>Feature sequence001 1530 718 gene locus_tag LOCUS_00010 1530 718 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_00010 2649 1558 gene locus_tag LOCUS_00020 2649 1558 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896132.1 protein_id gnl|my_center|LOCUS_00020 3481 2639 gene locus_tag LOCUS_00030 3481 2639 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419210.1 protein_id gnl|my_center|LOCUS_00030 4172 3483 gene locus_tag LOCUS_00040 4172 3483 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438150.1 protein_id gnl|my_center|LOCUS_00040 5063 4200 gene locus_tag LOCUS_00050 5063 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6226 5105 gene locus_tag LOCUS_00060 gene steA 6226 5105 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428389.1 protein_id gnl|my_center|LOCUS_00060 7935 6247 gene locus_tag LOCUS_00070 gene recN 7935 6247 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_00070 8851 7949 gene locus_tag LOCUS_00080 8851 7949 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_00080 10802 8862 gene locus_tag LOCUS_00090 gene dxs 10802 8862 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861141.1 protein_id gnl|my_center|LOCUS_00090 11250 10819 gene locus_tag LOCUS_00100 11250 10819 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428407.1 protein_id gnl|my_center|LOCUS_00100 12164 11274 gene locus_tag LOCUS_00110 12164 11274 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_00110 12448 12230 gene locus_tag LOCUS_00120 gene xseB 12448 12230 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428410.1 protein_id gnl|my_center|LOCUS_00120 13670 12480 gene locus_tag LOCUS_00130 gene xseA 13670 12480 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438130.1 protein_id gnl|my_center|LOCUS_00130 13903 14361 gene locus_tag LOCUS_00140 13903 14361 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_00140 14430 14954 gene locus_tag LOCUS_00150 gene dcd 14430 14954 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_00150 16078 15071 gene locus_tag LOCUS_00160 16078 15071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17178 16114 gene locus_tag LOCUS_00170 17178 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17731 17243 gene locus_tag LOCUS_00180 17731 17243 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705019.1 protein_id gnl|my_center|LOCUS_00180 18025 17768 gene locus_tag LOCUS_00190 18025 17768 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359402.1 protein_id gnl|my_center|LOCUS_00190 18181 18666 gene locus_tag LOCUS_00200 18181 18666 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965409.1 protein_id gnl|my_center|LOCUS_00200 19216 18794 gene locus_tag LOCUS_00210 19216 18794 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 protein_id gnl|my_center|LOCUS_00210 19437 19832 gene locus_tag LOCUS_00220 19437 19832 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860716.1 protein_id gnl|my_center|LOCUS_00220 19850 20263 gene locus_tag LOCUS_00230 19850 20263 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_00230 20299 21561 gene locus_tag LOCUS_00240 20299 21561 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187603.1 protein_id gnl|my_center|LOCUS_00240 22660 21665 gene locus_tag LOCUS_00250 gene ansA 22660 21665 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_00250 23077 22661 gene locus_tag LOCUS_00260 23077 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24964 23288 gene locus_tag LOCUS_00270 24964 23288 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_00270 25194 25682 gene locus_tag LOCUS_00280 25194 25682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25699 25920 gene locus_tag LOCUS_00290 25699 25920 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_00290 26558 26130 gene locus_tag LOCUS_00300 26558 26130 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_00300 27157 26573 gene locus_tag LOCUS_00310 27157 26573 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_00310 27536 28753 gene locus_tag LOCUS_00320 27536 28753 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_00320 30718 28850 gene locus_tag LOCUS_00330 30718 28850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31255 30815 gene locus_tag LOCUS_00340 31255 30815 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 protein_id gnl|my_center|LOCUS_00340 32200 31274 gene locus_tag LOCUS_00350 32200 31274 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986890.1 protein_id gnl|my_center|LOCUS_00350 33315 32452 gene locus_tag LOCUS_00360 33315 32452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35942 33723 gene locus_tag LOCUS_00370 35942 33723 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860727.1 protein_id gnl|my_center|LOCUS_00370 36413 35955 gene locus_tag LOCUS_00380 36413 35955 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_00380 38482 36725 gene locus_tag LOCUS_00390 38482 36725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_00390 38933 38469 gene locus_tag LOCUS_00400 38933 38469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40633 38945 gene locus_tag LOCUS_00410 40633 38945 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_00410 41432 40626 gene locus_tag LOCUS_00420 41432 40626 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297012.1 protein_id gnl|my_center|LOCUS_00420 41940 41422 gene locus_tag LOCUS_00430 41940 41422 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_00430 42388 41996 gene locus_tag LOCUS_00440 gene mscL 42388 41996 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728855.1 protein_id gnl|my_center|LOCUS_00440 44286 42490 gene locus_tag LOCUS_00450 44286 42490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_00450 45243 44305 gene locus_tag LOCUS_00460 45243 44305 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_00460 45648 45454 gene locus_tag LOCUS_00470 45648 45454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 45960 46559 gene locus_tag LOCUS_00480 45960 46559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 47851 46721 gene locus_tag LOCUS_00490 47851 46721 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986923.1 protein_id gnl|my_center|LOCUS_00490 48614 47865 gene locus_tag LOCUS_00500 48614 47865 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405093.1 protein_id gnl|my_center|LOCUS_00500 49155 50582 gene locus_tag LOCUS_00510 49155 50582 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485281.1 protein_id gnl|my_center|LOCUS_00510 50904 52943 gene locus_tag LOCUS_00520 50904 52943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 54894 53029 gene locus_tag LOCUS_00530 54894 53029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_00530 56620 54884 gene locus_tag LOCUS_00540 56620 54884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_00540 57584 57024 gene locus_tag LOCUS_00550 57584 57024 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_00550 58845 57991 gene locus_tag LOCUS_00560 58845 57991 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_00560 60190 59141 gene locus_tag LOCUS_00570 60190 59141 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922574.1 protein_id gnl|my_center|LOCUS_00570 61453 60479 gene locus_tag LOCUS_00580 61453 60479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 >Feature sequence002 1293 1018 gene locus_tag LOCUS_00590 1293 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 1607 1416 gene locus_tag LOCUS_00600 1607 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 1791 1600 gene locus_tag LOCUS_00610 1791 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2258 1827 gene locus_tag LOCUS_00620 2258 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 2463 2263 gene locus_tag LOCUS_00630 2463 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2806 2609 gene locus_tag LOCUS_00640 2806 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 2960 3340 gene locus_tag LOCUS_00650 2960 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 3364 3978 gene locus_tag LOCUS_00660 3364 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4051 4560 gene locus_tag LOCUS_00670 4051 4560 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583652.1 protein_id gnl|my_center|LOCUS_00670 4580 6289 gene locus_tag LOCUS_00680 4580 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6519 6301 gene locus_tag LOCUS_00690 6519 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 8000 7134 gene locus_tag LOCUS_00700 8000 7134 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429405.1 protein_id gnl|my_center|LOCUS_00700 9460 8024 gene locus_tag LOCUS_00710 9460 8024 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896350.1 protein_id gnl|my_center|LOCUS_00710 9715 10392 gene locus_tag LOCUS_00720 9715 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 10931 10593 gene locus_tag LOCUS_00730 10931 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 11797 11057 gene locus_tag LOCUS_00740 11797 11057 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_00740 12662 11910 gene locus_tag LOCUS_00750 12662 11910 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436409.1 protein_id gnl|my_center|LOCUS_00750 13355 12780 gene locus_tag LOCUS_00760 13355 12780 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419819.1 protein_id gnl|my_center|LOCUS_00760 14352 13366 gene locus_tag LOCUS_00770 14352 13366 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861205.1 protein_id gnl|my_center|LOCUS_00770 15006 14452 gene locus_tag LOCUS_00780 15006 14452 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861206.1 protein_id gnl|my_center|LOCUS_00780 15836 15036 gene locus_tag LOCUS_00790 15836 15036 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438534.1 protein_id gnl|my_center|LOCUS_00790 17156 15894 gene locus_tag LOCUS_00800 17156 15894 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438532.1 protein_id gnl|my_center|LOCUS_00800 17489 18385 gene locus_tag LOCUS_00810 17489 18385 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429344.1 protein_id gnl|my_center|LOCUS_00810 20668 18470 gene locus_tag LOCUS_00820 20668 18470 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861200.1 protein_id gnl|my_center|LOCUS_00820 22184 20670 gene locus_tag LOCUS_00830 gene glpK 22184 20670 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861192.1 protein_id gnl|my_center|LOCUS_00830 23120 22218 gene locus_tag LOCUS_00840 23120 22218 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_00840 24765 23365 gene locus_tag LOCUS_00850 gene asnS 24765 23365 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_00850 26735 25176 gene locus_tag LOCUS_00860 26735 25176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440234.1 protein_id gnl|my_center|LOCUS_00860 28709 26859 gene locus_tag LOCUS_00870 gene asnB 28709 26859 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566883.1 protein_id gnl|my_center|LOCUS_00870 29020 28805 gene locus_tag LOCUS_00880 29020 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 30017 29316 gene locus_tag LOCUS_00890 30017 29316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 31084 30248 gene locus_tag LOCUS_00900 31084 30248 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775600.1 protein_id gnl|my_center|LOCUS_00900 31670 31077 gene locus_tag LOCUS_00910 31670 31077 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037239.1 protein_id gnl|my_center|LOCUS_00910 32503 31850 gene locus_tag LOCUS_00920 gene fsa 32503 31850 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423115.1 protein_id gnl|my_center|LOCUS_00920 33111 32539 gene locus_tag LOCUS_00930 33111 32539 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454633.1 protein_id gnl|my_center|LOCUS_00930 33283 34782 gene locus_tag LOCUS_00940 33283 34782 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_00940 36578 34935 gene locus_tag LOCUS_00950 36578 34935 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861536.1 protein_id gnl|my_center|LOCUS_00950 36847 37986 gene locus_tag LOCUS_00960 36847 37986 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_00960 38149 39015 gene locus_tag LOCUS_00970 38149 39015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 40573 39179 gene locus_tag LOCUS_00980 40573 39179 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986662.1 protein_id gnl|my_center|LOCUS_00980 42045 40816 gene locus_tag LOCUS_00990 42045 40816 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454690.1 protein_id gnl|my_center|LOCUS_00990 42603 42064 gene locus_tag LOCUS_01000 42603 42064 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454691.1 protein_id gnl|my_center|LOCUS_01000 43476 42607 gene locus_tag LOCUS_01010 43476 42607 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_01010 45702 43477 gene locus_tag LOCUS_01020 45702 43477 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861544.1 protein_id gnl|my_center|LOCUS_01020 47416 46013 gene locus_tag LOCUS_01030 gene purF 47416 46013 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_01030 48147 47443 gene locus_tag LOCUS_01040 48147 47443 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_01040 49694 48534 gene locus_tag LOCUS_01050 gene nagA 49694 48534 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775571.1 protein_id gnl|my_center|LOCUS_01050 50589 49753 gene locus_tag LOCUS_01060 50589 49753 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972486.1 protein_id gnl|my_center|LOCUS_01060 51127 50678 gene locus_tag LOCUS_01070 51127 50678 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_01070 52652 51141 gene locus_tag LOCUS_01080 52652 51141 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430454.1 protein_id gnl|my_center|LOCUS_01080 53586 52666 gene locus_tag LOCUS_01090 53586 52666 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654136.1 protein_id gnl|my_center|LOCUS_01090 54356 53658 gene locus_tag LOCUS_01100 54356 53658 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706813.1 protein_id gnl|my_center|LOCUS_01100 54655 55395 gene locus_tag LOCUS_01110 gene nagB 54655 55395 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987104.1 protein_id gnl|my_center|LOCUS_01110 57806 56145 gene locus_tag LOCUS_01120 57806 56145 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_01120 58061 57825 gene locus_tag LOCUS_01130 gene dltC 58061 57825 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861715.1 protein_id gnl|my_center|LOCUS_01130 59350 58196 gene locus_tag LOCUS_01140 gene dltB 59350 58196 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426712.1 protein_id gnl|my_center|LOCUS_01140 60823 59351 gene locus_tag LOCUS_01150 60823 59351 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861716.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence003 60 1847 gene locus_tag LOCUS_01160 gene aspS 60 1847 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_01160 1853 2329 gene locus_tag LOCUS_01170 1853 2329 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454154.1 protein_id gnl|my_center|LOCUS_01170 2421 3389 gene locus_tag LOCUS_01180 gene pta 2421 3389 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067215.1 protein_id gnl|my_center|LOCUS_01180 3504 3914 gene locus_tag LOCUS_01190 3504 3914 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935466.1 protein_id gnl|my_center|LOCUS_01190 4604 4038 gene locus_tag LOCUS_01200 4604 4038 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454155.1 protein_id gnl|my_center|LOCUS_01200 5454 4606 gene locus_tag LOCUS_01210 5454 4606 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422952.1 protein_id gnl|my_center|LOCUS_01210 5672 7123 gene locus_tag LOCUS_01220 5672 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 7542 8021 gene locus_tag LOCUS_01230 7542 8021 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_01230 8047 9090 gene locus_tag LOCUS_01240 8047 9090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_01240 9094 9966 gene locus_tag LOCUS_01250 9094 9966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_01250 9953 10765 gene locus_tag LOCUS_01260 9953 10765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437015.1 protein_id gnl|my_center|LOCUS_01260 10778 11842 gene locus_tag LOCUS_01270 10778 11842 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_01270 12565 15621 gene locus_tag LOCUS_01280 12565 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 15660 17648 gene locus_tag LOCUS_01290 15660 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861657.1 protein_id gnl|my_center|LOCUS_01290 17657 17869 gene locus_tag LOCUS_01300 17657 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 17862 18884 gene locus_tag LOCUS_01310 gene galE 17862 18884 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861656.1 protein_id gnl|my_center|LOCUS_01310 18956 20062 gene locus_tag LOCUS_01320 18956 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 20075 21253 gene locus_tag LOCUS_01330 20075 21253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 21405 22409 gene locus_tag LOCUS_01340 gene asnA 21405 22409 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427105.1 protein_id gnl|my_center|LOCUS_01340 22442 22966 gene locus_tag LOCUS_01350 gene hpt 22442 22966 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_01350 23088 23753 gene locus_tag LOCUS_01360 23088 23753 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_01360 23871 25058 gene locus_tag LOCUS_01370 23871 25058 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_01370 25658 25194 gene locus_tag LOCUS_01380 25658 25194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427085.1 protein_id gnl|my_center|LOCUS_01380 26065 26862 gene locus_tag LOCUS_01390 26065 26862 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_01390 27401 27012 gene locus_tag LOCUS_01400 27401 27012 CDS product DUF4418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808181.1 protein_id gnl|my_center|LOCUS_01400 27561 28778 gene locus_tag LOCUS_01410 27561 28778 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460255.1 protein_id gnl|my_center|LOCUS_01410 28771 29469 gene locus_tag LOCUS_01420 28771 29469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431374.1 protein_id gnl|my_center|LOCUS_01420 29625 30323 gene locus_tag LOCUS_01430 gene ydjY 29625 30323 CDS product lipoprotein YdjY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939212.1 protein_id gnl|my_center|LOCUS_01430 30337 30720 gene locus_tag LOCUS_01440 30337 30720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 31024 31476 gene locus_tag LOCUS_01450 31024 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 31497 32756 gene locus_tag LOCUS_01460 31497 32756 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_01460 32781 34076 gene locus_tag LOCUS_01470 32781 34076 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_01470 34107 34844 gene locus_tag LOCUS_01480 gene lgt 34107 34844 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_01480 34834 35769 gene locus_tag LOCUS_01490 gene rsmH 34834 35769 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_01490 35828 37246 gene locus_tag LOCUS_01500 35828 37246 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 protein_id gnl|my_center|LOCUS_01500 37239 38204 gene locus_tag LOCUS_01510 gene mraY 37239 38204 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_01510 38495 38680 gene locus_tag LOCUS_01520 38495 38680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 39017 40390 gene locus_tag LOCUS_01530 gene murD 39017 40390 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_01530 40395 41510 gene locus_tag LOCUS_01540 gene murG 40395 41510 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_01540 41656 42816 gene locus_tag LOCUS_01550 gene ftsZ 41656 42816 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890867.1 protein_id gnl|my_center|LOCUS_01550 42892 43362 gene locus_tag LOCUS_01560 gene nrdR 42892 43362 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454958.1 protein_id gnl|my_center|LOCUS_01560 43352 44131 gene locus_tag LOCUS_01570 gene pgeF 43352 44131 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897820.1 protein_id gnl|my_center|LOCUS_01570 44134 45459 gene locus_tag LOCUS_01580 gene der 44134 45459 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_01580 45475 46110 gene locus_tag LOCUS_01590 gene plsY 45475 46110 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_01590 46145 47155 gene locus_tag LOCUS_01600 46145 47155 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_01600 47315 48013 gene locus_tag LOCUS_01610 47315 48013 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_01610 48070 48558 gene locus_tag LOCUS_01620 48070 48558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 48586 48843 gene locus_tag LOCUS_01630 48586 48843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 48858 49643 gene locus_tag LOCUS_01640 48858 49643 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_01640 49670 50320 gene locus_tag LOCUS_01650 49670 50320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 50734 53859 gene locus_tag LOCUS_01660 gene ileS 50734 53859 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_01660 54080 55873 gene locus_tag LOCUS_01670 54080 55873 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861177.1 protein_id gnl|my_center|LOCUS_01670 56885 56076 gene locus_tag LOCUS_01680 56885 56076 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_01680 57174 57632 gene locus_tag LOCUS_01690 57174 57632 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419561.1 protein_id gnl|my_center|LOCUS_01690 58939 57740 gene locus_tag LOCUS_01700 58939 57740 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_01700 >Feature sequence004 1473 667 gene locus_tag LOCUS_01710 1473 667 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_01710 2500 1490 gene locus_tag LOCUS_01720 2500 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 3748 2600 gene locus_tag LOCUS_01730 gene rpoD 3748 2600 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861220.1 protein_id gnl|my_center|LOCUS_01730 5656 3764 gene locus_tag LOCUS_01740 gene dnaG 5656 3764 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_01740 6754 5801 gene locus_tag LOCUS_01750 6754 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438621.1 protein_id gnl|my_center|LOCUS_01750 9733 6932 gene locus_tag LOCUS_01760 9733 6932 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905759.1 protein_id gnl|my_center|LOCUS_01760 10616 9717 gene locus_tag LOCUS_01770 10616 9717 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831939.1 protein_id gnl|my_center|LOCUS_01770 12068 10728 gene locus_tag LOCUS_01780 12068 10728 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_01780 13643 12192 gene locus_tag LOCUS_01790 13643 12192 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430278.1 protein_id gnl|my_center|LOCUS_01790 14338 13643 gene locus_tag LOCUS_01800 14338 13643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896932.1 protein_id gnl|my_center|LOCUS_01800 15721 14366 gene locus_tag LOCUS_01810 15721 14366 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439536.1 protein_id gnl|my_center|LOCUS_01810 16884 15733 gene locus_tag LOCUS_01820 16884 15733 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_01820 18086 16908 gene locus_tag LOCUS_01830 18086 16908 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_01830 19322 18099 gene locus_tag LOCUS_01840 19322 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 20165 19500 gene locus_tag LOCUS_01850 20165 19500 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423753.1 protein_id gnl|my_center|LOCUS_01850 20886 20269 gene locus_tag LOCUS_01860 20886 20269 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430270.1 protein_id gnl|my_center|LOCUS_01860 21699 20905 gene locus_tag LOCUS_01870 21699 20905 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439548.1 protein_id gnl|my_center|LOCUS_01870 23369 22185 gene locus_tag LOCUS_01880 23369 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861333.1 protein_id gnl|my_center|LOCUS_01880 27890 23589 gene locus_tag LOCUS_01890 27890 23589 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861332.1 protein_id gnl|my_center|LOCUS_01890 29300 28284 gene locus_tag LOCUS_01900 gene gap 29300 28284 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861329.1 protein_id gnl|my_center|LOCUS_01900 29565 30704 gene locus_tag LOCUS_01910 29565 30704 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_01910 31446 30880 gene locus_tag LOCUS_01920 31446 30880 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334933.1 protein_id gnl|my_center|LOCUS_01920 31953 31459 gene locus_tag LOCUS_01930 31953 31459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 33922 31946 gene locus_tag LOCUS_01940 gene ftsH 33922 31946 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428619.1 protein_id gnl|my_center|LOCUS_01940 34787 33924 gene locus_tag LOCUS_01950 34787 33924 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_01950 35409 34789 gene locus_tag LOCUS_01960 35409 34789 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 protein_id gnl|my_center|LOCUS_01960 36077 35412 gene locus_tag LOCUS_01970 gene cmk 36077 35412 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_01970 37549 36212 gene locus_tag LOCUS_01980 37549 36212 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439456.1 protein_id gnl|my_center|LOCUS_01980 38205 37552 gene locus_tag LOCUS_01990 38205 37552 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439458.1 protein_id gnl|my_center|LOCUS_01990 39148 38273 gene locus_tag LOCUS_02000 39148 38273 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424273.1 protein_id gnl|my_center|LOCUS_02000 39830 39270 gene locus_tag LOCUS_02010 39830 39270 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424276.1 protein_id gnl|my_center|LOCUS_02010 40592 39858 gene locus_tag LOCUS_02020 40592 39858 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 protein_id gnl|my_center|LOCUS_02020 41371 40673 gene locus_tag LOCUS_02030 41371 40673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 42956 41565 gene locus_tag LOCUS_02040 gene gltA 42956 41565 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420072.1 protein_id gnl|my_center|LOCUS_02040 43849 42956 gene locus_tag LOCUS_02050 43849 42956 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_02050 44305 45159 gene locus_tag LOCUS_02060 44305 45159 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436717.1 protein_id gnl|my_center|LOCUS_02060 45604 46737 gene locus_tag LOCUS_02070 45604 46737 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436742.1 protein_id gnl|my_center|LOCUS_02070 46753 47433 gene locus_tag LOCUS_02080 46753 47433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436744.1 protein_id gnl|my_center|LOCUS_02080 47430 48680 gene locus_tag LOCUS_02090 47430 48680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429753.1 protein_id gnl|my_center|LOCUS_02090 48832 50154 gene locus_tag LOCUS_02100 48832 50154 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_02100 50830 50318 gene locus_tag LOCUS_02110 gene rbr3B 50830 50318 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966861.1 protein_id gnl|my_center|LOCUS_02110 51046 51999 gene locus_tag LOCUS_02120 51046 51999 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896478.1 protein_id gnl|my_center|LOCUS_02120 52558 52124 gene locus_tag LOCUS_02130 52558 52124 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861236.1 protein_id gnl|my_center|LOCUS_02130 52711 53754 gene locus_tag LOCUS_02140 52711 53754 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861235.1 protein_id gnl|my_center|LOCUS_02140 54836 54003 gene locus_tag LOCUS_02150 54836 54003 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964304.1 protein_id gnl|my_center|LOCUS_02150 55621 54968 gene locus_tag LOCUS_02160 55621 54968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434110.1 protein_id gnl|my_center|LOCUS_02160 56579 55611 gene locus_tag LOCUS_02170 56579 55611 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896423.1 protein_id gnl|my_center|LOCUS_02170 57290 56940 gene locus_tag LOCUS_02180 57290 56940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 57784 58530 gene locus_tag LOCUS_02190 57784 58530 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836996.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence005 <1 886 gene locus_tag LOCUS_02200 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898727.