>Feature sequence001 929 141 gene locus_tag LOCUS_00010 929 141 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_00010 1869 904 gene locus_tag LOCUS_00020 1869 904 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_00020 3013 1874 gene locus_tag LOCUS_00030 3013 1874 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_00030 3730 3059 gene locus_tag LOCUS_00040 3730 3059 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_00040 4229 8323 gene locus_tag LOCUS_00050 4229 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9432 8380 gene locus_tag LOCUS_00060 9432 8380 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_00060 12932 10023 gene locus_tag LOCUS_00070 12932 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 14144 15337 gene locus_tag LOCUS_00080 14144 15337 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402980.1 protein_id gnl|my_center|LOCUS_00080 15471 17366 gene locus_tag LOCUS_00090 15471 17366 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256665.1 protein_id gnl|my_center|LOCUS_00090 18234 17377 gene locus_tag LOCUS_00100 18234 17377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 18453 19055 gene locus_tag LOCUS_00110 18453 19055 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140946.1 protein_id gnl|my_center|LOCUS_00110 19144 20370 gene locus_tag LOCUS_00120 19144 20370 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_00120 20432 22675 gene locus_tag LOCUS_00130 20432 22675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 24903 22753 gene locus_tag LOCUS_00140 24903 22753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 25897 25130 gene locus_tag LOCUS_00150 25897 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 28003 25958 gene locus_tag LOCUS_00160 28003 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 28278 29642 gene locus_tag LOCUS_00170 28278 29642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 29659 30669 gene locus_tag LOCUS_00180 29659 30669 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968456.1 protein_id gnl|my_center|LOCUS_00180 31622 30726 gene locus_tag LOCUS_00190 31622 30726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 32866 32147 gene locus_tag LOCUS_00200 32866 32147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 33599 33195 gene locus_tag LOCUS_00210 33599 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 34023 33730 gene locus_tag LOCUS_00220 34023 33730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 35194 34274 gene locus_tag LOCUS_00230 35194 34274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 36988 36203 gene locus_tag LOCUS_00240 36988 36203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 38575 37052 gene locus_tag LOCUS_00250 38575 37052 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_00250 40586 38583 gene locus_tag LOCUS_00260 40586 38583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 40915 42849 gene locus_tag LOCUS_00270 40915 42849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 43036 44829 gene locus_tag LOCUS_00280 43036 44829 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_00280 45213 46307 gene locus_tag LOCUS_00290 45213 46307 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000369.1 protein_id gnl|my_center|LOCUS_00290 47241 46330 gene locus_tag LOCUS_00300 47241 46330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 48292 47300 gene locus_tag LOCUS_00310 48292 47300 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_00310 48561 49301 gene locus_tag LOCUS_00320 gene sodA 48561 49301 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_00320 49355 50491 gene locus_tag LOCUS_00330 49355 50491 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_00330 50637 51416 gene locus_tag LOCUS_00340 50637 51416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 52791 51523 gene locus_tag LOCUS_00350 52791 51523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 53019 54617 gene locus_tag LOCUS_00360 gene cimA 53019 54617 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_00360 54705 55292 gene locus_tag LOCUS_00370 54705 55292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 56279 55308 gene locus_tag LOCUS_00380 56279 55308 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545846.1 protein_id gnl|my_center|LOCUS_00380 56878 56282 gene locus_tag LOCUS_00390 56878 56282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 57302 57733 gene locus_tag LOCUS_00400 57302 57733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 57730 58974 gene locus_tag LOCUS_00410 57730 58974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 58985 59776 gene locus_tag LOCUS_00420 58985 59776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 59836 60600 gene locus_tag LOCUS_00430 59836 60600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 60916 61068 gene locus_tag LOCUS_00440 60916 61068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 61220 61894 gene locus_tag LOCUS_00450 gene nfi 61220 61894 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_00450 61904 62686 gene locus_tag LOCUS_00460 61904 62686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 62692 64116 gene locus_tag LOCUS_00470 62692 64116 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_00470 64173 65348 gene locus_tag LOCUS_00480 gene alaC 64173 65348 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_00480 66330 65428 gene locus_tag LOCUS_00490 66330 65428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 67595 66384 gene locus_tag LOCUS_00500 67595 66384 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_00500 68281 67640 gene locus_tag LOCUS_00510 68281 67640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 68587 69459 gene locus_tag LOCUS_00520 68587 69459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 70900 69572 gene