 7525 gene locus_tag LOCUS_05010 5984 7525 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_05010 8567 7803 gene locus_tag LOCUS_05020 8567 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8868 10358 gene locus_tag LOCUS_05030 8868 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 10611 11177 gene locus_tag LOCUS_05040 10611 11177 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 protein_id gnl|my_center|LOCUS_05040 11196 13217 gene locus_tag LOCUS_05050 11196 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 14079 13558 gene locus_tag LOCUS_05060 gene raiA 14079 13558 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_05060 14652 16550 gene locus_tag LOCUS_05070 14652 16550 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_05070 17991 16666 gene locus_tag LOCUS_05080 17991 16666 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_05080 18678 18049 gene locus_tag LOCUS_05090 18678 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 19805 18873 gene locus_tag LOCUS_05100 19805 18873 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861235.1 protein_id gnl|my_center|LOCUS_05100 20215 21414 gene locus_tag LOCUS_05110 gene megL 20215 21414 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674490.1 protein_id gnl|my_center|LOCUS_05110 21644 21958 gene locus_tag LOCUS_05120 21644 21958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 22380 23561 gene locus_tag LOCUS_05130 gene metK 22380 23561 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_05130 24646 23756 gene locus_tag LOCUS_05140 24646 23756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 25606 24893 gene locus_tag LOCUS_05150 25606 24893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 26467 25763 gene locus_tag LOCUS_05160 26467 25763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 28853 26901 gene locus_tag LOCUS_05170 28853 26901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 29604 28939 gene locus_tag LOCUS_05180 29604 28939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 30037 30801 gene locus_tag LOCUS_05190 30037 30801 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_05190 30798 31907 gene locus_tag LOCUS_05200 30798 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 31904 32935 gene locus_tag LOCUS_05210 31904 32935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 32932 34296 gene locus_tag LOCUS_05220 32932 34296 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964890.1 protein_id gnl|my_center|LOCUS_05220 34335 34565 gene locus_tag LOCUS_05230 34335 34565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 34567 35475 gene locus_tag LOCUS_05240 gene ptb 34567 35475 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_05240 35509 36597 gene locus_tag LOCUS_05250 gene buk 35509 36597 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_05250 36799 37113 gene locus_tag LOCUS_05260 gene trxA 36799 37113 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_05260 37580 37386 gene locus_tag LOCUS_05270 37580 37386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 37901 38941 gene locus_tag LOCUS_05280 37901 38941 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_05280 39043 40611 gene locus_tag LOCUS_05290 39043 40611 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_05290 40626 41576 gene locus_tag LOCUS_05300 gene trxB 40626 41576 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_05300 41630 41977 gene locus_tag LOCUS_05310 41630 41977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 42863 42096 gene locus_tag LOCUS_05320 42863 42096 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_05320 45442 43034 gene locus_tag LOCUS_05330 45442 43034 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_05330 46190 45915 gene locus_tag LOCUS_05340 46190 45915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 47649 46249 gene locus_tag LOCUS_05350 gene atpD 47649 46249 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_05350 48548 47697 gene locus_tag LOCUS_05360 gene atpG 48548 47697 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_05360 50101 48596 gene locus_tag LOCUS_05370 gene atpA 50101 48596 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_05370 50756 50202 gene locus_tag LOCUS_05380 gene atpH 50756 50202 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_05380 51255 50740 gene locus_tag LOCUS_05390 51255 50740 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355885.1 protein_id gnl|my_center|LOCUS_05390 51560 51276 gene locus_tag LOCUS_05400 gene atpE 51560 51276 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421370.1 protein_id gnl|my_center|LOCUS_05400 52665 51697 gene locus_tag LOCUS_05410 52665 51697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 53137 52727 gene locus_tag LOCUS_05420 53137 52727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 54691 53360 gene locus_tag LOCUS_05430 54691 53360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 56046 54823 gene locus_tag LOCUS_05440 gene pepT 56046 54823 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_05440 56376 56451 gene locus_tag LOCUS_t00120 56376 56451 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 533 69 gene locus_tag LOCUS_05450 533 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1210 2289 gene locus_tag LOCUS_05460 1210 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_05460 2364 3839 gene locus_tag LOCUS_05470 2364 3839 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_05470 3928 4935 gene locus_tag LOCUS_05480 3928 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5052 6179 gene locus_tag LOCUS_05490 5052 6179 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_05490 6231 7646 gene locus_tag LOCUS_05500 gene cysS 6231 7646 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_05500 7788 8897 gene locus_tag LOCUS_05510 7788 8897 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_05510 8894 9769 gene locus_tag LOCUS_05520 gene prmC 8894 9769 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_05520 9803 10879 gene locus_tag LOCUS_05530 gene prfA 9803 10879 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_05530 11690 11034 gene locus_tag LOCUS_05540 11690 11034 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897858.1 protein_id gnl|my_center|LOCUS_05540 12379 11690 gene locus_tag LOCUS_05550 12379 11690 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_05550 15344 12657 gene locus_tag LOCUS_05560 15344 12657 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_05560 15891 17330 gene locus_tag LOCUS_05570 gene proS 15891 17330 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_05570 17669 17508 gene locus_tag LOCUS_05580 17669 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 19113 17707 gene locus_tag LOCUS_05590 19113 17707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 21267 19879 gene locus_tag LOCUS_05600 21267 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 21908 21402 gene locus_tag LOCUS_05610 21908 21402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 22522 21911 gene locus_tag LOCUS_05620 22522 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 23412 22777 gene locus_tag LOCUS_05630 23412 22777 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023352.1 protein_id gnl|my_center|LOCUS_05630 23737 24882 gene locus_tag LOCUS_05640 23737 24882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 25013 25088 gene locus_tag LOCUS_t00130 25013 25088 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26073 25198 gene locus_tag LOCUS_05650 gene ispE 26073 25198 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_05650 26301 27080 gene locus_tag LOCUS_05660 26301 27080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 27175 27846 gene locus_tag LOCUS_05670 gene sleB 27175 27846 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_05670 27896 29596 gene locus_tag LOCUS_05680 gene ypeB 27896 29596 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_05680 29857 30702 gene locus_tag LOCUS_05690 29857 30702 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_05690 30715 30852 gene locus_tag LOCUS_05700 30715 30852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 31592 30981 gene locus_tag LOCUS_05710 31592 30981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 32881 31628 gene locus_tag LOCUS_05720 32881 31628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 33056 33589 gene locus_tag LOCUS_05730 33056 33589 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723402.1 protein_id gnl|my_center|LOCUS_05730 33694 34122 gene locus_tag LOCUS_05740 33694 34122 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_05740 35806 34322 gene locus_tag LOCUS_05750 gene murF 35806 34322 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_05750 36924 35878 gene locus_tag LOCUS_05760 36924 35878 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_05760 38191 41466 gene locus_tag LOCUS_05770 38191 41466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 41744 44521 gene locus_tag LOCUS_05780 gene secA 41744 44521 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_05780 44663 45931 gene locus_tag LOCUS_05790 gene serS 44663 45931 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 protein_id gnl|my_center|LOCUS_05790 46217 47302 gene locus_tag LOCUS_05800 46217 47302 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_05800 47382 47948 gene locus_tag LOCUS_05810 47382 47948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 48185 49573 gene locus_tag LOCUS_05820 48185 49573 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_05820 49686 50771 gene locus_tag LOCUS_05830 gene murG 49686 50771 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 protein_id gnl|my_center|LOCUS_05830 50955 52142 gene locus_tag LOCUS_05840 50955 52142 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_05840 52383 53507 gene locus_tag LOCUS_05850 52383 53507 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_05850 54445 53720 gene locus_tag LOCUS_05860 54445 53720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence10 1061 174 gene locus_tag LOCUS_05870 1061 174 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_05870 1697 1236 gene locus_tag LOCUS_05880 gene nifU 1697 1236 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_05880 2919 1768 gene locus_tag LOCUS_05890 gene nifS 2919 1768 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_05890 3374 2931 gene locus_tag LOCUS_05900 3374 2931 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_05900 3864 3628 gene locus_tag LOCUS_05910 3864 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5278 3866 gene locus_tag LOCUS_05920 5278 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 5876 5337 gene locus_tag LOCUS_05930 5876 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 6194 5895 gene locus_tag LOCUS_05940 6194 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6451 7431 gene locus_tag LOCUS_05950 6451 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 7950 7420 gene locus_tag LOCUS_05960 7950 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 8833 8051 gene locus_tag LOCUS_05970 8833 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 9994 8873 gene locus_tag LOCUS_05980 9994 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 10858 10007 gene locus_tag LOCUS_05990 10858 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 12484 11276 gene locus_tag LOCUS_06000 12484 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 13017 12535 gene locus_tag LOCUS_06010 13017 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 14696 13494 gene locus_tag LOCUS_06020 14696 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 15353 14829 gene locus_tag LOCUS_06030 15353 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 16296 15412 gene locus_tag LOCUS_06040 16296 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 17187 16597 gene locus_tag LOCUS_06050 17187 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 17538 18152 gene locus_tag LOCUS_06060 17538 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 18197 21715 gene locus_tag LOCUS_06070 gene mfd 18197 21715 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_06070 21923 22498 gene locus_tag LOCUS_06080 21923 22498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 22545 23474 gene locus_tag LOCUS_06090 gene holB 22545 23474 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_06090 23557 24954 gene locus_tag LOCUS_06100 23557 24954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 26435 25071 gene locus_tag LOCUS_06110 gene ssnA 26435 25071 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_06110 27691 27104 gene locus_tag LOCUS_06120 27691 27104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 28187 27711 gene locus_tag LOCUS_06130 28187 27711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 28993 28238 gene locus_tag LOCUS_06140 gene cobS 28993 28238 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_06140 29614 29036 gene locus_tag LOCUS_06150 29614 29036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 30734 29631 gene locus_tag LOCUS_06160 gene cobT 30734 29631 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_06160 31647 30772 gene locus_tag LOCUS_06170 31647 30772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 32821 31589 gene locus_tag LOCUS_06180 32821 31589 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_06180 33117 32851 gene locus_tag LOCUS_06190 33117 32851 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048379.1 protein_id gnl|my_center|LOCUS_06190 34676 33138 gene locus_tag LOCUS_06200 34676 33138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 35178 36938 gene locus_tag LOCUS_06210 35178 36938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 37157 38722 gene locus_tag LOCUS_06220 37157 38722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 40529 38751 gene locus_tag LOCUS_06230 40529 38751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 40874 41653 gene locus_tag LOCUS_06240 40874 41653 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_06240 41698 42723 gene locus_tag LOCUS_06250 gene hslO 41698 42723 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_06250 42841 44901 gene locus_tag LOCUS_06260 42841 44901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 44891 46111 gene locus_tag LOCUS_06270 44891 46111 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_06270 48193 46319 gene locus_tag LOCUS_06280 48193 46319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_06280 50072 48186 gene locus_tag LOCUS_06290 50072 48186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_06290 51201 50245 gene locus_tag LOCUS_06300 51201 50245 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 protein_id gnl|my_center|LOCUS_06300 52733 51396 gene locus_tag LOCUS_06310 52733 51396 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence11 1076 699 gene locus_tag LOCUS_06320 1076 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 1381 1797 gene locus_tag LOCUS_06330 1381 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1842 2336 gene locus_tag LOCUS_06340 1842 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4085 2754 gene locus_tag LOCUS_06350 4085 2754 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_06350 5473 4085 gene locus_tag LOCUS_06360 5473 4085 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_06360 7795 5576 gene locus_tag LOCUS_06370 7795 5576 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_06370 8125 8397 gene locus_tag LOCUS_06380 gene yqfC 8125 8397 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357863.1 protein_id gnl|my_center|LOCUS_06380 8536 9663 gene locus_tag LOCUS_06390 8536 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 9819 10997 gene locus_tag LOCUS_06400 9819 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 11100 12593 gene locus_tag LOCUS_06410 11100 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 12577 13107 gene locus_tag LOCUS_06420 12577 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 13110 13529 gene locus_tag LOCUS_06430 13110 13529 