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU 977 1930 gene locus_tag LOCUS_02210 977 1930 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421448.1 protein_id gnl|my_center|LOCUS_02210 2270 3115 gene locus_tag LOCUS_02220 gene thiD 2270 3115 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897554.1 protein_id gnl|my_center|LOCUS_02220 3132 4571 gene locus_tag LOCUS_02230 3132 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 4712 5938 gene locus_tag LOCUS_02240 gene thiC 4712 5938 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015816.1 protein_id gnl|my_center|LOCUS_02240 6164 7561 gene locus_tag LOCUS_02250 6164 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7586 8296 gene locus_tag LOCUS_02260 7586 8296 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_02260 8572 8670 gene locus_tag LOCUS_r00010 8572 8670 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8794 10335 gene locus_tag LOCUS_02270 8794 10335 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861997.1 protein_id gnl|my_center|LOCUS_02270 10506 11195 gene locus_tag LOCUS_02280 10506 11195 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_02280 11360 12298 gene locus_tag LOCUS_02290 11360 12298 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_02290 12298 13185 gene locus_tag LOCUS_02300 12298 13185 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427637.1 protein_id gnl|my_center|LOCUS_02300 13194 13943 gene locus_tag LOCUS_02310 13194 13943 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_02310 13956 14795 gene locus_tag LOCUS_02320 gene rsmI 13956 14795 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_02320 14968 15306 gene locus_tag LOCUS_02330 14968 15306 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132486.1 protein_id gnl|my_center|LOCUS_02330 15321 16013 gene locus_tag LOCUS_02340 15321 16013 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990639.1 protein_id gnl|my_center|LOCUS_02340 16476 17912 gene locus_tag LOCUS_02350 16476 17912 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_02350 17941 18396 gene locus_tag LOCUS_02360 17941 18396 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421494.1 protein_id gnl|my_center|LOCUS_02360 18730 20670 gene locus_tag LOCUS_02370 gene metG 18730 20670 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861995.1 protein_id gnl|my_center|LOCUS_02370 20670 21440 gene locus_tag LOCUS_02380 20670 21440 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_02380 22137 24548 gene locus_tag LOCUS_02390 22137 24548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 24885 27419 gene locus_tag LOCUS_02400 24885 27419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 27682 29259 gene locus_tag LOCUS_02410 27682 29259 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777402.1 protein_id gnl|my_center|LOCUS_02410 29397 30329 gene locus_tag LOCUS_02420 29397 30329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 30414 31337 gene locus_tag LOCUS_02430 30414 31337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 31470 32255 gene locus_tag LOCUS_02440 31470 32255 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027974.1 protein_id gnl|my_center|LOCUS_02440 32295 33197 gene locus_tag LOCUS_02450 gene srtC1 32295 33197 CDS product class C sortase SrtC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529914.1 protein_id gnl|my_center|LOCUS_02450 33516 35939 gene locus_tag LOCUS_02460 33516 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 36211 38766 gene locus_tag LOCUS_02470 36211 38766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 38867 40342 gene locus_tag LOCUS_02480 38867 40342 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777402.1 protein_id gnl|my_center|LOCUS_02480 40636 41328 gene locus_tag LOCUS_02490 40636 41328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 41377 42420 gene locus_tag LOCUS_02500 41377 42420 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850398.1 protein_id gnl|my_center|LOCUS_02500 42604 43515 gene locus_tag LOCUS_02510 42604 43515 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432388.1 protein_id gnl|my_center|LOCUS_02510 43520 45889 gene locus_tag LOCUS_02520 43520 45889 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903701.1 protein_id gnl|my_center|LOCUS_02520 46021 46824 gene locus_tag LOCUS_02530 gene proC 46021 46824 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_02530 47078 48433 gene locus_tag LOCUS_02540 47078 48433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 48749 50713 gene locus_tag LOCUS_02550 48749 50713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 50725 52869 gene locus_tag LOCUS_02560 50725 52869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence006 722 18 gene locus_tag LOCUS_02570 722 18 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850398.1 protein_id gnl|my_center|LOCUS_02570 1985 930 gene locus_tag LOCUS_02580 1985 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4222 2012 gene locus_tag LOCUS_02590 4222 2012 CDS product pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822370.1 protein_id gnl|my_center|LOCUS_02590 12465 4480 gene locus_tag LOCUS_02600 12465 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 13244 13384 gene locus_tag LOCUS_02610 13244 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 13473 13655 gene locus_tag LOCUS_02620 13473 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 15493 13817 gene locus_tag LOCUS_02630 gene ilvB 15493 13817 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436643.1 protein_id gnl|my_center|LOCUS_02630 17154 15505 gene locus_tag LOCUS_02640 gene ilvD 17154 15505 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_02640 18162 17167 gene locus_tag LOCUS_02650 gene ilvC 18162 17167 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861252.1 protein_id gnl|my_center|LOCUS_02650 18521 18276 gene locus_tag LOCUS_02660 18521 18276 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429800.1 protein_id gnl|my_center|LOCUS_02660 19120 19665 gene locus_tag LOCUS_02670 gene hpt 19120 19665 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454045.1 protein_id gnl|my_center|LOCUS_02670 21150 19843 gene locus_tag LOCUS_02680 21150 19843 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021359871.1 protein_id gnl|my_center|LOCUS_02680 21354 21178 gene locus_tag LOCUS_02690 21354 21178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 23276 21489 gene locus_tag LOCUS_02700 gene pepF 23276 21489 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453998.1 protein_id gnl|my_center|LOCUS_02700 23525 24061 gene locus_tag LOCUS_02710 23525 24061 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_02710 26161 24158 gene locus_tag LOCUS_02720 26161 24158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 27479 26403 gene locus_tag LOCUS_02730 27479 26403 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435637.1 protein_id gnl|my_center|LOCUS_02730 28907 27558 gene locus_tag LOCUS_02740 28907 27558 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_02740 30667 29069 gene locus_tag LOCUS_02750 30667 29069 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_02750 31150 30779 gene locus_tag LOCUS_02760 31150 30779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417144.1 protein_id gnl|my_center|LOCUS_02760 32235 31162 gene locus_tag LOCUS_02770 32235 31162 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373757.1 protein_id gnl|my_center|LOCUS_02770 32895 32434 gene locus_tag LOCUS_02780 32895 32434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 34448 32943 gene locus_tag LOCUS_02790 34448 32943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 34947 34531 gene locus_tag LOCUS_02800 34947 34531 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891768.1 protein_id gnl|my_center|LOCUS_02800 36019 34967 gene locus_tag LOCUS_02810 36019 34967 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891769.1 protein_id gnl|my_center|LOCUS_02810 37226 35988 gene locus_tag LOCUS_02820 37226 35988 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435622.1 protein_id gnl|my_center|LOCUS_02820 38159 37530 gene locus_tag LOCUS_02830 gene yihA 38159 37530 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_02830 40701 38185 gene locus_tag LOCUS_02840 gene lon 40701 38185 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_02840 42473 41019 gene locus_tag LOCUS_02850 42473 41019 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_02850 44444 42744 gene locus_tag LOCUS_02860 gene argS 44444 42744 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_02860 45061 44609 gene locus_tag LOCUS_02870 45061 44609 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860931.1 protein_id gnl|my_center|LOCUS_02870 47531 45108 gene locus_tag LOCUS_02880 47531 45108 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_02880 47853 49298 gene locus_tag LOCUS_02890 47853 49298 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436882.1 protein_id gnl|my_center|LOCUS_02890 <50184 49380 gene locus_tag LOCUS_02900 <50184 49380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438997.1:DegV family protein >Feature sequence007 2395 875 gene locus_tag LOCUS_02910 gene lysS 2395 875 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_02910 2897 2412 gene locus_tag LOCUS_02920 gene greA 2897 2412 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_02920 3907 2942 gene locus_tag LOCUS_02930 gene dusB 3907 2942 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_02930 4782 4015 gene locus_tag LOCUS_02940 4782 4015 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_02940 5113 6096 gene locus_tag LOCUS_02950 5113 6096 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903819.1 protein_id gnl|my_center|LOCUS_02950 6752 6189 gene locus_tag LOCUS_02960 6752 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 7220 6777 gene locus_tag LOCUS_02970 7220 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 7761 7213 gene locus_tag LOCUS_02980 7761 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 8179 7775 gene locus_tag LOCUS_02990 8179 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 10679 8334 gene locus_tag LOCUS_03000 10679 8334 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_03000 11166 10681 gene locus_tag LOCUS_03010 11166 10681 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_03010 12053 11169 gene locus_tag LOCUS_03020 12053 11169 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_03020 13544 12453 gene locus_tag LOCUS_03030 13544 12453 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_03030 14282 13599 gene locus_tag LOCUS_03040 gene modB 14282 13599 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_03040 15202 14333 gene locus_tag LOCUS_03050 gene modA 15202 14333 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090881.1 protein_id gnl|my_center|LOCUS_03050 16177 15242 gene locus_tag LOCUS_03060 16177 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 17185 16199 gene locus_tag LOCUS_03070 gene moaA 17185 16199 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371204.1 protein_id gnl|my_center|LOCUS_03070 17646 17173 gene locus_tag LOCUS_03080 gene moaC 17646 17173 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_03080 18747 17701 gene locus_tag LOCUS_03090 18747 17701 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_03090 19762 18734 gene locus_tag LOCUS_03100 19762 18734 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_03100 20342 19764 gene locus_tag LOCUS_03110 gene cobC 20342 19764 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812873.1 protein_id gnl|my_center|LOCUS_03110 21294 20350 gene locus_tag LOCUS_03120 21294 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 23412 21490 gene locus_tag LOCUS_03130 gene ftsH 23412 21490 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_03130 24811 23432 gene locus_tag LOCUS_03140 gene tilS 24811 23432 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_03140 25259 24813 gene locus_tag LOCUS_03150 25259 24813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 26073 25267 gene locus_tag LOCUS_03160 gene murI 26073 25267 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_03160 27017 26085 gene locus_tag LOCUS_03170 gene ispE 27017 26085 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_03170 27420 27163 gene locus_tag LOCUS_03180 27420 27163 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892135.1 protein_id gnl|my_center|LOCUS_03180 28017 27523 gene locus_tag LOCUS_03190 28017 27523 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_03190 28869 28144 gene locus_tag LOCUS_03200 28869 28144 CDS product UPF0489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434933.1 protein_id gnl|my_center|LOCUS_03200 29731 29045 gene locus_tag LOCUS_03210 29731 29045 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_03210 30615 29746 gene locus_tag LOCUS_03220 30615 29746 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_03220 30799 31314 gene locus_tag LOCUS_03230 30799 31314 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403076.1 protein_id gnl|my_center|LOCUS_03230 31946 31383 gene locus_tag LOCUS_03240 31946 31383 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902004.1 protein_id gnl|my_center|LOCUS_03240 34710 32035 gene locus_tag LOCUS_03250 34710 32035 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721496.1 protein_id gnl|my_center|LOCUS_03250 35986 34934 gene locus_tag LOCUS_03260 35986 34934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 36851 36240 gene locus_tag LOCUS_03270 gene cysE 36851 36240 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889486.1 protein_id gnl|my_center|LOCUS_03270 37776 36889 gene locus_tag LOCUS_03280 gene cysK 37776 36889 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436514.1 protein_id gnl|my_center|LOCUS_03280 38043 38441 gene locus_tag LOCUS_03290 38043 38441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 39093 38449 gene locus_tag LOCUS_03300 39093 38449 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817367.1 protein_id gnl|my_center|LOCUS_03300 42495 39274 gene locus_tag LOCUS_03310 gene carB 42495 39274 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_03310 43574 42525 gene locus_tag LOCUS_03320 gene carA 43574 42525 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_03320 44307 43588 gene locus_tag LOCUS_03330 gene pyrF 44307 43588 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435818.1 protein_id gnl|my_center|LOCUS_03330 44848 45138 gene locus_tag LOCUS_03340 44848 45138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 45965 45267 gene locus_tag LOCUS_03350 45965 45267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_03350 48490 46289 gene locus_tag LOCUS_03360 48490 46289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 48696 48487 gene locus_tag LOCUS_03370 48696 48487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 49738 48740 gene locus_tag LOCUS_03380 49738 48740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence008 938 291 gene locus_tag LOCUS_03390 gene sigH 938 291 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966312.1 protein_id gnl|my_center|LOCUS_03390 1526 963 gene locus_tag LOCUS_03400 1526 963 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421194.1 protein_id gnl|my_center|LOCUS_03400 2226 1492 gene locus_tag LOCUS_03410 gene rlmB 2226 1492 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_03410 2678 2238 gene locus_tag LOCUS_03420 2678 2238 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_03420 4066 2663 gene locus_tag LOCUS_03430 gene cysS 4066 2663 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_03430 4563 4102 gene locus_tag LOCUS_03440 4563 4102 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422312.1 protein_id gnl|my_center|LOCUS_03440 7082 4587 gene locus_tag LOCUS_03450 7082 4587 CDS product cell wall-binding cysteine protease Cwp13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861325.1 protein_id gnl|my_center|LOCUS_03450 8011 7226 gene locus_tag LOCUS_03460 8011 7226 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964899.1 protein_id gnl|my_center|LOCUS_03460 9618 8023 gene locus_tag LOCUS_03470 9618 8023 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815046.1 protein_id gnl|my_center|LOCUS_03470 9870 10826 gene locus_tag LOCUS_03480 9870 10826 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_03480 12727 10976 gene locus_tag LOCUS_03490 12727 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 13735 12953 gene locus_tag LOCUS_03500 13735 12953 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_03500 14405 13737 gene locus_tag LOCUS_03510 14405 13737 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_03510 15542 14547 gene locus_tag LOCUS_03520 15542 14547 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_03520 15806 16264 gene locus_tag LOCUS_03530 15806 16264 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_03530 16388 16549 gene locus_tag LOCUS_03540 16388 16549 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_03540 16796 17593 gene locus_tag LOCUS_03550 16796 17593 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_03550 17593 18075 gene locus_tag LOCUS_03560 gene rlmH 17593 18075 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_03560 18136 19221 gene locus_tag LOCUS_03570 18136 19221 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429260.1 protein_id gnl|my_center|LOCUS_03570 19230 20216 gene locus_tag LOCUS_03580 19230 20216 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_03580 21969 20635 gene locus_tag LOCUS_03590 gene dnaB 21969 20635 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_03590 22494 22045 gene locus_tag LOCUS_03600 gene rplI 22494 22045 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429267.1 protein_id gnl|my_center|LOCUS_03600 24502 22496 gene locus_tag LOCUS_03610 24502 22496 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_03610 25542 24520 gene locus_tag LOCUS_03620 25542 24520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 25890 25663 gene locus_tag LOCUS_03630 gene rpsR 25890 25663 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420527.1 protein_id gnl|my_center|LOCUS_03630 26349 25912 gene locus_tag LOCUS_03640 gene ssb 26349 25912 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420524.1 protein_id gnl|my_center|LOCUS_03640 26654 26364 gene locus_tag LOCUS_03650 gene rpsF 26654 26364 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_03650 28270 26963 gene locus_tag LOCUS_03660 28270 26963 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860860.1 protein_id gnl|my_center|LOCUS_03660 29010 28267 gene locus_tag LOCUS_03670 29010 28267 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_03670 30173 29145 gene locus_tag LOCUS_03680 30173 29145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 31592 30624 gene locus_tag LOCUS_03690 31592 30624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964818.1 protein_id gnl|my_center|LOCUS_03690 32080 31595 gene locus_tag LOCUS_03700 32080 31595 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964817.1 protein_id gnl|my_center|LOCUS_03700 33335 32346 gene locus_tag LOCUS_03710 33335 32346 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_03710 34446 33547 gene locus_tag LOCUS_03720 34446 33547 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681808.1 protein_id gnl|my_center|LOCUS_03720 35265 34462 gene locus_tag LOCUS_03730 35265 34462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 36722 35526 gene locus_tag LOCUS_03740 36722 35526 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_03740 37018 36839 gene locus_tag LOCUS_03750 37018 36839 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420516.1 protein_id gnl|my_center|LOCUS_03750 37324 37058 gene locus_tag LOCUS_03760 37324 37058 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434250.1 protein_id gnl|my_center|LOCUS_03760 37946 37332 gene locus_tag LOCUS_03770 gene yedF 37946 37332 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892314.1 protein_id gnl|my_center|LOCUS_03770 38295 38927 gene locus_tag LOCUS_03780 38295 38927 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898849.1 protein_id gnl|my_center|LOCUS_03780 38983 40125 gene locus_tag LOCUS_03790 38983 40125 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_03790 40319 40771 gene locus_tag LOCUS_03800 40319 40771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 41039 41227 gene locus_tag LOCUS_03810 41039 41227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 42080 41358 gene locus_tag LOCUS_03820 gene rsmG 42080 41358 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_03820 43967 42081 gene locus_tag LOCUS_03830 gene mnmG 43967 42081 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898858.1 protein_id gnl|my_center|LOCUS_03830 45389 44010 gene locus_tag LOCUS_03840 gene mnmE 45389 44010 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_03840 45755 46294 gene locus_tag LOCUS_03850 45755 46294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 46369 47112 gene locus_tag LOCUS_03860 46369 47112 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860672.1 protein_id gnl|my_center|LOCUS_03860 47458 47213 gene locus_tag LOCUS_03870 47458 47213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence009 524 943 gene locus_tag LOCUS_03880 524 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 940 1536 gene locus_tag LOCUS_03890 940 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435191.1 protein_id gnl|my_center|LOCUS_03890 1554 4160 gene locus_tag LOCUS_03900 gene clpB 1554 4160 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435194.1 protein_id gnl|my_center|LOCUS_03900 4451 5752 gene locus_tag LOCUS_03910 gene brnQ 4451 5752 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902388.1 protein_id gnl|my_center|LOCUS_03910 5989 6933 gene locus_tag LOCUS_03920 gene prmA 5989 6933 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_03920 6944 7732 gene locus_tag LOCUS_03930 6944 7732 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_03930 7763 9067 gene locus_tag LOCUS_03940 gene mtaB 7763 9067 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_03940 9277 9999 gene locus_tag LOCUS_03950 9277 9999 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028427.1 protein_id gnl|my_center|LOCUS_03950 10149 10469 gene locus_tag LOCUS_03960 10149 10469 CDS product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725735.1 protein_id gnl|my_center|LOCUS_03960 10494 10838 gene locus_tag LOCUS_03970 10494 10838 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_03970 10954 11133 gene locus_tag LOCUS_03980 10954 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 11155 11598 gene locus_tag LOCUS_03990 11155 11598 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_03990 11846 13075 gene locus_tag LOCUS_04000 11846 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13275 13826 gene locus_tag LOCUS_04010 gene raiA 13275 13826 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430900.1 protein_id gnl|my_center|LOCUS_04010 14026 15024 gene locus_tag LOCUS_04020 14026 15024 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_04020 15035 15520 gene locus_tag LOCUS_04030 gene ybeY 15035 15520 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_04030 15501 16235 gene locus_tag LOCUS_04040 15501 16235 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416641.1 protein_id gnl|my_center|LOCUS_04040 16308 17210 gene locus_tag LOCUS_04050 gene era 16308 17210 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_04050 17228 18601 gene locus_tag LOCUS_04060 gene mgtE 17228 18601 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432938.1 protein_id gnl|my_center|LOCUS_04060 18656 19393 gene locus_tag LOCUS_04070 gene recO 18656 19393 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_04070 19409 19990 gene locus_tag LOCUS_04080 19409 19990 CDS product DUF4342 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890640.1 protein_id gnl|my_center|LOCUS_04080 20076 20960 gene locus_tag LOCUS_04090 gene glyQ 20076 20960 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416656.1 protein_id gnl|my_center|LOCUS_04090 20953 23016 gene locus_tag LOCUS_04100 gene glyS 20953 23016 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_04100 23470 24450 gene locus_tag LOCUS_04110 23470 24450 CDS product prealbumin-like fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027976.1 protein_id gnl|my_center|LOCUS_04110 24468 25340 gene locus_tag LOCUS_04120 24468 25340 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850398.1 protein_id gnl|my_center|LOCUS_04120 25347 26264 gene locus_tag LOCUS_04130 25347 26264 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027974.1 protein_id gnl|my_center|LOCUS_04130 26339 27238 gene locus_tag LOCUS_04140 26339 27238 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775391.1 protein_id gnl|my_center|LOCUS_04140 27481 28119 gene locus_tag LOCUS_04150 27481 28119 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201447694.1 protein_id gnl|my_center|LOCUS_04150 28165 29004 gene locus_tag LOCUS_04160 28165 29004 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454708.1 protein_id gnl|my_center|LOCUS_04160 29028 31673 gene locus_tag LOCUS_04170 gene ppdK 29028 31673 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861547.1 protein_id gnl|my_center|LOCUS_04170 32030 32407 gene locus_tag LOCUS_04180 32030 32407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 32430 33716 gene locus_tag LOCUS_04190 32430 33716 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948884.1 protein_id gnl|my_center|LOCUS_04190 33730 35025 gene locus_tag LOCUS_04200 gene grdB 33730 35025 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011345263.1 transl_except (pos:34771..34773,aa:Sec) note codon on position 348 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04200 35074 36168 gene locus_tag LOCUS_04210 35074 36168 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425444.1 protein_id gnl|my_center|LOCUS_04210 36451 37137 gene locus_tag LOCUS_04220 36451 37137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 37387 38466 gene locus_tag LOCUS_04230 37387 38466 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099305.1 protein_id gnl|my_center|LOCUS_04230 39269 38766 gene locus_tag LOCUS_04240 39269 38766 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043263.1 protein_id gnl|my_center|LOCUS_04240 40112 39279 gene locus_tag LOCUS_04250 40112 39279 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158612.1 protein_id gnl|my_center|LOCUS_04250 40439 42256 gene locus_tag LOCUS_04260 40439 42256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 42524 43717 gene locus_tag LOCUS_04270 42524 43717 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393411.1 protein_id gnl|my_center|LOCUS_04270 43984 43900 gene locus_tag LOCUS_t00010 43984 43900 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44120 46768 gene locus_tag LOCUS_04280 gene polA 44120 46768 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896068.1 protein_id gnl|my_center|LOCUS_04280 46902 47528 gene locus_tag LOCUS_04290 gene coaE 46902 47528 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438041.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence010 801 1013 gene locus_tag LOCUS_04300 801 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 1029 2201 gene locus_tag LOCUS_04310 1029 2201 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387517.1 protein_id gnl|my_center|LOCUS_04310 2203 3021 gene locus_tag LOCUS_04320 2203 3021 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_04320 3193 4023 gene locus_tag LOCUS_04330 3193 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5167 4139 gene locus_tag LOCUS_04340 5167 4139 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437556.1 protein_id gnl|my_center|LOCUS_04340 5971 5180 gene locus_tag LOCUS_04350 5971 5180 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437555.1 protein_id gnl|my_center|LOCUS_04350 7120 5984 gene locus_tag LOCUS_04360 7120 5984 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437554.1 protein_id gnl|my_center|LOCUS_04360 8514 7261 gene locus_tag LOCUS_04370 gene preA 8514 7261 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_04370 9748 8516 gene locus_tag LOCUS_04380 9748 8516 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987092.1 protein_id gnl|my_center|LOCUS_04380 10150 9761 gene locus_tag LOCUS_04390 10150 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 10623 10168 gene locus_tag LOCUS_04400 10623 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 11832 10639 gene locus_tag LOCUS_04410 11832 10639 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_04410 12397 11906 gene locus_tag LOCUS_04420 12397 11906 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072946.1 protein_id gnl|my_center|LOCUS_04420 13036 14625 gene locus_tag LOCUS_04430 13036 14625 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902485.1 protein_id gnl|my_center|LOCUS_04430 14922 16301 gene locus_tag LOCUS_04440 gene hydA 14922 16301 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047948.1 protein_id gnl|my_center|LOCUS_04440 16540 17817 gene locus_tag LOCUS_04450 16540 17817 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 protein_id gnl|my_center|LOCUS_04450 18439 18750 gene locus_tag LOCUS_04460 18439 18750 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986939.1 protein_id gnl|my_center|LOCUS_04460 18752 20725 gene locus_tag LOCUS_04470 18752 20725 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015806.1 protein_id gnl|my_center|LOCUS_04470 20841 21326 gene locus_tag LOCUS_04480 20841 21326 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904262.1 protein_id gnl|my_center|LOCUS_04480 21372 21917 gene locus_tag LOCUS_04490 21372 21917 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015805.1 protein_id gnl|my_center|LOCUS_04490 21931 22926 gene locus_tag LOCUS_04500 21931 22926 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_04500 22926 23249 gene locus_tag LOCUS_04510 22926 23249 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_04510 23267 25039 gene locus_tag LOCUS_04520 23267 25039 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_04520 25032 26417 gene locus_tag LOCUS_04530 25032 26417 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_04530 26419 27060 gene locus_tag LOCUS_04540 26419 27060 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_04540 28646 27249 gene locus_tag LOCUS_04550 28646 27249 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454160.1 protein_id gnl|my_center|LOCUS_04550 29364 28639 gene locus_tag LOCUS_04560 29364 28639 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_04560 29589 29984 gene locus_tag LOCUS_04570 29589 29984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 30279 30716 gene locus_tag LOCUS_04580 30279 30716 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166793.1 protein_id gnl|my_center|LOCUS_04580 30724 31503 gene locus_tag LOCUS_04590 30724 31503 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_04590 31445 32341 gene locus_tag LOCUS_04600 31445 32341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_04600 32459 32764 gene locus_tag LOCUS_04610 32459 32764 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_04610 32761 33096 gene locus_tag LOCUS_04620 32761 33096 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811035.1 protein_id gnl|my_center|LOCUS_04620 33447 34448 gene locus_tag LOCUS_04630 33447 34448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 34445 35179 gene locus_tag LOCUS_04640 34445 35179 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_04640 35639 35328 gene locus_tag LOCUS_04650 35639 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 36283 37560 gene locus_tag LOCUS_04660 36283 37560 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504787.1 protein_id gnl|my_center|LOCUS_04660 37583 38509 gene locus_tag LOCUS_04670 gene metA 37583 38509 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_04670 38570 39280 gene locus_tag LOCUS_04680 38570 39280 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_04680 39294 41672 gene locus_tag LOCUS_04690 39294 41672 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_04690 41711 43522 gene locus_tag LOCUS_04700 41711 43522 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963614.1 protein_id gnl|my_center|LOCUS_04700 43556 43909 gene locus_tag LOCUS_04710 43556 43909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 44043 45443 gene locus_tag LOCUS_04720 44043 45443 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891344.