>Feature sequence001 2450 894 gene locus_tag LOCUS_00010 gene purH 2450 894 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_00010 2652 4616 gene locus_tag LOCUS_00020 gene treZ 2652 4616 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_00020 4960 4808 gene locus_tag LOCUS_00030 4960 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4959 6215 gene locus_tag LOCUS_00040 gene glgC 4959 6215 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544940.1 protein_id gnl|my_center|LOCUS_00040 6319 7767 gene locus_tag LOCUS_00050 6319 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00050 7712 7721 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7764 9236 gene locus_tag LOCUS_00060 7764 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 9233 9463 gene locus_tag LOCUS_00070 9233 9463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10450 9452 gene locus_tag LOCUS_00080 10450 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10790 10608 gene locus_tag LOCUS_00090 10790 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13152 10900 gene locus_tag LOCUS_00100 13152 10900 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_00100 13304 13230 gene locus_tag LOCUS_t00010 13304 13230 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13609 14481 gene locus_tag LOCUS_00110 gene ubiA 13609 14481 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388330.1 protein_id gnl|my_center|LOCUS_00110 15600 14575 gene locus_tag LOCUS_00120 15600 14575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16451 15615 gene locus_tag LOCUS_00130 16451 15615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16921 16529 gene locus_tag LOCUS_00140 16921 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17666 16941 gene locus_tag LOCUS_00150 17666 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18291 17686 gene locus_tag LOCUS_00160 18291 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20256 18331 gene locus_tag LOCUS_00170 20256 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20615 20253 gene locus_tag LOCUS_00180 20615 20253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21425 20622 gene locus_tag LOCUS_00190 21425 20622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22559 21429 gene locus_tag LOCUS_00200 22559 21429 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_00200 23506 22562 gene locus_tag LOCUS_00210 23506 22562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 24349 23528 gene locus_tag LOCUS_00220 24349 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26073 24346 gene locus_tag LOCUS_00230 26073 24346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26658 26137 gene locus_tag LOCUS_00240 26658 26137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27634 27254 gene locus_tag LOCUS_00250 27634 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28660 27644 gene locus_tag LOCUS_00260 gene hpnH 28660 27644 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_00260 29007 28932 gene locus_tag LOCUS_t00020 29007 28932 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 31312 30062 gene locus_tag LOCUS_00270 gene ispG 31312 30062 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_00270 33228 31330 gene locus_tag LOCUS_00280 gene dxs 33228 31330 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_00280 33981 33355 gene locus_tag LOCUS_00290 33981 33355 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941479.1 protein_id gnl|my_center|LOCUS_00290 34862 34026 gene locus_tag LOCUS_00300 34862 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36879 34873 gene locus_tag LOCUS_00310 gene shc 36879 34873 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_00310 37770 37327 gene locus_tag LOCUS_00320 37770 37327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39811 37841 gene locus_tag LOCUS_00330 39811 37841 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_00330 41179 39830 gene locus_tag LOCUS_00340 gene dnaB 41179 39830 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_00340 42452 41166 gene locus_tag LOCUS_00350 42452 41166 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943919.1 protein_id gnl|my_center|LOCUS_00350 44159 42549 gene locus_tag LOCUS_00360 gene serA 44159 42549 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_00360 45252 44170 gene locus_tag LOCUS_00370 gene serC 45252 44170 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393775.1 protein_id gnl|my_center|LOCUS_00370 45701 46522 gene locus_tag LOCUS_00380 45701 46522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 46513 47907 gene locus_tag LOCUS_00390 gene rfbH 46513 47907 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_00390 48014 48283 gene locus_tag LOCUS_00400 48014 48283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 49341 48316 gene locus_tag LOCUS_00410 49341 48316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50901 49408 gene locus_tag LOCUS_00420 50901 49408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51136 52671 gene locus_tag LOCUS_00430 51136 52671 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_00430 52850 54460 gene locus_tag LOCUS_00440 gene lnt 52850 54460 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_00440 54655 55563 gene locus_tag LOCUS_00450 gene prfB 54655 55563 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 55786 57273 gene locus_tag LOCUS_00460 gene lysS 55786 57273 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_00460 57270 58523 gene locus_tag LOCUS_00470 57270 58523 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_00470 58520 59257 gene locus_tag LOCUS_00480 58520 59257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_00480 60005 59262 gene locus_tag LOCUS_00490 60005 59262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 60450 61325 gene locus_tag LOCUS_00500 gene bacA 60450 61325 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707770.1 protein_id gnl|my_center|LOCUS_00500 62204 61413 gene locus_tag LOCUS_00510 62204 61413 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404263.1 protein_id gnl|my_center|LOCUS_00510 62799 62392 gene locus_tag LOCUS_00520 62799 62392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63762 62902 gene locus_tag LOCUS_00530 63762 62902 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_00530 65109 63766 gene locus_tag LOCUS_00540 65109 63766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 66057 65113 gene locus_tag LOCUS_00550 66057 65113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 66276 66602 gene locus_tag LOCUS_00560 66276 66602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 67384 66659 gene locus_tag LOCUS_00570 67384 66659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 68099 67422 gene locus_tag LOCUS_00580 68099 67422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 68337 68152 gene locus_tag LOCUS_00590 68337 68152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69399 68440 gene locus_tag LOCUS_00600 gene xerD 69399 68440 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942464.1 protein_id gnl|my_center|LOCUS_00600 69679 71514 gene locus_tag LOCUS_00610 69679 71514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 71534 72238 gene locus_tag LOCUS_00620 71534 72238 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942478.1 protein_id gnl|my_center|LOCUS_00620 72275 73249 gene locus_tag LOCUS_00630 gene trpS 72275 73249 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_00630 73420 74427 gene locus_tag LOCUS_00640 gene gap 73420 74427 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546818.1 protein_id gnl|my_center|LOCUS_00640 74497 75690 gene locus_tag LOCUS_00650 74497 75690 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545367.1 protein_id gnl|my_center|LOCUS_00650 75778 76506 gene locus_tag LOCUS_00660 gene tpiA 75778 76506 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_00660 76524 77069 gene locus_tag LOCUS_00670 76524 77069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 78124 77210 gene locus_tag LOCUS_00680 78124 77210 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_00680 78817 79503 gene locus_tag LOCUS_00690 78817 79503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79630 79887 gene locus_tag LOCUS_00700 gene rpmA 79630 79887 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_00700 79974 80984 gene locus_tag LOCUS_00710 gene obgE 79974 80984 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_00710 80981 82105 gene locus_tag LOCUS_00720 gene proB 80981 82105 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_00720 82115 82837 gene locus_tag LOCUS_00730 gene nadD 82115 82837 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_00730 82906 83268 gene locus_tag LOCUS_00740 82906 83268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 83320 84345 gene locus_tag LOCUS_00750 gene bioB 83320 84345 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920732.1 protein_id gnl|my_center|LOCUS_00750 84510 84322 gene locus_tag LOCUS_00760 84510 84322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 84581 84946 gene locus_tag LOCUS_00770 84581 84946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 85911 84985 gene locus_tag LOCUS_00780 85911 84985 CDS product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130679.1 protein_id gnl|my_center|LOCUS_00780 86139 86906 gene locus_tag LOCUS_00790 86139 86906 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_00790 87594 86962 gene locus_tag LOCUS_00800 gene cysC 87594 86962 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_00800 87961 88845 gene locus_tag LOCUS_00810 87961 88845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 89300 89788 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 90717 89860 gene locus_tag LOCUS_00820 90717 89860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 91746 90745 gene locus_tag LOCUS_00830 91746 90745 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331384.1 protein_id gnl|my_center|LOCUS_00830 92800 91727 gene locus_tag LOCUS_00840 gene gmd 92800 91727 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868774.1 protein_id gnl|my_center|LOCUS_00840 93184 92954 gene locus_tag LOCUS_00850 93184 92954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 93083 93355 gene locus_tag LOCUS_00860 93083 93355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 93482 94450 gene locus_tag LOCUS_00870 93482 94450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 95906 94614 gene locus_tag LOCUS_00880 95906 94614 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533497.1 protein_id gnl|my_center|LOCUS_00880 96035 98026 gene locus_tag LOCUS_00890 96035 98026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 98218 99468 gene locus_tag LOCUS_00900 98218 99468 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065081.1 protein_id gnl|my_center|LOCUS_00900 100213 99641 gene locus_tag LOCUS_00910 100213 99641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00910 100842 100210 gene locus_tag LOCUS_00920 100842 100210 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_00920 100982 100764 gene locus_tag LOCUS_00930 100982 100764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 101493 101107 gene locus_tag LOCUS_00940 101493 101107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 >Feature sequence002 99 752 gene locus_tag LOCUS_00950 99 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 840 1220 gene locus_tag LOCUS_00960 gene crcB 840 1220 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871047.1 protein_id gnl|my_center|LOCUS_00960 2298 1252 gene locus_tag LOCUS_00970 2298 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 2456 3124 gene locus_tag LOCUS_00980 gene coaE 2456 3124 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219305.1 protein_id gnl|my_center|LOCUS_00980 3180 4097 gene locus_tag LOCUS_00990 gene trxB 3180 4097 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_00990 4097 5287 gene locus_tag LOCUS_01000 gene thiI 4097 5287 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_01000 5392 6207 gene locus_tag LOCUS_01010 5392 6207 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920216.1 protein_id gnl|my_center|LOCUS_01010 7223 6381 gene locus_tag LOCUS_01020 7223 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 7363 8136 gene locus_tag LOCUS_01030 gene fabG 7363 8136 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_01030 8130 8897 gene locus_tag LOCUS_01040 gene bioD 8130 8897 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_01040 9507 8854 gene locus_tag LOCUS_01050 9507 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 10883 9534 gene locus_tag LOCUS_01060 gene accC 10883 9534 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942662.1 protein_id gnl|my_center|LOCUS_01060 11404 10925 gene locus_tag LOCUS_01070 gene accB 11404 10925 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141286.1 protein_id gnl|my_center|LOCUS_01070 11977 11414 gene locus_tag LOCUS_01080 gene efp 11977 11414 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_01080 12491 12018 gene locus_tag LOCUS_01090 gene aroQ 12491 12018 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_01090 13394 12756 gene locus_tag LOCUS_01100 13394 12756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 14079 13339 gene locus_tag LOCUS_01110 14079 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 13375 13384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14711 14520 gene locus_tag LOCUS_01120 14711 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 15329 14865 gene locus_tag LOCUS_01130 15329 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 15921 15568 gene locus_tag LOCUS_01140 15921 15568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 16215 16127 gene locus_tag LOCUS_t00030 16215 16127 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17430 16423 gene locus_tag LOCUS_01150 17430 16423 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259096.1 protein_id gnl|my_center|LOCUS_01150 17598 17894 gene locus_tag LOCUS_01160 17598 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 18760 18572 gene locus_tag LOCUS_01170 18760 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 19708 18830 gene locus_tag LOCUS_01180 gene proC 19708 18830 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_01180 19987 21093 gene locus_tag LOCUS_01190 19987 21093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 21287 22390 gene locus_tag LOCUS_01200 21287 22390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 22467 22928 gene locus_tag LOCUS_01210 22467 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 23124 23294 gene locus_tag LOCUS_01220 23124 23294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 23455 25023 gene locus_tag LOCUS_01230 23455 25023 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_01230 25135 27021 gene locus_tag LOCUS_01240 gene acs 25135 27021 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_01240 28962 27289 gene locus_tag LOCUS_01250 28962 27289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 29733 29910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30785 31789 gene locus_tag LOCUS_01260 30785 31789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_01260 31786 32556 gene locus_tag LOCUS_01270 31786 32556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 32547 34079 gene locus_tag LOCUS_01280 32547 34079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 34087 35457 gene locus_tag LOCUS_01290 34087 35457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 35710 35501 gene locus_tag LOCUS_01300 35710 35501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 35747 36604 gene locus_tag LOCUS_01310 gene nirK 35747 36604 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_01310 37034 36714 gene locus_tag LOCUS_01320 37034 36714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 37295 37930 gene locus_tag LOCUS_01330 37295 37930 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070698.1 protein_id gnl|my_center|LOCUS_01330 38042 38254 gene locus_tag LOCUS_01340 38042 38254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 39046 38234 gene locus_tag LOCUS_01350 39046 38234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 40209 39118 gene locus_tag LOCUS_01360 gene rfbB 40209 39118 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548761.1 protein_id gnl|my_center|LOCUS_01360 41099 40179 gene locus_tag LOCUS_01370 gene rfbD 41099 40179 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_01370 41659 41096 gene locus_tag LOCUS_01380 gene rfbC 41659 41096 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_01380 42540 41659 gene locus_tag LOCUS_01390 gene rfbA 42540 41659 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 protein_id gnl|my_center|LOCUS_01390 42731 42821 gene locus_tag LOCUS_t00040 42731 42821 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 43286 42936 gene locus_tag LOCUS_01400 43286 42936 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_01400 44480 43479 gene locus_tag LOCUS_01410 44480 43479 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525200.1 protein_id gnl|my_center|LOCUS_01410 44828 45640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 46526 45699 gene locus_tag LOCUS_01420 46526 45699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 48110 46998 gene locus_tag LOCUS_01430 48110 46998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 48888 48091 gene locus_tag LOCUS_01440 48888 48091 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_01440 49776 48937 gene locus_tag LOCUS_01450 49776 48937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 50967 49855 gene locus_tag LOCUS_01460 50967 49855 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_01460 51774 50995 gene locus_tag LOCUS_01470 51774 50995 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942894.1 protein_id gnl|my_center|LOCUS_01470 52937 51885 gene locus_tag LOCUS_01480 gene waaC 52937 51885 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_01480 53555 52971 gene locus_tag LOCUS_01490 gene gmhB 53555 52971 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_01490 54588 53587 gene locus_tag LOCUS_01500 gene waaF 54588 53587 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_01500 55762 54728 gene locus_tag LOCUS_01510 gene lpxK 55762 54728 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_01510 57119 55821 gene locus_tag LOCUS_01520 57119 55821 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_01520 57428 57225 gene locus_tag LOCUS_01530 57428 57225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 57880 57389 gene locus_tag LOCUS_01540 57880 57389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01540 59662 57902 gene locus_tag LOCUS_01550 gene msbA 59662 57902 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_01550 60786 59650 gene locus_tag LOCUS_01560 gene lpxB 60786 59650 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_01560 61770 60790 gene locus_tag LOCUS_01570 61770 60790 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_01570 62767 61913 gene locus_tag LOCUS_01580 gene lpxI 62767 61913 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_01580 63598 62780 gene locus_tag LOCUS_01590 gene lpxA 63598 62780 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_01590 64107 63628 gene locus_tag LOCUS_01600 gene fabZ 64107 63628 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_01600 64772 64206 gene locus_tag LOCUS_01610 64772 64206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 67082 64839 gene locus_tag LOCUS_01620 gene bamA 67082 64839 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_01620 67156 67431 gene locus_tag LOCUS_01630 67156 67431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 67764 70229 gene locus_tag LOCUS_01640 gene lon 67764 70229 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_01640 70577 71635 gene locus_tag LOCUS_01650 gene thiL 70577 71635 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_01650 71769 73154 gene locus_tag LOCUS_01660 71769 73154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 75521 73197 gene locus_tag LOCUS_01670 gene lptD 75521 73197 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792614.1 protein_id gnl|my_center|LOCUS_01670 76803 75502 gene locus_tag LOCUS_01680 76803 75502 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_01680 77778 76903 gene locus_tag LOCUS_01690 gene accD 77778 76903 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_01690 79099 78041 gene locus_tag LOCUS_01700 gene moaA 79099 78041 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900633.1 protein_id gnl|my_center|LOCUS_01700 79560 79096 gene locus_tag LOCUS_01710 79560 79096 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_01710 79834 79553 gene locus_tag LOCUS_01720 79834 79553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence003 800 875 gene locus_tag LOCUS_t00050 800 875 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1451 933 gene locus_tag LOCUS_01730 1451 933 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_01730 2545 1568 gene locus_tag LOCUS_01740 2545 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3930 2830 gene locus_tag LOCUS_01750 3930 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4718 3987 gene locus_tag LOCUS_01760 gene tatC 4718 3987 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_01760 5004 4762 gene locus_tag LOCUS_01770 5004 4762 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_01770 5506 4994 gene locus_tag LOCUS_01780 gene rimI 5506 4994 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216075.1 protein_id gnl|my_center|LOCUS_01780 6224 5568 gene locus_tag LOCUS_01790 gene tsaB 6224 5568 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_01790 7230 6325 gene locus_tag LOCUS_01800 7230 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 8656 7235 gene locus_tag LOCUS_01810 gene radA 8656 7235 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_01810 9809 8967 gene locus_tag LOCUS_01820 9809 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 10032 9856 gene locus_tag LOCUS_01830 10032 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 10714 10103 gene locus_tag LOCUS_01840 10714 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 12051 11767 gene locus_tag LOCUS_01850 12051 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12394 12113 gene locus_tag LOCUS_01860 12394 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 12783 12403 gene locus_tag LOCUS_01870 12783 12403 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545617.1 protein_id gnl|my_center|LOCUS_01870 13026 12907 gene locus_tag LOCUS_01880 13026 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 13742 13086 gene locus_tag LOCUS_01890 gene ribE 13742 13086 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493840.1 protein_id gnl|my_center|LOCUS_01890 13881 13735 gene locus_tag LOCUS_01900 13881 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 15115 13919 gene locus_tag LOCUS_01910 15115 13919 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_01910 15379 17187 gene locus_tag LOCUS_01920 15379 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 17238 18374 gene locus_tag LOCUS_01930 17238 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 18818 18453 gene locus_tag LOCUS_01940 18818 18453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 19690 18848 gene locus_tag LOCUS_01950 19690 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 21190 19757 gene locus_tag LOCUS_01960 gene mgtE 21190 19757 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 protein_id gnl|my_center|LOCUS_01960 22084 21197 gene locus_tag LOCUS_01970 gene era 22084 21197 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_01970 22459 22157 gene locus_tag LOCUS_01980 22459 22157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 23814 22519 gene locus_tag LOCUS_01990 gene eno 23814 22519 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_01990 24530 23856 gene locus_tag LOCUS_02000 24530 23856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 26050 24623 gene locus_tag LOCUS_02010 gene gatB 26050 24623 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_02010 26376 26047 gene locus_tag LOCUS_02020 26376 26047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 26785 26369 gene locus_tag LOCUS_02030 26785 26369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 28331 26862 gene locus_tag LOCUS_02040 gene gatA 28331 26862 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_02040 29181 28336 gene locus_tag LOCUS_02050 29181 28336 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257127.1 protein_id gnl|my_center|LOCUS_02050 31782 29248 gene locus_tag LOCUS_02060 31782 29248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 32290 31892 gene locus_tag LOCUS_02070 32290 31892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 33830 32862 gene locus_tag LOCUS_02080 33830 32862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 35065 33956 gene locus_tag LOCUS_02090 35065 33956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 35264 35070 gene locus_tag LOCUS_02100 35264 35070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 37199 35496 gene locus_tag LOCUS_02110 37199 35496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 39226 37502 gene locus_tag LOCUS_02120 39226 37502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 40970 39231 gene locus_tag LOCUS_02130 40970 39231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 41334 41179 gene locus_tag LOCUS_02140 41334 41179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02140 41540 41325 gene locus_tag LOCUS_02150 41540 41325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02150 41864 41562 gene locus_tag LOCUS_02160 gene gatC 41864 41562 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_02160 42382 42654 gene locus_tag LOCUS_02170 42382 42654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 42805 43389 gene locus_tag LOCUS_02180 42805 43389 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_02180 43470 45233 gene locus_tag LOCUS_02190 gene aepX 43470 45233 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525540.1 protein_id gnl|my_center|LOCUS_02190 45291 46133 gene locus_tag LOCUS_02200 45291 46133 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947778.1 protein_id gnl|my_center|LOCUS_02200 46332 48056 gene locus_tag LOCUS_02210 46332 48056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 48123 48764 gene locus_tag LOCUS_02220 48123 48764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 48778 49629 gene locus_tag LOCUS_02230 48778 49629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 52442 49701 gene locus_tag LOCUS_02240 52442 49701 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_02240 52538 52744 gene locus_tag LOCUS_02250 52538 52744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 55119 52633 gene locus_tag LOCUS_02260 55119 52633 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_02260 56372 55293 gene locus_tag LOCUS_02270 56372 55293 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_02270 57462 56539 gene locus_tag LOCUS_02280 57462 56539 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_02280 58806 57472 gene locus_tag LOCUS_02290 58806 57472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 59744 59010 gene locus_tag LOCUS_02300 59744 59010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 60870 59755 gene locus_tag LOCUS_02310 60870 59755 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_02310 60973 61185 gene locus_tag LOCUS_02320 60973 61185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 61280 62179 gene locus_tag LOCUS_02330 gene gnd 61280 62179 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_02330 62207 63748 gene locus_tag LOCUS_02340 gene zwf 62207 63748 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_02340 65484 63757 gene locus_tag LOCUS_02350 65484 63757 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109316.1 protein_id gnl|my_center|LOCUS_02350 68483 65631 gene locus_tag LOCUS_02360 68483 65631 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_02360 70650 68572 gene locus_tag LOCUS_02370 gene tkt 70650 68572 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_02370 72008 71262 gene locus_tag LOCUS_02380 72008 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 72330 71986 gene locus_tag LOCUS_02390 72330 71986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence004 1387 161 gene locus_tag LOCUS_02400 1387 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1867 