locus_tag LOCUS_00530 70900 69572 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212503.1 protein_id gnl|my_center|LOCUS_00530 72183 71191 gene locus_tag LOCUS_00540 72183 71191 CDS product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886621.1 protein_id gnl|my_center|LOCUS_00540 73619 72195 gene locus_tag LOCUS_00550 gene der 73619 72195 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_00550 75877 73619 gene locus_tag LOCUS_00560 75877 73619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 77762 76185 gene locus_tag LOCUS_00570 77762 76185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 81980 77838 gene locus_tag LOCUS_00580 81980 77838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 84531 82258 gene locus_tag LOCUS_00590 84531 82258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 86746 84737 gene locus_tag LOCUS_00600 gene aspS 86746 84737 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460332.1 protein_id gnl|my_center|LOCUS_00600 90149 87024 gene locus_tag LOCUS_00610 90149 87024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 91846 90245 gene locus_tag LOCUS_00620 91846 90245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 92836 92015 gene locus_tag LOCUS_00630 92836 92015 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544934.1 protein_id gnl|my_center|LOCUS_00630 93129 94133 gene locus_tag LOCUS_00640 gene gap 93129 94133 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 protein_id gnl|my_center|LOCUS_00640 94220 95059 gene locus_tag LOCUS_00650 gene tpiA 94220 95059 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_00650 95106 95525 gene locus_tag LOCUS_00660 95106 95525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 95565 95993 gene locus_tag LOCUS_00670 95565 95993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 96016 97296 gene locus_tag LOCUS_00680 96016 97296 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 protein_id gnl|my_center|LOCUS_00680 97595 97311 gene locus_tag LOCUS_00690 97595 97311 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 protein_id gnl|my_center|LOCUS_00690 97677 98498 gene locus_tag LOCUS_00700 97677 98498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 99290 98499 gene locus_tag LOCUS_00710 99290 98499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 99718 101949 gene locus_tag LOCUS_00720 99718 101949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 102513 102881 gene locus_tag LOCUS_00730 102513 102881 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_00730 102885 103322 gene locus_tag LOCUS_00740 102885 103322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 103498 104724 gene locus_tag LOCUS_00750 103498 104724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 104811 105773 gene locus_tag LOCUS_00760 104811 105773 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256068.1 protein_id gnl|my_center|LOCUS_00760 105764 106348 gene locus_tag LOCUS_00770 105764 106348 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258867.1 protein_id gnl|my_center|LOCUS_00770 106530 108068 gene locus_tag LOCUS_00780 106530 108068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 108280 108041 gene locus_tag LOCUS_00790 108280 108041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 108236 110362 gene locus_tag LOCUS_00800 108236 110362 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_00800 110625 110861 gene locus_tag LOCUS_00810 110625 110861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 110845 112776 gene locus_tag LOCUS_00820 110845 112776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 112777 114684 gene locus_tag LOCUS_00830 112777 114684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 115715 114732 gene locus_tag LOCUS_00840 115715 114732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 116557 115985 gene locus_tag LOCUS_00850 116557 115985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 118131 116917 gene locus_tag LOCUS_00860 118131 116917 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_00860 118386 118153 gene locus_tag LOCUS_00870 118386 118153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 118921 118367 gene locus_tag LOCUS_00880 118921 118367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 119510 118950 gene locus_tag LOCUS_00890 119510 118950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 120504 119530 gene locus_tag LOCUS_00900 120504 119530 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_00900 121557 120523 gene locus_tag LOCUS_00910 121557 120523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 123546 121657 gene locus_tag LOCUS_00920 123546 121657 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_00920 124387 123629 gene locus_tag LOCUS_00930 124387 123629 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_00930 125729 124686 gene locus_tag LOCUS_00940 125729 124686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 126523 125729 gene locus_tag LOCUS_00950 126523 125729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 128102 126921 gene locus_tag LOCUS_00960 128102 126921 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_00960 131969 128319 gene locus_tag LOCUS_00970 131969 128319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 132535 133587 gene locus_tag LOCUS_00980 gene xylA 132535 133587 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_00980 133587 134324 gene locus_tag LOCUS_00990 133587 134324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 136039 134369 gene locus_tag LOCUS_01000 136039 134369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 136583 136020 gene locus_tag LOCUS_01010 136583 136020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 137186 136590 gene locus_tag LOCUS_01020 137186 136590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 