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence011 <1 568 gene locus_tag LOCUS_04730 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421079.1:HAD-IB family hydrolase 700 1110 gene locus_tag LOCUS_04740 700 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425143.1 protein_id gnl|my_center|LOCUS_04740 1123 1659 gene locus_tag LOCUS_04750 1123 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888171.1 protein_id gnl|my_center|LOCUS_04750 2275 1802 gene locus_tag LOCUS_04760 2275 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2766 2326 gene locus_tag LOCUS_04770 2766 2326 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_04770 3991 2756 gene locus_tag LOCUS_04780 3991 2756 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_04780 4846 4016 gene locus_tag LOCUS_04790 4846 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 6282 4858 gene locus_tag LOCUS_04800 gene sufB 6282 4858 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_04800 7039 6272 gene locus_tag LOCUS_04810 gene sufC 7039 6272 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_04810 8668 7364 gene locus_tag LOCUS_04820 8668 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 8889 9578 gene locus_tag LOCUS_04830 8889 9578 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379825.1 protein_id gnl|my_center|LOCUS_04830 10525 9686 gene locus_tag LOCUS_04840 10525 9686 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_04840 10698 11123 gene locus_tag LOCUS_04850 10698 11123 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_04850 12280 11300 gene locus_tag LOCUS_04860 gene arsS 12280 11300 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986518.1 protein_id gnl|my_center|LOCUS_04860 12638 12297 gene locus_tag LOCUS_04870 12638 12297 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_04870 12993 13931 gene locus_tag LOCUS_04880 12993 13931 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289187.1 protein_id gnl|my_center|LOCUS_04880 13941 14747 gene locus_tag LOCUS_04890 gene aroF 13941 14747 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_04890 14927 15478 gene locus_tag LOCUS_04900 14927 15478 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_04900 16106 15666 gene locus_tag LOCUS_04910 16106 15666 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426576.1 protein_id gnl|my_center|LOCUS_04910 16468 16896 gene locus_tag LOCUS_04920 16468 16896 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020238.1 protein_id gnl|my_center|LOCUS_04920 16980 18359 gene locus_tag LOCUS_04930 16980 18359 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_04930 19766 18531 gene locus_tag LOCUS_04940 19766 18531 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_04940 21060 19768 gene locus_tag LOCUS_04950 21060 19768 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356440.1 protein_id gnl|my_center|LOCUS_04950 21820 21062 gene locus_tag LOCUS_04960 21820 21062 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681412.1 protein_id gnl|my_center|LOCUS_04960 22290 21847 gene locus_tag LOCUS_04970 22290 21847 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_04970 24456 22567 gene locus_tag LOCUS_04980 24456 22567 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494687.1 protein_id gnl|my_center|LOCUS_04980 25474 24563 gene locus_tag LOCUS_04990 gene pfkB 25474 24563 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731860.1 protein_id gnl|my_center|LOCUS_04990 26422 25673 gene locus_tag LOCUS_05000 26422 25673 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957279.1 protein_id gnl|my_center|LOCUS_05000 26646 26470 gene locus_tag LOCUS_05010 26646 26470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 27231 26659 gene locus_tag LOCUS_05020 27231 26659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05020 27566 28291 gene locus_tag LOCUS_05030 27566 28291 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_05030 28902 28360 gene locus_tag LOCUS_05040 28902 28360 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940018.1 protein_id gnl|my_center|LOCUS_05040 30211 29057 gene locus_tag LOCUS_05050 30211 29057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 31377 30280 gene locus_tag LOCUS_05060 gene ychF 31377 30280 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_05060 31705 32214 gene locus_tag LOCUS_05070 31705 32214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 32216 33583 gene locus_tag LOCUS_05080 32216 33583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 33694 34269 gene locus_tag LOCUS_05090 33694 34269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 35618 34593 gene locus_tag LOCUS_05100 35618 34593 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_05100 37294 35798 gene locus_tag LOCUS_05110 37294 35798 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_05110 38005 37304 gene locus_tag LOCUS_05120 38005 37304 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_05120 39239 38022 gene locus_tag LOCUS_05130 39239 38022 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906398.1 protein_id gnl|my_center|LOCUS_05130 40288 39341 gene locus_tag LOCUS_05140 40288 39341 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861474.1 protein_id gnl|my_center|LOCUS_05140 40425 41060 gene locus_tag LOCUS_05150 40425 41060 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_05150 42264 41212 gene locus_tag LOCUS_05160 42264 41212 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_05160 44197 42257 gene locus_tag LOCUS_05170 44197 42257 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454235.1 protein_id gnl|my_center|LOCUS_05170 <45243 44245 gene locus_tag LOCUS_05180 <45243 44245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003418528.1:homocitrate synthase >Feature sequence012 814 11 gene locus_tag LOCUS_05190 814 11 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_05190 1724 807 gene locus_tag LOCUS_05200 1724 807 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_05200 2545 1709 gene locus_tag LOCUS_05210 2545 1709 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_05210 2846 3913 gene locus_tag LOCUS_05220 gene aroB 2846 3913 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_05220 3903 5264 gene locus_tag LOCUS_05230 gene aroA 3903 5264 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896990.1 protein_id gnl|my_center|LOCUS_05230 5236 6309 gene locus_tag LOCUS_05240 gene aroC 5236 6309 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_05240 6495 6803 gene locus_tag LOCUS_05250 6495 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 6881 7537 gene locus_tag LOCUS_05260 6881 7537 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_05260 7823 8809 gene locus_tag LOCUS_05270 7823 8809 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356030.1 protein_id gnl|my_center|LOCUS_05270 8825 9637 gene locus_tag LOCUS_05280 8825 9637 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 protein_id gnl|my_center|LOCUS_05280 9658 10575 gene locus_tag LOCUS_05290 9658 10575 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286670.1 protein_id gnl|my_center|LOCUS_05290 10638 11006 gene locus_tag LOCUS_05300 10638 11006 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699888.1 protein_id gnl|my_center|LOCUS_05300 11022 11996 gene locus_tag LOCUS_05310 gene manA 11022 11996 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_05310 13300 12131 gene locus_tag LOCUS_05320 13300 12131 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767787.1 protein_id gnl|my_center|LOCUS_05320 15174 13300 gene locus_tag LOCUS_05330 15174 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 17286 15460 gene locus_tag LOCUS_05340 gene glmS 17286 15460 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_05340 18047 17580 gene locus_tag LOCUS_05350 18047 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 19942 18521 gene locus_tag LOCUS_05360 19942 18521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 20236 20976 gene locus_tag LOCUS_05370 gene truA 20236 20976 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_05370 21154 22224 gene locus_tag LOCUS_05380 21154 22224 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_05380 22287 23225 gene locus_tag LOCUS_05390 22287 23225 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437082.1 protein_id gnl|my_center|LOCUS_05390 23225 24454 gene locus_tag LOCUS_05400 23225 24454 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437079.1 protein_id gnl|my_center|LOCUS_05400 25518 24565 gene locus_tag LOCUS_05410 25518 24565 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254339.1 protein_id gnl|my_center|LOCUS_05410 25625 25999 gene locus_tag LOCUS_05420 25625 25999 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 protein_id gnl|my_center|LOCUS_05420 26193 27875 gene locus_tag LOCUS_05430 gene ade 26193 27875 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461279.1 protein_id gnl|my_center|LOCUS_05430 28053 28484 gene locus_tag LOCUS_05440 gene rplM 28053 28484 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_05440 28509 28901 gene locus_tag LOCUS_05450 gene rpsI 28509 28901 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421105.1 protein_id gnl|my_center|LOCUS_05450 29411 30136 gene locus_tag LOCUS_05460 29411 30136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 30133 30495 gene locus_tag LOCUS_05470 30133 30495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 30963 31130 gene locus_tag LOCUS_05480 30963 31130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 32661 31360 gene locus_tag LOCUS_05490 32661 31360 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242311.1 protein_id gnl|my_center|LOCUS_05490 33974 32772 gene locus_tag LOCUS_05500 33974 32772 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159687.1 protein_id gnl|my_center|LOCUS_05500 35173 33983 gene locus_tag LOCUS_05510 35173 33983 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_05510 35869 35201 gene locus_tag LOCUS_05520 gene deoC 35869 35201 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_05520 36175 36966 gene locus_tag LOCUS_05530 gene deoR 36175 36966 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171306.1 protein_id gnl|my_center|LOCUS_05530 37080 38318 gene locus_tag LOCUS_05540 37080 38318 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861660.1 protein_id gnl|my_center|LOCUS_05540 38453 39982 gene locus_tag LOCUS_05550 38453 39982 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989914.1 protein_id gnl|my_center|LOCUS_05550 40018 40701 gene locus_tag LOCUS_05560 40018 40701 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_05560 40727 42562 gene locus_tag LOCUS_05570 40727 42562 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164733.1 protein_id gnl|my_center|LOCUS_05570 42946 43155 gene locus_tag LOCUS_05580 42946 43155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence013 2277 187 gene locus_tag LOCUS_05590 gene topA 2277 187 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892959.1 protein_id gnl|my_center|LOCUS_05590 3473 2292 gene locus_tag LOCUS_05600 gene dprA 3473 2292 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438264.1 protein_id gnl|my_center|LOCUS_05600 5289 3691 gene locus_tag LOCUS_05610 5289 3691 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902393.1 protein_id gnl|my_center|LOCUS_05610 5660 5286 gene locus_tag LOCUS_05620 5660 5286 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_05620 6246 5878 gene locus_tag LOCUS_05630 6246 5878 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_05630 7321 6266 gene locus_tag LOCUS_05640 7321 6266 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438242.1 protein_id gnl|my_center|LOCUS_05640 8277 7369 gene locus_tag LOCUS_05650 8277 7369 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_05650 9256 8348 gene locus_tag LOCUS_05660 gene ylqF 9256 8348 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_05660 9673 9320 gene locus_tag LOCUS_05670 gene rplS 9673 9320 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_05670 10662 9814 gene locus_tag LOCUS_05680 10662 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 14354 10638 gene locus_tag LOCUS_05690 14354 10638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05690 16036 14597 gene locus_tag LOCUS_05700 16036 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 16386 17612 gene locus_tag LOCUS_05710 gene tyrS 16386 17612 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_05710 18412 17729 gene locus_tag LOCUS_05720 gene trmD 18412 17729 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_05720 18930 18412 gene locus_tag LOCUS_05730 gene rimM 18930 18412 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_05730 19202 18969 gene locus_tag LOCUS_05740 19202 18969 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_05740 19495 19223 gene locus_tag LOCUS_05750 gene rpsP 19495 19223 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419338.1 protein_id gnl|my_center|LOCUS_05750 20923 19565 gene locus_tag LOCUS_05760 gene ffh 20923 19565 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_05760 21296 20925 gene locus_tag LOCUS_05770 21296 20925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 22388 21402 gene locus_tag LOCUS_05780 gene ftsY 22388 21402 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861159.1 protein_id gnl|my_center|LOCUS_05780 26041 22496 gene locus_tag LOCUS_05790 gene smc 26041 22496 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_05790 27051 26053 gene locus_tag LOCUS_05800 27051 26053 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_05800 27875 27168 gene locus_tag LOCUS_05810 gene rnc 27875 27168 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_05810 28502 27942 gene locus_tag LOCUS_05820 gene efp 28502 27942 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_05820 29800 28586 gene locus_tag LOCUS_05830 29800 28586 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 protein_id gnl|my_center|LOCUS_05830 30060 29812 gene locus_tag LOCUS_05840 30060 29812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 34336 30029 gene locus_tag LOCUS_05850 34336 30029 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438301.1 protein_id gnl|my_center|LOCUS_05850 35145 34459 gene locus_tag LOCUS_05860 35145 34459 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107872.1 protein_id gnl|my_center|LOCUS_05860 35403 36632 gene locus_tag LOCUS_05870 35403 36632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 37668 36790 gene locus_tag LOCUS_05880 37668 36790 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_05880 38259 37684 gene locus_tag LOCUS_05890 gene rsxA 38259 37684 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_05890 38863 38273 gene locus_tag LOCUS_05900 38863 38273 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_05900 39441 38875 gene locus_tag LOCUS_05910 39441 38875 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_05910 40415 39441 gene locus_tag LOCUS_05920 40415 39441 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_05920 41776 40439 gene locus_tag LOCUS_05930 gene rsxC 41776 40439 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence014 3613 2279 gene locus_tag LOCUS_05940 3613 2279 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949050.1 protein_id gnl|my_center|LOCUS_05940 3797 3709 gene locus_tag LOCUS_t00020 3797 3709 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4398 3919 gene locus_tag LOCUS_05950 4398 3919 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421624.1 protein_id gnl|my_center|LOCUS_05950 5898 4618 gene locus_tag LOCUS_05960 gene serS 5898 4618 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435562.1 protein_id gnl|my_center|LOCUS_05960 7062 6361 gene locus_tag LOCUS_05970 7062 6361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837230.1 protein_id gnl|my_center|LOCUS_05970 7956 7327 gene locus_tag LOCUS_05980 7956 7327 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748775.1 protein_id gnl|my_center|LOCUS_05980 10270 8024 gene locus_tag LOCUS_05990 10270 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 10771 10340 gene locus_tag LOCUS_06000 10771 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 11028 11639 gene locus_tag LOCUS_06010 11028 11639 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476510.1 protein_id gnl|my_center|LOCUS_06010 12905 11769 gene locus_tag LOCUS_06020 12905 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 14361 12946 gene locus_tag LOCUS_06030 14361 12946 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060458416.1 protein_id gnl|my_center|LOCUS_06030 15273 14449 gene locus_tag LOCUS_06040 15273 14449 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_06040 15972 15298 gene locus_tag LOCUS_06050 15972 15298 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_06050 16663 15974 gene locus_tag LOCUS_06060 16663 15974 CDS product YveK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966325.1 protein_id gnl|my_center|LOCUS_06060 17806 16730 gene locus_tag LOCUS_06070 17806 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 19036 17828 gene locus_tag LOCUS_06080 19036 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 19748 19011 gene locus_tag LOCUS_06090 19748 19011 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 protein_id gnl|my_center|LOCUS_06090 21248 19761 gene locus_tag LOCUS_06100 21248 19761 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_06100 22371 21295 gene locus_tag LOCUS_06110 22371 21295 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205352220.1 protein_id gnl|my_center|LOCUS_06110 22954 22466 gene locus_tag LOCUS_06120 22954 22466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 23362 22973 gene locus_tag LOCUS_06130 23362 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 23703 24212 gene locus_tag LOCUS_06140 23703 24212 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_06140 25329 24223 gene locus_tag LOCUS_06150 25329 24223 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_06150 25706 25395 gene locus_tag LOCUS_06160 25706 25395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 25975 25724 gene locus_tag LOCUS_06170 25975 25724 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016883.1 protein_id gnl|my_center|LOCUS_06170 26870 26052 gene locus_tag LOCUS_06180 26870 26052 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860622.1 protein_id gnl|my_center|LOCUS_06180 28224 27043 gene locus_tag LOCUS_06190 28224 27043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 29083 28214 gene locus_tag LOCUS_06200 29083 28214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_06200 29291 29109 gene locus_tag LOCUS_06210 29291 29109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 31113 29470 gene locus_tag LOCUS_06220 gene hcp 31113 29470 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_06220 32456 31251 gene locus_tag LOCUS_06230 gene hydF 32456 31251 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798360.1 protein_id gnl|my_center|LOCUS_06230 33897 32473 gene locus_tag LOCUS_06240 gene hydG 33897 32473 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_06240 34172 35347 gene locus_tag LOCUS_06250 34172 35347 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence015 242 502 gene locus_tag LOCUS_06260 242 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 665 1132 gene locus_tag LOCUS_06270 665 1132 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_06270 1154 2431 gene locus_tag LOCUS_06280 gene nusA 1154 2431 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428238.1 protein_id gnl|my_center|LOCUS_06280 2449 2733 gene locus_tag LOCUS_06290 2449 2733 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_06290 2745 3059 gene locus_tag LOCUS_06300 2745 3059 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419470.1 protein_id gnl|my_center|LOCUS_06300 3118 5058 gene locus_tag LOCUS_06310 gene infB 3118 5058 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438306.1 protein_id gnl|my_center|LOCUS_06310 5108 5446 gene locus_tag LOCUS_06320 gene rbfA 5108 5446 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_06320 5520 6431 gene locus_tag LOCUS_06330 5520 6431 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_06330 6505 7488 gene locus_tag LOCUS_06340 gene truB 6505 7488 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428232.1 protein_id gnl|my_center|LOCUS_06340 7499 8446 gene locus_tag LOCUS_06350 7499 8446 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_06350 8750 9457 gene locus_tag LOCUS_06360 8750 9457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_06360 9484 10845 gene locus_tag LOCUS_06370 9484 10845 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454160.1 protein_id gnl|my_center|LOCUS_06370 11147 11359 gene locus_tag LOCUS_06380 11147 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 11797 12084 gene locus_tag LOCUS_06390 11797 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 12160 14382 gene locus_tag LOCUS_06400 12160 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14407 15039 gene locus_tag LOCUS_06410 14407 15039 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748775.1 protein_id gnl|my_center|LOCUS_06410 15175 15432 gene locus_tag LOCUS_06420 gene rpsO 15175 15432 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_06420 15628 16716 gene locus_tag LOCUS_06430 15628 16716 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_06430 16920 17048 gene locus_tag LOCUS_06440 16920 17048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 17064 17489 gene locus_tag LOCUS_06450 17064 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06450 17601 18446 gene locus_tag LOCUS_06460 17601 18446 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889099.1 protein_id gnl|my_center|LOCUS_06460 18468 20564 gene locus_tag LOCUS_06470 gene pnp 18468 20564 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_06470 20843 22093 gene locus_tag LOCUS_06480 20843 22093 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438321.1 protein_id gnl|my_center|LOCUS_06480 22098 24548 gene locus_tag LOCUS_06490 22098 24548 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 protein_id gnl|my_center|LOCUS_06490 24550 25866 gene locus_tag LOCUS_06500 gene rimO 24550 25866 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_06500 25877 26416 gene locus_tag LOCUS_06510 gene pgsA 25877 26416 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_06510 26491 27546 gene locus_tag LOCUS_06520 gene recA 26491 27546 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_06520 27867 29390 gene locus_tag LOCUS_06530 gene rny 27867 29390 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_06530 29697 32030 gene locus_tag LOCUS_06540 29697 32030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 32054 32452 gene locus_tag LOCUS_06550 32054 32452 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence016 3112 461 gene locus_tag LOCUS_06560 3112 461 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_06560 3796 5343 gene locus_tag LOCUS_06570 3796 5343 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_06570 7042 5492 gene locus_tag LOCUS_06580 7042 5492 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902156.1 protein_id gnl|my_center|LOCUS_06580 7184 9994 gene locus_tag LOCUS_06590 7184 9994 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860956.1 protein_id gnl|my_center|LOCUS_06590 10468 10052 gene locus_tag LOCUS_06600 10468 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 11507 10443 gene locus_tag LOCUS_06610 11507 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 13315 11678 gene locus_tag LOCUS_06620 13315 11678 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_06620 14423 13548 gene locus_tag LOCUS_06630 14423 13548 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965720.1 protein_id gnl|my_center|LOCUS_06630 15735 14542 gene locus_tag LOCUS_06640 gene thiI 15735 14542 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_06640 16906 15743 gene locus_tag LOCUS_06650 16906 15743 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_06650 17097 18047 gene locus_tag LOCUS_06660 17097 18047 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_06660 18094 18603 gene locus_tag LOCUS_06670 18094 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 18596 20149 gene locus_tag LOCUS_06680 18596 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 20289 20936 gene locus_tag LOCUS_06690 20289 20936 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436685.1 protein_id gnl|my_center|LOCUS_06690 21831 20998 gene locus_tag LOCUS_06700 21831 20998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436375.1 protein_id gnl|my_center|LOCUS_06700 22523 21825 gene locus_tag LOCUS_06710 22523 21825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436372.1 protein_id gnl|my_center|LOCUS_06710 22887 22528 gene locus_tag LOCUS_06720 22887 22528 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430051.1 protein_id gnl|my_center|LOCUS_06720 24494 23163 gene locus_tag LOCUS_06730 24494 23163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 26616 24613 gene locus_tag LOCUS_06740 26616 24613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470142.1 protein_id gnl|my_center|LOCUS_06740 27370 26618 gene locus_tag LOCUS_06750 27370 26618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681851.1 protein_id gnl|my_center|LOCUS_06750 28438 27533 gene locus_tag LOCUS_06760 28438 27533 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456718.1 protein_id gnl|my_center|LOCUS_06760 29144 28455 gene locus_tag LOCUS_06770 29144 28455 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_06770 30589 29225 gene locus_tag LOCUS_06780 30589 29225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 30941 30591 gene locus_tag LOCUS_06790 30941 30591 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 protein_id gnl|my_center|LOCUS_06790 31228 31737 gene locus_tag LOCUS_06800 31228 31737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 31746 31952 gene locus_tag LOCUS_06810 31746 31952 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721916.1 protein_id gnl|my_center|LOCUS_06810 32749 32030 gene locus_tag LOCUS_06820 32749 32030 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_06820 <33927 33016 gene locus_tag LOCUS_06830 <33927 33016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987123.1:cation:proton antiporter >Feature sequence017 974 3 gene locus_tag LOCUS_06840 974 3 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891785.1 protein_id gnl|my_center|LOCUS_06840 1185 2402 gene locus_tag LOCUS_06850 1185 2402 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_06850 2943 2602 gene locus_tag LOCUS_06860 gene rplQ 2943 2602 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421117.1 protein_id gnl|my_center|LOCUS_06860 3931 2984 gene locus_tag LOCUS_06870 3931 2984 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_06870 4386 3985 gene locus_tag LOCUS_06880 gene rpsK 4386 3985 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_06880 4790 4419 gene locus_tag LOCUS_06890 gene rpsM 4790 4419 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421125.1 protein_id gnl|my_center|LOCUS_06890 5207 4989 gene locus_tag LOCUS_06900 gene infA 5207 4989 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421127.1 protein_id gnl|my_center|LOCUS_06900 5511 5242 gene locus_tag LOCUS_06910 5511 5242 CDS product KOW domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895197.1 protein_id gnl|my_center|LOCUS_06910 6319 5678 gene locus_tag LOCUS_06920 6319 5678 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_06920 7604 6336 gene locus_tag LOCUS_06930 gene secY 7604 6336 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_06930 8077 7634 gene locus_tag LOCUS_06940 gene rplO 8077 7634 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421135.1 protein_id gnl|my_center|LOCUS_06940 8293 8108 gene locus_tag LOCUS_06950 gene rpmD 8293 8108 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421137.1 protein_id gnl|my_center|LOCUS_06950 8821 8312 gene locus_tag LOCUS_06960 gene rpsE 8821 8312 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_06960 9210 8842 gene locus_tag LOCUS_06970 gene rplR 9210 8842 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_06970 9777 9235 gene locus_tag LOCUS_06980 gene rplF 9777 9235 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_06980 10204 9806 gene locus_tag LOCUS_06990 gene rpsH 10204 9806 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_06990 10420 10235 gene locus_tag LOCUS_07000 10420 10235 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_07000 10980 10438 gene locus_tag LOCUS_07010 gene rplE 10980 10438 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_07010 11313 11005 gene locus_tag LOCUS_07020 gene rplX 11313 11005 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427723.1 protein_id gnl|my_center|LOCUS_07020 11703 11335 gene locus_tag LOCUS_07030 gene rplN 11703 11335 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_07030 11980 11726 gene locus_tag LOCUS_07040 gene rpsQ 11980 11726 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_07040 12210 12007 gene locus_tag LOCUS_07050 gene rpmC 12210 12007 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_07050 12640 12212 gene locus_tag LOCUS_07060 gene rplP 12640 12212 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_07060 13460 12666 gene locus_tag LOCUS_07070 gene rpsC 13460 12666 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_07070 13817 13479 gene locus_tag LOCUS_07080 gene rplV 13817 13479 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887891.1 protein_id gnl|my_center|LOCUS_07080 14126 13845 gene locus_tag LOCUS_07090 gene rpsS 14126 13845 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421166.1 protein_id gnl|my_center|LOCUS_07090 14990 14160 gene locus_tag LOCUS_07100 gene rplB 14990 14160 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_07100 15305 15015 gene locus_tag LOCUS_07110 gene rplW 15305 15015 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_07110 15928 15305 gene locus_tag LOCUS_07120 gene rplD 15928 15305 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_07120 16581 15955 gene locus_tag LOCUS_07130 gene rplC 16581 15955 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_07130 16968 16657 gene locus_tag LOCUS_07140 gene rpsJ 16968 16657 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860633.1 protein_id gnl|my_center|LOCUS_07140 18269 17193 gene locus_tag LOCUS_07150 18269 17193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 19708 18281 gene locus_tag LOCUS_07160 19708 18281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 20613 19879 gene locus_tag LOCUS_07170 20613 19879 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_07170 21312 20632 gene locus_tag LOCUS_07180 21312 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 21565 24150 gene locus_tag LOCUS_07190 21565 24150 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 protein_id gnl|my_center|LOCUS_07190 24150 24818 gene locus_tag LOCUS_07200 24150 24818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_07200 25423 25073 gene locus_tag LOCUS_07210 25423 25073 