1622 gene locus_tag LOCUS_02410 1867 1622 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_02410 2424 1894 gene locus_tag LOCUS_02420 2424 1894 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229885.1 protein_id gnl|my_center|LOCUS_02420 2672 3586 gene locus_tag LOCUS_02430 gene ftcD 2672 3586 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080786.1 protein_id gnl|my_center|LOCUS_02430 3804 4628 gene locus_tag LOCUS_02440 3804 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 5787 4699 gene locus_tag LOCUS_02450 5787 4699 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_02450 6915 5938 gene locus_tag LOCUS_02460 gene egtD 6915 5938 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_02460 8879 7278 gene locus_tag LOCUS_02470 8879 7278 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 protein_id gnl|my_center|LOCUS_02470 9628 8876 gene locus_tag LOCUS_02480 9628 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9569 10978 gene locus_tag LOCUS_02490 9569 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 11088 12743 gene locus_tag LOCUS_02500 11088 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 13057 13605 gene locus_tag LOCUS_02510 13057 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 13800 14147 gene locus_tag LOCUS_02520 13800 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 14409 14756 gene locus_tag LOCUS_02530 14409 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 14952 15824 gene locus_tag LOCUS_02540 14952 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 17801 15861 gene locus_tag LOCUS_02550 17801 15861 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_02550 18088 17915 gene locus_tag LOCUS_02560 18088 17915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 18624 21701 gene locus_tag LOCUS_02570 18624 21701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 21775 22185 gene locus_tag LOCUS_02580 21775 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 22303 23244 gene locus_tag LOCUS_02590 gene mdh 22303 23244 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933173.1 protein_id gnl|my_center|LOCUS_02590 23822 23406 gene locus_tag LOCUS_02600 23822 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 24670 23795 gene locus_tag LOCUS_02610 24670 23795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 25371 24670 gene locus_tag LOCUS_02620 25371 24670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 26186 25689 gene locus_tag LOCUS_02630 gene purE 26186 25689 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_02630 26510 27817 gene locus_tag LOCUS_02640 gene nuoF 26510 27817 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396808.1 protein_id gnl|my_center|LOCUS_02640 27824 28180 gene locus_tag LOCUS_02650 gene fdx 27824 28180 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820620.1 protein_id gnl|my_center|LOCUS_02650 28177 28629 gene locus_tag LOCUS_02660 28177 28629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 28696 29328 gene locus_tag LOCUS_02670 gene folE 28696 29328 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633832.1 protein_id gnl|my_center|LOCUS_02670 30155 29316 gene locus_tag LOCUS_02680 30155 29316 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_02680 30377 33490 gene locus_tag LOCUS_02690 30377 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 33590 34879 gene locus_tag LOCUS_02700 33590 34879 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_02700 36733 34895 gene locus_tag LOCUS_02710 36733 34895 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_02710 36921 36846 gene locus_tag LOCUS_t00060 36921 36846 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 38024 37674 gene locus_tag LOCUS_02720 38024 37674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 38395 38096 gene locus_tag LOCUS_02730 38395 38096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 38642 38370 gene locus_tag LOCUS_02740 38642 38370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 39044 40486 gene locus_tag LOCUS_02750 gene gltX 39044 40486 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941876.1 protein_id gnl|my_center|LOCUS_02750 40620 40693 gene locus_tag LOCUS_t00070 40620 40693 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 41262 40810 gene locus_tag LOCUS_02760 41262 40810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 41985 43415 gene locus_tag LOCUS_02770 41985 43415 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_02770 43832 45538 gene locus_tag LOCUS_02780 43832 45538 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_02780 46580 45693 gene locus_tag LOCUS_02790 gene metF 46580 45693 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_02790 47038 47883 gene locus_tag LOCUS_02800 47038 47883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 47922 48905 gene locus_tag LOCUS_02810 47922 48905 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_02810 49067 50434 gene locus_tag LOCUS_02820 49067 50434 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_02820 51933 50626 gene locus_tag LOCUS_02830 gene der 51933 50626 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_02830 52730 52203 gene locus_tag LOCUS_02840 52730 52203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 54094 52727 gene locus_tag LOCUS_02850 54094 52727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 56221 54176 gene locus_tag LOCUS_02860 56221 54176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 56715 57896 gene locus_tag LOCUS_02870 gene metK 56715 57896 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_02870 57968 59347 gene locus_tag LOCUS_02880 gene ahcY 57968 59347 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 protein_id gnl|my_center|LOCUS_02880 59467 60153 gene locus_tag LOCUS_02890 59467 60153 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_02890 60508 61122 gene locus_tag LOCUS_02900 60508 61122 CDS product carbon monoxide dehydrogenase beta subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930681.1 protein_id gnl|my_center|LOCUS_02900 61233 62441 gene locus_tag LOCUS_02910 61233 62441 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880756.1 protein_id gnl|my_center|LOCUS_02910 62577 63482 gene locus_tag LOCUS_02920 62577 63482 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880757.1 protein_id gnl|my_center|LOCUS_02920 63527 64222 gene locus_tag LOCUS_02930 63527 64222 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880758.1 protein_id gnl|my_center|LOCUS_02930 64243 64521 gene locus_tag LOCUS_02940 64243 64521 CDS product ferredoxin oxidoreductase 2 subunit ForD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880734.1 protein_id gnl|my_center|LOCUS_02940 64650 64913 gene locus_tag LOCUS_02950 64650 64913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 65422 65497 gene locus_tag LOCUS_t00080 65422 65497 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 65733 67847 gene locus_tag LOCUS_02960 65733 67847 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_02960 68178 69368 gene locus_tag LOCUS_02970 68178 69368 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403856.1 protein_id gnl|my_center|LOCUS_02970 69619 70170 gene locus_tag LOCUS_02980 69619 70170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 70167 71306 gene locus_tag LOCUS_02990 70167 71306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 >Feature sequence005 <1 725 gene locus_tag LOCUS_03000 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943503.1:N-acetyl-gamma-glutamyl-phosphate reductase 769 1983 gene locus_tag LOCUS_03010 gene argJ 769 1983 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_03010 2162 2881 gene locus_tag LOCUS_03020 2162 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3133 2885 gene locus_tag LOCUS_03030 3133 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4289 3312 gene locus_tag LOCUS_03040 gene floA 4289 3312 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_03040 4749 4564 gene locus_tag LOCUS_03050 4749 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 5004 6074 gene locus_tag LOCUS_03060 gene ychF 5004 6074 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_03060 7692 6286 gene locus_tag LOCUS_03070 7692 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 9848 7689 gene locus_tag LOCUS_03080 9848 7689 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_03080 10098 10646 gene locus_tag LOCUS_03090 10098 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 10738 12450 gene locus_tag LOCUS_03100 10738 12450 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_03100 12711 13019 gene locus_tag LOCUS_03110 12711 13019 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_03110 13770 14915 gene locus_tag LOCUS_03120 13770 14915 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815218.1 protein_id gnl|my_center|LOCUS_03120 14972 15775 gene locus_tag LOCUS_03130 14972 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 16392 15931 gene locus_tag LOCUS_03140 16392 15931 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 protein_id gnl|my_center|LOCUS_03140 16916 17629 gene locus_tag LOCUS_03150 16916 17629 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_03150 17725 19278 gene locus_tag LOCUS_03160 17725 19278 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_03160 19930 19349 gene locus_tag LOCUS_03170 19930 19349 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_03170 20479 20003 gene locus_tag LOCUS_03180 gene bfr 20479 20003 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815898.1 protein_id gnl|my_center|LOCUS_03180 20758 22854 gene locus_tag LOCUS_03190 20758 22854 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_03190 23010 23549 gene locus_tag LOCUS_03200 23010 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 25983 23584 gene locus_tag LOCUS_03210 25983 23584 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_03210 25924 26148 gene locus_tag LOCUS_03220 25924 26148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 27545 26169 gene locus_tag LOCUS_03230 gene glmM 27545 26169 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_03230 28432 27545 gene locus_tag LOCUS_03240 gene folP 28432 27545 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_03240 30371 28554 gene locus_tag LOCUS_03250 gene ftsH 30371 28554 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_03250 32070 30652 gene locus_tag LOCUS_03260 gene tilS 32070 30652 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_03260 32882 32103 gene locus_tag LOCUS_03270 32882 32103 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937757.1 protein_id gnl|my_center|LOCUS_03270 34006 33023 gene locus_tag LOCUS_03280 gene hemB 34006 33023 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_03280 34493 34101 gene locus_tag LOCUS_03290 34493 34101 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963997.1 protein_id gnl|my_center|LOCUS_03290 36138 34588 gene locus_tag LOCUS_03300 gene cobA 36138 34588 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943897.1 protein_id gnl|my_center|LOCUS_03300 37086 36139 gene locus_tag LOCUS_03310 gene hemC 37086 36139 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_03310 38542 37157 gene locus_tag LOCUS_03320 gene hemA 38542 37157 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_03320 39348 38539 gene locus_tag LOCUS_03330 gene ccsB 39348 38539 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_03330 39662 39671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 40731 39988 gene locus_tag LOCUS_03340 40731 39988 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973892.1 protein_id gnl|my_center|LOCUS_03340 41097 41831 gene locus_tag LOCUS_03350 gene rsmI 41097 41831 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_03350 42063 41809 gene locus_tag LOCUS_03360 42063 41809 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423249.1 protein_id gnl|my_center|LOCUS_03360 42958 42203 gene locus_tag LOCUS_03370 42958 42203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 43328 43242 gene locus_tag LOCUS_t00090 43328 43242 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44310 43435 gene locus_tag LOCUS_03380 44310 43435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 44484 45155 gene locus_tag LOCUS_03390 44484 45155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 46481 45207 gene locus_tag LOCUS_03400 46481 45207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 46949 46638 gene locus_tag LOCUS_03410 46949 46638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 47353 48045 gene locus_tag LOCUS_03420 47353 48045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 48512 49699 gene locus_tag LOCUS_03430 48512 49699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 49763 50332 gene locus_tag LOCUS_03440 49763 50332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03440 50320 51129 gene locus_tag LOCUS_03450 50320 51129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03450 51238 52794 gene locus_tag LOCUS_03460 gene urtB 51238 52794 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763115.1 protein_id gnl|my_center|LOCUS_03460 52784 53908 gene locus_tag LOCUS_03470 gene urtC 52784 53908 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_03470 53947 54783 gene locus_tag LOCUS_03480 gene urtD 53947 54783 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_03480 54770 55480 gene locus_tag LOCUS_03490 gene urtE 54770 55480 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_03490 55485 55787 gene locus_tag LOCUS_03500 gene ureA 55485 55787 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_03500 55916 57034 gene locus_tag LOCUS_03510 55916 57034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 57077 57520 gene locus_tag LOCUS_03520 57077 57520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 57517 59244 gene locus_tag LOCUS_03530 gene ureC 57517 59244 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055860.1 protein_id gnl|my_center|LOCUS_03530 59262 59972 gene locus_tag LOCUS_03540 59262 59972 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892459.1 protein_id gnl|my_center|LOCUS_03540 59978 60664 gene locus_tag LOCUS_03550 gene ureG 59978 60664 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238762.1 protein_id gnl|my_center|LOCUS_03550 60820 61548 gene locus_tag LOCUS_03560 60820 61548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 62406 61564 gene locus_tag LOCUS_03570 62406 61564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_03570 63189 62458 gene locus_tag LOCUS_03580 63189 62458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_03580 63909 63208 gene locus_tag LOCUS_03590 63909 63208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 64414 63911 gene locus_tag LOCUS_03600 gene mobB 64414 63911 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_03600 65645 64419 gene locus_tag LOCUS_03610 65645 64419 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_03610 66221 65736 gene locus_tag LOCUS_03620 66221 65736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 67677 66292 gene locus_tag LOCUS_03630 67677 66292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 66315 66324 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence006 20 709 gene locus_tag LOCUS_03640 20 709 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_03640 876 1202 gene locus_tag LOCUS_03650 876 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1636 2388 gene locus_tag LOCUS_03660 1636 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 2545 3123 gene locus_tag LOCUS_03670 2545 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4775 3135 gene locus_tag LOCUS_03680 4775 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 5536 4772 gene locus_tag LOCUS_03690 5536 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392149.1 protein_id gnl|my_center|LOCUS_03690 5704 6468 gene locus_tag LOCUS_03700 5704 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 7791 6493 gene locus_tag LOCUS_03710 7791 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 8265 7984 gene locus_tag LOCUS_03720 8265 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 9927 8350 gene locus_tag LOCUS_03730 9927 8350 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_03730 11965 9920 gene locus_tag LOCUS_03740 11965 9920 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_03740 13571 12072 gene locus_tag LOCUS_03750 13571 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 13871 13614 gene locus_tag LOCUS_03760 13871 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 14043 14708 gene locus_tag LOCUS_03770 14043 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 15677 14862 gene locus_tag LOCUS_03780 15677 14862 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938538.1 protein_id gnl|my_center|LOCUS_03780 15977 15819 gene locus_tag LOCUS_03790 15977 15819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 16477 16133 gene locus_tag LOCUS_03800 16477 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 16695 17606 gene locus_tag LOCUS_03810 16695 17606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03810 17634 19121 gene locus_tag LOCUS_03820 17634 19121 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939137.1 protein_id gnl|my_center|LOCUS_03820 19118 21577 gene locus_tag LOCUS_03830 19118 21577 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404233.1 protein_id gnl|my_center|LOCUS_03830 21918 23858 gene locus_tag LOCUS_03840 21918 23858 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330711.1 protein_id gnl|my_center|LOCUS_03840 24024 25754 gene locus_tag LOCUS_03850 24024 25754 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021660.1 protein_id gnl|my_center|LOCUS_03850 25794 27563 gene locus_tag LOCUS_03860 25794 27563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 27553 27774 gene locus_tag LOCUS_03870 27553 27774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 27995 29422 gene locus_tag LOCUS_03880 gene noeA 27995 29422 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_03880 29801 30280 gene locus_tag LOCUS_03890 29801 30280 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_03890 30608 31036 gene locus_tag LOCUS_03900 30608 31036 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_03900 31091 32401 gene locus_tag LOCUS_03910 31091 32401 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_03910 32403 32987 gene locus_tag LOCUS_03920 32403 32987 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_03920 33150 33473 gene locus_tag LOCUS_03930 gene erpA 33150 33473 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 protein_id gnl|my_center|LOCUS_03930 33561 34370 gene locus_tag LOCUS_03940 33561 34370 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258499.1 protein_id gnl|my_center|LOCUS_03940 34742 34353 gene locus_tag LOCUS_03950 34742 34353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 35294 34824 gene locus_tag LOCUS_03960 35294 34824 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869368.1 protein_id gnl|my_center|LOCUS_03960 35665 35270 gene locus_tag LOCUS_03970 35665 35270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 35716 37986 gene locus_tag LOCUS_03980 35716 37986 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546286.1 protein_id gnl|my_center|LOCUS_03980 39007 38105 gene locus_tag LOCUS_03990 39007 38105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 39352 39137 gene locus_tag LOCUS_04000 gene iscX 39352 39137 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142213.1 protein_id gnl|my_center|LOCUS_04000 41181 39358 gene locus_tag LOCUS_04010 gene dnaK 41181 39358 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681815.1 protein_id gnl|my_center|LOCUS_04010 41958 41218 gene locus_tag LOCUS_04020 gene hscB 41958 41218 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 protein_id gnl|my_center|LOCUS_04020 42396 42043 gene locus_tag LOCUS_04030 gene erpA 42396 42043 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881213.1 protein_id gnl|my_center|LOCUS_04030 42861 42442 gene locus_tag LOCUS_04040 gene iscU 42861 42442 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331703.1 protein_id gnl|my_center|LOCUS_04040 44155 42941 gene locus_tag LOCUS_04050 44155 42941 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_04050 44631 44152 gene locus_tag LOCUS_04060 44631 44152 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 protein_id gnl|my_center|LOCUS_04060 44847 45260 gene locus_tag LOCUS_04070 44847 45260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 45288 45467 gene locus_tag LOCUS_04080 45288 45467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 45865 48225 gene locus_tag LOCUS_04090 45865 48225 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_04090 48458 50170 gene locus_tag LOCUS_04100 48458 50170 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_04100 50331 50516 gene locus_tag LOCUS_04110 50331 50516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 50657 52201 gene locus_tag LOCUS_04120 50657 52201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 52836 52609 gene locus_tag LOCUS_04130 52836 52609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 53120 53884 gene locus_tag LOCUS_04140 53120 53884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 54170 55657 gene locus_tag LOCUS_04150 54170 55657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 55926 57926 gene locus_tag LOCUS_04160 55926 57926 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_04160 60229 58178 gene locus_tag LOCUS_04170 60229 58178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 60497 60240 gene locus_tag LOCUS_04180 60497 60240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 62584 60506 gene locus_tag LOCUS_04190 62584 60506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 63232 62774 gene locus_tag LOCUS_04200 63232 62774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 64094 63210 gene locus_tag LOCUS_04210 64094 63210 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237695.1 protein_id gnl|my_center|LOCUS_04210 64876 64091 gene locus_tag LOCUS_04220 64876 64091 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence007 762 1892 gene locus_tag LOCUS_04230 762 1892 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_04230 2081 2386 gene locus_tag LOCUS_04240 2081 2386 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730101.1 protein_id gnl|my_center|LOCUS_04240 2595 3881 gene locus_tag LOCUS_04250 2595 3881 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 protein_id gnl|my_center|LOCUS_04250 3894 4790 gene locus_tag LOCUS_04260 3894 4790 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_04260 4787 5614 gene locus_tag LOCUS_04270 4787 5614 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_04270 5618 6709 gene locus_tag LOCUS_04280 gene ugpC 5618 6709 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329344.1 protein_id gnl|my_center|LOCUS_04280 7616 6744 gene locus_tag LOCUS_04290 7616 6744 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523300.1 protein_id gnl|my_center|LOCUS_04290 7739 8281 gene locus_tag LOCUS_04300 7739 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 8300 8629 gene locus_tag LOCUS_04310 8300 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 10348 8645 gene locus_tag LOCUS_04320 10348 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 12184 10352 gene locus_tag LOCUS_04330 gene rpoD 12184 10352 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_04330 12619 12422 gene locus_tag LOCUS_04340 12619 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 14215 12911 gene locus_tag LOCUS_04350 14215 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 14250 14474 gene locus_tag LOCUS_04360 14250 14474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 14476 16161 gene locus_tag LOCUS_04370 gene ettA 14476 16161 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_04370 16166 16387 gene locus_tag LOCUS_04380 16166 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 16473 16883 gene locus_tag LOCUS_04390 16473 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 17028 17375 gene locus_tag LOCUS_04400 17028 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 18131 17496 gene locus_tag LOCUS_04410 18131 17496 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_04410 18714 18484 gene locus_tag LOCUS_04420 18714 18484 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419624.1 protein_id gnl|my_center|LOCUS_04420 20728 19004 gene locus_tag LOCUS_04430 20728 19004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_04430 21363 20833 gene locus_tag LOCUS_04440 gene def 21363 20833 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038831.1 protein_id gnl|my_center|LOCUS_04440 22243 21407 gene locus_tag LOCUS_04450 22243 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 22435 23346 gene locus_tag LOCUS_04460 22435 23346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 23549 23340 gene locus_tag LOCUS_04470 23549 23340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 24403 24206 gene locus_tag LOCUS_04480 24403 24206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 26876 24513 gene locus_tag LOCUS_04490 26876 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 29585 27039 gene locus_tag LOCUS_04500 29585 27039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 31099 29624 gene locus_tag LOCUS_04510 31099 29624 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_04510 32676 31096 gene locus_tag LOCUS_04520 32676 31096 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969262.1 protein_id gnl|my_center|LOCUS_04520 34598 32703 gene locus_tag LOCUS_04530 gene nuoL 34598 32703 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_04530 34912 34583 gene locus_tag LOCUS_04540 gene nuoK 34912 34583 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_04540 35314 34925 gene locus_tag LOCUS_04550 35314 34925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 35901 35344 gene locus_tag LOCUS_04560 35901 35344 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_04560 36988 36014 gene locus_tag LOCUS_04570 36988 36014 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_04570 37649 37107 gene locus_tag LOCUS_04580 gene nuoI 37649 37107 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389438.1 protein_id gnl|my_center|LOCUS_04580 38769 37669 gene locus_tag LOCUS_04590 gene nuoH 38769 37669 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_04590 41553 38824 gene locus_tag LOCUS_04600 gene nuoG 41553 38824 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969254.1 protein_id gnl|my_center|LOCUS_04600 42870 41563 gene locus_tag LOCUS_04610 gene nuoF 42870 41563 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_04610 43472 42867 gene locus_tag LOCUS_04620 43472 42867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 44485 43478 gene locus_tag LOCUS_04630 44485 43478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 45921 44482 gene locus_tag LOCUS_04640 45921 44482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 47736 45985 gene locus_tag LOCUS_04650 gene nuoD 47736 45985 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880837.1 protein_id gnl|my_center|LOCUS_04650 48799 47912 gene locus_tag LOCUS_04660 48799 47912 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176150.1 protein_id gnl|my_center|LOCUS_04660 49382 48903 gene locus_tag LOCUS_04670 49382 48903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 49856 49485 gene locus_tag LOCUS_04680 49856 49485 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_04680 51108 49858 gene locus_tag LOCUS_04690 51108 49858 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_04690 52084 51332 gene locus_tag LOCUS_04700 52084 51332 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_04700 52934 52044 gene locus_tag LOCUS_04710 52934 52044 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256554.1 protein_id gnl|my_center|LOCUS_04710 55277 52989 gene locus_tag LOCUS_04720 gene secA 55277 52989 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545108.