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_06430 13533 14453 gene locus_tag LOCUS_06440 gene era 13533 14453 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134765.1 protein_id gnl|my_center|LOCUS_06440 14704 14507 gene locus_tag LOCUS_06450 14704 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 14873 15598 gene locus_tag LOCUS_06460 gene recO 14873 15598 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_06460 15669 15744 gene locus_tag LOCUS_t00140 15669 15744 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 16529 16604 gene locus_tag LOCUS_t00150 16529 16604 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 18930 16735 gene locus_tag LOCUS_06470 18930 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 19593 19889 gene locus_tag LOCUS_06480 19593 19889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 19956 20267 gene locus_tag LOCUS_06490 19956 20267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 22888 20474 gene locus_tag LOCUS_06500 22888 20474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 22940 23158 gene locus_tag LOCUS_06510 22940 23158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 23271 23816 gene locus_tag LOCUS_06520 23271 23816 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_06520 24038 25126 gene locus_tag LOCUS_06530 24038 25126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_06530 25170 25994 gene locus_tag LOCUS_06540 25170 25994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_06540 25991 26815 gene locus_tag LOCUS_06550 25991 26815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_06550 26921 27961 gene locus_tag LOCUS_06560 26921 27961 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_06560 28138 29520 gene locus_tag LOCUS_06570 gene asnS 28138 29520 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_06570 30968 29652 gene locus_tag LOCUS_06580 30968 29652 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_06580 31874 31044 gene locus_tag LOCUS_06590 31874 31044 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965364.1 protein_id gnl|my_center|LOCUS_06590 32187 31921 gene locus_tag LOCUS_06600 32187 31921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 32495 32313 gene locus_tag LOCUS_06610 32495 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 34008 32770 gene locus_tag LOCUS_06620 34008 32770 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_06620 34361 36193 gene locus_tag LOCUS_06630 gene typA 34361 36193 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_06630 36328 37065 gene locus_tag LOCUS_06640 36328 37065 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462031.1 protein_id gnl|my_center|LOCUS_06640 37140 38285 gene locus_tag LOCUS_06650 gene alr 37140 38285 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_06650 38546 38869 gene locus_tag LOCUS_06660 38546 38869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 40902 39013 gene locus_tag LOCUS_06670 40902 39013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671827.1 protein_id gnl|my_center|LOCUS_06670 42813 40918 gene locus_tag LOCUS_06680 42813 40918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_06680 43708 43031 gene locus_tag LOCUS_06690 43708 43031 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389343.1 protein_id gnl|my_center|LOCUS_06690 44439 43741 gene locus_tag LOCUS_06700 44439 43741 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_06700 45885 44590 gene locus_tag LOCUS_06710 gene nagA 45885 44590 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195336.1 protein_id gnl|my_center|LOCUS_06710 47043 45946 gene locus_tag LOCUS_06720 47043 45946 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_06720 47323 48114 gene locus_tag LOCUS_06730 47323 48114 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818363.1 protein_id gnl|my_center|LOCUS_06730 48209 49321 gene locus_tag LOCUS_06740 48209 49321 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_06740 49312 49968 gene locus_tag LOCUS_06750 49312 49968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 53287 50132 gene locus_tag LOCUS_06760 53287 50132 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149495417.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence12 354 1211 gene locus_tag LOCUS_06770 354 1211 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_06770 1449 2030 gene locus_tag LOCUS_06780 gene dhaS 1449 2030 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168609.1 protein_id gnl|my_center|LOCUS_06780 2436 2645 gene locus_tag LOCUS_06790 2436 2645 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_06790 2658 3728 gene locus_tag LOCUS_06800 2658 3728 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_06800 3731 4477 gene locus_tag LOCUS_06810 3731 4477 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_06810 4481 5020 gene locus_tag LOCUS_06820 4481 5020 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_06820 5704 5276 gene locus_tag LOCUS_06830 5704 5276 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966724.1 protein_id gnl|my_center|LOCUS_06830 6447 5722 gene locus_tag LOCUS_06840 6447 5722 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680712.1 protein_id gnl|my_center|LOCUS_06840 10296 6619 gene locus_tag LOCUS_06850 10296 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 10901 10443 gene locus_tag LOCUS_06860 gene tadA 10901 10443 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_06860 10982 12400 gene locus_tag LOCUS_06870 10982 12400 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_06870 12530 14746 gene locus_tag LOCUS_06880 12530 14746 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_06880 14879 16537 gene locus_tag LOCUS_06890 14879 16537 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_06890 16589 17587 gene locus_tag LOCUS_06900 16589 17587 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_06900 18149 17715 gene locus_tag LOCUS_06910 gene aroQ 18149 17715 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230223.1 protein_id gnl|my_center|LOCUS_06910 18471 19076 gene locus_tag LOCUS_06920 18471 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 19686 19237 gene locus_tag LOCUS_06930 19686 19237 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_06930 22118 19707 gene locus_tag LOCUS_06940 gene leuS 22118 19707 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_06940 23333 22707 gene locus_tag LOCUS_06950 23333 22707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 25533 23788 gene locus_tag LOCUS_06960 25533 23788 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460241.1 protein_id gnl|my_center|LOCUS_06960 26543 25659 gene locus_tag LOCUS_06970 26543 25659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 27246 27920 gene locus_tag LOCUS_06980 gene cas6 27246 27920 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_06980 29371 27926 gene locus_tag LOCUS_06990 29371 27926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 32191 29447 gene locus_tag LOCUS_07000 32191 29447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 34739 32406 gene locus_tag LOCUS_07010 34739 32406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 36057 34822 gene locus_tag LOCUS_07020 36057 34822 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_07020 36292 36987 gene locus_tag LOCUS_07030 36292 36987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 37131 37631 gene locus_tag LOCUS_07040 37131 37631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 37885 37580 gene locus_tag LOCUS_07050 37885 37580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 39579 37984 gene locus_tag LOCUS_07060 39579 37984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 40274 39597 gene locus_tag LOCUS_07070 40274 39597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 41138 40299 gene locus_tag LOCUS_07080 41138 40299 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_07080 42213 41140 gene locus_tag LOCUS_07090 42213 41140 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_07090 43201 42206 gene locus_tag LOCUS_07100 43201 42206 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_07100 43635 43189 gene locus_tag LOCUS_07110 43635 43189 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_07110 45620 43626 gene locus_tag LOCUS_07120 45620 43626 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_07120 46037 45636 gene locus_tag LOCUS_07130 46037 45636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 46907 46041 gene locus_tag LOCUS_07140 46907 46041 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_07140 47952 47005 gene locus_tag LOCUS_07150 47952 47005 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_07150 49266 48334 gene locus_tag LOCUS_07160 49266 48334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 49613 50248 gene locus_tag LOCUS_07170 49613 50248 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612793.1 protein_id gnl|my_center|LOCUS_07170 51282 50434 gene locus_tag LOCUS_07180 51282 50434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 51909 51478 gene locus_tag LOCUS_07190 51909 51478 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682066.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence13 9 1178 gene locus_tag LOCUS_07200 gene atpD 9 1178 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_07200 1195 1605 gene locus_tag LOCUS_07210 1195 1605 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_07210 2094 2411 gene locus_tag LOCUS_07220 2094 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2928 2317 gene locus_tag LOCUS_07230 2928 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3014 4657 gene locus_tag LOCUS_07240 3014 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4641 5702 gene locus_tag LOCUS_07250 4641 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 5757 6698 gene locus_tag LOCUS_07260 5757 6698 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_07260 7277 7918 gene locus_tag LOCUS_07270 7277 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 8057 10255 gene locus_tag LOCUS_07280 8057 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 10308 15056 gene locus_tag LOCUS_07290 10308 15056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 15196 17403 gene locus_tag LOCUS_07300 15196 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 18688 17543 gene locus_tag LOCUS_07310 gene dnaJ 18688 17543 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_07310 20793 18928 gene locus_tag LOCUS_07320 gene dnaK 20793 18928 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357980.1 protein_id gnl|my_center|LOCUS_07320 21667 21014 gene locus_tag LOCUS_07330 gene grpE 21667 21014 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_07330 22785 21688 gene locus_tag LOCUS_07340 gene hrcA 22785 21688 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_07340 22994 23686 gene locus_tag LOCUS_07350 22994 23686 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_07350 23809 24258 gene locus_tag LOCUS_07360 23809 24258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 24744 24409 gene locus_tag LOCUS_07370 24744 24409 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_07370 26134 24722 gene locus_tag LOCUS_07380 gene mtaB 26134 24722 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_07380 26889 26134 gene locus_tag LOCUS_07390 26889 26134 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_07390 27934 26960 gene locus_tag LOCUS_07400 gene prmA 27934 26960 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_07400 29018 28128 gene locus_tag LOCUS_07410 29018 28128 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059810.1 protein_id gnl|my_center|LOCUS_07410 29225 30436 gene locus_tag LOCUS_07420 29225 30436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002688425.1 protein_id gnl|my_center|LOCUS_07420 30738 30814 gene locus_tag LOCUS_t00160 30738 30814 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30959 31651 gene locus_tag LOCUS_07430 30959 31651 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_07430 31666 32664 gene locus_tag LOCUS_07440 31666 32664 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_07440 33029 34075 gene locus_tag LOCUS_07450 gene ord 33029 34075 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_07450 34174 34476 gene locus_tag LOCUS_07460 gene ortA 34174 34476 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_07460 34473 35873 gene locus_tag LOCUS_07470 gene ortB 34473 35873 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_07470 36014 36379 gene locus_tag LOCUS_07480 36014 36379 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_07480 36379 38628 gene locus_tag LOCUS_07490 gene oraE 36379 38628 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_07490 38663 40129 gene locus_tag LOCUS_07500 38663 40129 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_07500 40192 41268 gene locus_tag LOCUS_07510 gene orr 40192 41268 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_07510 41340 41678 gene locus_tag LOCUS_07520 41340 41678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 43178 41826 gene locus_tag LOCUS_07530 43178 41826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 44686 43361 gene locus_tag LOCUS_07540 gene der 44686 43361 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_07540 46015 44690 gene locus_tag LOCUS_07550 46015 44690 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811141.1 protein_id gnl|my_center|LOCUS_07550 47127 46288 gene locus_tag LOCUS_07560 47127 46288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 47619 47161 gene locus_tag LOCUS_07570 47619 47161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 48001 47855 gene locus_tag LOCUS_07580 48001 47855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence14 604 311 gene locus_tag LOCUS_07590 604 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 965 2128 gene locus_tag LOCUS_07600 965 2128 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_07600 2249 3475 gene locus_tag LOCUS_07610 2249 3475 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_07610 3586 4293 gene locus_tag LOCUS_07620 3586 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4314 5105 gene locus_tag LOCUS_07630 4314 5105 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 protein_id gnl|my_center|LOCUS_07630 5165 5824 gene locus_tag LOCUS_07640 5165 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 5988 6341 gene locus_tag LOCUS_07650 5988 6341 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021722362.1 protein_id gnl|my_center|LOCUS_07650 6377 8017 gene locus_tag LOCUS_07660 6377 8017 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_07660 8108 10078 gene locus_tag LOCUS_07670 gene recG 8108 10078 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_07670 10218 11051 gene locus_tag LOCUS_07680 10218 11051 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_07680 11119 12087 gene locus_tag LOCUS_07690 gene pstC 11119 12087 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_07690 13436 12354 gene locus_tag LOCUS_07700 13436 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 13985 13470 gene locus_tag LOCUS_07710 13985 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 14953 14000 gene locus_tag LOCUS_07720 14953 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 15605 15060 gene locus_tag LOCUS_07730 15605 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 15845 16780 gene locus_tag LOCUS_07740 gene pstA 15845 16780 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_07740 16777 17532 gene locus_tag LOCUS_07750 gene pstB 16777 17532 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_07750 17529 18179 gene locus_tag LOCUS_07760 gene phoU 17529 18179 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_07760 18307 18987 gene locus_tag LOCUS_07770 18307 18987 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_07770 19029 20750 gene locus_tag LOCUS_07780 19029 20750 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_07780 22445 20970 gene locus_tag LOCUS_07790 22445 20970 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_07790 23725 22538 gene locus_tag LOCUS_07800 23725 