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_07210 26394 25447 gene locus_tag LOCUS_07220 26394 25447 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986930.1 protein_id gnl|my_center|LOCUS_07220 27453 26419 gene locus_tag LOCUS_07230 27453 26419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948771.1 protein_id gnl|my_center|LOCUS_07230 28329 27517 gene locus_tag LOCUS_07240 28329 27517 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948770.1 protein_id gnl|my_center|LOCUS_07240 29191 28322 gene locus_tag LOCUS_07250 29191 28322 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_07250 30451 29201 gene locus_tag LOCUS_07260 30451 29201 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 protein_id gnl|my_center|LOCUS_07260 31561 30656 gene locus_tag LOCUS_07270 31561 30656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 <32940 31603 gene locus_tag LOCUS_07280 <32940 31603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459307.1:cell wall-binding repeat-containing protein >Feature sequence018 <1 677 gene locus_tag LOCUS_07290 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966588.1:cardiolipin synthase 915 1520 gene locus_tag LOCUS_07300 gene rpsD 915 1520 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401493.1 protein_id gnl|my_center|LOCUS_07300 2138 1722 gene locus_tag LOCUS_07310 2138 1722 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437525.1 protein_id gnl|my_center|LOCUS_07310 2868 2191 gene locus_tag LOCUS_07320 2868 2191 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437523.1 protein_id gnl|my_center|LOCUS_07320 3187 5220 gene locus_tag LOCUS_07330 3187 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5332 6342 gene locus_tag LOCUS_07340 5332 6342 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_07340 6342 6557 gene locus_tag LOCUS_07350 6342 6557 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_07350 6618 7691 gene locus_tag LOCUS_07360 6618 7691 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948306.1 protein_id gnl|my_center|LOCUS_07360 8003 8644 gene locus_tag LOCUS_07370 8003 8644 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_07370 8657 9412 gene locus_tag LOCUS_07380 gene nadE 8657 9412 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437535.1 protein_id gnl|my_center|LOCUS_07380 10210 9587 gene locus_tag LOCUS_07390 10210 9587 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015812.1 protein_id gnl|my_center|LOCUS_07390 11561 10296 gene locus_tag LOCUS_07400 gene thiH 11561 10296 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_07400 12344 11574 gene locus_tag LOCUS_07410 12344 11574 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_07410 13043 12408 gene locus_tag LOCUS_07420 gene thiF 13043 12408 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_07420 13238 13044 gene locus_tag LOCUS_07430 gene thiS 13238 13044 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546191.1 protein_id gnl|my_center|LOCUS_07430 14053 13478 gene locus_tag LOCUS_07440 gene leuD 14053 13478 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433189.1 protein_id gnl|my_center|LOCUS_07440 15454 14054 gene locus_tag LOCUS_07450 gene leuC 15454 14054 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000518111.1 protein_id gnl|my_center|LOCUS_07450 16516 15458 gene locus_tag LOCUS_07460 gene leuB 16516 15458 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221945.1 protein_id gnl|my_center|LOCUS_07460 18023 16527 gene locus_tag LOCUS_07470 18023 16527 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_07470 18402 19115 gene locus_tag LOCUS_07480 18402 19115 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_07480 19116 19379 gene locus_tag LOCUS_07490 19116 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 19574 20746 gene locus_tag LOCUS_07500 19574 20746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 20842 21306 gene locus_tag LOCUS_07510 gene bcp 20842 21306 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_07510 21829 21452 gene locus_tag LOCUS_07520 21829 21452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 22079 22258 gene locus_tag LOCUS_07530 22079 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 22337 23767 gene locus_tag LOCUS_07540 22337 23767 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_07540 23896 25989 gene locus_tag LOCUS_07550 gene ligA 23896 25989 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_07550 25989 27413 gene locus_tag LOCUS_07560 gene rph 25989 27413 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435607.1 protein_id gnl|my_center|LOCUS_07560 27485 27976 gene locus_tag LOCUS_07570 27485 27976 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_07570 28115 29398 gene locus_tag LOCUS_07580 gene tig 28115 29398 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_07580 29460 30044 gene locus_tag LOCUS_07590 gene clpP 29460 30044 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_07590 30078 31349 gene locus_tag LOCUS_07600 gene clpX 30078 31349 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417105.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence019 747 79 gene locus_tag LOCUS_07610 747 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1332 748 gene locus_tag LOCUS_07620 1332 748 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905492.1 protein_id gnl|my_center|LOCUS_07620 1582 2100 gene locus_tag LOCUS_07630 1582 2100 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861247.1 protein_id gnl|my_center|LOCUS_07630 2093 2671 gene locus_tag LOCUS_07640 gene rnmV 2093 2671 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_07640 2676 3557 gene locus_tag LOCUS_07650 gene rsmA 2676 3557 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_07650 3550 4386 gene locus_tag LOCUS_07660 3550 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425938.1 protein_id gnl|my_center|LOCUS_07660 4488 4619 gene locus_tag LOCUS_07670 4488 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 4692 5702 gene locus_tag LOCUS_07680 gene aroF 4692 5702 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_07680 5704 6519 gene locus_tag LOCUS_07690 5704 6519 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_07690 6516 7748 gene locus_tag LOCUS_07700 gene aroA 6516 7748 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_07700 7745 8821 gene locus_tag LOCUS_07710 gene aroC 7745 8821 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_07710 8864 10102 gene locus_tag LOCUS_07720 8864 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10787 10164 gene locus_tag LOCUS_07730 10787 10164 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922658.1 protein_id gnl|my_center|LOCUS_07730 11460 10768 gene locus_tag LOCUS_07740 11460 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 11546 11755 gene locus_tag LOCUS_07750 11546 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 12388 12984 gene locus_tag LOCUS_07760 12388 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 13596 13066 gene locus_tag LOCUS_07770 13596 13066 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_07770 14384 13647 gene locus_tag LOCUS_07780 14384 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 14885 15118 gene locus_tag LOCUS_07790 14885 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 15132 15377 gene locus_tag LOCUS_07800 15132 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 15825 17183 gene locus_tag LOCUS_07810 gene trkA 15825 17183 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_07810 17317 18768 gene locus_tag LOCUS_07820 17317 18768 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_07820 18931 20553 gene locus_tag LOCUS_07830 18931 20553 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_07830 20705 21622 gene locus_tag LOCUS_07840 20705 21622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948861.1 protein_id gnl|my_center|LOCUS_07840 21637 22473 gene locus_tag LOCUS_07850 21637 22473 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065067.1 protein_id gnl|my_center|LOCUS_07850 22466 23407 gene locus_tag LOCUS_07860 22466 23407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345583.1 protein_id gnl|my_center|LOCUS_07860 23391 24359 gene locus_tag LOCUS_07870 23391 24359 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_07870 25500 24574 gene locus_tag LOCUS_07880 25500 24574 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379732.1 protein_id gnl|my_center|LOCUS_07880 25849 25523 gene locus_tag LOCUS_07890 25849 25523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 26604 25846 gene locus_tag LOCUS_07900 26604 25846 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812271.1 protein_id gnl|my_center|LOCUS_07900 27456 26632 gene locus_tag LOCUS_07910 27456 26632 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023914.1 protein_id gnl|my_center|LOCUS_07910 27967 28230 gene locus_tag LOCUS_07920 27967 28230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 28749 29951 gene locus_tag LOCUS_07930 28749 29951 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_07930 29967 30431 gene locus_tag LOCUS_07940 29967 30431 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733108.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence020 52 1230 gene locus_tag LOCUS_07950 52 1230 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_07950 1293 2306 gene locus_tag LOCUS_07960 gene rseP 1293 2306 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_07960 2325 3380 gene locus_tag LOCUS_07970 gene ispG 2325 3380 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_07970 4407 3481 gene locus_tag LOCUS_07980 4407 3481 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494823.1 protein_id gnl|my_center|LOCUS_07980 5221 4436 gene locus_tag LOCUS_07990 5221 4436 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_07990 5963 5232 gene locus_tag LOCUS_08000 5963 5232 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_08000 6703 6146 gene locus_tag LOCUS_08010 gene frr 6703 6146 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_08010 7514 6810 gene locus_tag LOCUS_08020 gene pyrH 7514 6810 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_08020 8491 7583 gene locus_tag LOCUS_08030 gene tsf 8491 7583 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_08030 9355 8591 gene locus_tag LOCUS_08040 gene rpsB 9355 8591 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_08040 10645 9518 gene locus_tag LOCUS_08050 10645 9518 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897294.1 protein_id gnl|my_center|LOCUS_08050 10902 11483 gene locus_tag LOCUS_08060 10902 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 12022 11711 gene locus_tag LOCUS_08070 12022 11711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 13267 12038 gene locus_tag LOCUS_08080 13267 12038 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 protein_id gnl|my_center|LOCUS_08080 14263 13322 gene locus_tag LOCUS_08090 gene msrA 14263 13322 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373555.1 protein_id gnl|my_center|LOCUS_08090 15453 14284 gene locus_tag LOCUS_08100 15453 14284 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_08100 17294 15450 gene locus_tag LOCUS_08110 17294 15450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_08110 19446 17281 gene locus_tag LOCUS_08120 19446 17281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986473.1 protein_id gnl|my_center|LOCUS_08120 20575 19811 gene locus_tag LOCUS_08130 20575 19811 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889131.1 protein_id gnl|my_center|LOCUS_08130 21187 21642 gene locus_tag LOCUS_08140 21187 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419674.1 protein_id gnl|my_center|LOCUS_08140 22211 21807 gene locus_tag LOCUS_08150 22211 21807 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966935.1 protein_id gnl|my_center|LOCUS_08150 22703 22503 gene locus_tag LOCUS_08160 22703 22503 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419624.1 protein_id gnl|my_center|LOCUS_08160 22899 23723 gene locus_tag LOCUS_08170 22899 23723 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_08170 25793 23892 gene locus_tag LOCUS_08180 25793 23892 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428202.1 protein_id gnl|my_center|LOCUS_08180 26705 25953 gene locus_tag LOCUS_08190 26705 25953 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence021 452 814 gene locus_tag LOCUS_08200 452 814 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428464.1 protein_id gnl|my_center|LOCUS_08200 951 2168 gene locus_tag LOCUS_08210 gene ilvA 951 2168 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890721.1 protein_id gnl|my_center|LOCUS_08210 2254 2631 gene locus_tag LOCUS_08220 2254 2631 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_08220 3013 5685 gene locus_tag LOCUS_08230 3013 5685 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861573.1 protein_id gnl|my_center|LOCUS_08230 5915 6238 gene locus_tag LOCUS_08240 5915 6238 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_08240 8096 6360 gene locus_tag LOCUS_08250 8096 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 8310 9068 gene locus_tag LOCUS_08260 8310 9068 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890711.1 protein_id gnl|my_center|LOCUS_08260 9150 10136 gene locus_tag LOCUS_08270 9150 10136 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439110.1 protein_id gnl|my_center|LOCUS_08270 10370 11302 gene locus_tag LOCUS_08280 gene selD 10370 11302 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077699367.1 protein_id gnl|my_center|LOCUS_08280 11335 12786 gene locus_tag LOCUS_08290 gene selA 11335 12786 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897684.1 protein_id gnl|my_center|LOCUS_08290 12795 14684 gene locus_tag LOCUS_08300 gene selB 12795 14684 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454786.1 protein_id gnl|my_center|LOCUS_08300 16172 14850 gene locus_tag LOCUS_08310 gene prdC 16172 14850 CDS product proline reductase-associated electron transfer protein PrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431873.1 protein_id gnl|my_center|LOCUS_08310 16532 17953 gene locus_tag LOCUS_08320 gene prdR 16532 17953 CDS product sigma-54 dependent transcriptional regulator PrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428097.1 protein_id gnl|my_center|LOCUS_08320 19018 20931 gene locus_tag LOCUS_08330 gene prdA 19018 20931 CDS product D-proline reductase (dithiol) proprotein PrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422104.1 protein_id gnl|my_center|LOCUS_08330 20970 21332 gene locus_tag LOCUS_08340 20970 21332 CDS product CBO2463/CBO2479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422102.1 protein_id gnl|my_center|LOCUS_08340 21357 22088 gene locus_tag LOCUS_08350 gene prdB 21357 22088 CDS product D-proline reductase (dithiol) protein PrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861888.1 transl_except (pos:21813..21815,aa:Sec) note codon on position 153 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_08350 22215 22973 gene locus_tag LOCUS_08360 gene prdD 22215 22973 CDS product proline reductase cluster protein PrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428092.1 protein_id gnl|my_center|LOCUS_08360 22984 23451 gene locus_tag LOCUS_08370 22984 23451 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422094.1 protein_id gnl|my_center|LOCUS_08370 23548 24555 gene locus_tag LOCUS_08380 23548 24555 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422090.1 protein_id gnl|my_center|LOCUS_08380 24653 25549 gene locus_tag LOCUS_08390 24653 25549 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891694.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence022 351 1523 gene locus_tag LOCUS_08400 351 1523 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_08400 1656 2882 gene locus_tag LOCUS_08410 1656 2882 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_08410 2895 4337 gene locus_tag LOCUS_08420 2895 4337 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519112.1 protein_id gnl|my_center|LOCUS_08420 4355 4897 gene locus_tag LOCUS_08430 4355 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 4902 5630 gene locus_tag LOCUS_08440 gene ispD 4902 5630 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860629.1 protein_id gnl|my_center|LOCUS_08440 5658 6131 gene locus_tag LOCUS_08450 gene ispF 5658 6131 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_08450 7735 6290 gene locus_tag LOCUS_08460 gene proS 7735 6290 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_08460 9197 8109 gene locus_tag LOCUS_08470 9197 8109 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 protein_id gnl|my_center|LOCUS_08470 10303 9218 gene locus_tag LOCUS_08480 gene disA 10303 9218 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453975.1 protein_id gnl|my_center|LOCUS_08480 11698 10307 gene locus_tag LOCUS_08490 gene radA 11698 10307 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_08490 13834 11903 gene locus_tag LOCUS_08500 13834 11903 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887791.1 protein_id gnl|my_center|LOCUS_08500 14259 15572 gene locus_tag LOCUS_08510 14259 15572 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861250.1 protein_id gnl|my_center|LOCUS_08510 15828 18233 gene locus_tag LOCUS_08520 15828 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 20886 18445 gene locus_tag LOCUS_08530 20886 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 24628 21176 gene locus_tag LOCUS_08540 24628 21176 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425597.1 protein_id gnl|my_center|LOCUS_08540 25159 25061 gene locus_tag LOCUS_r00020 25159 25061 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence023 1285 410 gene locus_tag LOCUS_08550 1285 410 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680043.1 protein_id gnl|my_center|LOCUS_08550 2700 1471 gene locus_tag LOCUS_08560 gene pepT 2700 1471 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437954.1 protein_id gnl|my_center|LOCUS_08560 2970 3656 gene locus_tag LOCUS_08570 2970 3656 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963693.1 protein_id gnl|my_center|LOCUS_08570 4036 4641 gene locus_tag LOCUS_08580 4036 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4802 5557 gene locus_tag LOCUS_08590 4802 5557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393250.1 protein_id gnl|my_center|LOCUS_08590 5544 7424 gene locus_tag LOCUS_08600 5544 7424 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861246.1 protein_id gnl|my_center|LOCUS_08600 7505 7581 gene locus_tag LOCUS_t00030 7505 7581 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7618 8019 gene locus_tag LOCUS_08610 7618 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895151.1 protein_id gnl|my_center|LOCUS_08610 8251 8066 gene locus_tag LOCUS_08620 8251 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 8184 9089 gene locus_tag LOCUS_08630 8184 9089 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819234.1 protein_id gnl|my_center|LOCUS_08630 10438 9314 gene locus_tag LOCUS_08640 gene ugpC 10438 9314 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 protein_id gnl|my_center|LOCUS_08640 11094 10453 gene locus_tag LOCUS_08650 gene pgmB 11094 10453 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990084.1 protein_id gnl|my_center|LOCUS_08650 12787 11126 gene locus_tag LOCUS_08660 gene malL 12787 11126 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243333.1 protein_id gnl|my_center|LOCUS_08660 15079 12803 gene locus_tag LOCUS_08670 gene mdxK 15079 12803 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243769.1 protein_id gnl|my_center|LOCUS_08670 16007 15186 gene locus_tag LOCUS_08680 16007 15186 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_08680 16879 16007 gene locus_tag LOCUS_08690 16879 16007 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_08690 18280 16988 gene locus_tag LOCUS_08700 18280 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 19342 18326 gene locus_tag LOCUS_08710 19342 18326 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145423.1 protein_id gnl|my_center|LOCUS_08710 19635 20525 gene locus_tag LOCUS_08720 19635 20525 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433828.1 protein_id gnl|my_center|LOCUS_08720 21316 22245 gene locus_tag LOCUS_08730 21316 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 22457 22531 gene locus_tag LOCUS_t00040 22457 22531 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23988 22666 gene locus_tag LOCUS_08740 23988 22666 CDS product cyclic nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990029.1 protein_id gnl|my_center|LOCUS_08740 24117 24043 gene locus_tag LOCUS_t00050 24117 24043 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24291 24220 gene locus_tag LOCUS_t00060 24291 24220 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 24374 24300 gene locus_tag LOCUS_t00070 24374 24300 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 24454 24378 gene locus_tag LOCUS_t00080 24454 24378 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 24534 24459 gene locus_tag LOCUS_t00090 24534 24459 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 24631 24543 gene locus_tag LOCUS_t00100 24631 24543 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24739 24664 gene locus_tag LOCUS_t00110 24739 24664 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 24820 24745 gene locus_tag LOCUS_t00120 24820 24745 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 24937 24854 gene locus_tag LOCUS_t00130 24937 24854 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25038 24954 gene locus_tag LOCUS_t00140 25038 24954 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 25117 25043 gene locus_tag LOCUS_t00150 25117 25043 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 374 1414 gene locus_tag LOCUS_08750 374 1414 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429564.1 protein_id gnl|my_center|LOCUS_08750 1472 2479 gene locus_tag LOCUS_08760 gene gap 1472 2479 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421962.1 protein_id gnl|my_center|LOCUS_08760 2707 3906 gene locus_tag LOCUS_08770 2707 3906 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429565.1 protein_id gnl|my_center|LOCUS_08770 3947 4687 gene locus_tag LOCUS_08780 gene tpiA 3947 4687 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_08780 4715 6241 gene locus_tag LOCUS_08790 gene gpmI 4715 6241 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_08790 6513 7805 gene locus_tag LOCUS_08800 gene eno 6513 7805 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_08800 7904 8119 gene locus_tag LOCUS_08810 7904 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8187 8420 gene locus_tag LOCUS_08820 gene secG 8187 8420 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421948.1 protein_id gnl|my_center|LOCUS_08820 8481 10625 gene locus_tag LOCUS_08830 gene rnr 8481 10625 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434984.1 protein_id gnl|my_center|LOCUS_08830 10763 11218 gene locus_tag LOCUS_08840 gene smpB 10763 11218 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421925.1 protein_id gnl|my_center|LOCUS_08840 11635 15780 gene locus_tag LOCUS_08850 11635 15780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 15781 21528 gene locus_tag LOCUS_08860 15781 21528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 21791 22522 gene locus_tag LOCUS_08870 21791 22522 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274796.1 protein_id gnl|my_center|LOCUS_08870 23765 22743 gene locus_tag LOCUS_08880 23765 22743 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023905931.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence025 <1 591 gene locus_tag LOCUS_08890 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438164.1:endolytic transglycosylase MltG 730 1383 gene locus_tag LOCUS_08900 730 1383 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_08900 1408 2646 gene locus_tag LOCUS_08910 1408 2646 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_08910 2771 3151 gene locus_tag LOCUS_08920 2771 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3135 3671 gene locus_tag LOCUS_08930 3135 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3764 4285 gene locus_tag LOCUS_08940 3764 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4332 4823 gene locus_tag LOCUS_08950 4332 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5022 5696 gene locus_tag LOCUS_08960 5022 5696 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_08960 5727 6284 gene locus_tag LOCUS_08970 gene folE 5727 6284 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151482.1 protein_id gnl|my_center|LOCUS_08970 6324 6803 gene locus_tag LOCUS_08980 6324 6803 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_08980 6906 7724 gene locus_tag LOCUS_08990 gene folP 6906 7724 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_08990 7712 8518 gene locus_tag LOCUS_09000 gene folK 7712 8518 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966210.1 protein_id gnl|my_center|LOCUS_09000 8588 10363 gene locus_tag LOCUS_09010 8588 10363 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454999.1 protein_id gnl|my_center|LOCUS_09010 10691 14224 gene locus_tag LOCUS_09020 gene nifJ 10691 14224 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427073.1 protein_id gnl|my_center|LOCUS_09020 15290 15664 gene locus_tag LOCUS_09030 15290 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 15776 16519 gene locus_tag LOCUS_09040 15776 16519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 17236 17397 gene locus_tag LOCUS_09050 17236 17397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 17419 18291 gene locus_tag LOCUS_09060 17419 18291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454225.1 protein_id gnl|my_center|LOCUS_09060 18304 19536 gene locus_tag LOCUS_09070 18304 19536 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895871.1 protein_id gnl|my_center|LOCUS_09070 19571 20317 gene locus_tag LOCUS_09080 19571 20317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_09080 20540 21085 gene locus_tag LOCUS_09090 20540 21085 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439009.1 protein_id gnl|my_center|LOCUS_09090 21450 23375 gene locus_tag LOCUS_09100 gene thrS 21450 23375 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_09100 23646 23849 gene locus_tag LOCUS_09110 23646 23849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence026 133 384 gene locus_tag LOCUS_09120 133 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 556 362 gene locus_tag LOCUS_09130 556 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 742 1038 gene locus_tag LOCUS_09140 742 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3337 1973 gene locus_tag LOCUS_09150 gene rlmD 3337 1973 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_09150 4171 3470 gene locus_tag LOCUS_09160 4171 3470 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_09160 5062 4187 gene locus_tag LOCUS_09170 gene hslO 5062 4187 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_09170 6008 5244 gene locus_tag LOCUS_09180 6008 5244 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_09180 7269 6076 gene locus_tag LOCUS_09190 7269 6076 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422058.1 protein_id gnl|my_center|LOCUS_09190 7451 8332 gene locus_tag LOCUS_09200 gene dapA 7451 8332 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_09200 8588 8370 gene locus_tag LOCUS_09210 8588 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 9650 8661 gene locus_tag LOCUS_09220 gene nrdF 9650 8661 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439817.1 protein_id gnl|my_center|LOCUS_09220 11790 9676 gene locus_tag LOCUS_09230 gene nrdE 11790 9676 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861778.1 protein_id gnl|my_center|LOCUS_09230 14024 11892 gene locus_tag LOCUS_09240 14024 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 15320 14295 gene locus_tag LOCUS_09250 15320 14295 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970524.1 protein_id gnl|my_center|LOCUS_09250 16550 15357 gene locus_tag LOCUS_09260 16550 15357 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_09260 16861 16559 gene locus_tag LOCUS_09270 16861 16559 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966071.1 protein_id gnl|my_center|LOCUS_09270 17826 16870 gene locus_tag LOCUS_09280 17826 16870 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_09280 18404 17982 gene locus_tag LOCUS_09290 18404 17982 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_09290 18591 18941 gene locus_tag LOCUS_tm00010 18591 18941 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 20260 19076 gene locus_tag LOCUS_09300 20260 19076 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_09300 20937 20293 gene locus_tag LOCUS_09310 20937 20293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 21111 21311 gene locus_tag LOCUS_09320 21111 21311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 21326 21646 gene locus_tag LOCUS_09330 21326 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 21857 22819 gene locus_tag LOCUS_09340 21857 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence027 1212 589 gene locus_tag LOCUS_09350 1212 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09350 3273 1285 gene locus_tag LOCUS_09360 3273 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4251 3292 gene locus_tag LOCUS_09370 4251 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4470 4327 gene locus_tag LOCUS_09380 gene scfA 4470 4327 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_09380 4872 4555 gene locus_tag LOCUS_09390 gene yajC 4872 4555 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426573.1 protein_id gnl|my_center|LOCUS_09390 6087 4969 gene locus_tag LOCUS_09400 gene tgt 6087 4969 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_09400 7135 6110 gene locus_tag LOCUS_09410 gene queA 7135 6110 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_09410 8184 7159 gene locus_tag LOCUS_09420 gene ruvB 8184 7159 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_09420 8810 8199 gene locus_tag LOCUS_09430 gene ruvA 8810 8199 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_09430 9343 8834 gene locus_tag LOCUS_09440 gene ruvC 9343 8834 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_09440 9739 10308 gene locus_tag LOCUS_09450 9739 10308 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454415.1 protein_id gnl|my_center|LOCUS_09450 11218 10544 gene locus_tag LOCUS_09460 11218 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 11699 12106 gene locus_tag LOCUS_09470 11699 12106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 12123 12464 gene locus_tag LOCUS_09480 12123 