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence008 61 396 gene locus_tag LOCUS_04730 61 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04730 561 1382 gene locus_tag LOCUS_04740 561 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 1536 2411 gene locus_tag LOCUS_04750 1536 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04750 2467 5280 gene locus_tag LOCUS_04760 2467 5280 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_04760 4820 4829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5496 6917 gene locus_tag LOCUS_04770 5496 6917 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_04770 7017 7092 gene locus_tag LOCUS_t00100 7017 7092 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7241 7747 gene locus_tag LOCUS_04780 gene rimP 7241 7747 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_04780 7818 9242 gene locus_tag LOCUS_04790 gene nusA 7818 9242 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_04790 9480 11735 gene locus_tag LOCUS_04800 gene infB 9480 11735 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546130.1 protein_id gnl|my_center|LOCUS_04800 11797 12087 gene locus_tag LOCUS_04810 11797 12087 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_04810 12117 12536 gene locus_tag LOCUS_04820 gene rbfA 12117 12536 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392565.1 protein_id gnl|my_center|LOCUS_04820 12533 13618 gene locus_tag LOCUS_04830 12533 13618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 13721 13990 gene locus_tag LOCUS_04840 gene rpsO 13721 13990 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_04840 14045 16159 gene locus_tag LOCUS_04850 gene pnp 14045 16159 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_04850 16222 16446 gene locus_tag LOCUS_04860 16222 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04860 16384 16393 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16469 17521 gene locus_tag LOCUS_04870 16469 17521 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04870 17714 18256 gene locus_tag LOCUS_04880 17714 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 18347 19000 gene locus_tag LOCUS_04890 18347 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 21706 19061 gene locus_tag LOCUS_04900 gene mutS 21706 19061 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_04900 22204 21713 gene locus_tag LOCUS_04910 gene tsaE 22204 21713 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_04910 23840 22194 gene locus_tag LOCUS_04920 23840 22194 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_04920 24541 23813 gene locus_tag LOCUS_04930 24541 23813 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_04930 24759 25931 gene locus_tag LOCUS_04940 gene alaC 24759 25931 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_04940 25951 27267 gene locus_tag LOCUS_04950 25951 27267 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_04950 27267 28322 gene locus_tag LOCUS_04960 gene thrC 27267 28322 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_04960 28340 29374 gene locus_tag LOCUS_04970 28340 29374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 29567 30832 gene locus_tag LOCUS_04980 29567 30832 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_04980 30892 32550 gene locus_tag LOCUS_04990 gene cimA 30892 32550 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_04990 32687 32962 gene locus_tag LOCUS_05000 32687 32962 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_05000 33011 33457 gene locus_tag LOCUS_05010 33011 33457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 33435 33511 gene locus_tag LOCUS_t00110 33435 33511 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 33974 33720 gene locus_tag LOCUS_05020 33974 33720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 34086 34877 gene locus_tag LOCUS_05030 34086 34877 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_05030 35172 34975 gene locus_tag LOCUS_05040 35172 34975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 35553 35194 gene locus_tag LOCUS_05050 35553 35194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 35703 36524 gene locus_tag LOCUS_05060 gene mutM 35703 36524 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923346.1 protein_id gnl|my_center|LOCUS_05060 36623 37618 gene locus_tag LOCUS_05070 36623 37618 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_05070 37847 38302 gene locus_tag LOCUS_05080 37847 38302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 38308 39237 gene locus_tag LOCUS_05090 gene ftsY 38308 39237 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_05090 39490 40554 gene locus_tag LOCUS_05100 39490 40554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 40638 41693 gene locus_tag LOCUS_05110 40638 41693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 43525 41690 gene locus_tag LOCUS_05120 43525 41690 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_05120 43848 43525 gene locus_tag LOCUS_05130 43848 43525 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_05130 44758 43940 gene locus_tag LOCUS_05140 44758 43940 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939330.1 protein_id gnl|my_center|LOCUS_05140 45604 44906 gene locus_tag LOCUS_05150 45604 44906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 45812 47209 gene locus_tag LOCUS_05160 45812 47209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 47668 48009 gene locus_tag LOCUS_05170 47668 48009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 48159 48452 gene locus_tag LOCUS_05180 48159 48452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 49004 50593 gene locus_tag LOCUS_05190 49004 50593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 50797 51096 gene locus_tag LOCUS_05200 50797 51096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 51205 51516 gene locus_tag LOCUS_05210 51205 51516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05210 51609 52586 gene locus_tag LOCUS_05220 51609 52586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence009 1313 426 gene locus_tag LOCUS_05230 1313 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 1561 2400 gene locus_tag LOCUS_05240 gene lgt 1561 2400 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_05240 2421 5219 gene locus_tag LOCUS_05250 2421 5219 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_05250 5212 8721 gene locus_tag LOCUS_05260 5212 8721 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_05260 9302 8865 gene locus_tag LOCUS_05270 9302 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9519 9334 gene locus_tag LOCUS_05280 9519 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 9795 9541 gene locus_tag LOCUS_05290 9795 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 10595 9921 gene locus_tag LOCUS_05300 10595 9921 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_05300 11715 10579 gene locus_tag LOCUS_05310 11715 10579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12140 11715 gene locus_tag LOCUS_05320 gene nrdR 12140 11715 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_05320 13574 12312 gene locus_tag LOCUS_05330 13574 12312 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924918.1 protein_id gnl|my_center|LOCUS_05330 14083 13577 gene locus_tag LOCUS_05340 gene rplI 14083 13577 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_05340 14963 16417 gene locus_tag LOCUS_05350 14963 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 16537 17352 gene locus_tag LOCUS_05360 16537 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 17637 18218 gene locus_tag LOCUS_05370 17637 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 18435 18181 gene locus_tag LOCUS_05380 18435 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 18453 18538 gene locus_tag LOCUS_t00120 18453 18538 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18705 19262 gene locus_tag LOCUS_05390 18705 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 19265 20062 gene locus_tag LOCUS_05400 19265 20062 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_05400 20631 20149 gene locus_tag LOCUS_05410 20631 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 21082 20642 gene locus_tag LOCUS_05420 21082 20642 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 protein_id gnl|my_center|LOCUS_05420 21281 22057 gene locus_tag LOCUS_05430 21281 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 22165 22617 gene locus_tag LOCUS_05440 22165 22617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 22715 23041 gene locus_tag LOCUS_05450 22715 23041 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_05450 23063 23581 gene locus_tag LOCUS_05460 23063 23581 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117124.1 protein_id gnl|my_center|LOCUS_05460 23736 24068 gene locus_tag LOCUS_05470 23736 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 24213 24022 gene locus_tag LOCUS_05480 24213 24022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 25643 24711 gene locus_tag LOCUS_05490 25643 24711 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986681.1 protein_id gnl|my_center|LOCUS_05490 26967 25729 gene locus_tag LOCUS_05500 26967 25729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 27103 27188 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27415 27660 gene locus_tag LOCUS_05510 27415 27660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 29648 27678 gene locus_tag LOCUS_05520 29648 27678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 31537 29648 gene locus_tag LOCUS_05530 31537 29648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 31966 37215 gene locus_tag LOCUS_05540 31966 37215 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267807.1 protein_id gnl|my_center|LOCUS_05540 37668 38441 gene locus_tag LOCUS_05550 37668 38441 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_05550 42185 38496 gene locus_tag LOCUS_05560 gene metH 42185 38496 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_05560 43975 44841 gene locus_tag LOCUS_05570 43975 44841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 45039 45824 gene locus_tag LOCUS_05580 45039 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 46224 45862 gene locus_tag LOCUS_05590 46224 45862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 46492 46235 gene locus_tag LOCUS_05600 46492 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 46467 46694 gene locus_tag LOCUS_05610 46467 46694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 47026 46736 gene locus_tag LOCUS_05620 47026 46736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 47216 47965 gene locus_tag LOCUS_05630 47216 47965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 48152 47952 gene locus_tag LOCUS_05640 48152 47952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 48759 49034 gene locus_tag LOCUS_05650 48759 49034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 49050 49490 gene locus_tag LOCUS_05660 49050 49490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 49815 49504 gene locus_tag LOCUS_05670 49815 49504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence010 123 428 gene locus_tag LOCUS_05680 123 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 438 794 gene locus_tag LOCUS_05690 438 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05690 950 2485 gene locus_tag LOCUS_05700 950 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2826 3998 gene locus_tag LOCUS_05710 2826 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 4002 5123 gene locus_tag LOCUS_05720 4002 5123 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_05720 5120 5938 gene locus_tag LOCUS_05730 gene fhuC 5120 5938 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158930.1 protein_id gnl|my_center|LOCUS_05730 6267 8234 gene locus_tag LOCUS_05740 6267 8234 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_05740 8316 8903 gene locus_tag LOCUS_05750 8316 8903 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_05750 8873 9319 gene locus_tag LOCUS_05760 8873 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 9650 9327 gene locus_tag LOCUS_05770 9650 9327 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_05770 9805 10335 gene locus_tag LOCUS_05780 9805 10335 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_05780 10477 11109 gene locus_tag LOCUS_05790 10477 11109 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283347.1 protein_id gnl|my_center|LOCUS_05790 11133 11441 gene locus_tag LOCUS_05800 11133 11441 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_05800 12561 11494 gene locus_tag LOCUS_05810 gene alr 12561 11494 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_05810 13243 12683 gene locus_tag LOCUS_05820 gene frr 13243 12683 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_05820 13991 13236 gene locus_tag LOCUS_05830 gene pyrH 13991 13236 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_05830 14584 13988 gene locus_tag LOCUS_05840 gene tsf 14584 13988 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_05840 15477 14659 gene locus_tag LOCUS_05850 gene rpsB 15477 14659 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_05850 15859 17214 gene locus_tag LOCUS_05860 15859 17214 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_05860 17300 18766 gene locus_tag LOCUS_05870 17300 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 18942 19991 gene locus_tag LOCUS_05880 18942 19991 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_05880 20450 20605 gene locus_tag LOCUS_05890 20450 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 20841 20766 gene locus_tag LOCUS_t00130 20841 20766 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22097 20904 gene locus_tag LOCUS_05900 22097 20904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 22424 22113 gene locus_tag LOCUS_05910 22424 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 23158 22421 gene locus_tag LOCUS_05920 23158 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 23948 23241 gene locus_tag LOCUS_05930 23948 23241 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_05930 24294 25601 gene locus_tag LOCUS_05940 24294 25601 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940819.1 protein_id gnl|my_center|LOCUS_05940 25693 26148 gene locus_tag LOCUS_05950 25693 26148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 26230 26682 gene locus_tag LOCUS_05960 26230 26682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 26731 27330 gene locus_tag LOCUS_05970 gene thpR 26731 27330 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_05970 27582 28655 gene locus_tag LOCUS_05980 gene recA 27582 28655 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_05980 28802 31447 gene locus_tag LOCUS_05990 gene alaS 28802 31447 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_05990 31444 32463 gene locus_tag LOCUS_06000 gene mltG 31444 32463 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_06000 32476 32946 gene locus_tag LOCUS_06010 32476 32946 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 protein_id gnl|my_center|LOCUS_06010 33132 34040 gene locus_tag LOCUS_06020 33132 34040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 34049 35704 gene locus_tag LOCUS_06030 34049 35704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 35708 36721 gene locus_tag LOCUS_06040 35708 36721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 37471 36731 gene locus_tag LOCUS_06050 37471 36731 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_06050 38628 37513 gene locus_tag LOCUS_06060 gene dnaJ 38628 37513 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_06060 39588 38698 gene locus_tag LOCUS_06070 39588 38698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 41516 39591 gene locus_tag LOCUS_06080 gene dnaK 41516 39591 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_06080 42160 41513 gene locus_tag LOCUS_06090 42160 41513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 43075 42290 gene locus_tag LOCUS_06100 43075 42290 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_06100 43977 43159 gene locus_tag LOCUS_06110 43977 43159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 45001 43964 gene locus_tag LOCUS_06120 gene nadC 45001 43964 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_06120 47861 45006 gene locus_tag LOCUS_06130 47861 45006 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_06130 47997 48233 gene locus_tag LOCUS_06140 47997 48233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 48368 49081 gene locus_tag LOCUS_06150 48368 49081 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence011 397 310 gene locus_tag LOCUS_t00140 397 310 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 689 441 gene locus_tag LOCUS_06160 689 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 2061 736 gene locus_tag LOCUS_06170 gene serS 2061 736 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247131.1 protein_id gnl|my_center|LOCUS_06170 2124 2252 gene locus_tag LOCUS_06180 2124 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 2427 3143 gene locus_tag LOCUS_06190 2427 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 3118 3753 gene locus_tag LOCUS_06200 3118 3753 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_06200 3731 3807 gene locus_tag LOCUS_t00150 3731 3807 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3916 3991 gene locus_tag LOCUS_t00160 3916 3991 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4116 4304 gene locus_tag LOCUS_06210 4116 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5034 4456 gene locus_tag LOCUS_06220 5034 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 5587 5213 gene locus_tag LOCUS_06230 5587 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6872 5688 gene locus_tag LOCUS_06240 6872 5688 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_06240 7357 6869 gene locus_tag LOCUS_06250 gene coaD 7357 6869 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_06250 7922 7326 gene locus_tag LOCUS_06260 gene rsmD 7922 7326 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295491.1 protein_id gnl|my_center|LOCUS_06260 8333 9076 gene locus_tag LOCUS_06270 gene radC 8333 9076 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941054.1 protein_id gnl|my_center|LOCUS_06270 9326 11623 gene locus_tag LOCUS_06280 gene purL 9326 11623 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_06280 11828 12025 gene locus_tag LOCUS_06290 11828 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 12108 13574 gene locus_tag LOCUS_06300 gene purF 12108 13574 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_06300 13773 14303 gene locus_tag LOCUS_06310 13773 14303 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_06310 14304 14498 gene locus_tag LOCUS_06320 14304 14498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 14532 14771 gene locus_tag LOCUS_06330 14532 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 14768 15382 gene locus_tag LOCUS_06340 14768 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 15396 16400 gene locus_tag LOCUS_06350 15396 16400 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_06350 16493 17152 gene locus_tag LOCUS_06360 16493 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 17170 18525 gene locus_tag LOCUS_06370 17170 18525 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393867.1 protein_id gnl|my_center|LOCUS_06370 18528 19376 gene locus_tag LOCUS_06380 18528 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 19423 21693 gene locus_tag LOCUS_06390 19423 21693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 23049 21706 gene locus_tag LOCUS_06400 23049 21706 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_06400 23888 23265 gene locus_tag LOCUS_06410 gene plsY 23888 23265 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_06410 24458 23889 gene locus_tag LOCUS_06420 gene pgsA 24458 23889 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_06420 25470 24592 gene locus_tag LOCUS_06430 gene kdsA 25470 24592 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_06430 27269 25668 gene locus_tag LOCUS_06440 27269 25668 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_06440 28074 27298 gene locus_tag LOCUS_06450 gene kdsB 28074 27298 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_06450 28996 28061 gene locus_tag LOCUS_06460 28996 28061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 29915 29142 gene locus_tag LOCUS_06470 gene lepB 29915 29142 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_06470 31720 29912 gene locus_tag LOCUS_06480 gene lepA 31720 29912 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_06480 32004 33338 gene locus_tag LOCUS_06490 gene bioA 32004 33338 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939829.1 protein_id gnl|my_center|LOCUS_06490 33335 33766 gene locus_tag LOCUS_06500 33335 33766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 34660 33833 gene locus_tag LOCUS_06510 34660 33833 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_06510 35148 34663 gene locus_tag LOCUS_06520 gene greA 35148 34663 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_06520 38490 35176 gene locus_tag LOCUS_06530 gene carB 38490 35176 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_06530 39414 38497 gene locus_tag LOCUS_06540 39414 38497 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_06540 40628 39459 gene locus_tag LOCUS_06550 gene carA 40628 39459 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_06550 41143 40625 gene locus_tag LOCUS_06560 41143 40625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 42538 41222 gene locus_tag LOCUS_06570 42538 41222 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_06570 43517 42591 gene locus_tag LOCUS_06580 43517 42591 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_06580 44080 43514 gene locus_tag LOCUS_06590 gene pyrR 44080 43514 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_06590 46135 44354 gene locus_tag LOCUS_06600 46135 44354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 47587 46232 gene locus_tag LOCUS_06610 47587 46232 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_06610 47843 47918 gene locus_tag LOCUS_t00170 47843 47918 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 2 577 gene locus_tag LOCUS_06620 2 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 669 1295 gene locus_tag LOCUS_06630 669 1295 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_06630 1292 2311 gene locus_tag LOCUS_06640 gene trpD 1292 2311 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_06640 2308 3162 gene locus_tag LOCUS_06650 gene trpC 2308 3162 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_06650 3180 3827 gene locus_tag LOCUS_06660 3180 3827 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_06660 3945 5138 gene locus_tag LOCUS_06670 gene trpB 3945 5138 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_06670 5142 5963 gene locus_tag LOCUS_06680 gene trpA 5142 5963 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_06680 6013 7518 gene locus_tag LOCUS_06690 6013 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7534 8133 gene locus_tag LOCUS_06700 7534 8133 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770403.1 protein_id gnl|my_center|LOCUS_06700 9191 8160 gene locus_tag LOCUS_06710 gene mtnA 9191 8160 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_06710 12578 9216 gene locus_tag LOCUS_06720 12578 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 12879 13715 gene locus_tag LOCUS_06730 12879 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 13728 14150 gene locus_tag LOCUS_06740 13728 14150 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_06740 14234 14950 gene locus_tag LOCUS_06750 14234 14950 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869292.1 protein_id gnl|my_center|LOCUS_06750 17610 15013 gene locus_tag LOCUS_06760 gene clpB 17610 15013 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869824.1 protein_id gnl|my_center|LOCUS_06760 19679 18270 gene locus_tag LOCUS_06770 gene glnA 19679 18270 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_06770 20995 19733 gene locus_tag LOCUS_06780 20995 19733 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_06780 21446 21108 gene locus_tag LOCUS_06790 21446 21108 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_06790 21719 21540 gene locus_tag LOCUS_06800 21719 21540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 22371 22150 gene locus_tag LOCUS_06810 22371 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 22507 22432 gene locus_tag LOCUS_t00180 22507 22432 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23184 22549 gene locus_tag LOCUS_06820 gene purN 23184 22549 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_06820 24599 23211 gene locus_tag LOCUS_06830 24599 23211 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_06830 27030 24727 gene locus_tag LOCUS_06840 27030 24727 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_06840 27623 27213 gene locus_tag LOCUS_06850 27623 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 28635 27970 gene locus_tag LOCUS_06860 28635 27970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 28903 28640 gene locus_tag LOCUS_06870 28903 28640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 29100 28906 gene locus_tag LOCUS_06880 29100 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 29514 30398 gene locus_tag LOCUS_06890 29514 30398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 30391 31023 gene locus_tag LOCUS_06900 30391 31023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 31468 31061 gene locus_tag LOCUS_06910 31468 31061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 32111 31461 gene locus_tag LOCUS_06920 32111 31461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 32312 32236 gene locus_tag LOCUS_t00190 32312 32236 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32483 32866 gene locus_tag LOCUS_06930 32483 32866 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_06930 34953 32863 gene locus_tag LOCUS_06940 34953 32863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 35224 35640 gene locus_tag LOCUS_06950 35224 35640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 35643 35933 gene locus_tag LOCUS_06960 35643 35933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 36997 35921 gene locus_tag LOCUS_06970 36997 35921 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_06970 37394 36984 gene locus_tag LOCUS_06980 37394 36984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 37660 38544 gene locus_tag LOCUS_06990 gene htpX 37660 38544 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264281.1 protein_id gnl|my_center|LOCUS_06990 39132 38602 gene locus_tag LOCUS_07000 39132 38602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 39212 39988 gene locus_tag LOCUS_07010 39212 39988 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_07010 40439 39975 gene locus_tag LOCUS_07020 40439 39975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 40653 41867 gene locus_tag LOCUS_07030 40653 41867 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545784.1 protein_id gnl|my_center|LOCUS_07030 42013 42870 gene locus_tag LOCUS_07040 gene truA 42013 42870 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_07040 43868 42927 gene locus_tag LOCUS_07050 43868 42927 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337523.1 protein_id gnl|my_center|LOCUS_07050 44576 43926 gene locus_tag LOCUS_07060 gene cysE 44576 43926 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_07060 45093 44626 gene locus_tag LOCUS_07070 gene ispF 45093 44626 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence013 <1 1214 gene locus_tag LOCUS_07080 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545401.1:elongation factor Tu 1227 1544 gene locus_tag LOCUS_07090 gene rpsJ 1227 1544 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_07090 1616 2212 gene locus_tag LOCUS_07100 gene rplC 1616 2212 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_07100 2218 2841 gene locus_tag LOCUS_07110 gene rplD 2218 2841 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_07110 2838 3131 gene locus_tag LOCUS_07120 2838 3131 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_07120 3197 4027 gene locus_tag LOCUS_07130 gene rplB 3197 4027 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886959.1 protein_id gnl|my_center|LOCUS_07130 4047 4325 gene locus_tag LOCUS_07140 gene rpsS 4047 4325 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_07140 4354 4701 gene locus_tag LOCUS_07150 gene rplV 4354 4701 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_07150 4714 5379 gene locus_tag LOCUS_07160 gene rpsC 4714 5379 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_07160 5518 5889 gene locus_tag LOCUS_07170 gene rplP 5518 5889 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_07170 5893 6126 gene locus_tag LOCUS_07180 gene rpmC 5893 6126 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_07180 6123 6398 gene locus_tag LOCUS_07190 gene rpsQ 6123 6398 