22538 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_07800 24109 23762 gene locus_tag LOCUS_07810 24109 23762 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_07810 24520 24215 gene locus_tag LOCUS_07820 24520 24215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 25698 25000 gene locus_tag LOCUS_07830 25698 25000 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_07830 27021 25807 gene locus_tag LOCUS_07840 27021 25807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 27602 27018 gene locus_tag LOCUS_07850 gene ytfJ 27602 27018 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_07850 28248 27622 gene locus_tag LOCUS_07860 28248 27622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 28528 29391 gene locus_tag LOCUS_07870 28528 29391 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_07870 29454 30725 gene locus_tag LOCUS_07880 29454 30725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 30859 31560 gene locus_tag LOCUS_07890 30859 31560 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596541.1 protein_id gnl|my_center|LOCUS_07890 31860 32297 gene locus_tag LOCUS_07900 31860 32297 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_07900 33695 32400 gene locus_tag LOCUS_07910 33695 32400 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_07910 34438 34635 gene locus_tag LOCUS_07920 34438 34635 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_07920 34683 34889 gene locus_tag LOCUS_07930 34683 34889 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_07930 35537 35127 gene locus_tag LOCUS_07940 35537 35127 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_07940 37694 35658 gene locus_tag LOCUS_07950 gene ftsH 37694 35658 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_07950 38350 39333 gene locus_tag LOCUS_07960 38350 39333 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_07960 39522 40358 gene locus_tag LOCUS_07970 39522 40358 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_07970 40355 40963 gene locus_tag LOCUS_07980 40355 40963 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_07980 41137 42219 gene locus_tag LOCUS_07990 gene buk 41137 42219 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964967.1 protein_id gnl|my_center|LOCUS_07990 43800 42367 gene locus_tag LOCUS_08000 43800 42367 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_08000 45017 43833 gene locus_tag LOCUS_08010 45017 43833 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_08010 46683 45010 gene locus_tag LOCUS_08020 46683 45010 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_08020 47036 46794 gene locus_tag LOCUS_08030 47036 46794 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_08030 47901 47137 gene locus_tag LOCUS_08040 47901 47137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 48539 47925 gene locus_tag LOCUS_08050 48539 47925 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_08050 48898 49110 gene locus_tag LOCUS_08060 48898 49110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 49286 49675 gene locus_tag LOCUS_08070 49286 49675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence15 758 444 gene locus_tag LOCUS_08080 758 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1143 892 gene locus_tag LOCUS_08090 1143 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1582 1145 gene locus_tag LOCUS_08100 1582 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1948 3363 gene locus_tag LOCUS_08110 1948 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3903 5204 gene locus_tag LOCUS_08120 3903 5204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461646.1 protein_id gnl|my_center|LOCUS_08120 5426 5959 gene locus_tag LOCUS_08130 5426 5959 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_08130 5934 7184 gene locus_tag LOCUS_08140 5934 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7299 8033 gene locus_tag LOCUS_08150 7299 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 9546 8449 gene locus_tag LOCUS_08160 9546 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10199 9528 gene locus_tag LOCUS_08170 10199 9528 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_08170 11608 10256 gene locus_tag LOCUS_08180 gene mgtE 11608 10256 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_08180 12078 11944 gene locus_tag LOCUS_08190 12078 11944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 12369 13727 gene locus_tag LOCUS_08200 12369 13727 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_08200 13763 15046 gene locus_tag LOCUS_08210 13763 15046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 15269 15027 gene locus_tag LOCUS_08220 15269 15027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 15340 16725 gene locus_tag LOCUS_08230 15340 16725 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_08230 17047 18321 gene locus_tag LOCUS_08240 17047 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 19294 18365 gene locus_tag LOCUS_08250 19294 18365 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_08250 19593 20246 gene locus_tag LOCUS_08260 19593 20246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 20408 20190 gene locus_tag LOCUS_08270 20408 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 20723 20448 gene locus_tag LOCUS_08280 20723 20448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 21000 21629 gene locus_tag LOCUS_08290 21000 21629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 21787 22488 gene locus_tag LOCUS_08300 21787 22488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 22489 23406 gene locus_tag LOCUS_08310 22489 23406 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876451.1 protein_id gnl|my_center|LOCUS_08310 31389 23386 gene locus_tag LOCUS_08320 31389 23386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 32191 31979 gene locus_tag LOCUS_08330 32191 31979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 32766 32332 gene locus_tag LOCUS_08340 32766 32332 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_08340 33591 32851 gene locus_tag LOCUS_08350 33591 32851 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360698.1 protein_id gnl|my_center|LOCUS_08350 34829 33621 gene locus_tag LOCUS_08360 34829 33621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 35363 34902 gene locus_tag LOCUS_08370 35363 34902 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284098.1 protein_id gnl|my_center|LOCUS_08370 36696 35419 gene locus_tag LOCUS_08380 36696 35419 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_08380 37449 36754 gene locus_tag LOCUS_08390 37449 36754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 40140 38044 gene locus_tag LOCUS_08400 gene pnp 40140 38044 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_08400 40711 40448 gene locus_tag LOCUS_08410 gene rpsO 40711 40448 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence16 320 1462 gene locus_tag LOCUS_08420 320 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1596 2231 gene locus_tag LOCUS_08430 1596 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3780 2365 gene locus_tag LOCUS_08440 3780 2365 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_08440 5004 3826 gene locus_tag LOCUS_08450 5004 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 6311 5004 gene locus_tag LOCUS_08460 6311 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 6969 6298 gene locus_tag LOCUS_08470 6969 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8866 7055 gene locus_tag LOCUS_08480 8866 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 9285 9653 gene locus_tag LOCUS_08490 9285 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 10322 9687 gene locus_tag LOCUS_08500 10322 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 11141 10506 gene locus_tag LOCUS_08510 11141 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 12198 11320 gene locus_tag LOCUS_08520 12198 11320 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_08520 12574 13263 gene locus_tag LOCUS_08530 12574 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 13469 13996 gene locus_tag LOCUS_08540 13469 13996 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_08540 14265 15380 gene locus_tag LOCUS_08550 14265 15380 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_08550 15715 16311 gene locus_tag LOCUS_08560 15715 16311 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_08560 16468 17259 gene locus_tag LOCUS_08570 16468 17259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 17549 17974 gene locus_tag LOCUS_08580 gene ruvX 17549 17974 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_08580 18018 18356 gene locus_tag LOCUS_08590 18018 18356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 18463 19065 gene locus_tag LOCUS_08600 18463 19065 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_08600 19135 19644 gene locus_tag LOCUS_08610 19135 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 21293 19785 gene locus_tag LOCUS_08620 21293 19785 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_08620 22326 21463 gene locus_tag LOCUS_08630 22326 21463 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023435.1 protein_id gnl|my_center|LOCUS_08630 26361 22612 gene locus_tag LOCUS_08640 26361 22612 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_08640 27778 26435 gene locus_tag LOCUS_08650 gene purD 27778 26435 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_08650 29121 27949 gene locus_tag LOCUS_08660 29121 27949 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_08660 29947 29243 gene locus_tag LOCUS_08670 29947 29243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 30669 29998 gene locus_tag LOCUS_08680 gene purN 30669 29998 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_08680 31709 30663 gene locus_tag LOCUS_08690 gene purM 31709 30663 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_08690 33297 31810 gene locus_tag LOCUS_08700 gene purF 33297 31810 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_08700 34067 33357 gene locus_tag LOCUS_08710 34067 33357 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817239.1 protein_id gnl|my_center|LOCUS_08710 34734 34246 gene locus_tag LOCUS_08720 gene purE 34734 34246 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_08720 35215 36489 gene locus_tag LOCUS_08730 35215 36489 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288375.1 protein_id gnl|my_center|LOCUS_08730 36527 37951 gene locus_tag LOCUS_08740 gene purB 36527 37951 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_08740 38042 38737 gene locus_tag LOCUS_08750 38042 38737 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_08750 39271 39663 gene locus_tag LOCUS_08760 39271 39663 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence17 <1 621 gene locus_tag LOCUS_08770 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458899.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 2300 957 gene locus_tag LOCUS_08780 gene dnaA 2300 957 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_08780 2971 6384 gene locus_tag LOCUS_08790 2971 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 6533 7912 gene locus_tag LOCUS_08800 gene trkA 6533 7912 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_08800 7987 9441 gene locus_tag LOCUS_08810 7987 9441 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_08810 9490 10917 gene locus_tag LOCUS_08820 gene glgA 9490 10917 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860977.1 protein_id gnl|my_center|LOCUS_08820 12063 11014 gene locus_tag LOCUS_08830 12063 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 13559 12867 gene locus_tag LOCUS_08840 13559 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425116.1 protein_id gnl|my_center|LOCUS_08840 15166 13589 gene locus_tag LOCUS_08850 15166 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 16617 15277 gene locus_tag LOCUS_08860 16617 15277 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_08860 17176 16724 gene locus_tag LOCUS_08870 gene rplI 17176 16724 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_08870 18467 17274 gene locus_tag LOCUS_08880 18467 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 18696 18887 gene locus_tag LOCUS_08890 18696 18887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 18915 19241 gene locus_tag LOCUS_08900 18915 19241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 19379 20338 gene locus_tag LOCUS_08910 19379 20338 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_08910 22269 20569 gene locus_tag LOCUS_08920 gene ggt 22269 20569 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868894.1 protein_id gnl|my_center|LOCUS_08920 23505 22312 gene locus_tag LOCUS_08930 gene pgsA 23505 22312 CDS product capsular polyglutamate synthetase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243306.1 protein_id gnl|my_center|LOCUS_08930 24013 23555 gene locus_tag LOCUS_08940 gene pgsC 24013 23555 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227889.1 protein_id gnl|my_center|LOCUS_08940 25331 24093 gene locus_tag LOCUS_08950 gene pgsB 25331 24093 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227883.1 protein_id gnl|my_center|LOCUS_08950 26513 25710 gene locus_tag LOCUS_08960 26513 25710 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355903.1 protein_id gnl|my_center|LOCUS_08960 27646 26519 gene locus_tag LOCUS_08970 27646 26519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 27864 28287 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcaatccccctataaggggttcaatag 28532 28675 gene locus_tag LOCUS_08980 28532 28675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 28689 29252 gene locus_tag LOCUS_08990 28689 29252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08990 29484 29323 gene locus_tag LOCUS_09000 29484 29323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 29728 29967 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tctattgaaccccttatagggggattgaga 30302 30484 gene locus_tag LOCUS_09010 30302 30484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 30481 31458 gene locus_tag LOCUS_09020 30481 31458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 31700 32992 gene locus_tag LOCUS_09030 31700 32992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 33301 34872 gene locus_tag LOCUS_09040 33301 34872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_09040 34853 36058 gene locus_tag LOCUS_09050 34853 36058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_09050 36058 36999 gene locus_tag LOCUS_09060 36058 36999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_09060 <38337 37123 gene locus_tag LOCUS_09070 <38337 37123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002324544.1:site-specific resolvase TndX >Feature sequence18 2924 438 gene locus_tag LOCUS_09080 2924 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3186 4064 gene locus_tag LOCUS_09090 3186 4064 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_09090 4164 4790 gene locus_tag LOCUS_09100 gene gmk 4164 4790 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775044.1 protein_id gnl|my_center|LOCUS_09100 4887 5108 gene locus_tag LOCUS_09110 4887 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 5175 7430 gene locus_tag LOCUS_09120 gene priA 5175 7430 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_09120 7475 8350 gene locus_tag LOCUS_09130 7475 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8514 8906 gene locus_tag LOCUS_09140 8514 8906 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_09140 8962 9507 gene locus_tag LOCUS_09150 8962 9507 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_09150 12727 9674 gene locus_tag LOCUS_09160 12727 9674 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414652.1 protein_id gnl|my_center|LOCUS_09160 14110 12869 gene locus_tag LOCUS_09170 14110 12869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 14449 15072 gene locus_tag LOCUS_09180 14449 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 15321 17957 gene locus_tag LOCUS_09190 15321 17957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 18933 18139 gene locus_tag LOCUS_09200 18933 