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428670.1 protein_id gnl|my_center|LOCUS_09480 13289 12633 gene locus_tag LOCUS_09490 13289 12633 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903848.1 protein_id gnl|my_center|LOCUS_09490 14959 13478 gene locus_tag LOCUS_09500 14959 13478 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948787.1 protein_id gnl|my_center|LOCUS_09500 16292 14985 gene locus_tag LOCUS_09510 gene grdH 16292 14985 CDS product betaine reductase complex component B subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:O69407 transl_except (pos:complement(15246..15248),aa:Sec) note codon on position 349 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_09510 17632 16307 gene locus_tag LOCUS_09520 17632 16307 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_09520 18255 17902 gene locus_tag LOCUS_09530 gene rplT 18255 17902 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429730.1 protein_id gnl|my_center|LOCUS_09530 18477 18280 gene locus_tag LOCUS_09540 gene rpmI 18477 18280 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_09540 19022 18504 gene locus_tag LOCUS_09550 gene infC 19022 18504 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860916.1 protein_id gnl|my_center|LOCUS_09550 20381 19365 gene locus_tag LOCUS_09560 20381 19365 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948389.1 protein_id gnl|my_center|LOCUS_09560 21163 20528 gene locus_tag LOCUS_09570 21163 20528 CDS product DUF3841 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680352.1 protein_id gnl|my_center|LOCUS_09570 22002 21196 gene locus_tag LOCUS_09580 22002 21196 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_09580 22365 22970 gene locus_tag LOCUS_09590 22365 22970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence028 1109 33 gene locus_tag LOCUS_09600 1109 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2698 1436 gene locus_tag LOCUS_09610 gene sstT 2698 1436 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_09610 5757 2932 gene locus_tag LOCUS_09620 gene uvrA 5757 2932 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_09620 6360 5785 gene locus_tag LOCUS_09630 6360 5785 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_09630 8490 6514 gene locus_tag LOCUS_09640 gene uvrB 8490 6514 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_09640 8924 8529 gene locus_tag LOCUS_09650 8924 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 9130 10224 gene locus_tag LOCUS_09660 9130 10224 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_09660 11855 10671 gene locus_tag LOCUS_09670 11855 10671 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_09670 13431 12106 gene locus_tag LOCUS_09680 gene brnQ 13431 12106 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048240.1 protein_id gnl|my_center|LOCUS_09680 14472 13480 gene locus_tag LOCUS_09690 14472 13480 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_09690 15821 14814 gene locus_tag LOCUS_09700 15821 14814 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428573.1 protein_id gnl|my_center|LOCUS_09700 16666 15875 gene locus_tag LOCUS_09710 16666 15875 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888867.1 protein_id gnl|my_center|LOCUS_09710 17813 16683 gene locus_tag LOCUS_09720 gene acdA 17813 16683 CDS product 3-(aryl)acrylate reductase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357672.1 protein_id gnl|my_center|LOCUS_09720 18959 17841 gene locus_tag LOCUS_09730 gene hadC 18959 17841 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_09730 20194 18959 gene locus_tag LOCUS_09740 gene fldB 20194 18959 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_09740 20996 20208 gene locus_tag LOCUS_09750 gene fldI 20996 20208 CDS product phenyllactyl-CoA dehydratase activase FldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357618.1 protein_id gnl|my_center|LOCUS_09750 22375 21131 gene locus_tag LOCUS_09760 gene fldA 22375 21131 CDS product 3-(aryl)acryloyl-CoA:(R)-3-(aryl)lactate CoA-transferase FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048238.1 protein_id gnl|my_center|LOCUS_09760 <23185 22478 gene locus_tag LOCUS_09770 <23185 22478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048239.1:AMP-binding protein >Feature sequence029 150 2207 gene locus_tag LOCUS_09780 gene recG 150 2207 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_09780 2376 2936 gene locus_tag LOCUS_09790 gene rsmD 2376 2936 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_09790 2929 3414 gene locus_tag LOCUS_09800 gene coaD 2929 3414 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416314.1 protein_id gnl|my_center|LOCUS_09800 3452 3997 gene locus_tag LOCUS_09810 3452 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4016 5275 gene locus_tag LOCUS_09820 4016 5275 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_09820 5370 6566 gene locus_tag LOCUS_09830 5370 6566 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_09830 6717 7235 gene locus_tag LOCUS_09840 6717 7235 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_09840 7253 7432 gene locus_tag LOCUS_09850 gene rpmF 7253 7432 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_09850 7563 8564 gene locus_tag LOCUS_09860 gene plsX 7563 8564 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_09860 8554 10530 gene locus_tag LOCUS_09870 8554 10530 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438115.1 protein_id gnl|my_center|LOCUS_09870 10589 10927 gene locus_tag LOCUS_09880 10589 10927 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419170.1 protein_id gnl|my_center|LOCUS_09880 10920 11426 gene locus_tag LOCUS_09890 gene nusB 10920 11426 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428415.1 protein_id gnl|my_center|LOCUS_09890 11480 11845 gene locus_tag LOCUS_09900 11480 11845 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_09900 11854 12519 gene locus_tag LOCUS_09910 11854 12519 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_09910 12639 12735 gene locus_tag LOCUS_t00160 12639 12735 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 12945 14669 gene locus_tag LOCUS_09920 12945 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 14860 16134 gene locus_tag LOCUS_09930 14860 16134 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681414.1 protein_id gnl|my_center|LOCUS_09930 16252 16509 gene locus_tag LOCUS_09940 16252 16509 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681415.1 protein_id gnl|my_center|LOCUS_09940 16523 17308 gene locus_tag LOCUS_09950 16523 17308 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048211.1 protein_id gnl|my_center|LOCUS_09950 18286 17450 gene locus_tag LOCUS_09960 18286 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 18491 19201 gene locus_tag LOCUS_09970 18491 19201 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_09970 20234 19368 gene locus_tag LOCUS_09980 20234 19368 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861569.1 protein_id gnl|my_center|LOCUS_09980 20394 21299 gene locus_tag LOCUS_09990 20394 21299 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_09990 21314 22501 gene locus_tag LOCUS_10000 21314 22501 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence030 427 1065 gene locus_tag LOCUS_10010 427 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1187 2260 gene locus_tag LOCUS_10020 1187 2260 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905403.1 protein_id gnl|my_center|LOCUS_10020 4787 2433 gene locus_tag LOCUS_10030 gene secA 4787 2433 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861685.1 protein_id gnl|my_center|LOCUS_10030 5245 5093 gene locus_tag LOCUS_10040 5245 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6243 7556 gene locus_tag LOCUS_10050 6243 7556 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_10050 7546 8307 gene locus_tag LOCUS_10060 7546 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9337 8489 gene locus_tag LOCUS_10070 9337 8489 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888767.1 protein_id gnl|my_center|LOCUS_10070 10536 9340 gene locus_tag LOCUS_10080 10536 9340 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728698.1 protein_id gnl|my_center|LOCUS_10080 11114 10590 gene locus_tag LOCUS_10090 11114 10590 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437060.1 protein_id gnl|my_center|LOCUS_10090 12001 11162 gene locus_tag LOCUS_10100 12001 11162 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_10100 12527 12042 gene locus_tag LOCUS_10110 gene ybaK 12527 12042 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_10110 13958 12528 gene locus_tag LOCUS_10120 13958 12528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 15284 14025 gene locus_tag LOCUS_10130 15284 14025 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453528.1 protein_id gnl|my_center|LOCUS_10130 16970 15468 gene locus_tag LOCUS_10140 16970 15468 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437136.1 protein_id gnl|my_center|LOCUS_10140 17623 17261 gene locus_tag LOCUS_10150 17623 17261 CDS product DUF6483 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437137.1 protein_id gnl|my_center|LOCUS_10150 18743 17748 gene locus_tag LOCUS_10160 18743 17748 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 protein_id gnl|my_center|LOCUS_10160 19222 18761 gene locus_tag LOCUS_10170 19222 18761 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_10170 20806 19262 gene locus_tag LOCUS_10180 20806 19262 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 protein_id gnl|my_center|LOCUS_10180 <22219 20824 gene locus_tag LOCUS_10190 <22219 20824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860926.1:U32 family peptidase >Feature sequence031 555 34 gene locus_tag LOCUS_10200 555 34 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454132.1 protein_id gnl|my_center|LOCUS_10200 1273 584 gene locus_tag LOCUS_10210 1273 584 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_10210 2128 1364 gene locus_tag LOCUS_10220 gene dapB 2128 1364 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861884.1 protein_id gnl|my_center|LOCUS_10220 3243 2374 gene locus_tag LOCUS_10230 3243 2374 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949053.1 protein_id gnl|my_center|LOCUS_10230 5221 3413 gene locus_tag LOCUS_10240 5221 3413 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_10240 6256 5225 gene locus_tag LOCUS_10250 6256 5225 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949055.1 protein_id gnl|my_center|LOCUS_10250 6931 6275 gene locus_tag LOCUS_10260 6931 6275 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_10260 8142 7072 gene locus_tag LOCUS_10270 8142 7072 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358407.1 protein_id gnl|my_center|LOCUS_10270 9179 10384 gene locus_tag LOCUS_10280 9179 10384 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082682.1 protein_id gnl|my_center|LOCUS_10280 10415 11398 gene locus_tag LOCUS_10290 10415 11398 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163523.1 protein_id gnl|my_center|LOCUS_10290 11432 12340 gene locus_tag LOCUS_10300 gene dapA 11432 12340 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831141.1 protein_id gnl|my_center|LOCUS_10300 12356 13123 gene locus_tag LOCUS_10310 gene dapB 12356 13123 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698231.1 protein_id gnl|my_center|LOCUS_10310 13148 13864 gene locus_tag LOCUS_10320 gene dapD 13148 13864 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485048.1 protein_id gnl|my_center|LOCUS_10320 13928 15082 gene locus_tag LOCUS_10330 13928 15082 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003789.1 protein_id gnl|my_center|LOCUS_10330 15086 16243 gene locus_tag LOCUS_10340 15086 16243 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831203.1 protein_id gnl|my_center|LOCUS_10340 16885 16358 gene locus_tag LOCUS_10350 16885 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 16995 18290 gene locus_tag LOCUS_10360 gene lysA 16995 18290 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_10360 18485 19789 gene locus_tag LOCUS_10370 18485 19789 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 protein_id gnl|my_center|LOCUS_10370 19791 20840 gene locus_tag LOCUS_10380 gene thrC 19791 20840 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392819.1 protein_id gnl|my_center|LOCUS_10380 20850 21752 gene locus_tag LOCUS_10390 gene thrB 20850 21752 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057602.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence032 241 1221 gene locus_tag LOCUS_10400 241 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461155.1 protein_id gnl|my_center|LOCUS_10400 2693 1329 gene locus_tag LOCUS_10410 2693 1329 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943755.1 protein_id gnl|my_center|LOCUS_10410 3073 4005 gene locus_tag LOCUS_10420 3073 4005 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775387.1 protein_id gnl|my_center|LOCUS_10420 4077 4799 gene locus_tag LOCUS_10430 4077 4799 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_10430 4801 5673 gene locus_tag LOCUS_10440 4801 5673 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775385.1 protein_id gnl|my_center|LOCUS_10440 5670 6788 gene locus_tag LOCUS_10450 5670 6788 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_10450 6788 7435 gene locus_tag LOCUS_10460 6788 7435 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701679.1 protein_id gnl|my_center|LOCUS_10460 7714 10320 gene locus_tag LOCUS_10470 7714 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 10766 14506 gene locus_tag LOCUS_10480 gene rpoB 10766 14506 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_10480 14585 18094 gene locus_tag LOCUS_10490 gene rpoC 14585 18094 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429485.1 protein_id gnl|my_center|LOCUS_10490 18183 18635 gene locus_tag LOCUS_10500 18183 18635 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_10500 19594 18833 gene locus_tag LOCUS_10510 19594 18833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 19912 21069 gene locus_tag LOCUS_10520 19912 21069 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence033 1355 195 gene locus_tag LOCUS_10530 gene dnaJ 1355 195 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_10530 3291 1453 gene locus_tag LOCUS_10540 gene dnaK 3291 1453 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430934.1 protein_id gnl|my_center|LOCUS_10540 4060 3434 gene locus_tag LOCUS_10550 gene grpE 4060 3434 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454752.1 protein_id gnl|my_center|LOCUS_10550 5094 4081 gene locus_tag LOCUS_10560 gene hrcA 5094 4081 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_10560 5520 6599 gene locus_tag LOCUS_10570 5520 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 7650 6979 gene locus_tag LOCUS_10580 7650 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 8186 7785 gene locus_tag LOCUS_10590 8186 7785 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_10590 8425 8252 gene locus_tag LOCUS_10600 8425 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 10307 8970 gene locus_tag LOCUS_10610 10307 8970 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676360.1 protein_id gnl|my_center|LOCUS_10610 12016 10646 gene locus_tag LOCUS_10620 12016 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 12812 12069 gene locus_tag LOCUS_10630 12812 12069 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_10630 17342 13056 gene locus_tag LOCUS_10640 17342 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 18880 17738 gene locus_tag LOCUS_10650 gene grdD 18880 17738 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 protein_id gnl|my_center|LOCUS_10650 20428 18893 gene locus_tag LOCUS_10660 gene grdC 20428 18893 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence034 243 458 gene locus_tag LOCUS_10670 243 458 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889816.1 protein_id gnl|my_center|LOCUS_10670 442 1938 gene locus_tag LOCUS_10680 442 1938 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_10680 1931 2851 gene locus_tag LOCUS_10690 1931 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10690 2860 4266 gene locus_tag LOCUS_10700 2860 4266 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 protein_id gnl|my_center|LOCUS_10700 4267 4737 gene locus_tag LOCUS_10710 4267 4737 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287700.1 protein_id gnl|my_center|LOCUS_10710 6112 4781 gene locus_tag LOCUS_10720 6112 4781 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860793.1 protein_id gnl|my_center|LOCUS_10720 6468 6118 gene locus_tag LOCUS_10730 gene mobC 6468 6118 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860794.1 protein_id gnl|my_center|LOCUS_10730 6767 6991 gene locus_tag LOCUS_10740 6767 6991 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860795.1 protein_id gnl|my_center|LOCUS_10740 7079 8047 gene locus_tag LOCUS_10750 7079 8047 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039866225.1 protein_id gnl|my_center|LOCUS_10750 8186 8788 gene locus_tag LOCUS_10760 8186 8788 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860796.1 protein_id gnl|my_center|LOCUS_10760 8973 9485 gene locus_tag LOCUS_10770 8973 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 9498 10970 gene locus_tag LOCUS_10780 9498 10970 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860798.1 protein_id gnl|my_center|LOCUS_10780 10975 12690 gene locus_tag LOCUS_10790 10975 12690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860799.1 protein_id gnl|my_center|LOCUS_10790 12691 14439 gene locus_tag LOCUS_10800 12691 14439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860800.1 protein_id gnl|my_center|LOCUS_10800 14455 15801 gene locus_tag LOCUS_10810 14455 15801 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860801.1 protein_id gnl|my_center|LOCUS_10810 16103 16513 gene locus_tag LOCUS_10820 16103 16513 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426191.1 protein_id gnl|my_center|LOCUS_10820 16974 17120 gene locus_tag LOCUS_10830 16974 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860805.1 protein_id gnl|my_center|LOCUS_10830 17182 18990 gene locus_tag LOCUS_10840 17182 18990 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860806.1 protein_id gnl|my_center|LOCUS_10840 19011 19667 gene locus_tag LOCUS_10850 19011 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence035 405 953 gene locus_tag LOCUS_10860 405 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1533 3128 gene locus_tag LOCUS_10870 gene ply 1533 3128 CDS product cholesterol-dependent cytolysin pneumolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284359.1 protein_id gnl|my_center|LOCUS_10870 3440 5050 gene locus_tag LOCUS_10880 3440 5050 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393615.1 protein_id gnl|my_center|LOCUS_10880 5301 6590 gene locus_tag LOCUS_10890 5301 6590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902660.1 protein_id gnl|my_center|LOCUS_10890 6614 7780 gene locus_tag LOCUS_10900 6614 7780 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_10900 7940 9601 gene locus_tag LOCUS_10910 7940 9601 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730693.1 protein_id gnl|my_center|LOCUS_10910 9749 10711 gene locus_tag LOCUS_10920 9749 10711 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537834.1 protein_id gnl|my_center|LOCUS_10920 10721 12388 gene locus_tag LOCUS_10930 10721 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 12385 13095 gene locus_tag LOCUS_10940 12385 13095 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770472.1 protein_id gnl|my_center|LOCUS_10940 13108 15738 gene locus_tag LOCUS_10950 13108 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 15904 16785 gene locus_tag LOCUS_10960 15904 16785 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_10960 16909 17421 gene locus_tag LOCUS_10970 16909 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775348.1 protein_id gnl|my_center|LOCUS_10970 17620 18219 gene locus_tag LOCUS_10980 17620 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 18390 18887 gene locus_tag LOCUS_10990 18390 18887 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_10990 18954 19274 gene locus_tag LOCUS_11000 18954 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 19369 20235 gene locus_tag LOCUS_11010 19369 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence036 111 1925 gene locus_tag LOCUS_11020 gene uvrC 111 1925 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_11020 1929 2870 gene locus_tag LOCUS_11030 gene hprK 1929 2870 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_11030 2998 3912 gene locus_tag LOCUS_11040 gene murB 2998 3912 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_11040 3915 4652 gene locus_tag LOCUS_11050 3915 4652 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_11050 4679 5542 gene locus_tag LOCUS_11060 gene rapZ 4679 5542 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416961.1 protein_id gnl|my_center|LOCUS_11060 5555 6706 gene locus_tag LOCUS_11070 5555 6706 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891913.1 protein_id gnl|my_center|LOCUS_11070 6742 7158 gene locus_tag LOCUS_11080 6742 7158 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_11080 7166 8131 gene locus_tag LOCUS_11090 gene whiA 7166 8131 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_11090 8178 11912 gene locus_tag LOCUS_11100 8178 11912 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_11100 12550 13521 gene locus_tag LOCUS_11110 gene pfkA 12550 13521 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_11110 13558 15315 gene locus_tag LOCUS_11120 gene pyk 13558 15315 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_11120 15621 16997 gene locus_tag LOCUS_11130 gene rlmD 15621 16997 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_11130 18313 17060 gene locus_tag LOCUS_11140 18313 17060 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_11140 19075 18437 gene locus_tag LOCUS_11150 19075 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence037 35 1369 gene locus_tag LOCUS_11160 35 1369 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_11160 1667 3358 gene locus_tag LOCUS_11170 1667 3358 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681029.1 protein_id gnl|my_center|LOCUS_11170 3526 4800 gene locus_tag LOCUS_11180 3526 4800 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681018.1 protein_id gnl|my_center|LOCUS_11180 5023 5661 gene locus_tag LOCUS_11190 5023 5661 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432265.1 protein_id gnl|my_center|LOCUS_11190 5745 6599 gene locus_tag LOCUS_11200 5745 6599 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_11200 6620 8209 gene locus_tag LOCUS_11210 6620 8209 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_11210 8272 10161 gene locus_tag LOCUS_11220 8272 10161 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_11220 10609 11457 gene locus_tag LOCUS_11230 10609 11457 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432207.1 protein_id gnl|my_center|LOCUS_11230 11636 12301 gene locus_tag LOCUS_11240 11636 12301 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888558.1 protein_id gnl|my_center|LOCUS_11240 12316 13059 gene locus_tag LOCUS_11250 12316 13059 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_11250 14283 13315 gene locus_tag LOCUS_11260 14283 13315 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065598140.1 protein_id gnl|my_center|LOCUS_11260 14689 14384 gene locus_tag LOCUS_11270 14689 14384 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130388.1 protein_id gnl|my_center|LOCUS_11270 14918 16453 gene locus_tag LOCUS_11280 gene guaA 14918 16453 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425341.1 protein_id gnl|my_center|LOCUS_11280 18050 16614 gene locus_tag LOCUS_11290 18050 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 18500 18060 gene locus_tag LOCUS_11300 18500 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence038 485 1585 gene locus_tag LOCUS_11310 485 1585 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004329798.1 protein_id gnl|my_center|LOCUS_11310 2030 4519 gene locus_tag LOCUS_11320 2030 4519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860737.1 protein_id gnl|my_center|LOCUS_11320 4522 4644 gene locus_tag LOCUS_11330 4522 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4750 4998 gene locus_tag LOCUS_11340 4750 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5144 5707 gene locus_tag LOCUS_11350 5144 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6154 6408 gene locus_tag LOCUS_11360 6154 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 6667 6542 gene locus_tag LOCUS_11370 6667 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7027 9462 gene locus_tag LOCUS_11380 7027 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 9505 10185 gene locus_tag LOCUS_11390 9505 10185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454838.1 protein_id gnl|my_center|LOCUS_11390 10270 11472 gene locus_tag LOCUS_11400 10270 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794627.1 protein_id gnl|my_center|LOCUS_11400 11542 12708 gene locus_tag LOCUS_11410 11542 12708 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_11410 14297 12873 gene locus_tag LOCUS_11420 14297 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 14886 14284 gene locus_tag LOCUS_11430 14886 14284 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163262681.1 protein_id gnl|my_center|LOCUS_11430 16260 15079 gene locus_tag LOCUS_11440 16260 15079 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892490.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence039 <1 859 gene locus_tag LOCUS_11450 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227859.1:extracellular solute-binding protein 944 1831 gene locus_tag LOCUS_11460 944 1831 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310748.1 protein_id gnl|my_center|LOCUS_11460 1828 2688 gene locus_tag LOCUS_11470 1828 2688 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_11470 3864 2797 gene locus_tag LOCUS_11480 3864 2797 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583099.1 protein_id gnl|my_center|LOCUS_11480 4190 5344 gene locus_tag LOCUS_11490 4190 5344 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359361.1 protein_id gnl|my_center|LOCUS_11490 6649 5438 gene locus_tag LOCUS_11500 6649 5438 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_11500 7305 7042 gene locus_tag LOCUS_11510 7305 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 8702 7305 gene locus_tag LOCUS_11520 gene atpD 8702 7305 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_11520 9714 8713 gene locus_tag LOCUS_11530 gene atpG 9714 8713 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_11530 11239 9740 gene locus_tag LOCUS_11540 gene atpA 11239 9740 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_11540 11798 11256 gene locus_tag LOCUS_11550 11798 11256 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_11550 12298 11798 gene locus_tag LOCUS_11560 gene atpF 12298 11798 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892033.1 protein_id gnl|my_center|LOCUS_11560 12604 12344 gene locus_tag LOCUS_11570 12604 12344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 13480 12776 gene locus_tag LOCUS_11580 gene atpB 13480 12776 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_11580 13869 13483 gene locus_tag LOCUS_11590 13869 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 14104 13874 gene locus_tag LOCUS_11600 14104 13874 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421373.1 protein_id gnl|my_center|LOCUS_11600 15219 14590 gene locus_tag LOCUS_11610 gene upp 15219 14590 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437840.1 protein_id gnl|my_center|LOCUS_11610 15859 15413 gene locus_tag LOCUS_11620 gene rpiB 15859 15413 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_11620 <16531 15889 gene locus_tag LOCUS_11630 <16531 15889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892045.1:L-threonylcarbamoyladenylate synthase >Feature sequence040 <1 1018 gene locus_tag LOCUS_11640 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986692.1:electron transfer flavoprotein subunit alpha/FixB family protein 1137 2135 gene locus_tag LOCUS_11650 1137 2135 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048233.1 protein_id gnl|my_center|LOCUS_11650 2507 3388 gene locus_tag LOCUS_11660 gene prfB 2507 3388 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11660 3715 4440 gene locus_tag LOCUS_11670 3715 4440 CDS product sulfite oxidase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963524.1 protein_id gnl|my_center|LOCUS_11670 4474 5040 gene locus_tag LOCUS_11680 4474 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5054 7045 gene locus_tag LOCUS_11690 5054 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7521 7745 gene locus_tag LOCUS_11700 7521 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11700 7809 9974 gene locus_tag LOCUS_11710 7809 9974 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_11710 9987 10802 gene locus_tag LOCUS_11720 9987 10802 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_11720 11095 11715 gene locus_tag LOCUS_11730 11095 11715 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420780.1 protein_id gnl|my_center|LOCUS_11730 11943 12860 gene locus_tag LOCUS_11740 gene ptb 11943 12860 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420701.1 protein_id gnl|my_center|LOCUS_11740 13033 13488 gene locus_tag LOCUS_11750 gene tsaE 13033 13488 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_11750 13488 14207 gene locus_tag LOCUS_11760 gene tsaB 13488 14207 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_11760 14197 14646 gene locus_tag LOCUS_11770 gene rimI 14197 14646 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_11770 14649 15668 gene locus_tag LOCUS_11780 gene tsaD 14649 15668 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence041 3 356 gene locus_tag LOCUS_11790 3 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 356 1045 gene locus_tag LOCUS_11800 356 1045 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141952.1 protein_id gnl|my_center|LOCUS_11800 1033 2424 gene locus_tag LOCUS_11810 1033 2424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229353.1 protein_id gnl|my_center|LOCUS_11810 2656 3177 gene locus_tag LOCUS_11820 2656 3177 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775293.1 protein_id gnl|my_center|LOCUS_11820 3305 4069 gene locus_tag LOCUS_11830 3305 4069 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433833.1 protein_id gnl|my_center|LOCUS_11830 4263 6356 gene locus_tag LOCUS_11840 4263 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 6425 7180 gene locus_tag LOCUS_11850 6425 7180 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922507.1 protein_id gnl|my_center|LOCUS_11850 7181 8884 gene locus_tag LOCUS_11860 7181 8884 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_11860 9174 9911 gene locus_tag LOCUS_11870 9174 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 10089 11186 gene locus_tag LOCUS_11880 gene msrB 10089 11186 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998307.1 protein_id gnl|my_center|LOCUS_11880 11906 11331 gene locus_tag LOCUS_11890 11906 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 13573 12221 gene locus_tag LOCUS_11900 13573 12221 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891344.