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_07190 6450 6818 gene locus_tag LOCUS_07200 gene rplN 6450 6818 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_07200 6824 7186 gene locus_tag LOCUS_07210 gene rplX 6824 7186 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_07210 7183 7794 gene locus_tag LOCUS_07220 gene rplE 7183 7794 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842801.1 protein_id gnl|my_center|LOCUS_07220 8054 8458 gene locus_tag LOCUS_07230 gene rpsH 8054 8458 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173705.1 protein_id gnl|my_center|LOCUS_07230 8502 9041 gene locus_tag LOCUS_07240 gene rplF 8502 9041 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_07240 9051 9416 gene locus_tag LOCUS_07250 gene rplR 9051 9416 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_07250 9435 9923 gene locus_tag LOCUS_07260 gene rpsE 9435 9923 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_07260 9948 10145 gene locus_tag LOCUS_07270 gene rpmD 9948 10145 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222615.1 protein_id gnl|my_center|LOCUS_07270 10304 10591 gene locus_tag LOCUS_07280 10304 10591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 10584 11897 gene locus_tag LOCUS_07290 gene secY 10584 11897 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_07290 11907 12560 gene locus_tag LOCUS_07300 11907 12560 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_07300 12567 13337 gene locus_tag LOCUS_07310 gene map 12567 13337 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_07310 13337 13576 gene locus_tag LOCUS_07320 gene infA 13337 13576 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720929.1 protein_id gnl|my_center|LOCUS_07320 13779 14153 gene locus_tag LOCUS_07330 gene rpsM 13779 14153 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583368.1 protein_id gnl|my_center|LOCUS_07330 14176 14559 gene locus_tag LOCUS_07340 gene rpsK 14176 14559 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_07340 14715 15266 gene locus_tag LOCUS_07350 gene rpsD 14715 15266 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_07350 15336 16331 gene locus_tag LOCUS_07360 15336 16331 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_07360 16355 16786 gene locus_tag LOCUS_07370 16355 16786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 16986 17558 gene locus_tag LOCUS_07380 16986 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 17524 18060 gene locus_tag LOCUS_07390 17524 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 18074 18826 gene locus_tag LOCUS_07400 gene lptB 18074 18826 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_07400 18846 20396 gene locus_tag LOCUS_07410 gene rpoN 18846 20396 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_07410 20514 20317 gene locus_tag LOCUS_07420 20514 20317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 20714 21766 gene locus_tag LOCUS_07430 gene pilM 20714 21766 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_07430 21753 22313 gene locus_tag LOCUS_07440 21753 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 22306 22929 gene locus_tag LOCUS_07450 22306 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 22933 23457 gene locus_tag LOCUS_07460 22933 23457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 23667 24680 gene locus_tag LOCUS_07470 gene aroC 23667 24680 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_07470 24770 25879 gene locus_tag LOCUS_07480 gene aroB 24770 25879 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_07480 25919 27187 gene locus_tag LOCUS_07490 25919 27187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 27251 29035 gene locus_tag LOCUS_07500 27251 29035 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_07500 29067 31841 gene locus_tag LOCUS_07510 29067 31841 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974246.1 protein_id gnl|my_center|LOCUS_07510 32588 32076 gene locus_tag LOCUS_07520 32588 32076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 33335 32607 gene locus_tag LOCUS_07530 33335 32607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 33775 33317 gene locus_tag LOCUS_07540 33775 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 35295 33799 gene locus_tag LOCUS_07550 35295 33799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 36341 37414 gene locus_tag LOCUS_07560 36341 37414 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_07560 38230 37445 gene locus_tag LOCUS_07570 38230 37445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 39476 38430 gene locus_tag LOCUS_07580 39476 38430 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_07580 41216 39600 gene locus_tag LOCUS_07590 41216 39600 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141015.1 protein_id gnl|my_center|LOCUS_07590 42234 41194 gene locus_tag LOCUS_07600 42234 41194 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928654.1 protein_id gnl|my_center|LOCUS_07600 42713 42231 gene locus_tag LOCUS_07610 42713 42231 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_07610 42969 43538 gene locus_tag LOCUS_07620 42969 43538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence014 <1 746 gene locus_tag LOCUS_07630 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106010.1:(d)CMP kinase 743 1384 gene locus_tag LOCUS_07640 743 1384 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_07640 1512 3227 gene locus_tag LOCUS_07650 1512 3227 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_07650 3802 4704 gene locus_tag LOCUS_07660 gene sppA 3802 4704 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_07660 5040 5342 gene locus_tag LOCUS_07670 5040 5342 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940232.1 protein_id gnl|my_center|LOCUS_07670 5339 6319 gene locus_tag LOCUS_07680 5339 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 7007 6360 gene locus_tag LOCUS_07690 7007 6360 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889235.1 protein_id gnl|my_center|LOCUS_07690 8038 7013 gene locus_tag LOCUS_07700 8038 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 8388 8314 gene locus_tag LOCUS_t00200 8388 8314 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8743 8561 gene locus_tag LOCUS_07710 8743 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8847 10316 gene locus_tag LOCUS_07720 8847 10316 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105279.1 protein_id gnl|my_center|LOCUS_07720 10586 11272 gene locus_tag LOCUS_07730 10586 11272 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228280.1 protein_id gnl|my_center|LOCUS_07730 11829 11440 gene locus_tag LOCUS_07740 11829 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 13467 12070 gene locus_tag LOCUS_07750 13467 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 13737 14366 gene locus_tag LOCUS_07760 13737 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 15167 14481 gene locus_tag LOCUS_07770 15167 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 16087 15176 gene locus_tag LOCUS_07780 16087 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 16906 16121 gene locus_tag LOCUS_07790 16906 16121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057164.1 protein_id gnl|my_center|LOCUS_07790 18076 17105 gene locus_tag LOCUS_07800 18076 17105 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_07800 18741 18073 gene locus_tag LOCUS_07810 18741 18073 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917998.1 protein_id gnl|my_center|LOCUS_07810 18918 20114 gene locus_tag LOCUS_07820 18918 20114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 20102 20278 gene locus_tag LOCUS_07830 20102 20278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 20324 20641 gene locus_tag LOCUS_07840 20324 20641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 20655 24503 gene locus_tag LOCUS_07850 20655 24503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 24510 25175 gene locus_tag LOCUS_07860 24510 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 25845 25555 gene locus_tag LOCUS_07870 25845 25555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07870 26595 30032 gene locus_tag LOCUS_07880 26595 30032 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_07880 30146 31435 gene locus_tag LOCUS_07890 30146 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 31857 33152 gene locus_tag LOCUS_07900 gene mshL 31857 33152 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 protein_id gnl|my_center|LOCUS_07900 33318 34499 gene locus_tag LOCUS_07910 33318 34499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 35058 34636 gene locus_tag LOCUS_07920 35058 34636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 35298 36647 gene locus_tag LOCUS_07930 gene nhaD 35298 36647 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_07930 36644 37033 gene locus_tag LOCUS_07940 36644 37033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 37105 37449 gene locus_tag LOCUS_07950 37105 37449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 37567 39207 gene locus_tag LOCUS_07960 37567 39207 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_07960 39279 42338 gene locus_tag LOCUS_07970 39279 42338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence015 1839 631 gene locus_tag LOCUS_07980 1839 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2423 4096 gene locus_tag LOCUS_07990 gene ilvD 2423 4096 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_07990 5367 4132 gene locus_tag LOCUS_08000 5367 4132 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_08000 6692 5412 gene locus_tag LOCUS_08010 6692 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 7234 6791 gene locus_tag LOCUS_08020 7234 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 8087 7314 gene locus_tag LOCUS_08030 8087 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9526 8273 gene locus_tag LOCUS_08040 9526 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9901 9587 gene locus_tag LOCUS_08050 9901 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10755 9937 gene locus_tag LOCUS_08060 10755 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11890 10769 gene locus_tag LOCUS_08070 11890 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 13738 11963 gene locus_tag LOCUS_08080 13738 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 15060 14107 gene locus_tag LOCUS_08090 15060 14107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 16144 15197 gene locus_tag LOCUS_08100 16144 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 18006 17008 gene locus_tag LOCUS_08110 18006 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 18441 19544 gene locus_tag LOCUS_08120 18441 19544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 21001 19571 gene locus_tag LOCUS_08130 21001 19571 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_08130 24180 20998 gene locus_tag LOCUS_08140 24180 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 25220 24294 gene locus_tag LOCUS_08150 gene secF 25220 24294 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_08150 26867 25239 gene locus_tag LOCUS_08160 gene secD 26867 25239 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_08160 27206 26886 gene locus_tag LOCUS_08170 gene yajC 27206 26886 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_08170 28394 27207 gene locus_tag LOCUS_08180 gene tgt 28394 27207 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_08180 30234 28474 gene locus_tag LOCUS_08190 gene argS 30234 28474 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938544.1 protein_id gnl|my_center|LOCUS_08190 31310 30351 gene locus_tag LOCUS_08200 31310 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 33891 32080 gene locus_tag LOCUS_08210 33891 32080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 34932 33967 gene locus_tag LOCUS_08220 34932 33967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence016 492 2027 gene locus_tag LOCUS_08230 492 2027 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_08230 2259 2119 gene locus_tag LOCUS_08240 2259 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2286 2435 gene locus_tag LOCUS_08250 2286 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2432 2968 gene locus_tag LOCUS_08260 2432 2968 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_08260 2965 3231 gene locus_tag LOCUS_08270 2965 3231 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868321.1 protein_id gnl|my_center|LOCUS_08270 3232 3534 gene locus_tag LOCUS_08280 gene mnhG 3232 3534 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_08280 3531 4061 gene locus_tag LOCUS_08290 3531 4061 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_08290 4058 4555 gene locus_tag LOCUS_08300 4058 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4548 4925 gene locus_tag LOCUS_08310 4548 4925 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_08310 4922 6463 gene locus_tag LOCUS_08320 4922 6463 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_08320 6549 8669 gene locus_tag LOCUS_08330 gene nuoL 6549 8669 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389441.1 protein_id gnl|my_center|LOCUS_08330 9164 10675 gene locus_tag LOCUS_08340 9164 10675 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_08340 10720 10869 gene locus_tag LOCUS_08350 10720 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10811 13489 gene locus_tag LOCUS_08360 10811 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 13486 14886 gene locus_tag LOCUS_08370 13486 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 14888 15445 gene locus_tag LOCUS_08380 14888 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 15478 16473 gene locus_tag LOCUS_08390 15478 16473 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_08390 16692 19073 gene locus_tag LOCUS_08400 16692 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 19103 19861 gene locus_tag LOCUS_08410 19103 19861 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_08410 19971 21632 gene locus_tag LOCUS_08420 19971 21632 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926968.1 protein_id gnl|my_center|LOCUS_08420 21942 22937 gene locus_tag LOCUS_08430 21942 22937 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_08430 22945 23550 gene locus_tag LOCUS_08440 22945 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 23594 24811 gene locus_tag LOCUS_08450 23594 24811 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868625.1 protein_id gnl|my_center|LOCUS_08450 24784 27615 gene locus_tag LOCUS_08460 24784 27615 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933392.1 protein_id gnl|my_center|LOCUS_08460 27630 29408 gene locus_tag LOCUS_08470 27630 29408 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_08470 29426 30535 gene locus_tag LOCUS_08480 29426 30535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 30695 31891 gene locus_tag LOCUS_08490 30695 31891 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence017 1486 2 gene locus_tag LOCUS_08500 gene rny 1486 2 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546866.1 protein_id gnl|my_center|LOCUS_08500 2379 2083 gene locus_tag LOCUS_08510 2379 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2650 2363 gene locus_tag LOCUS_08520 2650 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5013 2716 gene locus_tag LOCUS_08530 5013 2716 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_08530 5047 4971 gene locus_tag LOCUS_t00210 5047 4971 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5930 5160 gene locus_tag LOCUS_08540 gene pyrF 5930 5160 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970804.1 protein_id gnl|my_center|LOCUS_08540 6021 6305 gene locus_tag LOCUS_08550 gene rpsT 6021 6305 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_08550 7465 6320 gene locus_tag LOCUS_08560 7465 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 8170 7478 gene locus_tag LOCUS_08570 8170 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 10849 8192 gene locus_tag LOCUS_08580 gene leuS 10849 8192 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011806.1 protein_id gnl|my_center|LOCUS_08580 11238 12512 gene locus_tag LOCUS_08590 11238 12512 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_08590 15659 12570 gene locus_tag LOCUS_08600 15659 12570 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153015413.1 protein_id gnl|my_center|LOCUS_08600 16328 15660 gene locus_tag LOCUS_08610 16328 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 17522 16341 gene locus_tag LOCUS_08620 17522 16341 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_08620 20239 17591 gene locus_tag LOCUS_08630 20239 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 21613 20474 gene locus_tag LOCUS_08640 21613 20474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 22860 21742 gene locus_tag LOCUS_08650 22860 21742 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104341.1 protein_id gnl|my_center|LOCUS_08650 25114 23357 gene locus_tag LOCUS_08660 gene uvrC 25114 23357 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_08660 25326 26756 gene locus_tag LOCUS_08670 25326 26756 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 protein_id gnl|my_center|LOCUS_08670 26890 27744 gene locus_tag LOCUS_08680 26890 27744 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_08680 27741 28289 gene locus_tag LOCUS_08690 27741 28289 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_08690 28499 30667 gene locus_tag LOCUS_08700 28499 30667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 30664 31698 gene locus_tag LOCUS_08710 30664 31698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 31778 32026 gene locus_tag LOCUS_08720 31778 32026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 31959 32174 gene locus_tag LOCUS_08730 31959 32174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence018 364 1020 gene locus_tag LOCUS_08740 364 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1240 1881 gene locus_tag LOCUS_08750 1240 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 3232 1904 gene locus_tag LOCUS_08760 3232 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4699 3392 gene locus_tag LOCUS_08770 4699 3392 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_08770 5313 4783 gene locus_tag LOCUS_08780 5313 4783 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_08780 6473 5367 gene locus_tag LOCUS_08790 gene gcvT 6473 5367 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_08790 6989 6540 gene locus_tag LOCUS_08800 6989 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7974 7486 gene locus_tag LOCUS_08810 7974 7486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_08810 8092 8421 gene locus_tag LOCUS_08820 8092 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 8782 8459 gene locus_tag LOCUS_08830 8782 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 9152 8784 gene locus_tag LOCUS_08840 9152 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 9786 9340 gene locus_tag LOCUS_08850 9786 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 10428 9910 gene locus_tag LOCUS_08860 10428 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 12263 10500 gene locus_tag LOCUS_08870 12263 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 12847 12260 gene locus_tag LOCUS_08880 12847 12260 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 protein_id gnl|my_center|LOCUS_08880 13367 13185 gene locus_tag LOCUS_08890 13367 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 13982 13512 gene locus_tag LOCUS_08900 13982 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 14181 14891 gene locus_tag LOCUS_08910 14181 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 16036 15014 gene locus_tag LOCUS_08920 gene queA 16036 15014 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583955.1 protein_id gnl|my_center|LOCUS_08920 17299 16121 gene locus_tag LOCUS_08930 17299 16121 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_08930 17655 17410 gene locus_tag LOCUS_08940 17655 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 18669 17659 gene locus_tag LOCUS_08950 18669 17659 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_08950 20005 18719 gene locus_tag LOCUS_08960 20005 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 21099 20005 gene locus_tag LOCUS_08970 gene leuB 21099 20005 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143540.1 protein_id gnl|my_center|LOCUS_08970 22672 21086 gene locus_tag LOCUS_08980 22672 21086 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_08980 22846 23082 gene locus_tag LOCUS_08990 22846 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 24290 23466 gene locus_tag LOCUS_09000 gene pssA 24290 23466 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_09000 24883 24287 gene locus_tag LOCUS_09010 24883 24287 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971370.1 protein_id gnl|my_center|LOCUS_09010 26053 25040 gene locus_tag LOCUS_09020 gene ilvC 26053 25040 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545824.1 protein_id gnl|my_center|LOCUS_09020 26640 26119 gene locus_tag LOCUS_09030 gene ilvN 26640 26119 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_09030 28924 27146 gene locus_tag LOCUS_09040 gene ilvB 28924 27146 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_09040 29209 30378 gene locus_tag LOCUS_09050 29209 30378 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228785.1 protein_id gnl|my_center|LOCUS_09050 30728 30537 gene locus_tag LOCUS_09060 30728 30537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 31028 30744 gene locus_tag LOCUS_09070 31028 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 31010 31237 gene locus_tag LOCUS_09080 31010 31237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 31930 31262 gene locus_tag LOCUS_09090 31930 31262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence019 478 1524 gene locus_tag LOCUS_09100 478 1524 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_09100 2950 1907 gene locus_tag LOCUS_09110 gene galE 2950 1907 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967679.1 protein_id gnl|my_center|LOCUS_09110 5049 3040 gene locus_tag LOCUS_09120 gene metG 5049 3040 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_09120 6134 5118 gene locus_tag LOCUS_09130 gene holB 6134 5118 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_09130 6879 6151 gene locus_tag LOCUS_09140 gene tmk 6879 6151 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_09140 7378 8073 gene locus_tag LOCUS_09150 7378 8073 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_09150 8228 9610 gene locus_tag LOCUS_09160 gene glmU 8228 9610 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_09160 9707 11536 gene locus_tag LOCUS_09170 gene glmS 9707 11536 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_09170 12458 11652 gene locus_tag LOCUS_09180 12458 11652 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_09180 13183 14304 gene locus_tag LOCUS_09190 13183 14304 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_09190 14767 14324 gene locus_tag LOCUS_09200 14767 14324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 14990 15520 gene locus_tag LOCUS_09210 14990 15520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09210 15560 16171 gene locus_tag LOCUS_09220 gene comE 15560 16171 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_09220 16176 17276 gene locus_tag LOCUS_09230 16176 17276 CDS product 2-aminoethylphosphonate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525538.1 protein_id gnl|my_center|LOCUS_09230 17273 18019 gene locus_tag LOCUS_09240 17273 18019 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188389.1 protein_id gnl|my_center|LOCUS_09240 18061 19533 gene locus_tag LOCUS_09250 18061 19533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 19709 19524 gene locus_tag LOCUS_09260 19709 19524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 19650 20639 gene locus_tag LOCUS_09270 19650 20639 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_09270 21674 20667 gene locus_tag LOCUS_09280 21674 20667 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_09280 21965 21684 gene locus_tag LOCUS_09290 21965 21684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 21978 26534 gene locus_tag LOCUS_09300 gene gltB 21978 26534 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_09300 26527 27963 gene locus_tag LOCUS_09310 26527 27963 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 protein_id gnl|my_center|LOCUS_09310 29110 28214 gene locus_tag LOCUS_09320 29110 28214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 30396 29350 gene locus_tag LOCUS_09330 30396 29350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 30765 31259 gene locus_tag LOCUS_09340 30765 31259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence020 562 3993 gene locus_tag LOCUS_09350 562 3993 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_09350 4026 5018 gene locus_tag LOCUS_09360 4026 5018 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943657.1 protein_id gnl|my_center|LOCUS_09360 5390 5076 gene locus_tag LOCUS_09370 5390 5076 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189573.1 protein_id gnl|my_center|LOCUS_09370 5799 5500 gene locus_tag LOCUS_09380 5799 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 7048 5891 gene locus_tag LOCUS_09390 7048 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9064 7244 gene locus_tag LOCUS_09400 9064 7244 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_09400 10435 9278 gene locus_tag LOCUS_09410 10435 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 11792 10776 gene locus_tag LOCUS_09420 11792 10776 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_09420 12275 11796 gene locus_tag LOCUS_09430 12275 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 12661 12737 gene locus_tag LOCUS_t00220 12661 12737 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13549 13001 gene locus_tag LOCUS_09440 13549 13001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 14394 13834 gene locus_tag LOCUS_09450 gene msrA 14394 13834 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_09450 14570 17122 gene locus_tag LOCUS_09460 14570 17122 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_09460 17624 17154 gene locus_tag LOCUS_09470 17624 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 18617 17829 gene locus_tag LOCUS_09480 gene thiD 18617 17829 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256279.1 protein_id gnl|my_center|LOCUS_09480 19179 18913 gene locus_tag LOCUS_09490 19179 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 19433 19176 gene locus_tag LOCUS_09500 19433 19176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 21146 19632 gene locus_tag LOCUS_09510 21146 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 21523 21143 gene locus_tag LOCUS_09520 21523 21143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 22221 21817 gene locus_tag LOCUS_09530 22221 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 22160 22459 gene locus_tag LOCUS_09540 22160 22459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 22695 23624 gene locus_tag LOCUS_09550 gene glyQ 22695 23624 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_09550 23644 25869 gene locus_tag LOCUS_09560 gene glyS 23644 25869 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_09560 26076 28916 gene locus_tag LOCUS_09570 gene ppdK 26076 28916 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546740.