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 20641 18926 gene locus_tag LOCUS_09210 20641 18926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 21507 20614 gene locus_tag LOCUS_09220 21507 20614 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_09220 22013 21531 gene locus_tag LOCUS_09230 22013 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 23539 22106 gene locus_tag LOCUS_09240 23539 22106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 24638 23604 gene locus_tag LOCUS_09250 24638 23604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 25225 25300 gene locus_tag LOCUS_t00170 25225 25300 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25438 25319 gene locus_tag LOCUS_09260 25438 25319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 25895 26083 gene locus_tag LOCUS_09270 25895 26083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 26387 27181 gene locus_tag LOCUS_09280 gene frlD 26387 27181 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287927.1 protein_id gnl|my_center|LOCUS_09280 27301 27549 gene locus_tag LOCUS_09290 27301 27549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 27666 28730 gene locus_tag LOCUS_09300 27666 28730 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287929.1 protein_id gnl|my_center|LOCUS_09300 28924 29160 gene locus_tag LOCUS_09310 28924 29160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 30451 29309 gene locus_tag LOCUS_09320 gene hemW 30451 29309 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_09320 32265 30463 gene locus_tag LOCUS_09330 gene lepA 32265 30463 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964590.1 protein_id gnl|my_center|LOCUS_09330 33357 32509 gene locus_tag LOCUS_09340 33357 32509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 33901 35811 gene locus_tag LOCUS_09350 gene thrS 33901 35811 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_09350 36048 36725 gene locus_tag LOCUS_09360 36048 36725 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_09360 36718 36933 gene locus_tag LOCUS_09370 36718 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 37083 37322 gene locus_tag LOCUS_09380 37083 37322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 37312 37503 gene locus_tag LOCUS_09390 37312 37503 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence19 4503 3415 gene locus_tag LOCUS_09400 4503 3415 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_09400 5254 4619 gene locus_tag LOCUS_09410 5254 4619 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_09410 6711 5374 gene locus_tag LOCUS_09420 gene tyrS 6711 5374 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_09420 7951 6761 gene locus_tag LOCUS_09430 7951 6761 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392901.1 protein_id gnl|my_center|LOCUS_09430 8888 8292 gene locus_tag LOCUS_09440 8888 8292 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_09440 9788 9087 gene locus_tag LOCUS_09450 9788 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 10585 10037 gene locus_tag LOCUS_09460 10585 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 11951 10614 gene locus_tag LOCUS_09470 11951 10614 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_09470 12682 12023 gene locus_tag LOCUS_09480 gene udk 12682 12023 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700143.1 protein_id gnl|my_center|LOCUS_09480 13261 12749 gene locus_tag LOCUS_09490 13261 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 15268 13325 gene locus_tag LOCUS_09500 gene glgB 15268 13325 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939518.1 protein_id gnl|my_center|LOCUS_09500 16772 15324 gene locus_tag LOCUS_09510 gene mnmE 16772 15324 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_09510 17933 16806 gene locus_tag LOCUS_09520 17933 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 19282 18230 gene locus_tag LOCUS_09530 19282 18230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 19718 19275 gene locus_tag LOCUS_09540 19718 19275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 20065 19715 gene locus_tag LOCUS_09550 20065 19715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 20999 20865 gene locus_tag LOCUS_09560 gene rpmH 20999 20865 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701411.1 protein_id gnl|my_center|LOCUS_09560 21507 22496 gene locus_tag LOCUS_09570 gene argF 21507 22496 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_09570 23232 22654 gene locus_tag LOCUS_09580 23232 22654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547298.1 protein_id gnl|my_center|LOCUS_09580 24567 23233 gene locus_tag LOCUS_09590 24567 23233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 25807 24725 gene locus_tag LOCUS_09600 25807 24725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 25995 26549 gene locus_tag LOCUS_09610 25995 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 26592 26816 gene locus_tag LOCUS_09620 26592 26816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 26918 27964 gene locus_tag LOCUS_09630 gene floA 26918 27964 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_09630 28090 28674 gene locus_tag LOCUS_09640 28090 28674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 29530 28874 gene locus_tag LOCUS_09650 29530 28874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 29781 29629 gene locus_tag LOCUS_09660 29781 29629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 30470 29961 gene locus_tag LOCUS_09670 30470 29961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 31096 31389 gene locus_tag LOCUS_09680 31096 31389 CDS product RyR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764012.1 protein_id gnl|my_center|LOCUS_09680 32436 33101 gene locus_tag LOCUS_09690 32436 33101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 34430 33261 gene locus_tag LOCUS_09700 34430 33261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 35005 34487 gene locus_tag LOCUS_09710 gene tmrB 35005 34487 CDS product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 protein_id gnl|my_center|LOCUS_09710 36035 35235 gene locus_tag LOCUS_09720 36035 35235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 36275 36048 gene locus_tag LOCUS_09730 36275 36048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 36705 36280 gene locus_tag LOCUS_09740 36705 36280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 37058 36702 gene locus_tag LOCUS_09750 37058 36702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence20 1823 876 gene locus_tag LOCUS_09760 gene atpG 1823 876 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157696.1 protein_id gnl|my_center|LOCUS_09760 3834 1939 gene locus_tag LOCUS_09770 gene atpA 3834 1939 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_09770 4403 3831 gene locus_tag LOCUS_09780 4403 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4877 4494 gene locus_tag LOCUS_09790 4877 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 5759 4896 gene locus_tag LOCUS_09800 5759 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 6060 5978 gene locus_tag LOCUS_t00180 6060 5978 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6746 6207 gene locus_tag LOCUS_09810 6746 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 6993 6700 gene locus_tag LOCUS_09820 6993 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 7332 8357 gene locus_tag LOCUS_09830 7332 8357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 8472 9230 gene locus_tag LOCUS_09840 8472 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 9242 9448 gene locus_tag LOCUS_09850 9242 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 10173 9382 gene locus_tag LOCUS_09860 10173 9382 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805101.1 protein_id gnl|my_center|LOCUS_09860 10308 10442 gene locus_tag LOCUS_09870 10308 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 10536 11033 gene locus_tag LOCUS_09880 gene nrdR 10536 11033 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_09880 11241 11942 gene locus_tag LOCUS_09890 gene pgeF 11241 11942 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_09890 12031 13770 gene locus_tag LOCUS_09900 12031 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 13850 14644 gene locus_tag LOCUS_09910 13850 14644 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_09910 14641 15582 gene locus_tag LOCUS_09920 14641 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 16335 15637 gene locus_tag LOCUS_09930 gene sigK 16335 15637 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_09930 16629 16372 gene locus_tag LOCUS_09940 16629 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 16824 17456 gene locus_tag LOCUS_09950 16824 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 17676 18632 gene locus_tag LOCUS_09960 gene spoIIIAA 17676 18632 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_09960 18626 19120 gene locus_tag LOCUS_09970 18626 19120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 19206 19403 gene locus_tag LOCUS_09980 gene spoIIIAC 19206 19403 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810911.1 protein_id gnl|my_center|LOCUS_09980 19434 19835 gene locus_tag LOCUS_09990 19434 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 20024 21199 gene locus_tag LOCUS_10000 gene spoIIIAE 20024 21199 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_10000 21307 21492 gene locus_tag LOCUS_10010 21307 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 21571 22134 gene locus_tag LOCUS_10020 21571 22134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 22221 22781 gene locus_tag LOCUS_10030 22221 22781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 22933 23352 gene locus_tag LOCUS_10040 22933 23352 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_10040 23527 24105 gene locus_tag LOCUS_10050 23527 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 24105 24332 gene locus_tag LOCUS_10060 24105 24332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 24563 24937 gene locus_tag LOCUS_10070 24563 24937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 24937 26016 gene locus_tag LOCUS_10080 24937 26016 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_10080 26095 26946 gene locus_tag LOCUS_10090 gene folD 26095 26946 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_10090 26933 28228 gene locus_tag LOCUS_10100 gene xseA 26933 28228 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_10100 28248 28502 gene locus_tag LOCUS_10110 28248 28502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 28694 29581 gene locus_tag LOCUS_10120 28694 29581 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_10120 29659 31467 gene locus_tag LOCUS_10130 gene dxs 29659 31467 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_10130 31501 32319 gene locus_tag LOCUS_10140 31501 32319 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_10140 32358 33182 gene locus_tag LOCUS_10150 32358 33182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 33205 34908 gene locus_tag LOCUS_10160 gene recN 33205 34908 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645158.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence21 1050 76 gene locus_tag LOCUS_10170 1050 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1522 1187 gene locus_tag LOCUS_10180 1522 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2597 1512 gene locus_tag LOCUS_10190 2597 1512 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_10190 2786 2598 gene locus_tag LOCUS_10200 2786 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_10200 3124 3651 gene locus_tag LOCUS_10210 3124 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 5397 3877 gene locus_tag LOCUS_10220 gene guaA 5397 3877 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548925.1 protein_id gnl|my_center|LOCUS_10220 6028 5453 gene locus_tag LOCUS_10230 6028 5453 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057285.1 protein_id gnl|my_center|LOCUS_10230 7191 6283 gene locus_tag LOCUS_10240 7191 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 7657 7334 gene locus_tag LOCUS_10250 7657 7334 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_10250 8184 7744 gene locus_tag LOCUS_10260 8184 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 8641 9372 gene locus_tag LOCUS_10270 8641 9372 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_10270 9365 11341 gene locus_tag LOCUS_10280 9365 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 12577 11489 gene locus_tag LOCUS_10290 12577 11489 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_10290 12834 12758 gene locus_tag LOCUS_t00190 12834 12758 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12950 12875 gene locus_tag LOCUS_t00200 12950 12875 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13560 14582 gene locus_tag LOCUS_10300 gene pheS 13560 14582 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_10300 14600 17035 gene locus_tag LOCUS_10310 gene pheT 14600 17035 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_10310 17330 17791 gene locus_tag LOCUS_10320 gene trmL 17330 17791 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_10320 17875 18537 gene locus_tag LOCUS_10330 gene eda 17875 18537 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_10330 18597 19376 gene locus_tag LOCUS_10340 18597 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 19467 19991 gene locus_tag LOCUS_10350 19467 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 20198 21178 gene locus_tag LOCUS_10360 20198 21178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 21304 21786 gene locus_tag LOCUS_10370 21304 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 21786 23192 gene locus_tag LOCUS_10380 21786 23192 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_10380 24151 23348 gene locus_tag LOCUS_10390 24151 23348 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_10390 25313 24144 gene locus_tag LOCUS_10400 25313 24144 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_10400 25539 26102 gene locus_tag LOCUS_10410 25539 26102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 27765 26110 gene locus_tag LOCUS_10420 27765 26110 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384284.1 protein_id gnl|my_center|LOCUS_10420 28384 27746 gene locus_tag LOCUS_10430 28384 27746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 29195 28452 gene locus_tag LOCUS_10440 gene coaE 29195 28452 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_10440 31843 29234 gene locus_tag LOCUS_10450 gene polA 31843 29234 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_10450 32649 31897 gene locus_tag LOCUS_10460 32649 31897 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262283.1 protein_id gnl|my_center|LOCUS_10460 33471 32680 gene locus_tag LOCUS_10470 33471 32680 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989760.