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence042 957 199 gene locus_tag LOCUS_11910 gene pstB 957 199 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_11910 2008 1127 gene locus_tag LOCUS_11920 gene pstA 2008 1127 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049767.1 protein_id gnl|my_center|LOCUS_11920 2856 2005 gene locus_tag LOCUS_11930 gene pstC 2856 2005 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595180.1 protein_id gnl|my_center|LOCUS_11930 3878 3012 gene locus_tag LOCUS_11940 3878 3012 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669493.1 protein_id gnl|my_center|LOCUS_11940 4210 5133 gene locus_tag LOCUS_11950 4210 5133 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679981.1 protein_id gnl|my_center|LOCUS_11950 8588 5409 gene locus_tag LOCUS_11960 8588 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 10155 9112 gene locus_tag LOCUS_11970 10155 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 10770 10267 gene locus_tag LOCUS_11980 10770 10267 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905642.1 protein_id gnl|my_center|LOCUS_11980 11409 10957 gene locus_tag LOCUS_11990 11409 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 11860 11420 gene locus_tag LOCUS_12000 11860 11420 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_12000 12530 11991 gene locus_tag LOCUS_12010 12530 11991 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_12010 13293 12667 gene locus_tag LOCUS_12020 13293 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964077.1 protein_id gnl|my_center|LOCUS_12020 13498 13316 gene locus_tag LOCUS_12030 13498 13316 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_12030 14638 13787 gene locus_tag LOCUS_12040 14638 13787 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860957.1 protein_id gnl|my_center|LOCUS_12040 15313 14753 gene locus_tag LOCUS_12050 15313 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 15730 15521 gene locus_tag LOCUS_12060 15730 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence043 1001 726 gene locus_tag LOCUS_12070 1001 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1895 1023 gene locus_tag LOCUS_12080 1895 1023 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_12080 2326 3210 gene locus_tag LOCUS_12090 2326 3210 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890955.1 protein_id gnl|my_center|LOCUS_12090 3515 5518 gene locus_tag LOCUS_12100 3515 5518 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989492.1 protein_id gnl|my_center|LOCUS_12100 5950 5612 gene locus_tag LOCUS_12110 5950 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6656 5940 gene locus_tag LOCUS_12120 6656 5940 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454563.1 protein_id gnl|my_center|LOCUS_12120 6812 7720 gene locus_tag LOCUS_12130 gene prmC 6812 7720 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_12130 8039 7791 gene locus_tag LOCUS_12140 gene rpmE 8039 7791 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421397.1 protein_id gnl|my_center|LOCUS_12140 9667 8099 gene locus_tag LOCUS_12150 gene rho 9667 8099 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_12150 10703 9819 gene locus_tag LOCUS_12160 gene galU 10703 9819 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_12160 11666 10752 gene locus_tag LOCUS_12170 11666 10752 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894028.1 protein_id gnl|my_center|LOCUS_12170 11905 11666 gene locus_tag LOCUS_12180 11905 11666 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_12180 12263 11985 gene locus_tag LOCUS_12190 12263 11985 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 protein_id gnl|my_center|LOCUS_12190 13885 12446 gene locus_tag LOCUS_12200 gene mazG 13885 12446 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894031.1 protein_id gnl|my_center|LOCUS_12200 15623 14007 gene locus_tag LOCUS_12210 15623 14007 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence044 <1 856 gene locus_tag LOCUS_12220 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626354.1:glucose-1-phosphate adenylyltransferase 869 1975 gene locus_tag LOCUS_12230 gene glgD 869 1975 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_12230 2006 3430 gene locus_tag LOCUS_12240 gene glgA 2006 3430 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860977.1 protein_id gnl|my_center|LOCUS_12240 3587 5974 gene locus_tag LOCUS_12250 gene glgP 3587 5974 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494076.1 protein_id gnl|my_center|LOCUS_12250 6179 7540 gene locus_tag LOCUS_12260 6179 7540 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454447.1 protein_id gnl|my_center|LOCUS_12260 7555 8442 gene locus_tag LOCUS_12270 gene moaA 7555 8442 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889647.1 protein_id gnl|my_center|LOCUS_12270 8599 10227 gene locus_tag LOCUS_12280 8599 10227 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_12280 10406 11473 gene locus_tag LOCUS_12290 gene add 10406 11473 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454392.1 protein_id gnl|my_center|LOCUS_12290 11509 12342 gene locus_tag LOCUS_12300 11509 12342 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430209.1 protein_id gnl|my_center|LOCUS_12300 12692 12417 gene locus_tag LOCUS_12310 12692 12417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 12805 13416 gene locus_tag LOCUS_12320 12805 13416 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889720.1 protein_id gnl|my_center|LOCUS_12320 13443 13733 gene locus_tag LOCUS_12330 13443 13733 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889495.1 protein_id gnl|my_center|LOCUS_12330 13915 14346 gene locus_tag LOCUS_12340 13915 14346 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436478.1 protein_id gnl|my_center|LOCUS_12340 14312 15031 gene locus_tag LOCUS_12350 14312 15031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893181.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence045 427 1860 gene locus_tag LOCUS_12360 gene gndA 427 1860 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722503.1 protein_id gnl|my_center|LOCUS_12360 1838 3214 gene locus_tag LOCUS_12370 gene zwf 1838 3214 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_12370 3327 4253 gene locus_tag LOCUS_12380 gene trxB 3327 4253 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 protein_id gnl|my_center|LOCUS_12380 4624 5901 gene locus_tag LOCUS_12390 4624 5901 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205044.1 protein_id gnl|my_center|LOCUS_12390 6007 7431 gene locus_tag LOCUS_12400 gene purB 6007 7431 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_12400 7645 8466 gene locus_tag LOCUS_12410 7645 8466 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_12410 8489 9472 gene locus_tag LOCUS_12420 8489 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 9613 10206 gene locus_tag LOCUS_12430 9613 10206 CDS product DUF3867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419758.1 protein_id gnl|my_center|LOCUS_12430 10193 11626 gene locus_tag LOCUS_12440 10193 11626 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436985.1 protein_id gnl|my_center|LOCUS_12440 11665 12267 gene locus_tag LOCUS_12450 gene lepB 11665 12267 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861178.1 protein_id gnl|my_center|LOCUS_12450 12322 13977 gene locus_tag LOCUS_12460 12322 13977 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436982.1 protein_id gnl|my_center|LOCUS_12460 14011 14655 gene locus_tag LOCUS_12470 14011 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 14719 15189 gene locus_tag LOCUS_12480 gene trmL 14719 15189 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence046 119 418 gene locus_tag LOCUS_12490 119 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 501 1583 gene locus_tag LOCUS_12500 501 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1714 2499 gene locus_tag LOCUS_12510 1714 2499 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 protein_id gnl|my_center|LOCUS_12510 2499 3794 gene locus_tag LOCUS_12520 2499 3794 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861675.1 protein_id gnl|my_center|LOCUS_12520 3802 4914 gene locus_tag LOCUS_12530 3802 4914 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431768.1 protein_id gnl|my_center|LOCUS_12530 5050 6501 gene locus_tag LOCUS_12540 5050 6501 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_12540 6511 8076 gene locus_tag LOCUS_12550 gene murJ 6511 8076 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454106.1 protein_id gnl|my_center|LOCUS_12550 8193 9683 gene locus_tag LOCUS_12560 8193 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 9984 12149 gene locus_tag LOCUS_12570 9984 12149 CDS product cell wall-binding glycosyl-hydrolase Cwp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861673.1 protein_id gnl|my_center|LOCUS_12570 12240 13586 gene locus_tag LOCUS_12580 12240 13586 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 protein_id gnl|my_center|LOCUS_12580 14747 13770 gene locus_tag LOCUS_12590 14747 13770 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454115.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence047 <1 1063 gene locus_tag LOCUS_12600 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775555.1:recombinase family protein 1252 2055 gene locus_tag LOCUS_12610 1252 2055 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_12610 2137 3096 gene locus_tag LOCUS_12620 2137 3096 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455016.1 protein_id gnl|my_center|LOCUS_12620 3114 3875 gene locus_tag LOCUS_12630 gene aroD 3114 3875 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_12630 3997 4482 gene locus_tag LOCUS_12640 3997 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12640 4504 5793 gene locus_tag LOCUS_12650 4504 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12650 5811 6800 gene locus_tag LOCUS_12660 5811 6800 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 protein_id gnl|my_center|LOCUS_12660 7564 6911 gene locus_tag LOCUS_12670 7564 6911 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437518.1 protein_id gnl|my_center|LOCUS_12670 7719 7973 gene locus_tag LOCUS_12680 7719 7973 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_12680 7973 8134 gene locus_tag LOCUS_12690 7973 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 8437 9366 gene locus_tag LOCUS_12700 gene hemC 8437 9366 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861963.1 protein_id gnl|my_center|LOCUS_12700 9368 10870 gene locus_tag LOCUS_12710 gene cobA 9368 10870 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_12710 10907 11872 gene locus_tag LOCUS_12720 gene hemB 10907 11872 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437722.1 protein_id gnl|my_center|LOCUS_12720 11882 12364 gene locus_tag LOCUS_12730 11882 12364 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927175.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence048 <1 751 gene locus_tag LOCUS_12740 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681571.1:ABC transporter substrate-binding protein 890 1588 gene locus_tag LOCUS_12750 890 1588 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672626.1 protein_id gnl|my_center|LOCUS_12750 1712 2710 gene locus_tag LOCUS_12760 1712 2710 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681570.1 protein_id gnl|my_center|LOCUS_12760 2688 3365 gene locus_tag LOCUS_12770 2688 3365 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433829.1 protein_id gnl|my_center|LOCUS_12770 3491 4489 gene locus_tag LOCUS_12780 gene asrA 3491 4489 CDS product anaerobic sulfite reductase subunit AsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433830.1 protein_id gnl|my_center|LOCUS_12780 4491 5291 gene locus_tag LOCUS_12790 gene asrB 4491 5291 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433831.1 protein_id gnl|my_center|LOCUS_12790 5311 6282 gene locus_tag LOCUS_12800 gene asrC 5311 6282 CDS product sulfite reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433832.1 protein_id gnl|my_center|LOCUS_12800 6396 7595 gene locus_tag LOCUS_12810 6396 7595 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890744.1 protein_id gnl|my_center|LOCUS_12810 7773 9137 gene locus_tag LOCUS_12820 7773 9137 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809662.1 protein_id gnl|my_center|LOCUS_12820 9648 11000 gene locus_tag LOCUS_12830 9648 11000 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891344.1 protein_id gnl|my_center|LOCUS_12830 11211 11561 gene locus_tag LOCUS_12840 11211 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 11551 12309 gene locus_tag LOCUS_12850 11551 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 12302 12838 gene locus_tag LOCUS_12860 12302 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence049 224 1261 gene locus_tag LOCUS_12870 gene holA 224 1261 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_12870 1746 1480 gene locus_tag LOCUS_12880 gene rpsT 1746 1480 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890686.1 protein_id gnl|my_center|LOCUS_12880 1978 3783 gene locus_tag LOCUS_12890 gene lepA 1978 3783 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_12890 3797 5071 gene locus_tag LOCUS_12900 3797 5071 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_12900 5103 5963 gene locus_tag LOCUS_12910 5103 5963 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438030.1 protein_id gnl|my_center|LOCUS_12910 6036 7379 gene locus_tag LOCUS_12920 gene hemW 6036 7379 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_12920 7733 8116 gene locus_tag LOCUS_12930 7733 8116 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897539.1 protein_id gnl|my_center|LOCUS_12930 8375 9319 gene locus_tag LOCUS_12940 gene trxB 8375 9319 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_12940 9514 9831 gene locus_tag LOCUS_12950 9514 9831 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416870.1 protein_id gnl|my_center|LOCUS_12950 9997 11283 gene locus_tag LOCUS_12960 9997 11283 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_12960 11415 11891 gene locus_tag LOCUS_12970 gene grdA 11415 11891 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861535.1 transl_except (pos:11547..11549,aa:Sec) note codon on position 45 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_12970 11913 13220 gene locus_tag LOCUS_12980 gene grdB 11913 13220 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861534.1 transl_except (pos:12960..12962,aa:Sec) note codon on position 350 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_12980 >Feature sequence050 24 257 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaagtaccatataaaattacaccactctcaaac 994 323 gene locus_tag LOCUS_12990 994 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1311 991 gene locus_tag LOCUS_13000 gene cas2 1311 991 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_13000 2182 1301 gene locus_tag LOCUS_13010 gene cas1 2182 1301 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_13010 6318 2185 gene locus_tag LOCUS_13020 gene cas9 6318 2185 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_13020 6637 6482 gene locus_tag LOCUS_13030 6637 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7865 6639 gene locus_tag LOCUS_13040 7865 6639 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_13040 8535 7858 gene locus_tag LOCUS_13050 8535 7858 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_13050 9012 9734 gene locus_tag LOCUS_13060 9012 9734 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_13060 9727 10404 gene locus_tag LOCUS_13070 9727 10404 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_13070 10498 12546 gene locus_tag LOCUS_13080 10498 12546 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence051 <1 837 gene locus_tag LOCUS_13090 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861168.1:membrane protein 993 1415 gene locus_tag LOCUS_13100 gene ruvX 993 1415 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_13100 1484 1921 gene locus_tag LOCUS_13110 1484 1921 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419428.1 protein_id gnl|my_center|LOCUS_13110 2415 2621 gene locus_tag LOCUS_13120 2415 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2700 2894 gene locus_tag LOCUS_13130 2700 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3037 4704 gene locus_tag LOCUS_13140 3037 4704 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861169.1 protein_id gnl|my_center|LOCUS_13140 4773 5378 gene locus_tag LOCUS_13150 4773 5378 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902398.1 protein_id gnl|my_center|LOCUS_13150 5401 6123 gene locus_tag LOCUS_13160 5401 6123 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861170.1 protein_id gnl|my_center|LOCUS_13160 6515 7036 gene locus_tag LOCUS_13170 gene scpB 6515 7036 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_13170 7493 7933 gene locus_tag LOCUS_13180 7493 7933 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419459.1 protein_id gnl|my_center|LOCUS_13180 8911 8156 gene locus_tag LOCUS_13190 8911 8156 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_13190 9219 10766 gene locus_tag LOCUS_13200 gene acd 9219 10766 CDS product N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861172.1 protein_id gnl|my_center|LOCUS_13200 10933 12132 gene locus_tag LOCUS_13210 gene dltD 10933 12132 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439587.1 protein_id gnl|my_center|LOCUS_13210 12189 12377 gene locus_tag LOCUS_13220 12189 12377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence052 520 197 gene locus_tag LOCUS_13230 520 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 908 786 gene locus_tag LOCUS_13240 908 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2569 1193 gene locus_tag LOCUS_13250 2569 1193 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681330.1 protein_id gnl|my_center|LOCUS_13250 5051 2571 gene locus_tag LOCUS_13260 5051 2571 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681327.1 protein_id gnl|my_center|LOCUS_13260 5667 5071 gene locus_tag LOCUS_13270 5667 5071 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681326.1 protein_id gnl|my_center|LOCUS_13270 6233 5970 gene locus_tag LOCUS_13280 6233 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6787 6590 gene locus_tag LOCUS_13290 6787 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 7250 7026 gene locus_tag LOCUS_13300 7250 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 9747 7558 gene locus_tag LOCUS_13310 9747 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 11464 9749 gene locus_tag LOCUS_13320 11464 9749 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964267.1 protein_id gnl|my_center|LOCUS_13320 11634 11461 gene locus_tag LOCUS_13330 11634 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 11773 12258 gene locus_tag LOCUS_13340 11773 12258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence053 332 2776 gene locus_tag LOCUS_13350 gene gyrA 332 2776 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_13350 2791 3108 gene locus_tag LOCUS_13360 2791 3108 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429306.1 protein_id gnl|my_center|LOCUS_13360 3111 3518 gene locus_tag LOCUS_13370 3111 3518 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892343.1 protein_id gnl|my_center|LOCUS_13370 3518 4291 gene locus_tag LOCUS_13380 3518 4291 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_13380 5641 4430 gene locus_tag LOCUS_13390 5641 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6159 5638 gene locus_tag LOCUS_13400 6159 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 6743 6144 gene locus_tag LOCUS_13410 6743 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 7328 6753 gene locus_tag LOCUS_13420 7328 6753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_13420 8461 7445 gene locus_tag LOCUS_13430 8461 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8762 8905 gene locus_tag LOCUS_13440 8762 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 8915 9823 gene locus_tag LOCUS_13450 8915 9823 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_13450 9956 10534 gene locus_tag LOCUS_13460 9956 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 11022 12086 gene locus_tag LOCUS_13470 gene hydE 11022 12086 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868900.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence054 2878 1529 gene locus_tag LOCUS_13480 gene glmM 2878 1529 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860638.1 protein_id gnl|my_center|LOCUS_13480 3555 3001 gene locus_tag LOCUS_13490 3555 3001 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_13490 4317 3556 gene locus_tag LOCUS_13500 4317 3556 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_13500 5378 4317 gene locus_tag LOCUS_13510 5378 4317 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_13510 5613 5398 gene locus_tag LOCUS_13520 5613 5398 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_13520 6344 5667 gene locus_tag LOCUS_13530 6344 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_13530 7528 6446 gene locus_tag LOCUS_13540 gene buk 7528 6446 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_13540 8829 7915 gene locus_tag LOCUS_13550 8829 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9696 8845 gene locus_tag LOCUS_13560 gene cdaA 9696 8845 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_13560 9920 9846 gene locus_tag LOCUS_t00170 9920 9846 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 10005 9931 gene locus_tag LOCUS_t00180 10005 9931 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10087 10011 gene locus_tag LOCUS_t00190 10087 10011 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10174 10099 gene locus_tag LOCUS_t00200 10174 10099 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10259 10186 gene locus_tag LOCUS_t00210 10259 10186 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10342 10270 gene locus_tag LOCUS_t00220 10342 10270 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10430 10355 gene locus_tag LOCUS_t00230 10430 10355 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10530 10443 gene locus_tag LOCUS_t00240 10530 10443 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10614 10540 gene locus_tag LOCUS_t00250 10614 10540 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10693 10620 gene locus_tag LOCUS_t00260 10693 10620 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10775 10699 gene locus_tag LOCUS_t00270 10775 10699 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10861 10785 gene locus_tag LOCUS_t00280 10861 10785 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10969 10893 gene locus_tag LOCUS_t00290 10969 10893 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11051 10975 gene locus_tag LOCUS_t00300 11051 10975 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11136 11061 gene locus_tag LOCUS_t00310 11136 11061 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11219 11145 gene locus_tag LOCUS_t00320 11219 11145 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11303 11227 gene locus_tag LOCUS_t00330 11303 11227 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 11385 11311 gene locus_tag LOCUS_t00340 11385 11311 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11488 11405 gene locus_tag LOCUS_t00350 11488 11405 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence055 1964 105 gene locus_tag LOCUS_13570 1964 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13570 3234 2026 gene locus_tag LOCUS_13580 gene coaBC 3234 2026 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_13580 3526 3260 gene locus_tag LOCUS_13590 gene rpoZ 3526 3260 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431167.1 protein_id gnl|my_center|LOCUS_13590 4146 3520 gene locus_tag LOCUS_13600 gene gmk 4146 3520 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_13600 5065 4184 gene locus_tag LOCUS_13610 5065 4184 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 protein_id gnl|my_center|LOCUS_13610 7008 5230 gene locus_tag LOCUS_13620 7008 5230 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_13620 7608 7081 gene locus_tag LOCUS_13630 gene pyrR 7608 7081 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431186.1 protein_id gnl|my_center|LOCUS_13630 8572 7646 gene locus_tag LOCUS_13640 8572 7646 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_13640 9014 8577 gene locus_tag LOCUS_13650 gene lspA 9014 8577 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_13650 10222 9215 gene locus_tag LOCUS_13660 gene trpS 10222 9215 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_13660 11008 10298 gene locus_tag LOCUS_13670 11008 10298 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence056 2417 1746 gene locus_tag LOCUS_13680 2417 1746 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005646.1 protein_id gnl|my_center|LOCUS_13680 3494 2559 gene locus_tag LOCUS_13690 3494 2559 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430615.1 protein_id gnl|my_center|LOCUS_13690 5366 3516 gene locus_tag LOCUS_13700 5366 3516 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434025.1 protein_id gnl|my_center|LOCUS_13700 5523 6089 gene locus_tag LOCUS_13710 5523 6089 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417110.1 protein_id gnl|my_center|LOCUS_13710 6083 6679 gene locus_tag LOCUS_13720 6083 6679 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_13720 7919 6816 gene locus_tag LOCUS_13730 7919 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9553 8072 gene locus_tag LOCUS_13740 9553 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 10429 9554 gene locus_tag LOCUS_13750 10429 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 10908 10444 gene locus_tag LOCUS_13760 10908 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence057 62 718 gene locus_tag LOCUS_13770 62 718 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986925.1 protein_id gnl|my_center|LOCUS_13770 727 1866 gene locus_tag LOCUS_13780 727 1866 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012100493.1 protein_id gnl|my_center|LOCUS_13780 1896 2612 gene locus_tag LOCUS_13790 1896 2612 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_13790 2762 3232 gene locus_tag LOCUS_13800 2762 3232 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_13800 3685 4326 gene locus_tag LOCUS_13810 3685 4326 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_13810 4527 5609 gene locus_tag LOCUS_13820 4527 5609 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_13820 5749 6600 gene locus_tag LOCUS_13830 5749 6600 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811618.1 protein_id gnl|my_center|LOCUS_13830 6865 7827 gene locus_tag LOCUS_13840 gene bioB 6865 7827 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_13840 7982 9295 gene locus_tag LOCUS_13850 7982 9295 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_13850 10373 9525 gene locus_tag LOCUS_13860 10373 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435340.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence058 333 1001 gene locus_tag LOCUS_13870 333 1001 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418257.1 protein_id gnl|my_center|LOCUS_13870 1013 1795 gene locus_tag LOCUS_13880 1013 1795 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_13880 2245 1940 gene locus_tag LOCUS_13890 2245 1940 CDS product DUF5960 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072463.1 protein_id gnl|my_center|LOCUS_13890 2591 2238 gene locus_tag LOCUS_13900 2591 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775537.1 protein_id gnl|my_center|LOCUS_13900 4000 2588 gene locus_tag LOCUS_13910 4000 2588 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775538.1 protein_id gnl|my_center|LOCUS_13910 4658 4005 gene locus_tag LOCUS_13920 4658 4005 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262342.1 protein_id gnl|my_center|LOCUS_13920 5143 6174 gene locus_tag LOCUS_13930 gene pheS 5143 6174 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_13930 6207 8603 gene locus_tag LOCUS_13940 gene pheT 6207 8603 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860925.1 protein_id gnl|my_center|LOCUS_13940 8705 9280 gene locus_tag LOCUS_13950 8705 9280 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895750.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence059 159 386 gene locus_tag LOCUS_13960 gene acpP 159 386 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418905.1 protein_id gnl|my_center|LOCUS_13960 1601 591 gene locus_tag LOCUS_13970 1601 591 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437972.1 protein_id gnl|my_center|LOCUS_13970 2542 1634 gene locus_tag LOCUS_13980 2542 1634 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_13980 3418 2555 gene locus_tag LOCUS_13990 3418 2555 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418878.1 protein_id gnl|my_center|LOCUS_13990 4902 3574 gene locus_tag LOCUS_14000 4902 3574 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_14000 6218 5211 gene locus_tag LOCUS_14010 6218 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 9899 6312 gene locus_tag LOCUS_14020 9899 6312 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861080.1 protein_id gnl|my_center|LOCUS_14020 <10447 9886 gene locus_tag LOCUS_14030 <10447 9886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437948.1:exonuclease SbcCD subunit D >Feature sequence060 742 155 gene locus_tag LOCUS_14040 742 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2818 899 gene locus_tag LOCUS_14050 2818 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4308 3211 gene locus_tag LOCUS_14060 4308 3211 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892066.1 protein_id gnl|my_center|LOCUS_14060 7716 4327 gene locus_tag LOCUS_14070 gene mfd 7716 4327 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425912.1 protein_id gnl|my_center|LOCUS_14070 8289 7729 gene locus_tag LOCUS_14080 gene pth 8289 7729 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_14080 8920 8306 gene locus_tag LOCUS_14090 8920 8306 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903799.1 protein_id gnl|my_center|LOCUS_14090 10106 8937 gene locus_tag LOCUS_14100 10106 8937 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837691.