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence021 2057 1560 gene locus_tag LOCUS_09580 2057 1560 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_09580 4128 2149 gene locus_tag LOCUS_09590 4128 2149 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941238.1 protein_id gnl|my_center|LOCUS_09590 4568 4125 gene locus_tag LOCUS_09600 4568 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4789 5259 gene locus_tag LOCUS_09610 4789 5259 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920750.1 protein_id gnl|my_center|LOCUS_09610 5773 5357 gene locus_tag LOCUS_09620 5773 5357 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_09620 6459 7709 gene locus_tag LOCUS_09630 gene rho 6459 7709 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_09630 7808 8023 gene locus_tag LOCUS_09640 gene rpmE 7808 8023 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545159.1 protein_id gnl|my_center|LOCUS_09640 8100 9233 gene locus_tag LOCUS_09650 gene prfA 8100 9233 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199033.1 protein_id gnl|my_center|LOCUS_09650 9230 10150 gene locus_tag LOCUS_09660 gene prmC 9230 10150 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_09660 10153 11412 gene locus_tag LOCUS_09670 gene murA 10153 11412 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037922.1 protein_id gnl|my_center|LOCUS_09670 11409 12080 gene locus_tag LOCUS_09680 gene hisG 11409 12080 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_09680 12077 13360 gene locus_tag LOCUS_09690 gene hisD 12077 13360 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_09690 13357 13974 gene locus_tag LOCUS_09700 gene hisB 13357 13974 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_09700 14009 14623 gene locus_tag LOCUS_09710 gene hisH 14009 14623 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943718.1 protein_id gnl|my_center|LOCUS_09710 14620 15375 gene locus_tag LOCUS_09720 14620 15375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 15494 16216 gene locus_tag LOCUS_09730 gene hisA 15494 16216 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140708.1 protein_id gnl|my_center|LOCUS_09730 16231 17034 gene locus_tag LOCUS_09740 gene hisF 16231 17034 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_09740 17018 17749 gene locus_tag LOCUS_09750 gene hisIE 17018 17749 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228687.1 protein_id gnl|my_center|LOCUS_09750 17951 19735 gene locus_tag LOCUS_09760 gene dnaG 17951 19735 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528223.1 protein_id gnl|my_center|LOCUS_09760 20033 20109 gene locus_tag LOCUS_t00230 20033 20109 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20190 20930 gene locus_tag LOCUS_09770 20190 20930 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_09770 21491 21225 gene locus_tag LOCUS_09780 21491 21225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 21753 21830 gene locus_tag LOCUS_t00240 21753 21830 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22035 22949 gene locus_tag LOCUS_09790 22035 22949 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_09790 26781 23263 gene locus_tag LOCUS_09800 26781 23263 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_09800 27313 27603 gene locus_tag LOCUS_09810 27313 27603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 29018 27624 gene locus_tag LOCUS_09820 29018 27624 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_09820 29566 29105 gene locus_tag LOCUS_09830 29566 29105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence022 273 46 gene locus_tag LOCUS_09840 273 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1727 486 gene locus_tag LOCUS_09850 1727 486 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_09850 2850 1795 gene locus_tag LOCUS_09860 gene argF 2850 1795 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_09860 3118 2837 gene locus_tag LOCUS_09870 3118 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4465 3146 gene locus_tag LOCUS_09880 4465 3146 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_09880 4831 5427 gene locus_tag LOCUS_09890 4831 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 6277 5444 gene locus_tag LOCUS_09900 6277 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6406 7011 gene locus_tag LOCUS_09910 gene gpmA 6406 7011 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_09910 8321 7395 gene locus_tag LOCUS_09920 8321 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 9155 8649 gene locus_tag LOCUS_09930 9155 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 9448 10005 gene locus_tag LOCUS_09940 9448 10005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10102 10725 gene locus_tag LOCUS_09950 10102 10725 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_09950 10968 12179 gene locus_tag LOCUS_09960 10968 12179 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_09960 12285 14015 gene locus_tag LOCUS_09970 12285 14015 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_09970 14052 17192 gene locus_tag LOCUS_09980 14052 17192 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_09980 17317 20076 gene locus_tag LOCUS_09990 gene polA 17317 20076 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_09990 21982 20147 gene locus_tag LOCUS_10000 21982 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 23031 22048 gene locus_tag LOCUS_10010 23031 22048 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258385.1 protein_id gnl|my_center|LOCUS_10010 23461 24258 gene locus_tag LOCUS_10020 23461 24258 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_10020 24446 24249 gene locus_tag LOCUS_10030 24446 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 25651 24761 gene locus_tag LOCUS_10040 gene argB 25651 24761 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_10040 27200 25773 gene locus_tag LOCUS_10050 gene hslU 27200 25773 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_10050 27739 27197 gene locus_tag LOCUS_10060 gene hslV 27739 27197 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_10060 28785 27736 gene locus_tag LOCUS_10070 28785 27736 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994886.1 protein_id gnl|my_center|LOCUS_10070 <29500 28758 gene locus_tag LOCUS_10080 <29500 28758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943183.1:methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO >Feature sequence023 309 73 gene locus_tag LOCUS_10090 309 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1194 613 gene locus_tag LOCUS_10100 1194 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2593 1199 gene locus_tag LOCUS_10110 2593 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5377 2630 gene locus_tag LOCUS_10120 5377 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6105 5419 gene locus_tag LOCUS_10130 gene prcA 6105 5419 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_10130 6953 6105 gene locus_tag LOCUS_10140 gene prcB 6953 6105 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_10140 8480 6957 gene locus_tag LOCUS_10150 gene dop 8480 6957 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080108.1 protein_id gnl|my_center|LOCUS_10150 10196 8511 gene locus_tag LOCUS_10160 gene arc 10196 8511 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_10160 11304 10663 gene locus_tag LOCUS_10170 gene thiE 11304 10663 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_10170 12279 11509 gene locus_tag LOCUS_10180 12279 11509 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_10180 12527 12297 gene locus_tag LOCUS_10190 gene thiS 12527 12297 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546191.1 protein_id gnl|my_center|LOCUS_10190 12753 13229 gene locus_tag LOCUS_10200 12753 13229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 13572 13348 gene locus_tag LOCUS_10210 13572 13348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 14972 13707 gene locus_tag LOCUS_10220 14972 13707 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_10220 16196 15120 gene locus_tag LOCUS_10230 16196 15120 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546667.1 protein_id gnl|my_center|LOCUS_10230 17080 16196 gene locus_tag LOCUS_10240 gene ftsX 17080 16196 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056458.1 protein_id gnl|my_center|LOCUS_10240 17748 17080 gene locus_tag LOCUS_10250 gene ftsE 17748 17080 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_10250 18195 17809 gene locus_tag LOCUS_10260 18195 17809 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_10260 18842 18192 gene locus_tag LOCUS_10270 18842 18192 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_10270 19314 18868 gene locus_tag LOCUS_10280 19314 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 20086 19292 gene locus_tag LOCUS_10290 gene trmD 20086 19292 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_10290 20603 20076 gene locus_tag LOCUS_10300 gene rimM 20603 20076 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_10300 21005 20718 gene locus_tag LOCUS_10310 gene rpsP 21005 20718 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_10310 22614 21079 gene locus_tag LOCUS_10320 gene ffh 22614 21079 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_10320 22764 23024 gene locus_tag LOCUS_10330 22764 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 25027 23021 gene locus_tag LOCUS_10340 gene uvrB 25027 23021 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_10340 25298 25083 gene locus_tag LOCUS_10350 25298 25083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 25359 26351 gene locus_tag LOCUS_10360 25359 26351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 26348 26968 gene locus_tag LOCUS_10370 26348 26968 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence024 2896 935 gene locus_tag LOCUS_10380 2896 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4404 3532 gene locus_tag LOCUS_10390 4404 3532 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392169.1 protein_id gnl|my_center|LOCUS_10390 5359 4445 gene locus_tag LOCUS_10400 5359 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5779 5408 gene locus_tag LOCUS_10410 5779 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 6456 5815 gene locus_tag LOCUS_10420 6456 5815 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403064.1 protein_id gnl|my_center|LOCUS_10420 8321 6453 gene locus_tag LOCUS_10430 8321 6453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 9415 8384 gene locus_tag LOCUS_10440 9415 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 9993 9400 gene locus_tag LOCUS_10450 9993 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 10710 9994 gene locus_tag LOCUS_10460 10710 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 11701 10703 gene locus_tag LOCUS_10470 11701 10703 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_10470 12970 12176 gene locus_tag LOCUS_10480 12970 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 15257 13227 gene locus_tag LOCUS_10490 15257 13227 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_10490 16821 15451 gene locus_tag LOCUS_10500 16821 15451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 17493 16822 gene locus_tag LOCUS_10510 17493 16822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 18403 17495 gene locus_tag LOCUS_10520 18403 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 19193 18420 gene locus_tag LOCUS_10530 19193 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 24451 19514 gene locus_tag LOCUS_10540 24451 19514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 25504 24641 gene locus_tag LOCUS_10550 gene dat 25504 24641 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 protein_id gnl|my_center|LOCUS_10550 25870 25520 gene locus_tag LOCUS_10560 25870 25520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 26818 26393 gene locus_tag LOCUS_10570 26818 26393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence025 <1 1214 gene locus_tag LOCUS_10580 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545621.1:penicillin-binding protein 2 1282 2811 gene locus_tag LOCUS_10590 1282 2811 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_10590 2814 4250 gene locus_tag LOCUS_10600 2814 4250 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_10600 4268 5344 gene locus_tag LOCUS_10610 gene mraY 4268 5344 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_10610 5355 6815 gene locus_tag LOCUS_10620 gene murD 5355 6815 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_10620 6828 8015 gene locus_tag LOCUS_10630 gene ftsW 6828 8015 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_10630 8021 9106 gene locus_tag LOCUS_10640 gene murG 8021 9106 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_10640 9125 10504 gene locus_tag LOCUS_10650 gene murC 9125 10504 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_10650 10501 11493 gene locus_tag LOCUS_10660 gene murB 10501 11493 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_10660 11501 12436 gene locus_tag LOCUS_10670 11501 12436 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_10670 12495 13214 gene locus_tag LOCUS_10680 12495 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 13224 14462 gene locus_tag LOCUS_10690 gene ftsA 13224 14462 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_10690 14600 15793 gene locus_tag LOCUS_10700 gene ftsZ 14600 15793 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_10700 15929 16603 gene locus_tag LOCUS_10710 15929 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 16608 17372 gene locus_tag LOCUS_10720 16608 17372 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_10720 17495 17794 gene locus_tag LOCUS_10730 17495 17794 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_10730 17855 19009 gene locus_tag LOCUS_10740 17855 19009 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927203.1 protein_id gnl|my_center|LOCUS_10740 19406 19056 gene locus_tag LOCUS_10750 19406 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 19671 20132 gene locus_tag LOCUS_10760 19671 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 20336 20941 gene locus_tag LOCUS_10770 20336 20941 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_10770 20971 22812 gene locus_tag LOCUS_10780 gene pilB 20971 22812 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_10780 22923 24134 gene locus_tag LOCUS_10790 22923 24134 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_10790 24134 25096 gene locus_tag LOCUS_10800 gene ispE 24134 25096 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence026 691 365 gene locus_tag LOCUS_10810 691 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 861 2060 gene locus_tag LOCUS_10820 861 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2499 2681 gene locus_tag LOCUS_10830 2499 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3412 2801 gene locus_tag LOCUS_10840 gene ruvA 3412 2801 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_10840 6711 3409 gene locus_tag LOCUS_10850 6711 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7385 7083 gene locus_tag LOCUS_10860 7385 7083 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_10860 7725 7507 gene locus_tag LOCUS_10870 7725 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 11068 7856 gene locus_tag LOCUS_10880 11068 7856 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_10880 11910 11206 gene locus_tag LOCUS_10890 11910 11206 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_10890 12275 12556 gene locus_tag LOCUS_10900 12275 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 12566 12892 gene locus_tag LOCUS_10910 12566 12892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 12967 13974 gene locus_tag LOCUS_10920 gene fmt 12967 13974 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_10920 14017 14361 gene locus_tag LOCUS_10930 14017 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 14377 15192 gene locus_tag LOCUS_10940 gene rsmA 14377 15192 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_10940 15392 17836 gene locus_tag LOCUS_10950 15392 17836 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_10950 17833 18525 gene locus_tag LOCUS_10960 17833 18525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 18709 19314 gene locus_tag LOCUS_10970 18709 19314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 19314 19988 gene locus_tag LOCUS_10980 19314 19988 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_10980 20679 21173 gene locus_tag LOCUS_10990 gene msrB 20679 21173 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968577.1 protein_id gnl|my_center|LOCUS_10990 21478 21290 gene locus_tag LOCUS_11000 gene rpmB 21478 21290 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546135.1 protein_id gnl|my_center|LOCUS_11000 21867 24122 gene locus_tag LOCUS_11010 gene recG 21867 24122 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence027 357 1472 gene locus_tag LOCUS_11020 357 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1498 1875 gene locus_tag LOCUS_11030 1498 1875 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_11030 1924 3732 gene locus_tag LOCUS_11040 1924 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3872 4225 gene locus_tag LOCUS_11050 3872 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4356 5756 gene locus_tag LOCUS_11060 4356 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 7110 5860 gene locus_tag LOCUS_11070 7110 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 7537 7208 gene locus_tag LOCUS_11080 gene grxD 7537 7208 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143330.1 protein_id gnl|my_center|LOCUS_11080 7802 7551 gene locus_tag LOCUS_11090 7802 7551 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144400.1 protein_id gnl|my_center|LOCUS_11090 7647 7656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8649 7933 gene locus_tag LOCUS_11100 8649 7933 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_11100 8865 8686 gene locus_tag LOCUS_11110 8865 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 9139 10008 gene locus_tag LOCUS_11120 9139 10008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 10449 11582 gene locus_tag LOCUS_11130 10449 11582 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143735.1 protein_id gnl|my_center|LOCUS_11130 11579 12157 gene locus_tag LOCUS_11140 11579 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 12262 13068 gene locus_tag LOCUS_11150 gene xth 12262 13068 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878084.1 protein_id gnl|my_center|LOCUS_11150 13713 13129 gene locus_tag LOCUS_11160 13713 13129 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_11160 13669 13845 gene locus_tag LOCUS_11170 13669 13845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 15259 13967 gene locus_tag LOCUS_11180 15259 13967 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222691.1 protein_id gnl|my_center|LOCUS_11180 16170 15412 gene locus_tag LOCUS_11190 16170 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 17467 16361 gene locus_tag LOCUS_11200 17467 16361 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_11200 17679 17602 gene locus_tag LOCUS_t00250 17679 17602 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17767 17928 gene locus_tag LOCUS_11210 17767 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 18615 17878 gene locus_tag LOCUS_11220 gene rpiA 18615 17878 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_11220 19687 18623 gene locus_tag LOCUS_11230 gene glk 19687 18623 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_11230 20576 20379 gene locus_tag LOCUS_11240 20576 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 21427 20573 gene locus_tag LOCUS_11250 21427 20573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 22014 21481 gene locus_tag LOCUS_11260 22014 21481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 22815 22357 gene locus_tag LOCUS_11270 22815 22357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487403.1 protein_id gnl|my_center|LOCUS_11270 23042 22812 gene locus_tag LOCUS_11280 23042 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 23674 23318 gene locus_tag LOCUS_11290 23674 23318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11290 23998 23684 gene locus_tag LOCUS_11300 23998 23684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence028 2427 613 gene locus_tag LOCUS_11310 gene mutL 2427 613 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_11310 4967 2640 gene locus_tag LOCUS_11320 4967 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6364 4964 gene locus_tag LOCUS_11330 gene tolB 6364 4964 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_11330 7755 6367 gene locus_tag LOCUS_11340 7755 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8202 7771 gene locus_tag LOCUS_11350 gene tolR 8202 7771 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_11350 8933 8202 gene locus_tag LOCUS_11360 gene tolQ 8933 8202 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_11360 9099 9022 gene locus_tag LOCUS_t00260 9099 9022 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9281 9206 gene locus_tag LOCUS_t00270 9281 9206 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9467 10702 gene locus_tag LOCUS_11370 9467 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 12032 10728 gene locus_tag LOCUS_11380 12032 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12866 13282 gene locus_tag LOCUS_11390 12866 13282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13297 14160 gene locus_tag LOCUS_11400 13297 14160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 14626 14186 gene locus_tag LOCUS_11410 14626 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 14744 15133 gene locus_tag LOCUS_11420 14744 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 15700 15203 gene locus_tag LOCUS_11430 15700 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 15853 16731 gene locus_tag LOCUS_11440 15853 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 16828 17706 gene locus_tag LOCUS_11450 16828 17706 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_11450 18180 17914 gene locus_tag LOCUS_11460 18180 17914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 20170 19274 gene locus_tag LOCUS_11470 20170 19274 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_11470 20403 21674 gene locus_tag LOCUS_11480 20403 21674 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_11480 21675 22820 gene locus_tag LOCUS_11490 21675 22820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence029 832 101 gene locus_tag LOCUS_11500 gene leuD 832 101 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_11500 2275 872 gene locus_tag LOCUS_11510 gene leuC 2275 872 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_11510 3326 4375 gene locus_tag LOCUS_11520 3326 4375 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_11520 4389 5294 gene locus_tag LOCUS_11530 gene mreC 4389 5294 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537511.1 protein_id gnl|my_center|LOCUS_11530 5291 5812 gene locus_tag LOCUS_11540 5291 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5809 7716 gene locus_tag LOCUS_11550 gene mrdA 5809 7716 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_11550 7709 8830 gene locus_tag LOCUS_11560 gene rodA 7709 8830 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_11560 9074 10618 gene locus_tag LOCUS_11570 gene rng 9074 10618 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_11570 10873 10951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10992 12107 gene locus_tag LOCUS_11580 gene dprA 10992 12107 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_11580 12429 15140 gene locus_tag LOCUS_11590 12429 15140 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_11590 16517 15249 gene locus_tag LOCUS_11600 gene clpX 16517 15249 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_11600 17216 16605 gene locus_tag LOCUS_11610 gene clpP 17216 16605 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_11610 18583 17258 gene locus_tag LOCUS_11620 gene tig 18583 17258 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_11620 18725 18643 gene locus_tag LOCUS_t00280 18725 18643 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19065 19322 gene locus_tag LOCUS_11630 19065 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 19356 20174 gene locus_tag LOCUS_11640 19356 20174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 20319 20408 gene locus_tag LOCUS_t00290 20319 20408 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20445 21317 gene locus_tag LOCUS_11650 20445 21317 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837305.1 protein_id gnl|my_center|LOCUS_11650 21327 21461 gene locus_tag LOCUS_11660 21327 21461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 21687 22220 gene locus_tag LOCUS_11670 21687 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence030 407 2452 gene locus_tag LOCUS_11680 gene thiC 407 2452 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_11680 2456 3316 gene locus_tag LOCUS_11690 2456 3316 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_11690 3515 4030 gene locus_tag LOCUS_11700 3515 4030 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930822.1 protein_id gnl|my_center|LOCUS_11700 4220 4268 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4353 4769 gene locus_tag LOCUS_11710 4353 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 4750 5868 gene locus_tag LOCUS_11720 4750 5868 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_11720 5935 6123 gene locus_tag LOCUS_11730 5935 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6175 7311 gene locus_tag LOCUS_11740 6175 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 7661 7446 gene locus_tag LOCUS_11750 7661 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 8150 7680 gene locus_tag LOCUS_11760 8150 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 8376 8585 gene locus_tag LOCUS_11770 8376 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 9480 9079 gene locus_tag LOCUS_11780 9480 9079 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_11780 10872 9973 gene locus_tag LOCUS_11790 10872 9973 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 protein_id gnl|my_center|LOCUS_11790 11360 12049 gene locus_tag LOCUS_11800 11360 12049 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_11800 12287 12634 gene locus_tag LOCUS_11810 12287 12634 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_11810 16589 12744 gene locus_tag LOCUS_11820 gene smc 16589 12744 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908442.1 protein_id gnl|my_center|LOCUS_11820 17763 16819 gene locus_tag LOCUS_11830 gene ispH 17763 16819 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_11830 18956 17928 gene locus_tag LOCUS_11840 18956 17928 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_11840 21108 18958 gene locus_tag LOCUS_11850 21108 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 21186 22340 gene locus_tag LOCUS_11860 21186 22340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence031 <1 823 gene locus_tag LOCUS_11870 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545172.1:ATP-dependent Clp protease ATP-binding subunit 907 2040 gene locus_tag LOCUS_11880 gene tsaD 907 2040 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_11880 2083 3771 gene locus_tag LOCUS_11890 gene hflX 2083 3771 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_11890 3768 4454 gene locus_tag LOCUS_11900 gene nth 3768 4454 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_11900 4448 5326 gene locus_tag LOCUS_11910 4448 5326 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942879.1 protein_id gnl|my_center|LOCUS_11910 5368 6009 gene locus_tag LOCUS_11920 gene gmk 5368 6009 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546551.1 protein_id gnl|my_center|LOCUS_11920 6043 6444 gene locus_tag LOCUS_11930 6043 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 6464 7720 gene locus_tag LOCUS_11940 gene coaBC 6464 7720 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_11940 7972 7885 gene locus_tag LOCUS_t00300 7972 7885 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8490 7993 gene locus_tag LOCUS_11950 gene tadA 8490 7993 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_11950 9523 10527 gene locus_tag LOCUS_11960 9523 10527 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816877.1 protein_id gnl|my_center|LOCUS_11960 10740 11360 gene locus_tag LOCUS_11970 gene thrH 10740 11360 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_11970 11479 11850 gene locus_tag LOCUS_11980 11479 11850 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144175.1 protein_id gnl|my_center|LOCUS_11980 12060 13040 gene locus_tag LOCUS_11990 12060 13040 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_11990 13333 14223 gene locus_tag LOCUS_12000 13333 14223 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880732.1 protein_id gnl|my_center|LOCUS_12000 14287 14991 gene locus_tag LOCUS_12010 14287 14991 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880733.1 protein_id gnl|my_center|LOCUS_12010 15018 15347 gene locus_tag LOCUS_12020 15018 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 15535 16149 gene locus_tag LOCUS_12030 15535 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 16221 17567 gene locus_tag LOCUS_12040 16221 17567 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880731.1 protein_id gnl|my_center|LOCUS_12040 17718 17551 gene locus_tag LOCUS_12050 17718 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 17817 18596 gene locus_tag LOCUS_12060 gene