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence22 591 833 gene locus_tag LOCUS_10480 591 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1042 1524 gene locus_tag LOCUS_10490 1042 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2036 2332 gene locus_tag LOCUS_10500 2036 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2611 4200 gene locus_tag LOCUS_10510 gene tndX 2611 4200 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_10510 4523 4437 gene locus_tag LOCUS_t00210 4523 4437 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9392 4863 gene locus_tag LOCUS_10520 9392 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 9555 10664 gene locus_tag LOCUS_10530 9555 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 11815 10838 gene locus_tag LOCUS_10540 11815 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 12061 12882 gene locus_tag LOCUS_10550 12061 12882 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403827.1 protein_id gnl|my_center|LOCUS_10550 13629 12928 gene locus_tag LOCUS_10560 13629 12928 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_10560 14470 13655 gene locus_tag LOCUS_10570 14470 13655 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064678.1 protein_id gnl|my_center|LOCUS_10570 14715 14791 gene locus_tag LOCUS_t00220 14715 14791 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15692 14901 gene locus_tag LOCUS_10580 15692 14901 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829605.1 protein_id gnl|my_center|LOCUS_10580 16178 16501 gene locus_tag LOCUS_10590 16178 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 17192 16620 gene locus_tag LOCUS_10600 17192 16620 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 protein_id gnl|my_center|LOCUS_10600 18051 17212 gene locus_tag LOCUS_10610 18051 17212 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_10610 19657 18248 gene locus_tag LOCUS_10620 gene citF 19657 18248 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_10620 20523 19657 gene locus_tag LOCUS_10630 20523 19657 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_10630 23511 20866 gene locus_tag LOCUS_10640 23511 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 23871 25049 gene locus_tag LOCUS_10650 23871 25049 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_10650 25283 26881 gene locus_tag LOCUS_10660 25283 26881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 27067 28008 gene locus_tag LOCUS_10670 27067 28008 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_10670 28043 28720 gene locus_tag LOCUS_10680 28043 28720 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_10680 28770 29309 gene locus_tag LOCUS_10690 28770 29309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 29355 29945 gene locus_tag LOCUS_10700 29355 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 29987 30358 gene locus_tag LOCUS_10710 29987 30358 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_10710 30978 30436 gene locus_tag LOCUS_10720 30978 30436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence23 3805 4056 gene locus_tag LOCUS_10730 3805 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4115 5050 gene locus_tag LOCUS_10740 4115 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 5052 6188 gene locus_tag LOCUS_10750 5052 6188 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878621.1 protein_id gnl|my_center|LOCUS_10750 6204 6467 gene locus_tag LOCUS_10760 6204 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6548 10453 gene locus_tag LOCUS_10770 6548 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 10847 12100 gene locus_tag LOCUS_10780 10847 12100 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_10780 12152 12868 gene locus_tag LOCUS_10790 gene pyrH 12152 12868 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_10790 13051 13602 gene locus_tag LOCUS_10800 gene frr 13051 13602 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_10800 13599 13844 gene locus_tag LOCUS_10810 13599 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 13946 14689 gene locus_tag LOCUS_10820 13946 14689 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_10820 14778 15584 gene locus_tag LOCUS_10830 14778 15584 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_10830 15745 16896 gene locus_tag LOCUS_10840 15745 16896 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_10840 16893 17975 gene locus_tag LOCUS_10850 gene rseP 16893 17975 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_10850 18021 18599 gene locus_tag LOCUS_10860 18021 18599 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_10860 19719 18700 gene locus_tag LOCUS_10870 19719 18700 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_10870 20663 19929 gene locus_tag LOCUS_10880 20663 19929 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_10880 21060 21563 gene locus_tag LOCUS_10890 gene mraZ 21060 21563 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_10890 21570 22541 gene locus_tag LOCUS_10900 gene rsmH 21570 22541 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_10900 22543 23004 gene locus_tag LOCUS_10910 22543 23004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 23151 25355 gene locus_tag LOCUS_10920 23151 25355 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_10920 25419 26873 gene locus_tag LOCUS_10930 25419 26873 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_10930 26949 27968 gene locus_tag LOCUS_10940 gene mraY 26949 27968 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_10940 28292 29641 gene locus_tag LOCUS_10950 gene murD 28292 29641 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence24 225 425 gene locus_tag LOCUS_10960 225 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 461 613 gene locus_tag LOCUS_10970 461 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1381 1124 gene locus_tag LOCUS_10980 1381 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3500 1509 gene locus_tag LOCUS_10990 3500 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3813 4781 gene locus_tag LOCUS_11000 3813 4781 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_11000 5000 5734 gene locus_tag LOCUS_11010 5000 5734 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_11010 5794 6477 gene locus_tag LOCUS_11020 5794 6477 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_11020 7208 6606 gene locus_tag LOCUS_11030 7208 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 7406 8044 gene locus_tag LOCUS_11040 7406 8044 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965678.1 protein_id gnl|my_center|LOCUS_11040 8197 9429 gene locus_tag LOCUS_11050 8197 9429 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_11050 11551 9584 gene locus_tag LOCUS_11060 gene gyrB 11551 9584 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_11060 14860 11606 gene locus_tag LOCUS_11070 14860 11606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 15802 15008 gene locus_tag LOCUS_11080 15802 15008 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_11080 16876 16154 gene locus_tag LOCUS_11090 gene plsY 16876 16154 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_11090 17897 16965 gene locus_tag LOCUS_11100 17897 16965 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_11100 18783 17905 gene locus_tag LOCUS_11110 gene truB 18783 17905 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_11110 19882 18869 gene locus_tag LOCUS_11120 19882 18869 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_11120 20330 19872 gene locus_tag LOCUS_11130 20330 19872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 23633 20532 gene locus_tag LOCUS_11140 gene infB 23633 20532 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460393.1 protein_id gnl|my_center|LOCUS_11140 23973 23620 gene locus_tag LOCUS_11150 23973 23620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 24327 23980 gene locus_tag LOCUS_11160 24327 23980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 25604 24417 gene locus_tag LOCUS_11170 gene nusA 25604 24417 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_11170 26157 25684 gene locus_tag LOCUS_11180 gene rimP 26157 25684 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_11180 <29048 26439 gene locus_tag LOCUS_11190 <29048 26439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461752.1:DNA polymerase III subunit alpha >Feature sequence25 1611 316 gene locus_tag LOCUS_11200 1611 316 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_11200 2679 1837 gene locus_tag LOCUS_11210 2679 1837 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_11210 3912 2803 gene locus_tag LOCUS_11220 3912 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4221 5828 gene locus_tag LOCUS_11230 4221 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6003 7145 gene locus_tag LOCUS_11240 6003 7145 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263349.1 protein_id gnl|my_center|LOCUS_11240 8526 7318 gene locus_tag LOCUS_11250 gene tuf 8526 7318 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_11250 10790 8712 gene locus_tag LOCUS_11260 gene fusA 10790 8712 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_11260 11378 10908 gene locus_tag LOCUS_11270 gene rpsG 11378 10908 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810168.1 protein_id gnl|my_center|LOCUS_11270 11764 11390 gene locus_tag LOCUS_11280 gene rpsL 11764 11390 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357676.1 protein_id gnl|my_center|LOCUS_11280 13099 12131 gene locus_tag LOCUS_11290 13099 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 14692 13919 gene locus_tag LOCUS_11300 14692 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 18766 14999 gene locus_tag LOCUS_11310 18766 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 22641 18793 gene locus_tag LOCUS_11320 gene rpoB 22641 18793 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966421.1 protein_id gnl|my_center|LOCUS_11320 22873 23040 gene locus_tag LOCUS_11330 22873 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 23632 23108 gene locus_tag LOCUS_11340 23632 23108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 24759 23800 gene locus_tag LOCUS_11350 24759 23800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 25031 25611 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatcaatccccgcaatggggggcaatag <27939 25899 gene locus_tag LOCUS_11360 <27939 25899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966549.1:Ig-like domain-containing protein >Feature sequence26 1304 321 gene locus_tag LOCUS_11370 gene gerM 1304 321 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126748.1 protein_id gnl|my_center|LOCUS_11370 2144 4384 gene locus_tag LOCUS_11380 2144 4384 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_11380 4499 5716 gene locus_tag LOCUS_11390 4499 5716 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_11390 5849 6139 gene locus_tag LOCUS_11400 gene citD 5849 6139 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263227.1 protein_id gnl|my_center|LOCUS_11400 6276 7139 gene locus_tag LOCUS_11410 gene citE 6276 7139 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355998.1 protein_id gnl|my_center|LOCUS_11410 7145 8671 gene locus_tag LOCUS_11420 gene citF 7145 8671 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026596.1 protein_id gnl|my_center|LOCUS_11420 9957 8815 gene locus_tag LOCUS_11430 9957 8815 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_11430 10032 10232 gene locus_tag LOCUS_11440 10032 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 10239 10736 gene locus_tag LOCUS_11450 gene ruvC 10239 10736 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_11450 10764 11357 gene locus_tag LOCUS_11460 gene ruvA 10764 11357 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_11460 11471 12499 gene locus_tag LOCUS_11470 gene ruvB 11471 12499 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_11470 12588 14036 gene locus_tag LOCUS_11480 12588 14036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14076 14870 gene locus_tag LOCUS_11490 gene surE 14076 14870 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812070.1 protein_id gnl|my_center|LOCUS_11490 14937 16304 gene locus_tag LOCUS_11500 14937 16304 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_11500 16358 17062 gene locus_tag LOCUS_11510 gene cmk 16358 17062 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_11510 17093 17719 gene locus_tag LOCUS_11520 17093 17719 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_11520 17756 20020 gene locus_tag LOCUS_11530 17756 20020 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_11530 20441 22375 gene locus_tag LOCUS_11540 20441 22375 CDS product bifunctional phosphoglycerate kinase/triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081072.1 protein_id gnl|my_center|LOCUS_11540 22528 24069 gene locus_tag LOCUS_11550 gene gpmI 22528 24069 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_11550 24170 24412 gene locus_tag LOCUS_11560 24170 24412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 24523 24987 gene locus_tag LOCUS_11570 gene smpB 24523 24987 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_11570 25112 25464 gene locus_tag LOCUS_tm00010 25112 25464 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence27 768 1637 gene locus_tag LOCUS_11580 768 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1657 3210 gene locus_tag LOCUS_11590 1657 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3207 4709 gene locus_tag LOCUS_11600 3207 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4798 6546 gene locus_tag LOCUS_11610 4798 6546 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935389.1 protein_id gnl|my_center|LOCUS_11610 9155 6780 gene locus_tag LOCUS_11620 9155 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 9906 9472 gene locus_tag LOCUS_11630 9906 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 10792 10103 gene locus_tag LOCUS_11640 gene rplA 10792 10103 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_11640 11272 10847 gene locus_tag LOCUS_11650 gene rplK 11272 10847 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_11650 12005 11445 gene locus_tag LOCUS_11660 gene nusG 12005 11445 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_11660 12275 12015 gene locus_tag LOCUS_11670 12275 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 12442 12293 gene locus_tag LOCUS_11680 gene rpmG 12442 12293 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_11680 14536 13292 gene locus_tag LOCUS_11690 14536 13292 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_11690 15095 14760 gene locus_tag LOCUS_11700 15095 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 15324 15249 gene locus_tag LOCUS_t00230 15324 15249 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16477 15581 gene locus_tag LOCUS_11710 16477 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 16882 18009 gene locus_tag LOCUS_11720 gene recF 16882 18009 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_11720 18185 20107 gene locus_tag LOCUS_11730 gene gyrB 18185 20107 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_11730 20257 22866 gene locus_tag LOCUS_11740 gene gyrA 20257 22866 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_11740 24751 24098 gene locus_tag LOCUS_11750 24751 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 25216 25022 gene locus_tag LOCUS_11760 25216 25022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence28 <1 1353 gene locus_tag LOCUS_11770 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 2218 1460 gene locus_tag LOCUS_11780 2218 1460 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_11780 2671 3945 gene locus_tag LOCUS_11790 2671 3945 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_11790 3974 5017 gene locus_tag LOCUS_11800 gene tdh 3974 5017 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 protein_id gnl|my_center|LOCUS_11800 5078 6259 gene locus_tag LOCUS_11810 5078 6259 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532322.1 protein_id gnl|my_center|LOCUS_11810 6425 7414 gene locus_tag LOCUS_11820 gene trpS 6425 7414 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070666.1 protein_id gnl|my_center|LOCUS_11820 7941 7519 gene locus_tag LOCUS_11830 7941 7519 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948438.1 protein_id gnl|my_center|LOCUS_11830 10319 8247 gene locus_tag LOCUS_11840 gene fusA 10319 8247 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_11840 13332 10627 gene locus_tag LOCUS_11850 13332 10627 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_11850 14309 13710 gene locus_tag LOCUS_11860 14309 13710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 14901 14494 gene locus_tag LOCUS_11870 14901 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 16627 15092 gene locus_tag LOCUS_11880 16627 15092 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_11880 18736 16880 gene locus_tag LOCUS_11890 18736 16880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_11890 20610 18736 gene locus_tag LOCUS_11900 20610 18736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_11900 21804 22088 gene locus_tag LOCUS_11910 21804 22088 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_11910 22191 23813 gene locus_tag LOCUS_11920 gene groL 22191 23813 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_11920 24954 24046 gene locus_tag LOCUS_11930 24954 24046 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455196.