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence061 816 73 gene locus_tag LOCUS_14110 816 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2073 1066 gene locus_tag LOCUS_14120 2073 1066 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357153.1 protein_id gnl|my_center|LOCUS_14120 2554 2186 gene locus_tag LOCUS_14130 gene rplL 2554 2186 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421186.1 protein_id gnl|my_center|LOCUS_14130 3151 2633 gene locus_tag LOCUS_14140 gene rplJ 3151 2633 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_14140 4092 3394 gene locus_tag LOCUS_14150 gene rplA 4092 3394 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_14150 4627 4202 gene locus_tag LOCUS_14160 gene rplK 4627 4202 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_14160 5232 4642 gene locus_tag LOCUS_14170 gene nusG 5232 4642 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421190.1 protein_id gnl|my_center|LOCUS_14170 5468 5259 gene locus_tag LOCUS_14180 gene secE 5468 5259 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429494.1 protein_id gnl|my_center|LOCUS_14180 5642 5493 gene locus_tag LOCUS_14190 gene rpmG 5642 5493 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_14190 6051 5830 gene locus_tag LOCUS_14200 6051 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 6588 6094 gene locus_tag LOCUS_14210 6588 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 8953 6956 gene locus_tag LOCUS_14220 8953 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 9782 9030 gene locus_tag LOCUS_14230 9782 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence062 2159 441 gene locus_tag LOCUS_14240 2159 441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358584.1 protein_id gnl|my_center|LOCUS_14240 3900 2149 gene locus_tag LOCUS_14250 3900 2149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682081.1 protein_id gnl|my_center|LOCUS_14250 4510 3902 gene locus_tag LOCUS_14260 4510 3902 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956720.1 protein_id gnl|my_center|LOCUS_14260 5165 4779 gene locus_tag LOCUS_14270 5165 4779 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_14270 5612 5214 gene locus_tag LOCUS_14280 5612 5214 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_14280 6188 5643 gene locus_tag LOCUS_14290 6188 5643 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_14290 7006 6596 gene locus_tag LOCUS_14300 7006 6596 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418487.1 protein_id gnl|my_center|LOCUS_14300 8863 7241 gene locus_tag LOCUS_14310 8863 7241 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437727.1 protein_id gnl|my_center|LOCUS_14310 9666 8902 gene locus_tag LOCUS_14320 gene cobK 9666 8902 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437730.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence063 561 1946 gene locus_tag LOCUS_14330 561 1946 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_14330 1958 2932 gene locus_tag LOCUS_14340 gene cbiB 1958 2932 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_14340 2929 4017 gene locus_tag LOCUS_14350 2929 4017 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861966.1 protein_id gnl|my_center|LOCUS_14350 4017 4931 gene locus_tag LOCUS_14360 4017 4931 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861965.1 protein_id gnl|my_center|LOCUS_14360 4906 5547 gene locus_tag LOCUS_14370 4906 5547 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437747.1 protein_id gnl|my_center|LOCUS_14370 5664 6815 gene locus_tag LOCUS_14380 gene cbiD 5664 6815 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861964.1 protein_id gnl|my_center|LOCUS_14380 6838 7473 gene locus_tag LOCUS_14390 6838 7473 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437741.1 protein_id gnl|my_center|LOCUS_14390 7494 8051 gene locus_tag LOCUS_14400 7494 8051 CDS product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898664.1 protein_id gnl|my_center|LOCUS_14400 8076 8828 gene locus_tag LOCUS_14410 8076 8828 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence064 43 1575 gene locus_tag LOCUS_14420 43 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4016 1755 gene locus_tag LOCUS_14430 4016 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5922 4081 gene locus_tag LOCUS_14440 5922 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 8294 6075 gene locus_tag LOCUS_14450 8294 6075 CDS product cell wall-binding protein Cwp8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861692.1 protein_id gnl|my_center|LOCUS_14450 9436 8660 gene locus_tag LOCUS_14460 9436 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence065 <1 790 gene locus_tag LOCUS_14470 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436063.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase 863 2122 gene locus_tag LOCUS_14480 gene purD 863 2122 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_14480 2115 5897 gene locus_tag LOCUS_14490 2115 5897 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860677.1 protein_id gnl|my_center|LOCUS_14490 7330 5969 gene locus_tag LOCUS_14500 7330 5969 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_14500 7461 7922 gene locus_tag LOCUS_14510 7461 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 7951 8649 gene locus_tag LOCUS_14520 7951 8649 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022236.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence066 314 724 gene locus_tag LOCUS_14530 314 724 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963442.1 protein_id gnl|my_center|LOCUS_14530 795 4103 gene locus_tag LOCUS_14540 795 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5395 4364 gene locus_tag LOCUS_14550 5395 4364 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262368.1 protein_id gnl|my_center|LOCUS_14550 5545 6411 gene locus_tag LOCUS_14560 5545 6411 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_14560 6645 7481 gene locus_tag LOCUS_14570 6645 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 7579 8997 gene locus_tag LOCUS_14580 7579 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 9102 9389 gene locus_tag LOCUS_14590 9102 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence067 2992 2507 gene locus_tag LOCUS_14600 2992 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 3883 3002 gene locus_tag LOCUS_14610 gene mreC 3883 3002 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438051.1 protein_id gnl|my_center|LOCUS_14610 4945 3896 gene locus_tag LOCUS_14620 4945 3896 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_14620 5817 5134 gene locus_tag LOCUS_14630 gene radC 5817 5134 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888913.1 protein_id gnl|my_center|LOCUS_14630 6534 7472 gene locus_tag LOCUS_14640 6534 7472 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438004.1 protein_id gnl|my_center|LOCUS_14640 7923 7717 gene locus_tag LOCUS_14650 7923 7717 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418943.1 protein_id gnl|my_center|LOCUS_14650 9441 8044 gene locus_tag LOCUS_14660 9441 8044 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896029.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence068 1521 787 gene locus_tag LOCUS_14670 1521 787 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_14670 3653 1716 gene locus_tag LOCUS_14680 gene prkC 3653 1716 CDS product PASTA domain-containing Ser/Thr kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861606.1 protein_id gnl|my_center|LOCUS_14680 4418 3666 gene locus_tag LOCUS_14690 4418 3666 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416261.1 protein_id gnl|my_center|LOCUS_14690 5479 4430 gene locus_tag LOCUS_14700 gene rlmN 5479 4430 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_14700 6858 5503 gene locus_tag LOCUS_14710 gene rsmB 6858 5503 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_14710 7651 6965 gene locus_tag LOCUS_14720 7651 6965 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_14720 8596 7664 gene locus_tag LOCUS_14730 gene fmt 8596 7664 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_14730 9045 8599 gene locus_tag LOCUS_14740 gene def 9045 8599 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_14740 <9809 9076 gene locus_tag LOCUS_14750 <9809 9076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861610.1:primosomal protein N' >Feature sequence069 78 1382 gene locus_tag LOCUS_14760 78 1382 CDS product ISL3-like element IS1476 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102866030.1 protein_id gnl|my_center|LOCUS_14760 5715 1573 gene locus_tag LOCUS_14770 5715 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7397 5883 gene locus_tag LOCUS_14780 gene murJ 7397 5883 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886330.1 protein_id gnl|my_center|LOCUS_14780 7568 8476 gene locus_tag LOCUS_14790 7568 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 8506 9030 gene locus_tag LOCUS_14800 8506 9030 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence070 3306 733 gene locus_tag LOCUS_14810 3306 733 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068835.1 protein_id gnl|my_center|LOCUS_14810 4198 3680 gene locus_tag LOCUS_14820 4198 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 5099 4221 gene locus_tag LOCUS_14830 5099 4221 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_14830 5246 5115 gene locus_tag LOCUS_14840 5246 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14840 6261 5452 gene locus_tag LOCUS_14850 6261 5452 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861366.1 protein_id gnl|my_center|LOCUS_14850 6800 6306 gene locus_tag LOCUS_14860 6800 6306 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680355.1 protein_id gnl|my_center|LOCUS_14860 8770 7436 gene locus_tag LOCUS_14870 8770 7436 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860801.1 protein_id gnl|my_center|LOCUS_14870 <9503 8786 gene locus_tag LOCUS_14880 <9503 8786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860800.1:ABC transporter ATP-binding protein >Feature sequence071 <1 2664 gene locus_tag LOCUS_14890 <1 2664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000822370.1:pilin N-terminal domain-containing protein 3397 2891 gene locus_tag LOCUS_14900 gene tpx 3397 2891 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 protein_id gnl|my_center|LOCUS_14900 3722 4555 gene locus_tag LOCUS_14910 3722 4555 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_14910 4874 5464 gene locus_tag LOCUS_14920 4874 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016974.1 protein_id gnl|my_center|LOCUS_14920 5535 5918 gene locus_tag LOCUS_14930 5535 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896389.1 protein_id gnl|my_center|LOCUS_14930 6055 8265 gene locus_tag LOCUS_14940 6055 8265 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016976.1 protein_id gnl|my_center|LOCUS_14940 8268 9050 gene locus_tag LOCUS_14950 8268 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918333.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence072 2113 389 gene locus_tag LOCUS_14960 2113 389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_14960 3878 2106 gene locus_tag LOCUS_14970 3878 2106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_14970 4150 5136 gene locus_tag LOCUS_14980 4150 5136 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122904.1 protein_id gnl|my_center|LOCUS_14980 6683 5451 gene locus_tag LOCUS_14990 6683 5451 CDS product acyl-CoA thioesterase/bile acid-CoA:amino acid N-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261908.1 protein_id gnl|my_center|LOCUS_14990 7107 6673 gene locus_tag LOCUS_15000 7107 6673 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261909.1 protein_id gnl|my_center|LOCUS_15000 7456 7674 gene locus_tag LOCUS_15010 7456 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 7652 8074 gene locus_tag LOCUS_15020 7652 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 9012 8149 gene locus_tag LOCUS_15030 9012 8149 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547312.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence073 256 384 gene locus_tag LOCUS_15040 256 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 513 2246 gene locus_tag LOCUS_15050 513 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2262 2510 gene locus_tag LOCUS_15060 2262 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2510 4759 gene locus_tag LOCUS_15070 2510 4759 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775615.1 protein_id gnl|my_center|LOCUS_15070 4776 5492 gene locus_tag LOCUS_15080 4776 5492 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438100.1 protein_id gnl|my_center|LOCUS_15080 5485 6273 gene locus_tag LOCUS_15090 5485 6273 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775616.1 protein_id gnl|my_center|LOCUS_15090 6275 7000 gene locus_tag LOCUS_15100 6275 7000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775617.1 protein_id gnl|my_center|LOCUS_15100 7076 7747 gene locus_tag LOCUS_15110 7076 7747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323578.1 protein_id gnl|my_center|LOCUS_15110 7732 8817 gene locus_tag LOCUS_15120 7732 8817 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775619.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence074 1351 1091 gene locus_tag LOCUS_15130 1351 1091 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419418.1 protein_id gnl|my_center|LOCUS_15130 4255 1619 gene locus_tag LOCUS_15140 gene alaS 4255 1619 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_15140 5835 4753 gene locus_tag LOCUS_15150 gene mnmA 5835 4753 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_15150 6396 5947 gene locus_tag LOCUS_15160 6396 5947 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_15160 7792 6530 gene locus_tag LOCUS_15170 7792 6530 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861165.1 protein_id gnl|my_center|LOCUS_15170 8633 7854 gene locus_tag LOCUS_15180 gene codY 8633 7854 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence075 35 301 gene locus_tag LOCUS_15190 35 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 720 1817 gene locus_tag LOCUS_15200 gene ribD 720 1817 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284101.1 protein_id gnl|my_center|LOCUS_15200 1802 2458 gene locus_tag LOCUS_15210 1802 2458 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_15210 2575 3786 gene locus_tag LOCUS_15220 2575 3786 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_15220 3824 4291 gene locus_tag LOCUS_15230 gene ribE 3824 4291 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_15230 4882 6951 gene locus_tag LOCUS_15240 4882 6951 CDS product pilin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822370.1 protein_id gnl|my_center|LOCUS_15240 7814 7176 gene locus_tag LOCUS_15250 7814 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 8090 8758 gene locus_tag LOCUS_15260 8090 8758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence076 38 1492 gene locus_tag LOCUS_15270 38 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1691 2212 gene locus_tag LOCUS_15280 1691 2212 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_15280 2246 4495 gene locus_tag LOCUS_15290 2246 4495 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_15290 4504 4953 gene locus_tag LOCUS_15300 gene dtd 4504 4953 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_15300 4962 5588 gene locus_tag LOCUS_15310 4962 5588 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454137.1 protein_id gnl|my_center|LOCUS_15310 5588 7180 gene locus_tag LOCUS_15320 5588 7180 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_15320 7170 8432 gene locus_tag LOCUS_15330 gene hisS 7170 8432 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence077 <1 939 gene locus_tag LOCUS_15340 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861408.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA 1041 2318 gene locus_tag LOCUS_15350 1041 2318 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_15350 2840 3589 gene locus_tag LOCUS_15360 2840 3589 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485218.1 protein_id gnl|my_center|LOCUS_15360 4334 3837 gene locus_tag LOCUS_15370 4334 3837 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_15370 4944 7064 gene locus_tag LOCUS_15380 gene nrdD 4944 7064 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479384.1 protein_id gnl|my_center|LOCUS_15380 7090 7596 gene locus_tag LOCUS_15390 gene nrdG 7090 7596 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_15390 7779 8096 gene locus_tag LOCUS_15400 7779 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424083.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence078 1677 1267 gene locus_tag LOCUS_15410 1677 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2085 3572 gene locus_tag LOCUS_15420 2085 3572 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_15420 3565 4068 gene locus_tag LOCUS_15430 3565 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15430 4041 4220 gene locus_tag LOCUS_15440 4041 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5056 4313 gene locus_tag LOCUS_15450 gene pflA 5056 4313 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860950.1 protein_id gnl|my_center|LOCUS_15450 7297 5066 gene locus_tag LOCUS_15460 gene pflB 7297 5066 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence079 1655 588 gene locus_tag LOCUS_15470 gene prfA 1655 588 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_15470 3281 1986 gene locus_tag LOCUS_15480 gene brnQ 3281 1986 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861162.1 protein_id gnl|my_center|LOCUS_15480 4503 3850 gene locus_tag LOCUS_15490 4503 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5825 4506 gene locus_tag LOCUS_15500 5825 4506 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_15500 7270 6173 gene locus_tag LOCUS_15510 7270 6173 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861572.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence080 948 163 gene locus_tag LOCUS_15520 gene etfB 948 163 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_15520 2106 964 gene locus_tag LOCUS_15530 gene acdB 2106 964 CDS product putative isocaproyl-CoA dehydrogenase AcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986694.1 protein_id gnl|my_center|LOCUS_15530 3251 2130 gene locus_tag LOCUS_15540 3251 2130 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_15540 4477 3251 gene locus_tag LOCUS_15550 gene hadB 4477 3251 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986696.1 protein_id gnl|my_center|LOCUS_15550 5706 4495 gene locus_tag LOCUS_15560 5706 4495 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986697.1 protein_id gnl|my_center|LOCUS_15560 7474 6290 gene locus_tag LOCUS_15570 7474 6290 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454238.1 protein_id gnl|my_center|LOCUS_15570 <8305 7592 gene locus_tag LOCUS_15580 <8305 7592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434571.1:sigma 54-interacting transcriptional regulator >Feature sequence081 414 94 gene locus_tag LOCUS_15590 414 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1466 543 gene locus_tag LOCUS_15600 1466 543 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_15600 2572 1568 gene locus_tag LOCUS_15610 2572 1568 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861516.1 protein_id gnl|my_center|LOCUS_15610 3008 2541 gene locus_tag LOCUS_15620 3008 2541 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379854.1 protein_id gnl|my_center|LOCUS_15620 3837 3205 gene locus_tag LOCUS_15630 3837 3205 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681344.1 protein_id gnl|my_center|LOCUS_15630 4969 4040 gene locus_tag LOCUS_15640 4969 4040 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003822229.1 protein_id gnl|my_center|LOCUS_15640 8280 5119 gene locus_tag LOCUS_15650 8280 5119 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068838.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence082 1578 871 gene locus_tag LOCUS_15660 1578 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2014 1835 gene locus_tag LOCUS_15670 2014 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4515 1981 gene locus_tag LOCUS_15680 4515 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 5449 4535 gene locus_tag LOCUS_15690 5449 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5635 5483 gene locus_tag LOCUS_15700 5635 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15700 7051 5720 gene locus_tag LOCUS_15710 7051 5720 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_15710 7618 7196 gene locus_tag LOCUS_15720 7618 7196 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185623697.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence083 189 2402 gene locus_tag LOCUS_15730 189 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2844 3392 gene locus_tag LOCUS_15740 2844 3392 CDS product tryptophan transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435247.1 protein_id gnl|my_center|LOCUS_15740 5781 3604 gene locus_tag LOCUS_15750 5781 3604 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861228.1 protein_id gnl|my_center|LOCUS_15750 6126 7292 gene locus_tag LOCUS_15760 6126 7292 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence084 384 1001 gene locus_tag LOCUS_15770 384 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1601 1068 gene locus_tag LOCUS_15780 1601 1068 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891708.1 protein_id gnl|my_center|LOCUS_15780 1822 3090 gene locus_tag LOCUS_15790 1822 3090 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439074.1 protein_id gnl|my_center|LOCUS_15790 4521 3226 gene locus_tag LOCUS_15800 gene hflX 4521 3226 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_15800 5896 4535 gene locus_tag LOCUS_15810 gene hflX 5896 4535 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_15810 6212 6427 gene locus_tag LOCUS_15820 6212 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6431 7966 gene locus_tag LOCUS_15830 gene cls 6431 7966 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence085 615 1226 gene locus_tag LOCUS_15840 615 1226 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_15840 1532 5185 gene locus_tag LOCUS_15850 1532 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 5474 5887 gene locus_tag LOCUS_15860 5474 5887 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426191.1 protein_id gnl|my_center|LOCUS_15860 5948 6748 gene locus_tag LOCUS_15870 5948 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 7255 7485 gene locus_tag LOCUS_15880 7255 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence086 1440 319 gene locus_tag LOCUS_15890 1440 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3506 1656 gene locus_tag LOCUS_15900 3506 1656 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861075.1 protein_id gnl|my_center|LOCUS_15900 4925 3603 gene locus_tag LOCUS_15910 4925 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 6296 4935 gene locus_tag LOCUS_15920 6296 4935 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_15920 6570 6725 gene locus_tag LOCUS_15930 6570 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 6825 7001 gene locus_tag LOCUS_15940 6825 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 7104 7298 gene locus_tag LOCUS_15950 7104 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 7491 7679 gene locus_tag LOCUS_15960 7491 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence087 1395 340 gene locus_tag LOCUS_15970 1395 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2369 1530 gene locus_tag LOCUS_15980 2369 1530 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948217.1 protein_id gnl|my_center|LOCUS_15980 3133 2384 gene locus_tag LOCUS_15990 3133 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4088 3144 gene locus_tag LOCUS_16000 4088 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5260 4085 gene locus_tag LOCUS_16010 5260 4085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168156.1 protein_id gnl|my_center|LOCUS_16010 6331 5369 gene locus_tag LOCUS_16020 6331 5369 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550481.1 protein_id gnl|my_center|LOCUS_16020 7450 6674 gene locus_tag LOCUS_16030 7450 6674 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047711.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence088 2005 503 gene locus_tag LOCUS_16040 gene malQ 2005 503 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_16040 4063 2210 gene locus_tag LOCUS_16050 4063 2210 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 protein_id gnl|my_center|LOCUS_16050 4302 6233 gene locus_tag LOCUS_16060 gene glgB 4302 6233 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence089 <1 1315 gene locus_tag LOCUS_16070 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860793.1:relaxase/mobilization nuclease domain-containing protein 1643 1338 gene locus_tag LOCUS_16080 1643 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3909 1636 gene locus_tag LOCUS_16090 3909 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 4167 3925 gene locus_tag LOCUS_16100 4167 3925 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889816.1 protein_id gnl|my_center|LOCUS_16100 5095 4154 gene locus_tag LOCUS_16110 5095 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5896 5237 gene locus_tag LOCUS_16120 5896 5237 CDS product single-strand DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861368.1 protein_id gnl|my_center|LOCUS_16120 <6938 5938 gene locus_tag LOCUS_16130 <6938 5938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861367.1:DEAD/DEAH box helicase family protein >Feature sequence090 262 933 gene locus_tag LOCUS_16140 262 933 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424455.1 protein_id gnl|my_center|LOCUS_16140 926 1963 gene locus_tag LOCUS_16150 926 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1982 3355 gene locus_tag LOCUS_16160 1982 3355 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897252.1 protein_id gnl|my_center|LOCUS_16160 3525 5144 gene locus_tag LOCUS_16170 3525 5144 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429004.1 protein_id gnl|my_center|LOCUS_16170 5569 6135 gene locus_tag LOCUS_16180 5569 6135 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426023.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence091 435 710 gene locus_tag LOCUS_16190 435 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 722 883 gene locus_tag LOCUS_16200 722 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 834 1811 gene locus_tag LOCUS_16210 834 1811 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_16210 1852 6624 gene locus_tag LOCUS_16220 1852 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence092 3852 1696 gene locus_tag LOCUS_16230 3852 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5186 4371 gene locus_tag LOCUS_16240 5186 4371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435263.1 protein_id gnl|my_center|LOCUS_16240 6177 5164 gene locus_tag LOCUS_16250 6177 5164 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964709.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence093 630 373 gene locus_tag LOCUS_16260 630 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1304 810 gene locus_tag LOCUS_16270 1304 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966118.1 protein_id gnl|my_center|LOCUS_16270 1711 1316 gene locus_tag LOCUS_16280 1711 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16280 2299 2165 gene locus_tag LOCUS_16290 2299 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2531 2283 gene locus_tag LOCUS_16300 2531 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3128 2730 gene locus_tag LOCUS_16310 gene mutT 3128 2730 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_16310 3899 3141 gene locus_tag LOCUS_16320 3899 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4250 4011 gene locus_tag LOCUS_16330 4250 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4591 4382 gene locus_tag LOCUS_16340 4591 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5371 5204 gene locus_tag LOCUS_16350 5371 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16350 5655 5470 gene locus_tag LOCUS_16360 5655 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 <6706 5798 gene locus_tag LOCUS_16370 <6706 5798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017159.1:PDDEXK nuclease domain-containing protein >Feature sequence094 493 2484 gene locus_tag LOCUS_16380 gene tkt 493 2484 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_16380 2556 3509 gene locus_tag LOCUS_16390 2556 3509 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101851.1 protein_id gnl|my_center|LOCUS_16390 4385 3582 gene locus_tag LOCUS_16400 4385 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4705 5277 gene locus_tag LOCUS_16410 4705 5277 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966586.1 protein_id gnl|my_center|LOCUS_16410 5629 6138 gene locus_tag LOCUS_16420 5629 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence095 1482 1252 gene locus_tag LOCUS_16430 1482 1252 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_16430 1928 1710 gene locus_tag LOCUS_16440 1928 1710 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_16440 3705 2452 gene locus_tag LOCUS_16450 gene gluD 3705 2452 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420866.1 protein_id gnl|my_center|LOCUS_16450 4489 4322 gene locus_tag LOCUS_16460 4489 4322 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_16460 5343 4708 gene locus_tag LOCUS_16470 5343 4708 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_16470 <6628 5640 gene locus_tag LOCUS_16480 <6628 5640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434478.