surE 17817 18596 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_12060 18616 19257 gene locus_tag LOCUS_12070 18616 19257 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_12070 19254 20711 gene locus_tag LOCUS_12080 gene cysS 19254 20711 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_12080 20686 21474 gene locus_tag LOCUS_12090 gene rlmB 20686 21474 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_12090 21736 21461 gene locus_tag LOCUS_12100 21736 21461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence032 487 1731 gene locus_tag LOCUS_12110 gene amrB 487 1731 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_12110 2289 1759 gene locus_tag LOCUS_12120 2289 1759 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933473.1 protein_id gnl|my_center|LOCUS_12120 2523 3452 gene locus_tag LOCUS_12130 2523 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3497 4150 gene locus_tag LOCUS_12140 3497 4150 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_12140 4300 5232 gene locus_tag LOCUS_12150 4300 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5439 6281 gene locus_tag LOCUS_12160 5439 6281 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_12160 6250 7071 gene locus_tag LOCUS_12170 6250 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7155 10013 gene locus_tag LOCUS_12180 7155 10013 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_12180 10032 10310 gene locus_tag LOCUS_12190 10032 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 11355 10402 gene locus_tag LOCUS_12200 11355 10402 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_12200 14853 11380 gene locus_tag LOCUS_12210 gene dnaE 14853 11380 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_12210 14749 15060 gene locus_tag LOCUS_12220 14749 15060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 15666 15169 gene locus_tag LOCUS_12230 15666 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 15872 16489 gene locus_tag LOCUS_12240 15872 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 16536 17801 gene locus_tag LOCUS_12250 16536 17801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 18207 17851 gene locus_tag LOCUS_12260 gene arsC 18207 17851 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194454.1 protein_id gnl|my_center|LOCUS_12260 18327 18695 gene locus_tag LOCUS_12270 18327 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 19671 18820 gene locus_tag LOCUS_12280 19671 18820 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence033 35 1196 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgtggtttccctacaaaccaaaagcggctatact 1576 1244 gene locus_tag LOCUS_12290 gene cas2 1576 1244 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_12290 2479 1586 gene locus_tag LOCUS_12300 gene cas1 2479 1586 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_12300 5754 2455 gene locus_tag LOCUS_12310 5754 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 7324 6062 gene locus_tag LOCUS_12320 gene tyrS 7324 6062 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_12320 7738 7331 gene locus_tag LOCUS_12330 7738 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 9138 7735 gene locus_tag LOCUS_12340 gene lpdA 9138 7735 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_12340 9551 9138 gene locus_tag LOCUS_12350 gene gcvH 9551 9138 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_12350 10977 9601 gene locus_tag LOCUS_12360 10977 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 11550 11140 gene locus_tag LOCUS_12370 gene ndk 11550 11140 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_12370 12002 12730 gene locus_tag LOCUS_12380 12002 12730 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_12380 12827 13027 gene locus_tag LOCUS_12390 gene thiS 12827 13027 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_12390 13024 13953 gene locus_tag LOCUS_12400 gene cysK 13024 13953 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_12400 13988 14815 gene locus_tag LOCUS_12410 gene thiF 13988 14815 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_12410 14815 16134 gene locus_tag LOCUS_12420 gene thrC 14815 16134 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_12420 16131 16412 gene locus_tag LOCUS_12430 16131 16412 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_12430 16405 16644 gene locus_tag LOCUS_12440 16405 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 16651 17451 gene locus_tag LOCUS_12450 gene moeB 16651 17451 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_12450 17457 17969 gene locus_tag LOCUS_12460 17457 17969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 20516 18075 gene locus_tag LOCUS_12470 20516 18075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence034 368 1042 gene locus_tag LOCUS_12480 368 1042 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896828.1 protein_id gnl|my_center|LOCUS_12480 1114 1608 gene locus_tag LOCUS_12490 gene pth 1114 1608 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_12490 1782 2165 gene locus_tag LOCUS_12500 1782 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2152 2571 gene locus_tag LOCUS_12510 gene ssb 2152 2571 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_12510 2921 3490 gene locus_tag LOCUS_12520 2921 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3598 3467 gene locus_tag LOCUS_12530 3598 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3841 4806 gene locus_tag LOCUS_12540 3841 4806 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_12540 4986 5168 gene locus_tag LOCUS_12550 gene rpmF 4986 5168 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_12550 5214 6242 gene locus_tag LOCUS_12560 gene plsX 5214 6242 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_12560 6291 7217 gene locus_tag LOCUS_12570 6291 7217 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_12570 7546 7902 gene locus_tag LOCUS_12580 7546 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7973 8788 gene locus_tag LOCUS_12590 7973 8788 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_12590 8922 9809 gene locus_tag LOCUS_12600 gene fabD 8922 9809 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_12600 9843 10583 gene locus_tag LOCUS_12610 gene fabG 9843 10583 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_12610 10636 10866 gene locus_tag LOCUS_12620 gene acpP 10636 10866 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_12620 10886 12187 gene locus_tag LOCUS_12630 gene fabF 10886 12187 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_12630 12263 12976 gene locus_tag LOCUS_12640 gene rnc 12263 12976 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_12640 13003 13644 gene locus_tag LOCUS_12650 13003 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 14351 13674 gene locus_tag LOCUS_12660 14351 13674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 15298 14348 gene locus_tag LOCUS_12670 15298 14348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 15573 16427 gene locus_tag LOCUS_12680 gene folD 15573 16427 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_12680 16449 17342 gene locus_tag LOCUS_12690 16449 17342 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_12690 17339 18124 gene locus_tag LOCUS_12700 gene panB 17339 18124 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence035 32 1255 gene locus_tag LOCUS_12710 32 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1597 4314 gene locus_tag LOCUS_12720 1597 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 4285 4294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4634 4981 gene locus_tag LOCUS_12730 4634 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 5029 5202 gene locus_tag LOCUS_12740 5029 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5225 5902 gene locus_tag LOCUS_12750 5225 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546359.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12750 5941 6342 gene locus_tag LOCUS_12760 5941 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 6894 6535 gene locus_tag LOCUS_12770 6894 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 7421 7909 gene locus_tag LOCUS_12780 7421 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 8753 8388 gene locus_tag LOCUS_12790 8753 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 10171 8939 gene locus_tag LOCUS_12800 10171 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 10854 10510 gene locus_tag LOCUS_12810 10854 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 11077 12396 gene locus_tag LOCUS_12820 11077 12396 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_12820 12400 13011 gene locus_tag LOCUS_12830 12400 13011 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_12830 13507 13169 gene locus_tag LOCUS_12840 13507 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 13667 14167 gene locus_tag LOCUS_12850 13667 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 15403 14183 gene locus_tag LOCUS_12860 15403 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 15971 18940 gene locus_tag LOCUS_12870 15971 18940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence036 239 919 gene locus_tag LOCUS_12880 239 919 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956994.1 protein_id gnl|my_center|LOCUS_12880 926 1654 gene locus_tag LOCUS_12890 926 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1651 2145 gene locus_tag LOCUS_12900 1651 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2341 2793 gene locus_tag LOCUS_12910 gene ccmE 2341 2793 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_12910 2856 4505 gene locus_tag LOCUS_12920 2856 4505 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_12920 4590 6551 gene locus_tag LOCUS_12930 4590 6551 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070640.1 protein_id gnl|my_center|LOCUS_12930 6555 7133 gene locus_tag LOCUS_12940 6555 7133 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268401.1 protein_id gnl|my_center|LOCUS_12940 7137 7607 gene locus_tag LOCUS_12950 7137 7607 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387794.1 protein_id gnl|my_center|LOCUS_12950 7656 8576 gene locus_tag LOCUS_12960 7656 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 9205 8573 gene locus_tag LOCUS_12970 9205 8573 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092770497.1 protein_id gnl|my_center|LOCUS_12970 10099 9233 gene locus_tag LOCUS_12980 10099 9233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 10636 10166 gene locus_tag LOCUS_12990 10636 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 10888 10658 gene locus_tag LOCUS_13000 10888 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 11590 11018 gene locus_tag LOCUS_13010 11590 11018 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272666.1 protein_id gnl|my_center|LOCUS_13010 12664 11828 gene locus_tag LOCUS_13020 12664 11828 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275437.1 protein_id gnl|my_center|LOCUS_13020 13397 12672 gene locus_tag LOCUS_13030 13397 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 14008 13721 gene locus_tag LOCUS_13040 14008 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 15430 15272 gene locus_tag LOCUS_13050 15430 15272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 15485 15988 gene locus_tag LOCUS_13060 15485 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 15989 17470 gene locus_tag LOCUS_13070 15989 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 17954 17481 gene locus_tag LOCUS_13080 17954 17481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 18790 17930 gene locus_tag LOCUS_13090 18790 17930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 18195 18204 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19122 18805 gene locus_tag LOCUS_13100 19122 18805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence037 134 352 gene locus_tag LOCUS_13110 134 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 448 1536 gene locus_tag LOCUS_13120 448 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1540 2043 gene locus_tag LOCUS_13130 1540 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2046 2981 gene locus_tag LOCUS_13140 2046 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3532 4227 gene locus_tag LOCUS_13150 3532 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 4307 4525 gene locus_tag LOCUS_13160 4307 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4721 5467 gene locus_tag LOCUS_13170 4721 5467 CDS product HIRAN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185757.1 protein_id gnl|my_center|LOCUS_13170 5624 8839 gene locus_tag LOCUS_13180 5624 8839 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_13180 9089 11185 gene locus_tag LOCUS_13190 9089 11185 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268660.1 protein_id gnl|my_center|LOCUS_13190 11188 12552 gene locus_tag LOCUS_13200 11188 12552 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268661.1 protein_id gnl|my_center|LOCUS_13200 13068 12631 gene locus_tag LOCUS_13210 13068 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 14710 13058 gene locus_tag LOCUS_13220 14710 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 17013 14923 gene locus_tag LOCUS_13230 17013 14923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 18954 17158 gene locus_tag LOCUS_13240 18954 17158 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence038 1424 1786 gene locus_tag LOCUS_13250 1424 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 5228 2046 gene locus_tag LOCUS_13260 5228 2046 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_13260 6791 5388 gene locus_tag LOCUS_13270 6791 5388 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_13270 8428 6788 gene locus_tag LOCUS_13280 8428 6788 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 protein_id gnl|my_center|LOCUS_13280 9081 8686 gene locus_tag LOCUS_13290 9081 8686 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_13290 10975 9260 gene locus_tag LOCUS_13300 10975 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 11886 10972 gene locus_tag LOCUS_13310 11886 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 13148 11985 gene locus_tag LOCUS_13320 13148 11985 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_13320 13277 14011 gene locus_tag LOCUS_13330 13277 14011 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525296.1 protein_id gnl|my_center|LOCUS_13330 14683 14117 gene locus_tag LOCUS_13340 14683 14117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_13340 16581 14977 gene locus_tag LOCUS_13350 gene murJ 16581 14977 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_13350 17523 16597 gene locus_tag LOCUS_13360 17523 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 18355 18152 gene locus_tag LOCUS_13370 18355 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence039 1708 377 gene locus_tag LOCUS_13380 1708 377 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_13380 1903 1977 gene locus_tag LOCUS_t00310 1903 1977 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2064 3911 gene locus_tag LOCUS_13390 2064 3911 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_13390 3987 4343 gene locus_tag LOCUS_13400 3987 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4764 4294 gene locus_tag LOCUS_13410 4764 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 6752 4791 gene locus_tag LOCUS_13420 6752 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 8123 6825 gene locus_tag LOCUS_13430 8123 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8259 9335 gene locus_tag LOCUS_13440 8259 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 9328 9573 gene locus_tag LOCUS_13450 9328 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 9696 9863 gene locus_tag LOCUS_13460 9696 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9928 10164 gene locus_tag LOCUS_13470 9928 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 11031 10291 gene locus_tag LOCUS_13480 11031 10291 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_13480 11168 11377 gene locus_tag LOCUS_13490 11168 11377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 11374 12264 gene locus_tag LOCUS_13500 11374 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 12272 14959 gene locus_tag LOCUS_13510 12272 14959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_13510 15275 16219 gene locus_tag LOCUS_13520 15275 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 16345 16665 gene locus_tag LOCUS_13530 16345 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 16979 16895 gene locus_tag LOCUS_t00320 16979 16895 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17208 17903 gene locus_tag LOCUS_13540 17208 17903 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083519.1 protein_id gnl|my_center|LOCUS_13540 17916 18560 gene locus_tag LOCUS_13550 gene queE 17916 18560 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence040 958 161 gene locus_tag LOCUS_13560 958 161 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_13560 3172 1211 gene locus_tag LOCUS_13570 gene oadA 3172 1211 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_13570 4639 3221 gene locus_tag LOCUS_13580 4639 3221 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546372.1 protein_id gnl|my_center|LOCUS_13580 5812 4907 gene locus_tag LOCUS_13590 5812 4907 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_13590 6256 5948 gene locus_tag LOCUS_13600 6256 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 6457 6636 gene locus_tag LOCUS_13610 6457 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6681 6884 gene locus_tag LOCUS_13620 6681 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 6984 7460 gene locus_tag LOCUS_13630 6984 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7569 8609 gene locus_tag LOCUS_13640 gene hemE 7569 8609 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258456.1 protein_id gnl|my_center|LOCUS_13640 8675 10126 gene locus_tag LOCUS_13650 gene hemY 8675 10126 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_13650 10140 10457 gene locus_tag LOCUS_13660 10140 10457 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_13660 10640 11155 gene locus_tag LOCUS_13670 10640 11155 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357441.1 protein_id gnl|my_center|LOCUS_13670 11551 11904 gene locus_tag LOCUS_13680 11551 11904 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924922.1 protein_id gnl|my_center|LOCUS_13680 12341 13036 gene locus_tag LOCUS_13690 gene queC 12341 13036 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_13690 13066 13536 gene locus_tag LOCUS_13700 13066 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 14037 14669 gene locus_tag LOCUS_13710 14037 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 14782 15591 gene locus_tag LOCUS_13720 gene modA 14782 15591 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_13720 15628 16296 gene locus_tag LOCUS_13730 gene modB 15628 16296 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 protein_id gnl|my_center|LOCUS_13730 16293 17378 gene locus_tag LOCUS_13740 gene modC 16293 17378 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence041 1317 718 gene locus_tag LOCUS_13750 1317 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1381 1551 gene locus_tag LOCUS_13760 1381 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1952 2566 gene locus_tag LOCUS_13770 1952 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3367 2588 gene locus_tag LOCUS_13780 gene larB 3367 2588 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_13780 4467 3364 gene locus_tag LOCUS_13790 4467 3364 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_13790 5121 6332 gene locus_tag LOCUS_13800 5121 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6329 8128 gene locus_tag LOCUS_13810 6329 8128 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_13810 8469 9749 gene locus_tag LOCUS_13820 8469 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 11002 9683 gene locus_tag LOCUS_13830 11002 9683 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_13830 11419 11643 gene locus_tag LOCUS_13840 11419 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 11597 11908 gene locus_tag LOCUS_13850 11597 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 12141 12722 gene locus_tag LOCUS_13860 12141 12722 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_13860 12706 13728 gene locus_tag LOCUS_13870 12706 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_13870 16118 13764 gene locus_tag LOCUS_13880 16118 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 16964 16167 gene locus_tag LOCUS_13890 16964 16167 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929738.1 protein_id gnl|my_center|LOCUS_13890 17317 16925 gene locus_tag LOCUS_13900 17317 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence042 149 1186 gene locus_tag LOCUS_13910 149 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525081.1 protein_id gnl|my_center|LOCUS_13910 1835 2701 gene locus_tag LOCUS_13920 1835 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2780 4063 gene locus_tag LOCUS_13930 2780 4063 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705134.1 protein_id gnl|my_center|LOCUS_13930 4254 5384 gene locus_tag LOCUS_13940 4254 5384 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666416.1 protein_id gnl|my_center|LOCUS_13940 6295 5507 gene locus_tag LOCUS_13950 6295 5507 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_13950 7230 6574 gene locus_tag LOCUS_13960 gene phoU 7230 6574 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_13960 8231 7335 gene locus_tag LOCUS_13970 gene pstB 8231 7335 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_13970 9805 8237 gene locus_tag LOCUS_13980 gene pstA 9805 8237 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_13980 9915 10184 gene locus_tag LOCUS_13990 9915 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 12591 10234 gene locus_tag LOCUS_14000 12591 10234 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_14000 13860 12745 gene locus_tag LOCUS_14010 gene pstS 13860 12745 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_14010 14032 13883 gene locus_tag LOCUS_14020 14032 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 14309 14004 gene locus_tag LOCUS_14030 14309 14004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 15843 14479 gene locus_tag LOCUS_14040 15843 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 16554 15865 gene locus_tag LOCUS_14050 16554 15865 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence043 207 1229 gene locus_tag LOCUS_14060 gene miaA 207 1229 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_14060 1337 2173 gene locus_tag LOCUS_14070 gene mtnP 1337 2173 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_14070 2175 3089 gene locus_tag LOCUS_14080 2175 3089 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_14080 3123 3338 gene locus_tag LOCUS_14090 3123 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3335 3811 gene locus_tag LOCUS_14100 3335 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3939 4397 gene locus_tag LOCUS_14110 3939 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4534 4740 gene locus_tag LOCUS_14120 4534 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4798 5682 gene locus_tag LOCUS_14130 4798 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 6240 5821 gene locus_tag LOCUS_14140 6240 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7179 6304 gene locus_tag LOCUS_14150 7179 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7620 9635 gene locus_tag LOCUS_14160 7620 9635 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_14160 9632 10525 gene locus_tag LOCUS_14170 9632 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10777 10852 gene locus_tag LOCUS_t00330 10777 10852 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10879 10954 gene locus_tag LOCUS_t00340 10879 10954 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12948 10966 gene locus_tag LOCUS_14180 12948 10966 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_14180 14362 13130 gene locus_tag LOCUS_14190 14362 13130 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_14190 14914 14507 gene locus_tag LOCUS_14200 14914 14507 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_14200 15590 14967 gene locus_tag LOCUS_14210 15590 14967 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_14210 15986 15642 gene locus_tag LOCUS_14220 15986 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence044 2358 376 gene locus_tag LOCUS_14230 gene nuoL 2358 376 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_14230 2662 2360 gene locus_tag LOCUS_14240 gene nuoK 2662 2360 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_14240 3201 2659 gene locus_tag LOCUS_14250 3201 2659 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_14250 3786 3211 gene locus_tag LOCUS_14260 3786 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 6494 3783 gene locus_tag LOCUS_14270 gene fdhF 6494 3783 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_14270 7834 6584 gene locus_tag LOCUS_14280 gene nuoD 7834 6584 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_14280 8367 7873 gene locus_tag LOCUS_14290 8367 7873 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941008.1 protein_id gnl|my_center|LOCUS_14290 8903 8367 gene locus_tag LOCUS_14300 8903 8367 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769074.1 protein_id gnl|my_center|LOCUS_14300 9345 8959 gene locus_tag LOCUS_14310 9345 8959 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_14310 9897 9562 gene locus_tag LOCUS_14320 9897 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 10369 9866 gene locus_tag LOCUS_14330 10369 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 10459 12750 gene locus_tag LOCUS_14340 10459 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 13244 12822 gene locus_tag LOCUS_14350 13244 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 15984 13360 gene locus_tag LOCUS_14360 15984 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence045 342 124 gene locus_tag LOCUS_14370 342 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 230 841 gene locus_tag LOCUS_14380 230 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1797 1102 gene locus_tag LOCUS_14390 gene yihA 1797 1102 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_14390 2332 1856 gene locus_tag LOCUS_14400 gene smpB 2332 1856 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_14400 2789 3286 gene locus_tag LOCUS_14410 2789 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3297 4022 gene locus_tag LOCUS_14420 3297 4022 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_14420 5103 4099 gene locus_tag LOCUS_14430 5103 4099 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_14430 5218 6207 gene locus_tag LOCUS_14440 gene dapF 5218 6207 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_14440 6753 7898 gene locus_tag LOCUS_14450 6753 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 7986 8348 gene locus_tag LOCUS_14460 7986 8348 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_14460 9482 8394 gene locus_tag LOCUS_14470 9482 8394 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 protein_id gnl|my_center|LOCUS_14470 10032 9571 gene locus_tag LOCUS_14480 gene bcp 10032 9571 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963650.1 protein_id gnl|my_center|LOCUS_14480 10286 11521 gene locus_tag LOCUS_14490 gene pdxB 10286 11521 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120453040.1 protein_id gnl|my_center|LOCUS_14490 11574 12041 gene locus_tag LOCUS_14500 11574 12041 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259066.1 protein_id gnl|my_center|LOCUS_14500 12122 13381 gene locus_tag LOCUS_14510 gene pdxB 12122 13381 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120453040.1 protein_id gnl|my_center|LOCUS_14510 13585 13442 gene locus_tag LOCUS_14520 13585 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence046 39 786 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttggtttgtagggaaa 1197 1580 gene locus_tag LOCUS_14530 1197 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2116 2190 gene locus_tag LOCUS_t00350 2116 2190 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2506 2321 gene locus_tag LOCUS_14540 2506 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2948 3484 gene locus_tag LOCUS_14550 2948 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 4861 3779 gene locus_tag LOCUS_14560 gene lpxD 4861 3779 