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence29 816 70 gene locus_tag LOCUS_11940 816 70 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_11940 1785 979 gene locus_tag LOCUS_11950 1785 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2052 3749 gene locus_tag LOCUS_11960 gene argS 2052 3749 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_11960 3882 4919 gene locus_tag LOCUS_11970 gene prfB 3882 4919 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010959142.1 protein_id gnl|my_center|LOCUS_11970 5137 5484 gene locus_tag LOCUS_11980 5137 5484 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_11980 5502 6089 gene locus_tag LOCUS_11990 gene recR 5502 6089 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_11990 6276 7202 gene locus_tag LOCUS_12000 6276 7202 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858282.1 protein_id gnl|my_center|LOCUS_12000 8743 7343 gene locus_tag LOCUS_12010 8743 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 9331 9083 gene locus_tag LOCUS_12020 9331 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 9619 10707 gene locus_tag LOCUS_12030 gene ychF 9619 10707 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_12030 10711 12765 gene locus_tag LOCUS_12040 10711 12765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 12871 13266 gene locus_tag LOCUS_12050 12871 13266 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_12050 13440 13691 gene locus_tag LOCUS_12060 13440 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_12060 15940 14054 gene locus_tag LOCUS_12070 15940 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 16255 17715 gene locus_tag LOCUS_12080 gene gltX 16255 17715 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_12080 17814 18473 gene locus_tag LOCUS_12090 17814 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 20962 18599 gene locus_tag LOCUS_12100 20962 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 21227 21300 gene locus_tag LOCUS_t00240 21227 21300 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21845 21339 gene locus_tag LOCUS_12110 21845 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 22734 22015 gene locus_tag LOCUS_12120 22734 22015 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913203.1 protein_id gnl|my_center|LOCUS_12120 23260 22892 gene locus_tag LOCUS_12130 23260 22892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence30 1301 720 gene locus_tag LOCUS_12140 gene eutD 1301 720 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721580.1 protein_id gnl|my_center|LOCUS_12140 2636 1428 gene locus_tag LOCUS_12150 2636 1428 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970043.1 protein_id gnl|my_center|LOCUS_12150 3469 2915 gene locus_tag LOCUS_12160 3469 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4098 3613 gene locus_tag LOCUS_12170 gene spoVAC 4098 3613 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_12170 4265 4098 gene locus_tag LOCUS_12180 4265 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4494 4252 gene locus_tag LOCUS_12190 4494 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5312 4620 gene locus_tag LOCUS_12200 gene sigF 5312 4620 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460233.1 protein_id gnl|my_center|LOCUS_12200 5913 5314 gene locus_tag LOCUS_12210 5913 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6234 5917 gene locus_tag LOCUS_12220 gene spoIIAA 6234 5917 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_12220 6596 7657 gene locus_tag LOCUS_12230 gene aroB 6596 7657 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920829.1 protein_id gnl|my_center|LOCUS_12230 7668 8876 gene locus_tag LOCUS_12240 7668 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 8860 9915 gene locus_tag LOCUS_12250 gene aroC 8860 9915 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_12250 9977 10723 gene locus_tag LOCUS_12260 9977 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 11990 10803 gene locus_tag LOCUS_12270 11990 10803 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_12270 12660 11980 gene locus_tag LOCUS_12280 12660 11980 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_12280 13063 13962 gene locus_tag LOCUS_12290 13063 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 14342 16798 gene locus_tag LOCUS_12300 14342 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 16931 17458 gene locus_tag LOCUS_12310 16931 17458 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_12310 17689 19863 gene locus_tag LOCUS_12320 17689 19863 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_12320 19860 20306 gene locus_tag LOCUS_12330 gene dtd 19860 20306 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_12330 20349 21017 gene locus_tag LOCUS_12340 20349 21017 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence31 2490 3311 gene locus_tag LOCUS_12350 gene coaW 2490 3311 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442504.1 protein_id gnl|my_center|LOCUS_12350 3782 3414 gene locus_tag LOCUS_12360 gene spoVAE 3782 3414 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_12360 4903 3866 gene locus_tag LOCUS_12370 gene spoVAD 4903 3866 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_12370 5651 5193 gene locus_tag LOCUS_12380 5651 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6053 5709 gene locus_tag LOCUS_12390 6053 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 6308 6232 gene locus_tag LOCUS_t00250 6308 6232 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6389 6314 gene locus_tag LOCUS_t00260 6389 6314 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6625 7395 gene locus_tag LOCUS_12400 gene larE 6625 7395 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_12400 7430 8194 gene locus_tag LOCUS_12410 gene larB 7430 8194 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_12410 8256 9599 gene locus_tag LOCUS_12420 8256 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 10012 10515 gene locus_tag LOCUS_12430 10012 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 10570 11031 gene locus_tag LOCUS_12440 10570 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 12484 11240 gene locus_tag LOCUS_12450 12484 11240 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_12450 14006 12612 gene locus_tag LOCUS_12460 gene lpdA 14006 12612 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_12460 14238 15284 gene locus_tag LOCUS_12470 14238 15284 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_12470 15442 15882 gene locus_tag LOCUS_12480 gene rpiB 15442 15882 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_12480 15941 16582 gene locus_tag LOCUS_12490 gene upp 15941 16582 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_12490 16716 18026 gene locus_tag LOCUS_12500 16716 18026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 19434 18154 gene locus_tag LOCUS_12510 19434 18154 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_12510 21094 19736 gene locus_tag LOCUS_12520 21094 19736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence32 450 1487 gene locus_tag LOCUS_12530 450 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1703 2902 gene locus_tag LOCUS_12540 gene ftsA 1703 2902 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216537.1 protein_id gnl|my_center|LOCUS_12540 3015 4502 gene locus_tag LOCUS_12550 3015 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5046 6530 gene locus_tag LOCUS_12560 5046 6530 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061775.1 protein_id gnl|my_center|LOCUS_12560 7710 6673 gene locus_tag LOCUS_12570 gene gap 7710 6673 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_12570 8824 7898 gene locus_tag LOCUS_12580 8824 7898 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_12580 9675 9031 gene locus_tag LOCUS_12590 9675 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11125 9668 gene locus_tag LOCUS_12600 11125 9668 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_12600 11474 11211 gene locus_tag LOCUS_12610 11474 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 12603 11668 gene locus_tag LOCUS_12620 gene fba 12603 11668 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_12620 13687 12830 gene locus_tag LOCUS_12630 13687 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 16929 14485 gene locus_tag LOCUS_12640 16929 14485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 18395 17091 gene locus_tag LOCUS_12650 18395 17091 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_12650 19527 18520 gene locus_tag LOCUS_12660 19527 18520 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_12660 20371 19733 gene locus_tag LOCUS_12670 20371 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 21106 20504 gene locus_tag LOCUS_12680 21106 20504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence33 1590 160 gene locus_tag LOCUS_12690 1590 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 2219 1722 gene locus_tag LOCUS_12700 2219 1722 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_12700 2617 3099 gene locus_tag LOCUS_12710 gene def 2617 3099 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_12710 3169 4119 gene locus_tag LOCUS_12720 gene fmt 3169 4119 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_12720 4183 5568 gene locus_tag LOCUS_12730 gene rsmB 4183 5568 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_12730 5656 6723 gene locus_tag LOCUS_12740 gene rlmN 5656 6723 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_12740 6785 7558 gene locus_tag LOCUS_12750 gene prpC 6785 7558 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_12750 7555 9474 gene locus_tag LOCUS_12760 gene pknB 7555 9474 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733096.1 protein_id gnl|my_center|LOCUS_12760 9567 10517 gene locus_tag LOCUS_12770 gene rsgA 9567 10517 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113932.1 protein_id gnl|my_center|LOCUS_12770 10560 11213 gene locus_tag LOCUS_12780 gene rpe 10560 11213 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_12780 11307 13775 gene locus_tag LOCUS_12790 gene gyrA 11307 13775 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_12790 14157 13864 gene locus_tag LOCUS_12800 14157 13864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 14370 14927 gene locus_tag LOCUS_12810 14370 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 15095 15712 gene locus_tag LOCUS_12820 gene nth 15095 15712 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_12820 15714 17024 gene locus_tag LOCUS_12830 gene obgE 15714 17024 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836728.1 protein_id gnl|my_center|LOCUS_12830 17264 17340 gene locus_tag LOCUS_t00270 17264 17340 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17350 17425 gene locus_tag LOCUS_t00280 17350 17425 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17438 17514 gene locus_tag LOCUS_t00290 17438 17514 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17528 17604 gene locus_tag LOCUS_t00300 17528 17604 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17643 17718 gene locus_tag LOCUS_t00310 17643 17718 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17737 17821 gene locus_tag LOCUS_t00320 17737 17821 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 17835 17921 gene locus_tag LOCUS_t00330 17835 17921 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18339 18593 gene locus_tag LOCUS_12840 18339 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 18590 19165 gene locus_tag LOCUS_12850 18590 19165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 19391 19570 gene locus_tag LOCUS_12860 19391 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 19563 19955 gene locus_tag LOCUS_12870 19563 19955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 20199 20549 gene locus_tag LOCUS_12880 20199 20549 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273897.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12880 20803 20591 gene locus_tag LOCUS_12890 20803 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence34 271 780 gene locus_tag LOCUS_12900 271 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1219 4266 gene locus_tag LOCUS_12910 1219 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4527 4943 gene locus_tag LOCUS_12920 gene glmS 4527 4943 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_12920 4994 6370 gene locus_tag LOCUS_12930 gene glmL 4994 6370 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_12930 6437 7906 gene locus_tag LOCUS_12940 6437 7906 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_12940 8024 9274 gene locus_tag LOCUS_12950 8024 9274 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_12950 10389 9583 gene locus_tag LOCUS_12960 10389 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 12517 10697 gene locus_tag LOCUS_12970 12517 10697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_12970 14283 12514 gene locus_tag LOCUS_12980 14283 12514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_12980 14590 15387 gene locus_tag LOCUS_12990 14590 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 16188 15487 gene locus_tag LOCUS_13000 16188 15487 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668240.1 protein_id gnl|my_center|LOCUS_13000 17000 16254 gene locus_tag LOCUS_13010 17000 16254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 17757 17539 gene locus_tag LOCUS_13020 17757 17539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 18909 17776 gene locus_tag LOCUS_13030 18909 17776 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_13030 19130 19585 gene locus_tag LOCUS_13040 19130 19585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence35 873 292 gene locus_tag LOCUS_13050 873 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1698 922 gene locus_tag LOCUS_13060 1698 922 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_13060 2008 2457 gene locus_tag LOCUS_13070 2008 2457 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_13070 2499 3119 gene locus_tag LOCUS_13080 gene thyX 2499 3119 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393959.1 protein_id gnl|my_center|LOCUS_13080 4879 3281 gene locus_tag LOCUS_13090 4879 3281 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_13090 5677 5009 gene locus_tag LOCUS_13100 5677 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 7014 5674 gene locus_tag LOCUS_13110 7014 5674 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964815.1 protein_id gnl|my_center|LOCUS_13110 7670 7011 gene locus_tag LOCUS_13120 7670 7011 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_13120 8478 7831 gene locus_tag LOCUS_13130 8478 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8803 8648 gene locus_tag LOCUS_13140 8803 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9674 8808 gene locus_tag LOCUS_13150 9674 8808 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_13150 11378 9693 gene locus_tag LOCUS_13160 11378 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 12226 11501 gene locus_tag LOCUS_13170 12226 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 12441 13676 gene locus_tag LOCUS_13180 12441 13676 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_13180 14011 13688 gene locus_tag LOCUS_13190 14011 13688 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943224.1 protein_id gnl|my_center|LOCUS_13190 14954 14040 gene locus_tag LOCUS_13200 14954 14040 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963753.1 protein_id gnl|my_center|LOCUS_13200 17459 15294 gene locus_tag LOCUS_13210 17459 15294 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518812.1 protein_id gnl|my_center|LOCUS_13210 18967 17852 gene locus_tag LOCUS_13220 18967 17852 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976026.