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence096 738 223 gene locus_tag LOCUS_16490 738 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1119 2162 gene locus_tag LOCUS_16500 1119 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2152 2445 gene locus_tag LOCUS_16510 2152 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 4322 2526 gene locus_tag LOCUS_16520 4322 2526 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106777216.1 protein_id gnl|my_center|LOCUS_16520 5749 4337 gene locus_tag LOCUS_16530 5749 4337 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_16530 6457 5756 gene locus_tag LOCUS_16540 6457 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence097 1473 1628 gene locus_tag LOCUS_16550 1473 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2066 4489 gene locus_tag LOCUS_16560 2066 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4559 5788 gene locus_tag LOCUS_16570 4559 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 5925 6131 gene locus_tag LOCUS_16580 5925 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence098 26 598 gene locus_tag LOCUS_16590 26 598 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_16590 752 1648 gene locus_tag LOCUS_16600 752 1648 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048127.1 protein_id gnl|my_center|LOCUS_16600 1715 2767 gene locus_tag LOCUS_16610 gene buk 1715 2767 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454677.1 protein_id gnl|my_center|LOCUS_16610 2916 3590 gene locus_tag LOCUS_16620 2916 3590 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_16620 4024 3779 gene locus_tag LOCUS_16630 4024 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417301.1 protein_id gnl|my_center|LOCUS_16630 4246 5196 gene locus_tag LOCUS_16640 4246 5196 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860742.1 protein_id gnl|my_center|LOCUS_16640 5213 6031 gene locus_tag LOCUS_16650 5213 6031 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417310.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence099 824 264 gene locus_tag LOCUS_16660 824 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1576 968 gene locus_tag LOCUS_16670 1576 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1804 1992 gene locus_tag LOCUS_16680 1804 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3585 2032 gene locus_tag LOCUS_16690 3585 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4320 3952 gene locus_tag LOCUS_16700 gene crcB 4320 3952 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_16700 5073 4363 gene locus_tag LOCUS_16710 5073 4363 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861779.1 protein_id gnl|my_center|LOCUS_16710 6058 5231 gene locus_tag LOCUS_16720 gene purR 6058 5231 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425934.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence100 2120 933 gene locus_tag LOCUS_16730 2120 933 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461380.1 protein_id gnl|my_center|LOCUS_16730 2395 2865 gene locus_tag LOCUS_16740 2395 2865 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_16740 3250 2873 gene locus_tag LOCUS_16750 gene acpS 3250 2873 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_16750 3547 4359 gene locus_tag LOCUS_16760 3547 4359 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421354.1 protein_id gnl|my_center|LOCUS_16760 4371 5309 gene locus_tag LOCUS_16770 4371 5309 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence101 649 44 gene locus_tag LOCUS_16780 649 44 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599739.1 protein_id gnl|my_center|LOCUS_16780 954 817 gene locus_tag LOCUS_16790 954 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1439 2284 gene locus_tag LOCUS_16800 1439 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4106 2559 gene locus_tag LOCUS_16810 4106 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4723 4103 gene locus_tag LOCUS_16820 4723 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16820 <5948 4724 gene locus_tag LOCUS_16830 <5948 4724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202292.1:DEAD/DEAH box helicase family protein >Feature sequence102 27 1280 gene locus_tag LOCUS_16840 27 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2400 1477 gene locus_tag LOCUS_16850 gene fba 2400 1477 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860777.1 protein_id gnl|my_center|LOCUS_16850 2722 3894 gene locus_tag LOCUS_16860 2722 3894 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454156.1 protein_id gnl|my_center|LOCUS_16860 4182 4880 gene locus_tag LOCUS_16870 4182 4880 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890976.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence103 950 1429 gene locus_tag LOCUS_16880 gene accB 950 1429 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 protein_id gnl|my_center|LOCUS_16880 1426 2799 gene locus_tag LOCUS_16890 1426 2799 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_16890 2799 3644 gene locus_tag LOCUS_16900 gene accD 2799 3644 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_16900 3649 4389 gene locus_tag LOCUS_16910 3649 4389 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 protein_id gnl|my_center|LOCUS_16910 4397 4897 gene locus_tag LOCUS_16920 4397 4897 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455488.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence104 2850 1735 gene locus_tag LOCUS_16930 gene recF 2850 1735 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429303.1 protein_id gnl|my_center|LOCUS_16930 3089 2883 gene locus_tag LOCUS_16940 3089 2883 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941132.1 protein_id gnl|my_center|LOCUS_16940 4374 3274 gene locus_tag LOCUS_16950 gene dnaN 4374 3274 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_16950 <5858 4650 gene locus_tag LOCUS_16960 <5858 4650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420483.1:chromosomal replication initiator protein DnaA >Feature sequence105 331 1341 gene locus_tag LOCUS_16970 331 1341 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_16970 1804 2988 gene locus_tag LOCUS_16980 gene metK 1804 2988 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_16980 4436 3252 gene locus_tag LOCUS_16990 4436 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence106 <1 2244 gene locus_tag LOCUS_17000 <1 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861078.1:helicase-exonuclease AddAB subunit AddB >Feature sequence107 <1 2282 gene locus_tag LOCUS_17010 <1 2282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000527121.1:YSIRK signal domain/LPXTG anchor domain surface protein 2620 4500 gene locus_tag LOCUS_17020 2620 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence108 29 370 gene locus_tag LOCUS_17030 29 370 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612791.1 protein_id gnl|my_center|LOCUS_17030 345 896 gene locus_tag LOCUS_17040 345 896 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412258.1 protein_id gnl|my_center|LOCUS_17040 1227 3719 gene locus_tag LOCUS_17050 1227 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3921 4613 gene locus_tag LOCUS_17060 3921 4613 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence109 1752 88 gene locus_tag LOCUS_17070 1752 88 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_17070 2119 1769 gene locus_tag LOCUS_17080 2119 1769 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431114.1 protein_id gnl|my_center|LOCUS_17080 2348 2536 gene locus_tag LOCUS_17090 gene rpmB 2348 2536 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_17090 4996 2624 gene locus_tag LOCUS_17100 4996 2624 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861604.1 protein_id gnl|my_center|LOCUS_17100 <5547 4968 gene locus_tag LOCUS_17110 <5547 4968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861605.1:response regulator transcription factor >Feature sequence110 <1 565 gene locus_tag LOCUS_17120 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861128.1:penicillin-binding transpeptidase domain-containing protein 611 1732 gene locus_tag LOCUS_17130 gene rodA 611 1732 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_17130 1774 3666 gene locus_tag LOCUS_17140 1774 3666 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419074.1 protein_id gnl|my_center|LOCUS_17140 3666 4364 gene locus_tag LOCUS_17150 3666 4364 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence111 401 901 gene locus_tag LOCUS_17160 401 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 913 1296 gene locus_tag LOCUS_17170 913 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1417 2364 gene locus_tag LOCUS_17180 1417 2364 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_17180 2543 2824 gene locus_tag LOCUS_17190 2543 2824 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_17190 3002 4621 gene locus_tag LOCUS_17200 gene groL 3002 4621 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence112 272 535 gene locus_tag LOCUS_17210 272 535 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_17210 601 2316 gene locus_tag LOCUS_17220 gene ptsP 601 2316 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_17220 3192 2542 gene locus_tag LOCUS_17230 3192 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861667.1 protein_id gnl|my_center|LOCUS_17230 4464 3469 gene locus_tag LOCUS_17240 4464 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence113 171 341 gene locus_tag LOCUS_17250 171 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 401 958 gene locus_tag LOCUS_17260 401 958 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_17260 1257 1610 gene locus_tag LOCUS_17270 1257 1610 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814195.1 protein_id gnl|my_center|LOCUS_17270 1802 2476 gene locus_tag LOCUS_17280 1802 2476 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_17280 2613 3146 gene locus_tag LOCUS_17290 2613 3146 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218952.1 protein_id gnl|my_center|LOCUS_17290 3540 4043 gene locus_tag LOCUS_17300 3540 4043 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_17300 4218 4763 gene locus_tag LOCUS_17310 4218 4763 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642345.1 protein_id gnl|my_center|LOCUS_17310 4927 5058 gene locus_tag LOCUS_17320 4927 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17320 >Feature sequence114 1055 294 gene locus_tag LOCUS_17330 1055 294 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775663.1 protein_id gnl|my_center|LOCUS_17330 2579 1068 gene locus_tag LOCUS_17340 2579 1068 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775664.1 protein_id gnl|my_center|LOCUS_17340 3312 2584 gene locus_tag LOCUS_17350 3312 2584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775278.1 protein_id gnl|my_center|LOCUS_17350 3786 3433 gene locus_tag LOCUS_17360 3786 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4076 3942 gene locus_tag LOCUS_17370 4076 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4327 4082 gene locus_tag LOCUS_17380 4327 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence115 462 1433 gene locus_tag LOCUS_17390 462 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1435 3243 gene locus_tag LOCUS_17400 1435 3243 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_17400 3272 4405 gene locus_tag LOCUS_17410 3272 4405 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860934.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence116 3510 1876 gene locus_tag LOCUS_17420 3510 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4154 3525 gene locus_tag LOCUS_17430 4154 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4467 4144 gene locus_tag LOCUS_17440 4467 4144 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889116.1 protein_id gnl|my_center|LOCUS_17440 4908 4810 gene locus_tag LOCUS_r00030 4908 4810 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence117 1136 1270 gene locus_tag LOCUS_17450 gene rpmH 1136 1270 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420485.1 protein_id gnl|my_center|LOCUS_17450 1358 1741 gene locus_tag LOCUS_17460 gene rnpA 1358 1741 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_17460 1999 2697 gene locus_tag LOCUS_17470 1999 2697 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_17470 2717 3478 gene locus_tag LOCUS_17480 2717 3478 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434235.1 protein_id gnl|my_center|LOCUS_17480 3660 4340 gene locus_tag LOCUS_17490 3660 4340 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence118 1309 257 gene locus_tag LOCUS_17500 1309 257 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861672.1 protein_id gnl|my_center|LOCUS_17500 1472 2260 gene locus_tag LOCUS_17510 1472 2260 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_17510 2300 3292 gene locus_tag LOCUS_17520 2300 3292 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861670.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence119 216 503 gene locus_tag LOCUS_17530 216 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3048 772 gene locus_tag LOCUS_17540 3048 772 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861457.1 protein_id gnl|my_center|LOCUS_17540 3232 3435 gene locus_tag LOCUS_17550 3232 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence120 <1 1257 gene locus_tag LOCUS_17560 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974991.1:sodium:alanine symporter family protein 1459 1782 gene locus_tag LOCUS_17570 1459 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1816 2796 gene locus_tag LOCUS_17580 1816 2796 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_17580 3068 2838 gene locus_tag LOCUS_17590 3068 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 4696 3347 gene locus_tag LOCUS_17600 gene murC 4696 3347 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence121 895 581 gene locus_tag LOCUS_17610 895 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1738 1004 gene locus_tag LOCUS_17620 1738 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 3330 1855 gene locus_tag LOCUS_17630 3330 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 3508 4386 gene locus_tag LOCUS_17640 3508 4386 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861260.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence122 201 377 gene locus_tag LOCUS_17650 201 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 400 576 gene locus_tag LOCUS_17660 400 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 582 995 gene locus_tag LOCUS_17670 582 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1983 1162 gene locus_tag LOCUS_17680 gene yaaA 1983 1162 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861343.1 protein_id gnl|my_center|LOCUS_17680 2152 2559 gene locus_tag LOCUS_17690 gene mhqR 2152 2559 CDS product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 protein_id gnl|my_center|LOCUS_17690 2696 3718 gene locus_tag LOCUS_17700 2696 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3954 4430 gene locus_tag LOCUS_17710 gene purE 3954 4430 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425290.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence123 619 17 gene locus_tag LOCUS_17720 619 17 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860796.1 protein_id gnl|my_center|LOCUS_17720 1724 756 gene locus_tag LOCUS_17730 1724 756 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039866225.1 protein_id gnl|my_center|LOCUS_17730 2099 1830 gene locus_tag LOCUS_17740 2099 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2393 2247 gene locus_tag LOCUS_17750 2393 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3292 2417 gene locus_tag LOCUS_17760 3292 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 4338 3907 gene locus_tag LOCUS_17770 4338 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence124 <1 733 gene locus_tag LOCUS_17780 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430621.1:translational GTPase TypA 2642 978 gene locus_tag LOCUS_17790 2642 978 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_17790 3314 2736 gene locus_tag LOCUS_17800 3314 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 <4597 3409 gene locus_tag LOCUS_17810 <4597 3409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435252.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence125 <1 898 gene locus_tag LOCUS_17820 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803896.1:CPBP family intramembrane metalloprotease 1566 1027 gene locus_tag LOCUS_17830 1566 1027 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_17830 2782 1640 gene locus_tag LOCUS_17840 2782 1640 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861586.1 protein_id gnl|my_center|LOCUS_17840 4417 2987 gene locus_tag LOCUS_17850 4417 2987 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680081.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence126 1279 1491 gene locus_tag LOCUS_17860 1279 1491 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885335.1 protein_id gnl|my_center|LOCUS_17860 1505 2359 gene locus_tag LOCUS_17870 1505 2359 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_17870 2352 3656 gene locus_tag LOCUS_17880 2352 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 protein_id gnl|my_center|LOCUS_17880 4108 4278 gene locus_tag LOCUS_17890 4108 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence127 2790 1873 gene locus_tag LOCUS_17900 2790 1873 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454848.1 protein_id gnl|my_center|LOCUS_17900 2957 3592 gene locus_tag LOCUS_17910 gene recX 2957 3592 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454825.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence128 351 686 gene locus_tag LOCUS_17920 351 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 1225 2085 gene locus_tag LOCUS_17930 1225 2085 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_17930 2258 3487 gene locus_tag LOCUS_17940 2258 3487 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368474.1 protein_id gnl|my_center|LOCUS_17940 3834 4424 gene locus_tag LOCUS_17950 3834 4424 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence129 <1 648 gene locus_tag LOCUS_17960 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437815.1:S41 family peptidase 718 1773 gene locus_tag LOCUS_17970 gene cobT 718 1773 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437772.1 protein_id gnl|my_center|LOCUS_17970 1796 2386 gene locus_tag LOCUS_17980 gene cobU 1796 2386 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_17980 2401 3174 gene locus_tag LOCUS_17990 gene cobS 2401 3174 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437766.1 protein_id gnl|my_center|LOCUS_17990 3204 3848 gene locus_tag LOCUS_18000 3204 3848 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861969.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence130 3978 1294 gene locus_tag LOCUS_18010 gene secA 3978 1294 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895216.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence131 1242 2201 gene locus_tag LOCUS_18020 gene pip 1242 2201 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680838.1 protein_id gnl|my_center|LOCUS_18020 2365 4155 gene locus_tag LOCUS_18030 2365 4155 CDS product aminopeptidase P family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986733.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence132 1567 353 gene locus_tag LOCUS_18040 1567 353 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_18040 2625 1687 gene locus_tag LOCUS_18050 2625 1687 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432207.1 protein_id gnl|my_center|LOCUS_18050 <4300 3158 gene locus_tag LOCUS_18060 <4300 3158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903396.1:cytochrome c biogenesis protein CcdA >Feature sequence133 2089 1421 gene locus_tag LOCUS_18070 2089 1421 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244084.1 protein_id gnl|my_center|LOCUS_18070 3702 2317 gene locus_tag LOCUS_18080 3702 2317 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667252.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence134 <1 1638 gene locus_tag LOCUS_18090 <1 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889552.1:Na+/H+ antiporter NhaC family protein 1997 2668 gene locus_tag LOCUS_18100 1997 2668 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889581.1 protein_id gnl|my_center|LOCUS_18100 2733 3899 gene locus_tag LOCUS_18110 2733 3899 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454470.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence135 <1 612 gene locus_tag LOCUS_18120 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434194.1:M18 family aminopeptidase 928 2103 gene locus_tag LOCUS_18130 928 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439078.1 protein_id gnl|my_center|LOCUS_18130 3666 2302 gene locus_tag LOCUS_18140 3666 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3968 3843 gene locus_tag LOCUS_18150 3968 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence136 606 1796 gene locus_tag LOCUS_18160 606 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425141.1 protein_id gnl|my_center|LOCUS_18160 2078 3865 gene locus_tag LOCUS_18170 gene iorA 2078 3865 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430808.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence137 149 1237 gene locus_tag LOCUS_18180 149 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2211 1363 gene locus_tag LOCUS_18190 gene panC 2211 1363 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948190.1 protein_id gnl|my_center|LOCUS_18190 3066 2233 gene locus_tag LOCUS_18200 gene panB 3066 2233 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_18200 <3814 3098 gene locus_tag LOCUS_18210 <3814 3098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002349114.1:Rossmann-like and DUF2520 domain-containing protein >Feature sequence138 347 1669 gene locus_tag LOCUS_18220 347 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1748 2578 gene locus_tag LOCUS_18230 1748 2578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922278.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence139 <1 1244 gene locus_tag LOCUS_18240 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679271.1:NAD(P)-binding protein 1238 3010 gene locus_tag LOCUS_18250 1238 3010 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence140 2581 1268 gene locus_tag LOCUS_18260 2581 1268 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_18260 3488 2631 gene locus_tag LOCUS_18270 3488 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence141 1108 818 gene locus_tag LOCUS_18280 1108 818 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894377.1 protein_id gnl|my_center|LOCUS_18280 2178 1330 gene locus_tag LOCUS_18290 2178 1330 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775391.1 protein_id gnl|my_center|LOCUS_18290 3137 2178 gene locus_tag LOCUS_18300 3137 2178 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027974.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence142 1357 917 gene locus_tag LOCUS_18310 gene ohrR 1357 917 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_18310 1916 1377 gene locus_tag LOCUS_18320 1916 1377 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_18320 2749 2288 gene locus_tag LOCUS_18330 2749 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 <3602 2963 gene locus_tag LOCUS_18340 <3602 2963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437034.1:HAMP domain-containing sensor histidine kinase >Feature sequence143 1520 966 gene locus_tag LOCUS_18350 1520 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3327 1510 gene locus_tag LOCUS_18360 3327 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence144 227 1177 gene locus_tag LOCUS_18370 gene fabD 227 1177 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_18370 1190 1939 gene locus_tag LOCUS_18380 gene fabG 1190 1939 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_18380 1965 3200 gene locus_tag LOCUS_18390 gene fabF 1965 3200 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence145 2697 1225 gene locus_tag LOCUS_18400 2697 1225 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860798.1 protein_id gnl|my_center|LOCUS_18400 3401 2709 gene locus_tag LOCUS_18410 3401 2709 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860797.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence146 1721 189 gene locus_tag LOCUS_18420 gene purH 1721 189 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436063.1 protein_id gnl|my_center|LOCUS_18420 2374 1781 gene locus_tag LOCUS_18430 gene purN 2374 1781 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_18430 <3448 2392 gene locus_tag LOCUS_18440 <3448 2392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895312.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence147 27 674 gene locus_tag LOCUS_18450 27 674 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434506.1 protein_id gnl|my_center|LOCUS_18450 674 1576 gene locus_tag LOCUS_18460 674 1576 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860662.1 protein_id gnl|my_center|LOCUS_18460 1636 2220 gene locus_tag LOCUS_18470 gene pyrE 1636 2220 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420885.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence148 1261 74 gene locus_tag LOCUS_18480 1261 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2084 1272 gene locus_tag LOCUS_18490 2084 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2877 2107 gene locus_tag LOCUS_18500 2877 2107 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_18500 <3412 2891 gene locus_tag LOCUS_18510 <3412 2891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891044.1:sugar transferase >Feature sequence149 1797 58 gene locus_tag LOCUS_18520 1797 58 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681164.1 protein_id gnl|my_center|LOCUS_18520 2507 1935 gene locus_tag LOCUS_18530 2507 1935 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681165.1 protein_id gnl|my_center|LOCUS_18530 2806 3156 gene locus_tag LOCUS_18540 gene mobC 2806 3156 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426139.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence150 224 2581 gene locus_tag LOCUS_18550 224 2581 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437942.1 protein_id gnl|my_center|LOCUS_18550 2574 3275 gene locus_tag LOCUS_18560 2574 3275 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428590.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence151 32 331 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagagtggtgtaattttatatggtacttaaac 487 768 gene locus_tag LOCUS_18570 487 768 CDS product CD1845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860780.1 protein_id gnl|my_center|LOCUS_18570 845 1882 gene locus_tag LOCUS_18580 845 1882 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861353.1 protein_id gnl|my_center|LOCUS_18580 1882 2367 gene locus_tag LOCUS_18590 1882 2367 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861354.1 protein_id gnl|my_center|LOCUS_18590 2364 2678 gene locus_tag LOCUS_18600 2364 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18600 2721 2933 gene locus_tag LOCUS_18610 2721 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18610 >Feature sequence152 1414 2727 gene locus_tag LOCUS_18620 1414 2727 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430579.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence153 <1 1998 gene locus_tag LOCUS_18630 <1 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434402.1:ATP-dependent RecD-like DNA helicase 2032 2823 gene locus_tag LOCUS_18640 2032 2823 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860641.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence154 14 637 gene locus_tag LOCUS_18650 14 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 816 1541 gene locus_tag LOCUS_18660 816 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence155 <2783 981 gene locus_tag LOCUS_18670 <2783 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888186.1:DUF3553 domain-containing protein >Feature sequence156 1530 1240 gene locus_tag LOCUS_18680 gene rpmA 1530 1240 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419086.1 protein_id gnl|my_center|LOCUS_18680 1861 1544 gene locus_tag LOCUS_18690 1861 1544 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438074.1 protein_id gnl|my_center|LOCUS_18690 2179 1871 gene locus_tag LOCUS_18700 gene rplU 2179 1871 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence157 <1 1201 gene locus_tag LOCUS_18710 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000087552.1:CoA-disulfide reductase 1219 2034 gene locus_tag LOCUS_18720 1219 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2133 2387 gene locus_tag LOCUS_18730 2133 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence158 >Feature sequence159 1851 1099 gene locus_tag LOCUS_18740 1851 1099 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_18740 2433 1876 gene locus_tag LOCUS_18750 2433 1876 CDS product decarboxylating cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898664.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence160 >Feature sequence161 1085 171 gene locus_tag LOCUS_18760 gene pyrB 1085 171 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434504.1 protein_id gnl|my_center|LOCUS_18760 1472 1329 gene locus_tag LOCUS_18770 1472 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 <2585 1490 gene locus_tag LOCUS_18780 <2585 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460242.1:ferrous iron transport protein B >Feature sequence162 >Feature sequence163 74 661 gene locus_tag LOCUS_18790 74 661 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_18790 873 1466 gene locus_tag LOCUS_18800 873 1466 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_18800 1788 2009 gene locus_tag LOCUS_18810 1788 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2026 2253 gene locus_tag LOCUS_18820 2026 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2314 2463 gene locus_tag LOCUS_18830 2314 2463 CDS product YvrJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890850.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence164 421 2142 gene locus_tag LOCUS_18840 421 2142 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence165 <1 652 gene locus_tag LOCUS_18850 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891005.1:AarF/ABC1/UbiB kinase family protein >Feature sequence166 364 582 gene locus_tag LOCUS_18860 364 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 929 2329 gene locus_tag LOCUS_18870 929 2329 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362447.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence167 2092 1235 gene locus_tag LOCUS_18880 2092 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence168 65 1066 gene locus_tag LOCUS_18890 65 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence169 <1 1277 gene locus_tag LOCUS_18900 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438072.1:Rne/Rng family ribonuclease 1337 1513 gene locus_tag LOCUS_18910 1337 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 <2180 1671 gene locus_tag LOCUS_18920 <2180 1671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671107.1:[FeFe] hydrogenase, group A >Feature sequence170 1274 36 gene locus_tag LOCUS_18930 1274 36 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437948.1 protein_id gnl|my_center|LOCUS_18930 2069 1326 gene locus_tag LOCUS_18940 2069 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940