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_14560 5331 4858 gene locus_tag LOCUS_14570 5331 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 6648 5389 gene locus_tag LOCUS_14580 gene fabF 6648 5389 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_14580 7798 6704 gene locus_tag LOCUS_14590 gene lptG 7798 6704 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_14590 8883 7798 gene locus_tag LOCUS_14600 8883 7798 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055867.1 protein_id gnl|my_center|LOCUS_14600 9161 9721 gene locus_tag LOCUS_14610 9161 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 9844 11322 gene locus_tag LOCUS_14620 gene cpsB 9844 11322 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084309.1 protein_id gnl|my_center|LOCUS_14620 11319 12716 gene locus_tag LOCUS_14630 11319 12716 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_14630 12866 13630 gene locus_tag LOCUS_14640 12866 13630 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_14640 13785 14690 gene locus_tag LOCUS_14650 gene fbp 13785 14690 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143122.1 protein_id gnl|my_center|LOCUS_14650 14766 14984 gene locus_tag LOCUS_14660 14766 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 14977 15687 gene locus_tag LOCUS_14670 gene ispD 14977 15687 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence047 473 2149 gene locus_tag LOCUS_14680 473 2149 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14680 2708 2313 gene locus_tag LOCUS_14690 2708 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2776 4479 gene locus_tag LOCUS_14700 2776 4479 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14700 4638 6539 gene locus_tag LOCUS_14710 4638 6539 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14710 6546 8405 gene locus_tag LOCUS_14720 6546 8405 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14720 8875 10629 gene locus_tag LOCUS_14730 8875 10629 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14730 11881 10739 gene locus_tag LOCUS_14740 11881 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 13538 15415 gene locus_tag LOCUS_14750 13538 15415 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence048 3136 1322 gene locus_tag LOCUS_14760 3136 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3729 3412 gene locus_tag LOCUS_14770 3729 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4097 5347 gene locus_tag LOCUS_14780 gene hisS 4097 5347 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_14780 5542 5907 gene locus_tag LOCUS_14790 5542 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 6443 7807 gene locus_tag LOCUS_14800 gene dnaA 6443 7807 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_14800 7830 9098 gene locus_tag LOCUS_14810 gene dnaN 7830 9098 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_14810 9242 11920 gene locus_tag LOCUS_14820 gene gyrB 9242 11920 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_14820 12189 14855 gene locus_tag LOCUS_14830 gene gyrA 12189 14855 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_14830 14742 14751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence049 675 1367 gene locus_tag LOCUS_14840 gene rsmG 675 1367 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_14840 1527 2300 gene locus_tag LOCUS_14850 1527 2300 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_14850 2278 3135 gene locus_tag LOCUS_14860 2278 3135 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_14860 3601 4056 gene locus_tag LOCUS_14870 3601 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4080 5201 gene locus_tag LOCUS_14880 gene mnmA 4080 5201 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256566.1 protein_id gnl|my_center|LOCUS_14880 5360 5953 gene locus_tag LOCUS_14890 gene atpH 5360 5953 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_14890 5957 7465 gene locus_tag LOCUS_14900 gene atpA 5957 7465 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_14900 7736 8578 gene locus_tag LOCUS_14910 gene atpG 7736 8578 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544924.1 protein_id gnl|my_center|LOCUS_14910 8673 10145 gene locus_tag LOCUS_14920 gene atpD 8673 10145 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_14920 10145 10606 gene locus_tag LOCUS_14930 10145 10606 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545870.1 protein_id gnl|my_center|LOCUS_14930 10631 11656 gene locus_tag LOCUS_14940 10631 11656 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_14940 11653 12093 gene locus_tag LOCUS_14950 11653 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 12148 12223 gene locus_tag LOCUS_t00360 12148 12223 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12343 13149 gene locus_tag LOCUS_14960 12343 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 13166 14317 gene locus_tag LOCUS_14970 13166 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 14424 14615 gene locus_tag LOCUS_14980 14424 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence050 2224 143 gene locus_tag LOCUS_14990 gene fusA 2224 143 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_14990 2890 2420 gene locus_tag LOCUS_15000 gene rpsG 2890 2420 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_15000 3295 2924 gene locus_tag LOCUS_15010 gene rpsL 3295 2924 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_15010 7737 3397 gene locus_tag LOCUS_15020 gene rpoC 7737 3397 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546248.1 protein_id gnl|my_center|LOCUS_15020 11855 7803 gene locus_tag LOCUS_15030 gene rpoB 11855 7803 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390505.1 protein_id gnl|my_center|LOCUS_15030 12865 11939 gene locus_tag LOCUS_15040 12865 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 13582 12890 gene locus_tag LOCUS_15050 gene rplA 13582 12890 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545797.1 protein_id gnl|my_center|LOCUS_15050 14043 13618 gene locus_tag LOCUS_15060 gene rplK 14043 13618 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 protein_id gnl|my_center|LOCUS_15060 14670 14134 gene locus_tag LOCUS_15070 gene nusG 14670 14134 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921038.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence051 191 478 gene locus_tag LOCUS_15080 191 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 569 1369 gene locus_tag LOCUS_15090 569 1369 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141655.1 protein_id gnl|my_center|LOCUS_15090 1369 2457 gene locus_tag LOCUS_15100 gene trpD 1369 2457 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 protein_id gnl|my_center|LOCUS_15100 2454 3251 gene locus_tag LOCUS_15110 2454 3251 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_15110 3238 5127 gene locus_tag LOCUS_15120 3238 5127 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945027.1 protein_id gnl|my_center|LOCUS_15120 5526 5206 gene locus_tag LOCUS_15130 gene sugE 5526 5206 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_15130 5713 6063 gene locus_tag LOCUS_tm00010 5713 6063 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6256 6594 gene locus_tag LOCUS_15140 6256 6594 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616592.1 protein_id gnl|my_center|LOCUS_15140 6587 8527 gene locus_tag LOCUS_15150 6587 8527 CDS product RiPP maturation radical SAM C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084777.1 protein_id gnl|my_center|LOCUS_15150 8846 8583 gene locus_tag LOCUS_15160 8846 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 9207 9923 gene locus_tag LOCUS_15170 9207 9923 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_15170 10237 11244 gene locus_tag LOCUS_15180 10237 11244 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337326.1 protein_id gnl|my_center|LOCUS_15180 11241 14519 gene locus_tag LOCUS_15190 11241 14519 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_15190 12197 12206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence052 857 465 gene locus_tag LOCUS_15200 gene rpsI 857 465 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_15200 1345 911 gene locus_tag LOCUS_15210 gene rplM 1345 911 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_15210 1879 1364 gene locus_tag LOCUS_15220 1879 1364 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_15220 2401 1946 gene locus_tag LOCUS_15230 2401 1946 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_15230 4599 2878 gene locus_tag LOCUS_15240 4599 2878 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_15240 6100 4718 gene locus_tag LOCUS_15250 gene rseP 6100 4718 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 protein_id gnl|my_center|LOCUS_15250 7295 6135 gene locus_tag LOCUS_15260 7295 6135 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_15260 8213 7326 gene locus_tag LOCUS_15270 8213 7326 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_15270 8905 8210 gene locus_tag LOCUS_15280 8905 8210 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_15280 9698 11140 gene locus_tag LOCUS_15290 gene tldD 9698 11140 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039540.1 protein_id gnl|my_center|LOCUS_15290 11200 12558 gene locus_tag LOCUS_15300 gene pmbA 11200 12558 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_15300 12573 13073 gene locus_tag LOCUS_15310 12573 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 13856 13131 gene locus_tag LOCUS_15320 13856 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 13975 13984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence053 2795 498 gene locus_tag LOCUS_15330 2795 498 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640696.1 protein_id gnl|my_center|LOCUS_15330 4508 2808 gene locus_tag LOCUS_15340 gene recJ 4508 2808 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_15340 4903 4700 gene locus_tag LOCUS_15350 4903 4700 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061283.1 protein_id gnl|my_center|LOCUS_15350 7174 5123 gene locus_tag LOCUS_15360 7174 5123 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_15360 8147 9076 gene locus_tag LOCUS_15370 gene hflK 8147 9076 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_15370 9076 9933 gene locus_tag LOCUS_15380 9076 9933 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937986.1 protein_id gnl|my_center|LOCUS_15380 10105 10788 gene locus_tag LOCUS_15390 10105 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 11801 10785 gene locus_tag LOCUS_15400 gene cobW 11801 10785 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975898.1 protein_id gnl|my_center|LOCUS_15400 12648 12211 gene locus_tag LOCUS_15410 12648 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 13262 12645 gene locus_tag LOCUS_15420 13262 12645 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_15420 13960 13262 gene locus_tag LOCUS_15430 13960 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence054 194 2191 gene locus_tag LOCUS_15440 194 2191 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_15440 3102 2188 gene locus_tag LOCUS_15450 3102 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4021 3182 gene locus_tag LOCUS_15460 4021 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4518 6128 gene locus_tag LOCUS_15470 4518 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 6547 8232 gene locus_tag LOCUS_15480 6547 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 8435 10276 gene locus_tag LOCUS_15490 8435 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 10967 11902 gene locus_tag LOCUS_15500 10967 11902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 11841 12395 gene locus_tag LOCUS_15510 11841 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence055 1302 607 gene locus_tag LOCUS_15520 gene purQ 1302 607 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393545.1 protein_id gnl|my_center|LOCUS_15520 1574 1299 gene locus_tag LOCUS_15530 gene purS 1574 1299 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532128.1 protein_id gnl|my_center|LOCUS_15530 2935 1583 gene locus_tag LOCUS_15540 gene purB 2935 1583 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_15540 3475 2993 gene locus_tag LOCUS_15550 gene nusB 3475 2993 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_15550 3993 3472 gene locus_tag LOCUS_15560 gene ribE 3993 3472 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_15560 5223 4021 gene locus_tag LOCUS_15570 5223 4021 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_15570 6517 5378 gene locus_tag LOCUS_15580 6517 5378 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 protein_id gnl|my_center|LOCUS_15580 7022 8077 gene locus_tag LOCUS_15590 7022 8077 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_15590 8294 8614 gene locus_tag LOCUS_15600 8294 8614 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546861.1 protein_id gnl|my_center|LOCUS_15600 8686 10335 gene locus_tag LOCUS_15610 gene groL 8686 10335 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_15610 10476 10907 gene locus_tag LOCUS_15620 10476 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 10948 11964 gene locus_tag LOCUS_15630 gene queG 10948 11964 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_15630 12184 13419 gene locus_tag LOCUS_15640 12184 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence056 20 1474 gene locus_tag LOCUS_15650 20 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1479 2060 gene locus_tag LOCUS_15660 1479 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2190 4856 gene locus_tag LOCUS_15670 2190 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4860 5627 gene locus_tag LOCUS_15680 4860 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 5634 6134 gene locus_tag LOCUS_15690 5634 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15690 6216 8651 gene locus_tag LOCUS_15700 6216 8651 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074841.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15700 8677 10044 gene locus_tag LOCUS_15710 gene pafA 8677 10044 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_15710 10107 10988 gene locus_tag LOCUS_15720 10107 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 11815 10985 gene locus_tag LOCUS_15730 11815 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 11973 12662 gene locus_tag LOCUS_15740 11973 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 12893 13309 gene locus_tag LOCUS_15750 12893 13309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 13702 13439 gene locus_tag LOCUS_15760 13702 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence057 648 1034 gene locus_tag LOCUS_15770 648 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1895 1059 gene locus_tag LOCUS_15780 1895 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2121 2672 gene locus_tag LOCUS_15790 2121 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2820 3167 gene locus_tag LOCUS_15800 gene trxA 2820 3167 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_15800 3194 4930 gene locus_tag LOCUS_15810 gene recN 3194 4930 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_15810 5136 4939 gene locus_tag LOCUS_15820 5136 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 6510 6917 gene locus_tag LOCUS_15830 6510 6917 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_15830 6982 7470 gene locus_tag LOCUS_15840 6982 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 7668 8156 gene locus_tag LOCUS_15850 7668 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 8426 8604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9355 9200 gene locus_tag LOCUS_15860 9355 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 9651 9352 gene locus_tag LOCUS_15870 9651 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 10769 9693 gene locus_tag LOCUS_15880 10769 9693 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957933.1 protein_id gnl|my_center|LOCUS_15880 11278 12168 gene locus_tag LOCUS_15890 11278 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 12162 12854 gene locus_tag LOCUS_15900 12162 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence058 1547 1032 gene locus_tag LOCUS_15910 1547 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1995 3035 gene locus_tag LOCUS_15920 gene rlmN 1995 3035 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_15920 3092 3904 gene locus_tag LOCUS_15930 gene larE 3092 3904 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_15930 4540 3959 gene locus_tag LOCUS_15940 4540 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 5067 4537 gene locus_tag LOCUS_15950 gene atpF 5067 4537 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 protein_id gnl|my_center|LOCUS_15950 5307 5077 gene locus_tag LOCUS_15960 5307 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6126 5401 gene locus_tag LOCUS_15970 6126 5401 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533645.1 protein_id gnl|my_center|LOCUS_15970 6391 6176 gene locus_tag LOCUS_15980 6391 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 6694 6984 gene locus_tag LOCUS_15990 6694 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 6985 7191 gene locus_tag LOCUS_16000 6985 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 7318 8745 gene locus_tag LOCUS_16010 gene pabB 7318 8745 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189680.1 protein_id gnl|my_center|LOCUS_16010 8765 9628 gene locus_tag LOCUS_16020 gene ilvE 8765 9628 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_16020 10349 9867 gene locus_tag LOCUS_16030 10349 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 12324 10663 gene locus_tag LOCUS_16040 gene nadB 12324 10663 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence059 1324 314 gene locus_tag LOCUS_16050 1324 314 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_16050 2315 1329 gene locus_tag LOCUS_16060 2315 1329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_16060 3326 2319 gene locus_tag LOCUS_16070 3326 2319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_16070 4304 3327 gene locus_tag LOCUS_16080 4304 3327 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_16080 6590 4458 gene locus_tag LOCUS_16090 6590 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 7638 6697 gene locus_tag LOCUS_16100 gene lipA 7638 6697 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_16100 8087 8785 gene locus_tag LOCUS_16110 8087 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 8844 9557 gene locus_tag LOCUS_16120 8844 9557 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_16120 9554 11947 gene locus_tag LOCUS_16130 9554 11947 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence060 205 32 gene locus_tag LOCUS_16140 205 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 387 1082 gene locus_tag LOCUS_16150 gene radC 387 1082 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_16150 1156 4002 gene locus_tag LOCUS_16160 1156 4002 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016452.1 protein_id gnl|my_center|LOCUS_16160 4020 5981 gene locus_tag LOCUS_16170 4020 5981 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_16170 5984 8728 gene locus_tag LOCUS_16180 5984 8728 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_16180 <11993 8766 gene locus_tag LOCUS_16190 <11993 8766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074836736.1:HigA family addiction module antitoxin >Feature sequence061 346 1650 gene locus_tag LOCUS_16200 346 1650 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_16200 1810 3417 gene locus_tag LOCUS_16210 1810 3417 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_16210 3495 3564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3944 4351 gene locus_tag LOCUS_16220 3944 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5454 4438 gene locus_tag LOCUS_16230 5454 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 6333 5776 gene locus_tag LOCUS_16240 6333 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 7164 6334 gene locus_tag LOCUS_16250 7164 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 8178 7504 gene locus_tag LOCUS_16260 gene recR 8178 7504 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_16260 8521 8195 gene locus_tag LOCUS_16270 8521 8195 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_16270 10584 8524 gene locus_tag LOCUS_16280 gene dnaX 10584 8524 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence062 1112 456 gene locus_tag LOCUS_16290 1112 456 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_16290 1360 1166 gene locus_tag LOCUS_16300 gene rpsU 1360 1166 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066968.1 protein_id gnl|my_center|LOCUS_16300 1517 1690 gene locus_tag LOCUS_16310 1517 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3540 2125 gene locus_tag LOCUS_16320 3540 2125 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_16320 3824 3537 gene locus_tag LOCUS_16330 3824 3537 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_16330 5005 3827 gene locus_tag LOCUS_16340 5005 3827 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_16340 5214 6932 gene locus_tag LOCUS_16350 5214 6932 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_16350 8305 7013 gene locus_tag LOCUS_16360 8305 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 8787 8506 gene locus_tag LOCUS_16370 8787 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 9337 10062 gene locus_tag LOCUS_16380 9337 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence063 338 826 gene locus_tag LOCUS_16390 338 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1225 1299 gene locus_tag LOCUS_t00370 1225 1299 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1490 3346 gene locus_tag LOCUS_16400 gene thrS 1490 3346 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_16400 3343 3864 gene locus_tag LOCUS_16410 gene infC 3343 3864 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081439339.1 protein_id gnl|my_center|LOCUS_16410 4185 4538 gene locus_tag LOCUS_16420 gene rplT 4185 4538 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_16420 4552 5091 gene locus_tag LOCUS_16430 4552 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6103 5105 gene locus_tag LOCUS_16440 6103 5105 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_16440 7544 6075 gene locus_tag LOCUS_16450 7544 6075 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_16450 9412 7700 gene locus_tag LOCUS_16460 gene pheT 9412 7700 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957104.1 protein_id gnl|my_center|LOCUS_16460 <11052 9499 gene locus_tag LOCUS_16470 <11052 9499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680967.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence064 1037 264 gene locus_tag LOCUS_16480 gene panC 1037 264 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_16480 1688 1125 gene locus_tag LOCUS_16490 gene folK 1688 1125 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943608.1 protein_id gnl|my_center|LOCUS_16490 2876 1701 gene locus_tag LOCUS_16500 2876 1701 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_16500 3769 3059 gene locus_tag LOCUS_16510 3769 3059 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_16510 4534 4256 gene locus_tag LOCUS_16520 4534 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5720 4545 gene locus_tag LOCUS_16530 5720 4545 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938996.1 protein_id gnl|my_center|LOCUS_16530 6446 5769 gene locus_tag LOCUS_16540 6446 5769 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_16540 7211 6513 gene locus_tag LOCUS_16550 7211 6513 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444207.1 protein_id gnl|my_center|LOCUS_16550 7956 8570 gene locus_tag LOCUS_16560 7956 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 10340 8580 gene locus_tag LOCUS_16570 10340 8580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence065 433 1188 gene locus_tag LOCUS_16580 gene ubiE 433 1188 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948588.1 protein_id gnl|my_center|LOCUS_16580 1192 2820 gene locus_tag LOCUS_16590 1192 2820 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_16590 3546 2875 gene locus_tag LOCUS_16600 3546 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 4548 3580 gene locus_tag LOCUS_16610 4548 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5258 4614 gene locus_tag LOCUS_16620 5258 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 5970 5260 gene locus_tag LOCUS_16630 5970 5260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 6903 6088 gene locus_tag LOCUS_16640 6903 6088 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_16640 7208 6900 gene locus_tag LOCUS_16650 7208 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 7371 8822 gene locus_tag LOCUS_16660 7371 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 8886 9704 gene locus_tag LOCUS_16670 8886 9704 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence066 3843 3559 gene locus_tag LOCUS_16680 3843 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5800 4118 gene locus_tag LOCUS_16690 5800 4118 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932359.1 protein_id gnl|my_center|LOCUS_16690 9161 5769 gene locus_tag LOCUS_16700 9161 5769 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence067 44 873 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtctagcacatgggaataggcggtgctaggacaac 2279 873 gene locus_tag LOCUS_16710 gene sthA 2279 873 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_16710 2297 2539 gene locus_tag LOCUS_16720 2297 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2620 3021 gene locus_tag LOCUS_16730 2620 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3140 3817 gene locus_tag LOCUS_16740 3140 3817 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_16740 3837 5213 gene locus_tag LOCUS_16750 3837 5213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_16750 5398 6921 gene locus_tag LOCUS_16760 5398 6921 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_16760 7048 8343 gene locus_tag LOCUS_16770 gene rpoD 7048 8343 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565648.1 protein_id gnl|my_center|LOCUS_16770 <10306 8301 gene locus_tag LOCUS_16780 <10306 8301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963026.1:oligopeptidase B >Feature sequence068 1482 187 gene locus_tag LOCUS_16790 gene aroA 1482 187 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_16790 2372 1479 gene locus_tag LOCUS_16800 2372 1479 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_16800 2581 2369 gene locus_tag LOCUS_16810 2581 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3910 2897 gene locus_tag LOCUS_16820 gene aroF 3910 2897 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_16820 5036 3921 gene locus_tag LOCUS_16830 gene hisC 5036 3921 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_16830 6178 5096 gene locus_tag LOCUS_16840 gene pheA 6178 5096 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_16840 6451 6269 gene locus_tag LOCUS_16850 6451 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6708 8291 gene locus_tag LOCUS_16860 6708 8291 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_16860 8363 8707 gene locus_tag LOCUS_16870 8363 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 8704 9138 gene locus_tag LOCUS_16880 8704 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 9126 9863 gene locus_tag LOCUS_16890 9126 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence069 1367 750 gene locus_tag LOCUS_16900 1367 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2998 1421 gene locus_tag LOCUS_16910 2998 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3739 3017 gene locus_tag LOCUS_16920 3739 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 6018 3769 gene locus_tag LOCUS_16930 6018 3769 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_16930 7935 6109 gene locus_tag LOCUS_16940 7935 6109 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_16940 9186 7981 gene locus_tag LOCUS_16950 9186 7981 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence070 533 922 gene locus_tag LOCUS_16960 533 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1115 2059 gene locus_tag LOCUS_16970 1115 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2111 2533 gene locus_tag LOCUS_16980 2111 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2776 3501 gene locus_tag LOCUS_16990 2776 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3498 4568 gene locus_tag LOCUS_17000 3498 4568 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_17000 4596 5861 gene locus_tag LOCUS_17010 