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence36 836 1012 gene locus_tag LOCUS_13230 836 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1586 4732 gene locus_tag LOCUS_13240 gene ileS 1586 4732 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_13240 4869 5915 gene locus_tag LOCUS_13250 4869 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 6112 6756 gene locus_tag LOCUS_13260 6112 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6928 7110 gene locus_tag LOCUS_13270 6928 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 9746 7464 gene locus_tag LOCUS_13280 9746 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 10071 10466 gene locus_tag LOCUS_13290 10071 10466 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_13290 10470 11369 gene locus_tag LOCUS_13300 10470 11369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657068.1 protein_id gnl|my_center|LOCUS_13300 11383 13650 gene locus_tag LOCUS_13310 11383 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 15345 14026 gene locus_tag LOCUS_13320 15345 14026 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_13320 15837 15559 gene locus_tag LOCUS_13330 15837 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 16661 15933 gene locus_tag LOCUS_13340 16661 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 17007 16825 gene locus_tag LOCUS_13350 17007 16825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence37 893 471 gene locus_tag LOCUS_13360 893 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1600 1019 gene locus_tag LOCUS_13370 1600 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1767 1843 gene locus_tag LOCUS_t00340 1767 1843 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2045 2118 gene locus_tag LOCUS_t00350 2045 2118 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2294 4075 gene locus_tag LOCUS_13380 gene hflX 2294 4075 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965596.1 protein_id gnl|my_center|LOCUS_13380 4099 4788 gene locus_tag LOCUS_13390 4099 4788 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 protein_id gnl|my_center|LOCUS_13390 4856 5917 gene locus_tag LOCUS_13400 4856 5917 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_13400 6204 7871 gene locus_tag LOCUS_13410 6204 7871 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_13410 9282 7987 gene locus_tag LOCUS_13420 9282 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 10007 9375 gene locus_tag LOCUS_13430 10007 9375 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922736.1 protein_id gnl|my_center|LOCUS_13430 11330 10098 gene locus_tag LOCUS_13440 gene hutI 11330 10098 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_13440 12302 11406 gene locus_tag LOCUS_13450 gene ftcD 12302 11406 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_13450 14552 12531 gene locus_tag LOCUS_13460 14552 12531 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680599.1 protein_id gnl|my_center|LOCUS_13460 16185 14662 gene locus_tag LOCUS_13470 gene hutH 16185 14662 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017128.1 protein_id gnl|my_center|LOCUS_13470 16490 16684 gene locus_tag LOCUS_13480 16490 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 16943 16776 gene locus_tag LOCUS_13490 16943 16776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence38 <1 664 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttgccacagcgcattcgcgcgggttgcgac 2355 859 gene locus_tag LOCUS_13500 2355 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3180 2656 gene locus_tag LOCUS_13510 3180 2656 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103118.1 protein_id gnl|my_center|LOCUS_13510 3739 3335 gene locus_tag LOCUS_13520 3739 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4101 4637 gene locus_tag LOCUS_13530 gene pgsA 4101 4637 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_13530 4708 5703 gene locus_tag LOCUS_13540 4708 5703 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_13540 5891 6628 gene locus_tag LOCUS_13550 5891 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6849 8276 gene locus_tag LOCUS_13560 6849 8276 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_13560 8397 9605 gene locus_tag LOCUS_13570 gene mrdB 8397 9605 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816839.1 protein_id gnl|my_center|LOCUS_13570 9686 12286 gene locus_tag LOCUS_13580 9686 12286 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101242.1 protein_id gnl|my_center|LOCUS_13580 12299 13966 gene locus_tag LOCUS_13590 12299 13966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 14319 15596 gene locus_tag LOCUS_13600 14319 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 16103 15774 gene locus_tag LOCUS_13610 16103 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 16738 16136 gene locus_tag LOCUS_13620 16738 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence39 419 1567 gene locus_tag LOCUS_13630 419 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2676 1624 gene locus_tag LOCUS_13640 2676 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2993 3595 gene locus_tag LOCUS_13650 2993 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3765 5492 gene locus_tag LOCUS_13660 3765 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5758 8352 gene locus_tag LOCUS_13670 5758 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8636 11671 gene locus_tag LOCUS_13680 8636 11671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 11672 13042 gene locus_tag LOCUS_13690 gene rimO 11672 13042 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_13690 13153 13746 gene locus_tag LOCUS_13700 gene pgsA 13153 13746 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296025.1 protein_id gnl|my_center|LOCUS_13700 14215 14802 gene locus_tag LOCUS_13710 14215 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 15600 14968 gene locus_tag LOCUS_13720 15600 14968 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_13720 16327 15878 gene locus_tag LOCUS_13730 16327 15878 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence40 576 2399 gene locus_tag LOCUS_13740 576 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2633 2833 gene locus_tag LOCUS_13750 2633 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2895 3605 gene locus_tag LOCUS_13760 2895 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 4583 3786 gene locus_tag LOCUS_13770 gene murI 4583 3786 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_13770 6017 4605 gene locus_tag LOCUS_13780 gene citG 6017 4605 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_13780 7745 6042 gene locus_tag LOCUS_13790 7745 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8867 7884 gene locus_tag LOCUS_13800 gene citC 8867 7884 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181444.1 protein_id gnl|my_center|LOCUS_13800 9215 8925 gene locus_tag LOCUS_13810 gene citD 9215 8925 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691461.1 protein_id gnl|my_center|LOCUS_13810 10410 9304 gene locus_tag LOCUS_13820 10410 9304 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_13820 11136 10522 gene locus_tag LOCUS_13830 11136 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 12683 11601 gene locus_tag LOCUS_13840 12683 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 13832 12741 gene locus_tag LOCUS_13850 13832 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence41 526 179 gene locus_tag LOCUS_13860 526 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 705 615 gene locus_tag LOCUS_t00360 705 615 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 867 2198 gene locus_tag LOCUS_13870 867 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3045 2374 gene locus_tag LOCUS_13880 3045 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3346 4035 gene locus_tag LOCUS_13890 3346 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808298.1 protein_id gnl|my_center|LOCUS_13890 4797 5642 gene locus_tag LOCUS_13900 4797 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 5872 6780 gene locus_tag LOCUS_13910 5872 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6811 8724 gene locus_tag LOCUS_13920 6811 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 8914 10263 gene locus_tag LOCUS_13930 gene glmM 8914 10263 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_13930 10331 11035 gene locus_tag LOCUS_13940 10331 11035 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_13940 11032 12186 gene locus_tag LOCUS_13950 11032 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 13210 12332 gene locus_tag LOCUS_13960 13210 12332 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_13960 14029 13214 gene locus_tag LOCUS_13970 14029 13214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_13970 14205 14432 gene locus_tag LOCUS_13980 14205 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence42 195 962 gene locus_tag LOCUS_13990 195 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1289 1050 gene locus_tag LOCUS_14000 1289 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1530 4157 gene locus_tag LOCUS_14010 gene ppdK 1530 4157 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_14010 4645 4367 gene locus_tag LOCUS_14020 4645 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5142 4876 gene locus_tag LOCUS_14030 5142 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5391 5221 gene locus_tag LOCUS_14040 5391 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 8091 5596 gene locus_tag LOCUS_14050 8091 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 8455 8234 gene locus_tag LOCUS_14060 8455 8234 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_14060 8787 8575 gene locus_tag LOCUS_14070 8787 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 10801 9467 gene locus_tag LOCUS_14080 gene aspS 10801 9467 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902296.1 protein_id gnl|my_center|LOCUS_14080 11768 11073 gene locus_tag LOCUS_14090 11768 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 12013 12909 gene locus_tag LOCUS_14100 12013 12909 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245785.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence43 1479 2198 gene locus_tag LOCUS_14110 1479 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2458 3930 gene locus_tag LOCUS_14120 gene mazG 2458 3930 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458939.1 protein_id gnl|my_center|LOCUS_14120 4117 4395 gene locus_tag LOCUS_14130 gene hbs 4117 4395 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_14130 4557 4727 gene locus_tag LOCUS_14140 4557 4727 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_14140 5596 5039 gene locus_tag LOCUS_14150 5596 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 5750 6856 gene locus_tag LOCUS_14160 5750 6856 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_14160 7004 8194 gene locus_tag LOCUS_14170 7004 8194 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328323.1 protein_id gnl|my_center|LOCUS_14170 8551 9135 gene locus_tag LOCUS_14180 8551 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 9505 10218 gene locus_tag LOCUS_14190 9505 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 10330 11061 gene locus_tag LOCUS_14200 10330 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 11157 11633 gene locus_tag LOCUS_14210 11157 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 11653 12711 gene locus_tag LOCUS_14220 11653 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence44 164 1201 gene locus_tag LOCUS_14230 gene recA 164 1201 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_14230 2127 1366 gene locus_tag LOCUS_14240 2127 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3065 2649 gene locus_tag LOCUS_14250 3065 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 4576 3068 gene locus_tag LOCUS_14260 4576 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 5266 4595 gene locus_tag LOCUS_14270 5266 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6441 5266 gene locus_tag LOCUS_14280 6441 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 7444 6716 gene locus_tag LOCUS_14290 7444 6716 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_14290 7676 9232 gene locus_tag LOCUS_14300 gene rny 7676 9232 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_14300 12141 9382 gene locus_tag LOCUS_14310 12141 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence45 658 1575 gene locus_tag LOCUS_14320 658 1575 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_14320 1572 2693 gene locus_tag LOCUS_14330 1572 2693 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242735.1 protein_id gnl|my_center|LOCUS_14330 2947 3675 gene locus_tag LOCUS_14340 2947 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3688 4785 gene locus_tag LOCUS_14350 3688 4785 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_14350 4787 5923 gene locus_tag LOCUS_14360 4787 5923 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225909.1 protein_id gnl|my_center|LOCUS_14360 5924 7027 gene locus_tag LOCUS_14370 5924 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 7024 8010 gene locus_tag LOCUS_14380 7024 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 8003 8968 gene locus_tag LOCUS_14390 8003 8968 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994175.1 protein_id gnl|my_center|LOCUS_14390 8961 9992 gene locus_tag LOCUS_14400 8961 9992 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_14400 10002 11003 gene locus_tag LOCUS_14410 10002 11003 CDS product stealth conserved region 3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207631.1 protein_id gnl|my_center|LOCUS_14410 11000 12172 gene locus_tag LOCUS_14420 11000 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence46 1263 2159 gene locus_tag LOCUS_14430 gene murB 1263 2159 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_14430 2225 3103 gene locus_tag LOCUS_14440 gene rapZ 2225 3103 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_14440 3181 4224 gene locus_tag LOCUS_14450 gene whiA 3181 4224 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_14450 4303 7767 gene locus_tag LOCUS_14460 4303 7767 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_14460 7808 8833 gene locus_tag LOCUS_14470 gene pfkA 7808 8833 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_14470 8954 10576 gene locus_tag LOCUS_14480 gene rlmD 8954 10576 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914581.1 protein_id gnl|my_center|LOCUS_14480 10587 10832 gene locus_tag LOCUS_14490 10587 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 11808 10906 gene locus_tag LOCUS_14500 11808 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence47 380 892 gene locus_tag LOCUS_14510 380 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 980 1858 gene locus_tag LOCUS_14520 980 1858 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_14520 2120 4153 gene locus_tag LOCUS_14530 2120 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986676.1 protein_id gnl|my_center|LOCUS_14530 4221 5585 gene locus_tag LOCUS_14540 4221 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986675.1 protein_id gnl|my_center|LOCUS_14540 5602 7215 gene locus_tag LOCUS_14550 gene cas10 5602 7215 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986674.1 protein_id gnl|my_center|LOCUS_14550 7193 8368 gene locus_tag LOCUS_14560 7193 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 8365 9189 gene locus_tag LOCUS_14570 gene cmr4 8365 9189 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_14570 9186 9608 gene locus_tag LOCUS_14580 9186 9608 CDS product type III-B CRISPR module-associated protein Cmr5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986671.1 protein_id gnl|my_center|LOCUS_14580 9601 10578 gene locus_tag LOCUS_14590 gene cmr6 9601 10578 CDS product type III-B CRISPR module RAMP protein Cmr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986670.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence48 2646 2356 gene locus_tag LOCUS_14600 2646 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2999 2661 gene locus_tag LOCUS_14610 2999 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3879 3178 gene locus_tag LOCUS_14620 3879 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 6141 3943 gene locus_tag LOCUS_14630 6141 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 6540 7664 gene locus_tag LOCUS_14640 6540 7664 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_14640 7890 8321 gene locus_tag LOCUS_14650 gene rplM 7890 8321 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494906.1 protein_id gnl|my_center|LOCUS_14650 8346 8744 gene locus_tag LOCUS_14660 gene rpsI 8346 8744 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_14660 9126 8827 gene locus_tag LOCUS_14670 9126 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14670 10273 9458 gene locus_tag LOCUS_14680 10273 9458 CDS product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681717.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence49 382 1236 gene locus_tag LOCUS_14690 382 1236 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_14690 2744 1335 gene locus_tag LOCUS_14700 2744 1335 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_14700 3012 3794 gene locus_tag LOCUS_14710 3012 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4857 3868 gene locus_tag LOCUS_14720 4857 3868 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_14720 5050 5355 gene locus_tag LOCUS_14730 gene rplU 5050 5355 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_14730 5367 5696 gene locus_tag LOCUS_14740 5367 5696 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048022.1 protein_id gnl|my_center|LOCUS_14740 5699 5989 gene locus_tag LOCUS_14750 gene rpmA 5699 5989 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_14750 6303 6160 gene locus_tag LOCUS_14760 6303 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 6533 7111 gene locus_tag LOCUS_14770 6533 7111 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_14770 7285 8337 gene locus_tag LOCUS_14780 gene ispG 7285 8337 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence50 1926 529 gene locus_tag LOCUS_14790 1926 529 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_14790 2394 2804 gene locus_tag LOCUS_14800 2394 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_14800 2979 3995 gene locus_tag LOCUS_14810 gene plsX 2979 3995 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_14810 4124 4345 gene locus_tag LOCUS_14820 gene acpP 4124 4345 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_14820 4578 5288 gene locus_tag LOCUS_14830 gene rnc 4578 5288 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_14830 5364 8921 gene locus_tag LOCUS_14840 gene smc 5364 8921 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965058.1 protein_id gnl|my_center|LOCUS_14840 8967 10319 gene locus_tag LOCUS_14850 8967 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence51 608 3040 gene locus_tag LOCUS_14860 608 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4306 3125 gene locus_tag LOCUS_14870 4306 3125 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_14870 5106 4321 gene locus_tag LOCUS_14880 gene etfB 5106 4321 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_14880 6262 5123 gene locus_tag LOCUS_14890 6262 5123 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965998.1 protein_id gnl|my_center|LOCUS_14890 8551 6689 gene locus_tag LOCUS_14900 8551 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 8913 8692 gene locus_tag LOCUS_14910 8913 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 9376 9020 gene locus_tag LOCUS_14920 9376 9020 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence52 464 754 gene locus_tag LOCUS_14930 464 754 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460321.1 protein_id gnl|my_center|LOCUS_14930 751 1698 gene locus_tag LOCUS_14940 751 1698 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393143.1 protein_id gnl|my_center|LOCUS_14940 1996 1796 gene locus_tag LOCUS_14950 gene rpmE 1996 1796 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421397.1 protein_id gnl|my_center|LOCUS_14950 2718 2185 gene locus_tag LOCUS_14960 2718 2185 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_14960 4114 2933 gene locus_tag LOCUS_14970 4114 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5493 4408 gene locus_tag LOCUS_14980 gene rpoD 5493 4408 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_14980 7403 5613 gene locus_tag LOCUS_14990 gene dnaG 7403 5613 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_14990 8129 7656 gene locus_tag LOCUS_15000 8129 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 8921 8199 gene locus_tag LOCUS_15010 8921 8199 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence53 405 824 gene locus_tag LOCUS_15020 405 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 821 1135 gene locus_tag LOCUS_15030 821 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1326 2153 gene locus_tag LOCUS_15040 1326 2153 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_15040 2199 3239 gene locus_tag LOCUS_15050 gene kdd 2199 3239 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_15050 3483 4751 gene locus_tag LOCUS_15060 gene ablA 3483 4751 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_15060 4921 6483 gene locus_tag LOCUS_15070 4921 6483 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_15070 6483 7271 gene locus_tag LOCUS_15080 6483 7271 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_15080 7521 8429 gene locus_tag LOCUS_15090 gene glsA 7521 8429 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399984.1 protein_id gnl|my_center|LOCUS_15090 9290 8565 gene locus_tag LOCUS_15100 9290 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 9816 9418 gene locus_tag LOCUS_15110 9816 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence54 119 265 gene locus_tag LOCUS_15120 gene scfA 119 265 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_15120 414 1841 gene locus_tag LOCUS_15130 gene scfB 414 1841 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_15130 1879 3288 gene locus_tag LOCUS_15140 1879 3288 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 protein_id gnl|my_center|LOCUS_15140 3430 3996 gene locus_tag LOCUS_15150 3430 3996 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 protein_id gnl|my_center|LOCUS_15150 3996 5159 gene locus_tag LOCUS_15160 gene tgt 3996 5159 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_15160 5313 5780 gene locus_tag LOCUS_15170 5313 5780 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_15170 6001 6450 gene locus_tag LOCUS_15180 6001 6450 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837262.1 protein_id gnl|my_center|LOCUS_15180 7493 6549 gene locus_tag LOCUS_15190 7493 6549 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_15190 8910 7525 gene locus_tag LOCUS_15200 gene murC 8910 7525 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence55 334 1191 gene locus_tag LOCUS_15210 334 1191 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_15210 2242 1268 gene locus_tag LOCUS_15220 2242 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3480 2314 gene locus_tag LOCUS_15230 gene thiI 3480 2314 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_15230 4682 3546 gene locus_tag LOCUS_15240 4682 3546 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_15240 7811 4857 gene locus_tag LOCUS_15250 7811 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 8005 8787 gene locus_tag LOCUS_15260 gene yunB 8005 8787 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence56 181 621 gene locus_tag LOCUS_15270 181 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 702 1121 gene locus_tag LOCUS_15280 702 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1379 2809 gene locus_tag LOCUS_15290 1379 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2848 3207 gene locus_tag LOCUS_15300 2848 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3332 4447 gene locus_tag LOCUS_15310 3332 4447 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_15310 4444 4953 gene locus_tag LOCUS_15320 4444 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4943 5611 gene locus_tag LOCUS_15330 4943 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 6078 6512 gene locus_tag LOCUS_15340 6078 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 6604 7011 gene locus_tag LOCUS_15350 6604 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7068 7409 gene locus_tag LOCUS_15360 7068 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 7422 7811 gene locus_tag LOCUS_15370 7422 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 7837 8475 gene locus_tag LOCUS_15380 7837 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence57 797 444 gene locus_tag LOCUS_15390 797 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1555 902 gene locus_tag LOCUS_15400 1555 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2462 1557 gene locus_tag LOCUS_15410 2462 1557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_15410 2903 3649 gene locus_tag LOCUS_15420 gene pnuC 2903 3649 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992863.1 protein_id gnl|my_center|LOCUS_15420 5609 3870 gene locus_tag LOCUS_15430 5609 3870 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_15430 6042 6284 gene locus_tag LOCUS_15440 6042 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 6297 6536 gene locus_tag LOCUS_15450 6297 6536 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438891.1 protein_id gnl|my_center|LOCUS_15450 6548 7135 gene locus_tag LOCUS_15460 6548 7135 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948863.1 protein_id gnl|my_center|LOCUS_15460 8560 8174 gene locus_tag LOCUS_15470 8560 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence58 1121 378 gene locus_tag LOCUS_15480 1121 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3055 1250 gene locus_tag LOCUS_15490 3055 1250 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_15490 3335 4285 gene locus_tag LOCUS_15500 3335 4285 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837212.1 protein_id gnl|my_center|LOCUS_15500 4553 5428 gene locus_tag LOCUS_15510 gene noc 4553 5428 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254588.1 protein_id gnl|my_center|LOCUS_15510 7510 5705 gene locus_tag LOCUS_15520 7510 5705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012914013.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence59 1757 312 gene locus_tag LOCUS_15530 1757 312 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_15530 3143 2124 gene locus_tag LOCUS_15540 3143 2124 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680378.1 protein_id gnl|my_center|LOCUS_15540 3770 3168 gene locus_tag LOCUS_15550 3770 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5493 3802 gene locus_tag LOCUS_15560 5493 3802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_15560 5880 5656 gene locus_tag LOCUS_15570 5880 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 6269 7663 gene locus_tag LOCUS_15580 6269 7663 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence60 <1 629 gene locus_tag LOCUS_15590 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861460.1:DUF3810 domain-containing protein 824 3037 gene locus_tag LOCUS_15600 824 3037 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_15600 3105 3764 gene locus_tag LOCUS_15610 3105 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3815 4312 gene locus_tag LOCUS_15620 gene rimI 3815 4312 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_15620 4422 4802 gene locus_tag LOCUS_15630 4422 4802 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_15630 4924 6507 gene locus_tag LOCUS_15640 4924 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 6504 7481 gene locus_tag LOCUS_15650 gene holA 6504 7481 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence61 2437 3189 gene locus_tag LOCUS_15660 gene rpsB 2437 3189 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_15660 3346 4233 gene locus_tag LOCUS_15670 gene tsf 3346 4233 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_15670 4496 5851 gene locus_tag LOCUS_15680 4496 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 5848 7122 gene locus_tag LOCUS_15690 5848 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 7125 7520 gene locus_tag LOCUS_15700 7125 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence62 1454 2209 gene locus_tag LOCUS_15710 1454 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2594 2394 gene locus_tag LOCUS_15720 2594 2394 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_15720 4294 2678 gene locus_tag LOCUS_15730 4294 2678 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_15730 6901 4496 gene locus_tag LOCUS_15740 gene malP 6901 4496 CDS product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence63 334 996 gene locus_tag LOCUS_15750 gene cas5c 334 996 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_15750 993 2837 gene locus_tag LOCUS_15760 gene cas8c 993 2837 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_15760 2840 3745 gene locus_tag LOCUS_15770 gene cas7c 2840 3745 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_15770 3742 4401 gene locus_tag LOCUS_15780 gene cas4 3742 4401 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_15780 4401 5432 gene locus_tag LOCUS_15790 gene cas1c 4401 5432 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_15790 5463 5753 gene locus_tag LOCUS_15800 gene cas2 5463 5753 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence64 442 1302 gene locus_tag LOCUS_15810 442 1302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_15810 1313 2605 gene locus_tag LOCUS_15820 1313 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2598 3638 gene locus_tag LOCUS_15830 2598 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3686 4672 gene locus_tag LOCUS_15840 3686 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4675 5571 gene locus_tag LOCUS_15850 4675 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence65 93 1 gene locus_tag LOCUS_t00370 93 1 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 205 117 gene locus_tag LOCUS_t00380 205 117 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2482 383 gene locus_tag LOCUS_15860 2482 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2853 2479 gene locus_tag LOCUS_15870 2853 2479 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_15870 3721 3341 gene locus_tag LOCUS_15880 3721 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 4427 4708 gene locus_tag LOCUS_15890 4427 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 4701 5111 gene locus_tag LOCUS_15900 4701 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence66 1293 346 gene locus_tag LOCUS_15910 1293 346 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_15910 2162 1290 gene locus_tag LOCUS_15920 2162 1290 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_15920 2932 2231 gene locus_tag LOCUS_15930 2932 2231 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_15930 3286 3035 gene locus_tag LOCUS_15940 3286 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 4460 3660 gene locus_tag LOCUS_15950 4460 3660 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_15950 4765 4505 gene locus_tag LOCUS_15960 4765 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666892.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence67 1843 401 gene locus_tag LOCUS_15970 1843 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2331 3902 gene locus_tag LOCUS_15980 2331 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence68 852 373 gene locus_tag LOCUS_15990 gene rlmH 852 373 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_15990 1707 928 gene locus_tag LOCUS_16000 1707 928 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence69 370 158 gene locus_tag LOCUS_16010 370 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1584 625 gene locus_tag LOCUS_16020 1584 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1946 2086 gene locus_tag LOCUS_16030 1946 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2349 2810 gene locus_tag LOCUS_16040 2349 2810 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762311.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence70 <1 1240 gene locus_tag LOCUS_16050 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021361993.1:coproporphyrinogen III oxidase