4596 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6061 6990 gene locus_tag LOCUS_17020 6061 6990 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_17020 7069 7767 gene locus_tag LOCUS_17030 7069 7767 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_17030 7780 8313 gene locus_tag LOCUS_17040 7780 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 9032 9520 gene locus_tag LOCUS_17050 9032 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence071 9 1310 gene locus_tag LOCUS_17060 gene mtaB 9 1310 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_17060 1301 2671 gene locus_tag LOCUS_17070 gene miaB 1301 2671 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_17070 2770 2845 gene locus_tag LOCUS_t00380 2770 2845 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4015 2930 gene locus_tag LOCUS_17080 4015 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 4877 4194 gene locus_tag LOCUS_17090 4877 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 5343 4891 gene locus_tag LOCUS_17100 gene mraZ 5343 4891 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_17100 5577 6833 gene locus_tag LOCUS_17110 5577 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 6838 6972 gene locus_tag LOCUS_17120 6838 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 6871 6880 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7174 8064 gene locus_tag LOCUS_17130 7174 8064 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527266.1 protein_id gnl|my_center|LOCUS_17130 8055 9074 gene locus_tag LOCUS_17140 8055 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence072 360 154 gene locus_tag LOCUS_17150 360 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1680 646 gene locus_tag LOCUS_17160 1680 646 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_17160 2625 1732 gene locus_tag LOCUS_17170 2625 1732 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_17170 2846 2673 gene locus_tag LOCUS_17180 2846 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3914 2847 gene locus_tag LOCUS_17190 3914 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5246 4014 gene locus_tag LOCUS_17200 5246 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 6789 5824 gene locus_tag LOCUS_17210 6789 5824 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371239.1 protein_id gnl|my_center|LOCUS_17210 8472 6922 gene locus_tag LOCUS_17220 8472 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 8827 9405 gene locus_tag LOCUS_17230 8827 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence073 2619 1090 gene locus_tag LOCUS_17240 2619 1090 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_17240 3332 2838 gene locus_tag LOCUS_17250 3332 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 3764 3363 gene locus_tag LOCUS_17260 3764 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4077 4892 gene locus_tag LOCUS_17270 4077 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5565 5068 gene locus_tag LOCUS_17280 5565 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 6127 8118 gene locus_tag LOCUS_17290 gene ligA 6127 8118 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_17290 8518 8147 gene locus_tag LOCUS_17300 8518 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 8444 8701 gene locus_tag LOCUS_17310 8444 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 <9261 8644 gene locus_tag LOCUS_17320 <9261 8644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228155.1:hemolysin family protein note possible pseudo, frameshifted 8675 8684 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence074 78 707 gene locus_tag LOCUS_17330 78 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 711 1514 gene locus_tag LOCUS_17340 711 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1583 1813 gene locus_tag LOCUS_17350 1583 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2063 2977 gene locus_tag LOCUS_17360 2063 2977 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 protein_id gnl|my_center|LOCUS_17360 3034 3834 gene locus_tag LOCUS_17370 3034 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4658 4032 gene locus_tag LOCUS_17380 4658 4032 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_17380 5790 4675 gene locus_tag LOCUS_17390 5790 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 6617 7465 gene locus_tag LOCUS_17400 6617 7465 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_17400 7513 8217 gene locus_tag LOCUS_17410 7513 8217 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence075 1432 692 gene locus_tag LOCUS_17420 1432 692 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_17420 1943 2899 gene locus_tag LOCUS_17430 1943 2899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_17430 2949 3692 gene locus_tag LOCUS_17440 2949 3692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_17440 3706 5640 gene locus_tag LOCUS_17450 3706 5640 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_17450 6274 7527 gene locus_tag LOCUS_17460 6274 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 7782 8309 gene locus_tag LOCUS_17470 7782 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence076 952 146 gene locus_tag LOCUS_17480 gene dapB 952 146 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_17480 1979 1095 gene locus_tag LOCUS_17490 gene dapA 1979 1095 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_17490 3423 2107 gene locus_tag LOCUS_17500 gene lysA 3423 2107 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_17500 5293 3416 gene locus_tag LOCUS_17510 5293 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6491 5589 gene locus_tag LOCUS_17520 6491 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6782 6492 gene locus_tag LOCUS_17530 6782 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 8287 6779 gene locus_tag LOCUS_17540 gene argH 8287 6779 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence077 579 1646 gene locus_tag LOCUS_17550 579 1646 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_17550 1714 2778 gene locus_tag LOCUS_17560 1714 2778 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_17560 2845 3966 gene locus_tag LOCUS_17570 2845 3966 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_17570 4765 4175 gene locus_tag LOCUS_17580 4765 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 6284 7735 gene locus_tag LOCUS_17590 6284 7735 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211405.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence078 37 813 gene locus_tag LOCUS_17600 37 813 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_17600 887 1393 gene locus_tag LOCUS_17610 887 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1403 1807 gene locus_tag LOCUS_17620 1403 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1828 2421 gene locus_tag LOCUS_17630 1828 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5409 2590 gene locus_tag LOCUS_17640 5409 2590 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_17640 5968 5480 gene locus_tag LOCUS_17650 5968 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7335 5968 gene locus_tag LOCUS_17660 7335 5968 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence079 295 304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1208 963 gene locus_tag LOCUS_17670 1208 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1797 1285 gene locus_tag LOCUS_17680 1797 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2876 1947 gene locus_tag LOCUS_17690 2876 1947 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_17690 3555 4943 gene locus_tag LOCUS_17700 3555 4943 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565719.1 protein_id gnl|my_center|LOCUS_17700 6228 5104 gene locus_tag LOCUS_17710 gene purM 6228 5104 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_17710 6409 6336 gene locus_tag LOCUS_t00390 6409 6336 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7139 6483 gene locus_tag LOCUS_17720 7139 6483 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530054.1 protein_id gnl|my_center|LOCUS_17720 7471 7244 gene locus_tag LOCUS_17730 7471 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 7392 7401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence080 149 1456 gene locus_tag LOCUS_17740 149 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1563 3101 gene locus_tag LOCUS_17750 1563 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3105 5756 gene locus_tag LOCUS_17760 3105 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5753 7609 gene locus_tag LOCUS_17770 5753 7609 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence081 <1 1087 gene locus_tag LOCUS_17780 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941018.1:NADH-quinone oxidoreductase subunit M 1087 2670 gene locus_tag LOCUS_17790 1087 2670 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_17790 2690 4162 gene locus_tag LOCUS_17800 2690 4162 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_17800 4226 4705 gene locus_tag LOCUS_17810 4226 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 4752 5231 gene locus_tag LOCUS_17820 4752 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5828 5346 gene locus_tag LOCUS_17830 5828 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 7393 6578 gene locus_tag LOCUS_17840 7393 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence082 658 667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 792 2021 gene locus_tag LOCUS_17850 gene sucC 792 2021 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_17850 2064 2963 gene locus_tag LOCUS_17860 gene sucD 2064 2963 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_17860 3006 3158 gene locus_tag LOCUS_17870 3006 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3119 3271 gene locus_tag LOCUS_17880 3119 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 3319 3444 gene locus_tag LOCUS_17890 3319 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3445 3780 gene locus_tag LOCUS_17900 3445 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3777 4319 gene locus_tag LOCUS_17910 3777 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4963 5388 gene locus_tag LOCUS_17920 4963 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 5431 5583 gene locus_tag LOCUS_17930 5431 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5544 5696 gene locus_tag LOCUS_17940 5544 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5744 5869 gene locus_tag LOCUS_17950 5744 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5870 6205 gene locus_tag LOCUS_17960 5870 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6202 6744 gene locus_tag LOCUS_17970 6202 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence083 3039 145 gene locus_tag LOCUS_17980 gene gcvP 3039 145 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_17980 3073 3276 gene locus_tag LOCUS_17990 3073 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3419 4759 gene locus_tag LOCUS_18000 3419 4759 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_18000 5404 4826 gene locus_tag LOCUS_18010 5404 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5879 5610 gene locus_tag LOCUS_18020 5879 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 5944 6231 gene locus_tag LOCUS_18030 5944 6231 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_18030 6634 6359 gene locus_tag LOCUS_18040 6634 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence084 261 1130 gene locus_tag LOCUS_18050 261 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1120 2031 gene locus_tag LOCUS_18060 1120 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2109 2438 gene locus_tag LOCUS_18070 2109 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4974 2461 gene locus_tag LOCUS_18080 gene uvrA 4974 2461 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546498.1 protein_id gnl|my_center|LOCUS_18080 5173 4952 gene locus_tag LOCUS_18090 5173 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 5351 5202 gene locus_tag LOCUS_18100 5351 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5538 6002 gene locus_tag LOCUS_18110 5538 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5944 6177 gene locus_tag LOCUS_18120 5944 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence085 838 1779 gene locus_tag LOCUS_18130 838 1779 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 protein_id gnl|my_center|LOCUS_18130 1685 2704 gene locus_tag LOCUS_18140 1685 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2701 4104 gene locus_tag LOCUS_18150 2701 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4143 5654 gene locus_tag LOCUS_18160 4143 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence086 728 931 gene locus_tag LOCUS_18170 728 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1294 1503 gene locus_tag LOCUS_18180 1294 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1954 2274 gene locus_tag LOCUS_18190 1954 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3080 2304 gene locus_tag LOCUS_18200 3080 2304 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_18200 3449 3141 gene locus_tag LOCUS_18210 3449 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4941 3544 gene locus_tag LOCUS_18220 gene xseA 4941 3544 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_18220 5713 4934 gene locus_tag LOCUS_18230 5713 4934 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545500.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence087 3402 970 gene locus_tag LOCUS_18240 3402 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3853 3575 gene locus_tag LOCUS_18250 3853 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 4224 4583 gene locus_tag LOCUS_18260 4224 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5412 4573 gene locus_tag LOCUS_18270 5412 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence088 1063 95 gene locus_tag LOCUS_18280 1063 95 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_18280 1578 1108 gene locus_tag LOCUS_18290 1578 1108 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893248.1 protein_id gnl|my_center|LOCUS_18290 2537 1602 gene locus_tag LOCUS_18300 gene tatC 2537 1602 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_18300 4097 2622 gene locus_tag LOCUS_18310 4097 2622 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_18310 4240 5217 gene locus_tag LOCUS_18320 4240 5217 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence089 479 1255 gene locus_tag LOCUS_18330 479 1255 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928939.1 protein_id gnl|my_center|LOCUS_18330 1405 2976 gene locus_tag LOCUS_18340 1405 2976 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840109.1 protein_id gnl|my_center|LOCUS_18340 2973 4433 gene locus_tag LOCUS_18350 2973 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 4478 5308 gene locus_tag LOCUS_18360 4478 5308 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390203.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence090 4567 734 gene locus_tag LOCUS_18370 4567 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 5068 4661 gene locus_tag LOCUS_18380 gene rfaE2 5068 4661 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence091 142 525 gene locus_tag LOCUS_18390 142 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18390 680 1306 gene locus_tag LOCUS_18400 680 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18400 1291 1300 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1393 2340 gene locus_tag LOCUS_18410 1393 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18410 2386 2565 gene locus_tag LOCUS_18420 2386 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2591 3016 gene locus_tag LOCUS_18430 2591 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 4168 3119 gene locus_tag LOCUS_18440 4168 3119 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_18440 4795 4181 gene locus_tag LOCUS_18450 4795 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence092 877 155 gene locus_tag LOCUS_18460 gene rpe 877 155 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_18460 1555 998 gene locus_tag LOCUS_18470 1555 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2396 1548 gene locus_tag LOCUS_18480 2396 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3511 2492 gene locus_tag LOCUS_18490 gene pdxA 3511 2492 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_18490 4729 3569 gene locus_tag LOCUS_18500 gene larC 4729 3569 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence093 2287 1160 gene locus_tag LOCUS_18510 2287 1160 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_18510 3628 2378 gene locus_tag LOCUS_18520 3628 2378 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_18520 4195 3914 gene locus_tag LOCUS_18530 4195 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4084 4093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4677 4192 gene locus_tag LOCUS_18540 4677 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence094 4027 2081 gene locus_tag LOCUS_18550 4027 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4997 4209 gene locus_tag LOCUS_18560 4997 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence095 444 1649 gene locus_tag LOCUS_18570 444 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1881 2888 gene locus_tag LOCUS_18580 1881 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2866 3330 gene locus_tag LOCUS_18590 2866 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 3351 4736 gene locus_tag LOCUS_18600 3351 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence096 211 567 gene locus_tag LOCUS_18610 211 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1164 1922 gene locus_tag LOCUS_18620 gene pgl 1164 1922 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_18620 2161 3381 gene locus_tag LOCUS_18630 2161 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3394 4374 gene locus_tag LOCUS_18640 gene arsS 3394 4374 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_18640 4662 4405 gene locus_tag LOCUS_18650 4662 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence097 396 1157 gene locus_tag LOCUS_18660 396 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2751 2113 gene locus_tag LOCUS_18670 2751 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 4022 2748 gene locus_tag LOCUS_18680 4022 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4139 4663 gene locus_tag LOCUS_18690 4139 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence098 164 1081 gene locus_tag LOCUS_18700 164 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2512 1499 gene locus_tag LOCUS_18710 2512 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2979 3608 gene locus_tag LOCUS_18720 2979 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3765 4643 gene locus_tag LOCUS_18730 gene hpnD 3765 4643 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930256.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence099 548 1051 gene locus_tag LOCUS_18740 548 1051 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_18740 1773 1354 gene locus_tag LOCUS_18750 1773 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2559 1810 gene locus_tag LOCUS_18760 2559 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 4299 2668 gene locus_tag LOCUS_18770 4299 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence100 544 1686 gene locus_tag LOCUS_18780 544 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1751 2872 gene locus_tag LOCUS_18790 1751 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2865 3620 gene locus_tag LOCUS_18800 2865 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3826 4527 gene locus_tag LOCUS_18810 3826 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence101 2035 371 gene locus_tag LOCUS_18820 2035 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4068 2170 gene locus_tag LOCUS_18830 gene mnmG 4068 2170 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_18830 4492 4181 gene locus_tag LOCUS_18840 4492 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence102 <1 359 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttcctgcttccgcaggaatgacg 529 1539 gene locus_tag LOCUS_18850 529 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3385 1586 gene locus_tag LOCUS_18860 gene aspS 3385 1586 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_18860 4317 3382 gene locus_tag LOCUS_18870 4317 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence103 349 657 gene locus_tag LOCUS_18880 349 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 835 4155 gene locus_tag LOCUS_18890 835 4155 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_18890 4186 4590 gene locus_tag LOCUS_18900 4186 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence104 1230 604 gene locus_tag LOCUS_18910 gene msrA 1230 604 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_18910 1519 2622 gene locus_tag LOCUS_18920 1519 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2753 3379 gene locus_tag LOCUS_18930 2753 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3533 4159 gene locus_tag LOCUS_18940 3533 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence105 1174 494 gene locus_tag LOCUS_18950 1174 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2913 1441 gene locus_tag LOCUS_18960 2913 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2889 2898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence106 492 989 gene locus_tag LOCUS_18970 492 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1243 1638 gene locus_tag LOCUS_18980 1243 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 1675 2472 gene locus_tag LOCUS_18990 1675 2472 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_18990 3076 3142 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3492 3698 gene locus_tag LOCUS_19000 3492 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 4358 4095 gene locus_tag LOCUS_19010 4358 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence107 376 561 gene locus_tag LOCUS_19020 376 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2092 1325 gene locus_tag LOCUS_19030 2092 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2192 2497 gene locus_tag LOCUS_19040 2192 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3479 2634 gene locus_tag LOCUS_19050 3479 2634 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088051.1 protein_id gnl|my_center|LOCUS_19050 3732 3741 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence108 1344 34 gene locus_tag LOCUS_19060 1344 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1607 3841 gene locus_tag LOCUS_19070 1607 3841 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence109 1994 165 gene locus_tag LOCUS_19080 1994 165 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_19080 2763 4142 gene locus_tag LOCUS_19090 2763 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence110 <1 2563 gene locus_tag LOCUS_19100 <1 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein 2774 2959 gene locus_tag LOCUS_19110 2774 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2886 3056 gene locus_tag LOCUS_19120 2886 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3632 3718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3753 4049 gene locus_tag LOCUS_19130 3753 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence111 1108 1217 gene locus_tag LOCUS_r00010 1108 1217 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1358 2197 gene locus_tag LOCUS_19140 1358 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2379 3341 gene locus_tag LOCUS_19150 2379 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence112 504 746 gene locus_tag LOCUS_19160 504 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2072 771 gene locus_tag LOCUS_19170 gene hemL 2072 771 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_19170 2415 2206 gene locus_tag LOCUS_19180 2415 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3392 2577 gene locus_tag LOCUS_19190 3392 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence113 1060 1395 gene locus_tag LOCUS_19200 1060 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3473 2109 gene locus_tag LOCUS_19210 3473 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence114 319 648 gene locus_tag LOCUS_19220 319 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 863 1750 gene locus_tag LOCUS_19230 863 1750 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_19230 1678 1917 gene locus_tag LOCUS_19240 1678 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2429 1899 gene locus_tag LOCUS_19250 gene lspA 2429 1899 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_19250 <3809 2426 gene locus_tag LOCUS_19260 <3809 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546193.1:isoleucine--tRNA ligase >Feature sequence115 422 147 gene locus_tag LOCUS_19270 422 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1973 831 gene locus_tag LOCUS_19280 1973 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2231 2887 gene locus_tag LOCUS_19290 2231 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2899 3642 gene locus_tag LOCUS_19300 2899 3642 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence116 1506 1369 gene locus_tag LOCUS_19310 1506 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2841 1546 gene locus_tag LOCUS_19320 2841 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence117 532 978 gene locus_tag LOCUS_19330 532 978 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_19330 1376 990 gene locus_tag LOCUS_19340 1376 990 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888860.1 protein_id gnl|my_center|LOCUS_19340 1506 2207 gene locus_tag LOCUS_19350 1506 2207 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_19350 2857 2204 gene locus_tag LOCUS_19360 gene fsa 2857 2204 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence118 96 1610 gene locus_tag LOCUS_19370 96 1610 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_19370 1588 2802 gene locus_tag LOCUS_19380 1588 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence119 204 464 gene locus_tag LOCUS_19390 204 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 454 741 gene locus_tag LOCUS_19400 454 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1124 2161 gene locus_tag LOCUS_19410 1124 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence120 736 2274 gene locus_tag LOCUS_19420 736 2274 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence121 <1 1080 gene locus_tag LOCUS_19430 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546759.1:IMP dehydrogenase 1158 2711 gene locus_tag LOCUS_19440 gene guaA 1158 2711 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence122 104 760 gene locus_tag LOCUS_19450 104 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2345 870 gene locus_tag LOCUS_19460 2345 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence123 246 947 gene locus_tag LOCUS_19470 246 947 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_19470 1057 1659 gene locus_tag LOCUS_19480 1057 1659 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_19480 1688 2434 gene locus_tag LOCUS_19490 gene fabG 1688 2434 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence124 1358 1855 gene locus_tag LOCUS_19500 1358 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1866 2588 gene locus_tag LOCUS_19510 1866 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence125 2241 394 gene locus_tag LOCUS_19520 2241 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 >Feature sequence126 1331 249 gene locus_tag LOCUS_19530 gene ruvB 1331 249 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_19530 1885 1358 gene locus_tag LOCUS_19540 1885 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 1995 1876 gene locus_tag LOCUS_19550 1995 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence127 >Feature sequence128 148 585 gene locus_tag LOCUS_19560 148 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 694 1083 gene locus_tag LOCUS_19570 694 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1096 1479 gene locus_tag LOCUS_19580 1096 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 1472 1789 gene locus_tag LOCUS_19590 1472 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1891 2124 gene locus_tag LOCUS_19600 1891 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence129 966 649 gene locus_tag LOCUS_19610 966 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1745 963 gene locus_tag LOCUS_19620 1745 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence130 >Feature sequence131 1793 162 gene locus_tag LOCUS_19630 1793 162 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_19630