137522 138067 gene locus_tag LOCUS_01030 137522 138067 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_01030 138064 139158 gene locus_tag LOCUS_01040 gene aroB 138064 139158 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439850.1 protein_id gnl|my_center|LOCUS_01040 139252 140397 gene locus_tag LOCUS_01050 139252 140397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 140406 141056 gene locus_tag LOCUS_01060 140406 141056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 141059 141874 gene locus_tag LOCUS_01070 141059 141874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 141879 142529 gene locus_tag LOCUS_01080 141879 142529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256161.1 protein_id gnl|my_center|LOCUS_01080 142733 143575 gene locus_tag LOCUS_01090 gene frlC 142733 143575 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 protein_id gnl|my_center|LOCUS_01090 143578 144960 gene locus_tag LOCUS_01100 143578 144960 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_01100 146987 145047 gene locus_tag LOCUS_01110 146987 145047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 148092 147379 gene locus_tag LOCUS_01120 gene fabG 148092 147379 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144338.1 protein_id gnl|my_center|LOCUS_01120 149132 148218 gene locus_tag LOCUS_01130 149132 148218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256555.1 protein_id gnl|my_center|LOCUS_01130 150036 149116 gene locus_tag LOCUS_01140 150036 149116 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256554.1 protein_id gnl|my_center|LOCUS_01140 151191 150196 gene locus_tag LOCUS_01150 151191 150196 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_01150 153187 151193 gene locus_tag LOCUS_01160 153187 151193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 153900 153445 gene locus_tag LOCUS_01170 153900 153445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 154966 153935 gene locus_tag LOCUS_01180 gene floA 154966 153935 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_01180 155921 155025 gene locus_tag LOCUS_01190 gene floA 155921 155025 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_01190 156467 155985 gene locus_tag LOCUS_01200 156467 155985 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812221.1 protein_id gnl|my_center|LOCUS_01200 157992 156538 gene locus_tag LOCUS_01210 157992 156538 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922090.1 protein_id gnl|my_center|LOCUS_01210 159012 158431 gene locus_tag LOCUS_01220 159012 158431 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_01220 160028 159054 gene locus_tag LOCUS_01230 160028 159054 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_01230 161753 160248 gene locus_tag LOCUS_01240 gene xylB 161753 160248 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_01240 163542 165443 gene locus_tag LOCUS_01250 163542 165443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 165462 166241 gene locus_tag LOCUS_01260 165462 166241 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_01260 166238 167044 gene locus_tag LOCUS_01270 166238 167044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 167753 167196 gene locus_tag LOCUS_01280 167753 167196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 169012 168116 gene locus_tag LOCUS_01290 169012 168116 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01290 169517 170299 gene locus_tag LOCUS_01300 169517 170299 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_01300 171276 170449 gene locus_tag LOCUS_01310 171276 170449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 172392 171589 gene locus_tag LOCUS_01320 172392 171589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 174080 172389 gene locus_tag LOCUS_01330 174080 172389 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01330 175082 174090 gene locus_tag LOCUS_01340 175082 174090 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141892.1 protein_id gnl|my_center|LOCUS_01340 175835 176557 gene locus_tag LOCUS_01350 175835 176557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 176958 177206 gene locus_tag LOCUS_01360 176958 177206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 179027 177621 gene locus_tag LOCUS_01370 179027 177621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 179340 182150 gene locus_tag LOCUS_01380 179340 182150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 183387 182176 gene locus_tag LOCUS_01390 183387 182176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 184307 183396 gene locus_tag LOCUS_01400 184307 183396 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526755.1 protein_id gnl|my_center|LOCUS_01400 185731 184406 gene locus_tag LOCUS_01410 185731 184406 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_01410 186596 185874 gene locus_tag LOCUS_01420 186596 185874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 186836 187093 gene locus_tag LOCUS_01430 186836 187093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 187137 187403 gene locus_tag LOCUS_01440 187137 187403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 187501 188445 gene locus_tag LOCUS_01450 187501 188445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 188506 191154 gene locus_tag LOCUS_01460 188506 191154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 191217 193139 gene locus_tag LOCUS_01470 191217 193139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 193212 194030 gene locus_tag LOCUS_01480 193212 194030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01480 >Feature sequence002 <1 675 gene locus_tag LOCUS_01490 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402980.1:RNA-guided endonuclease TnpB family protein 636 653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 842 1087 gene locus_tag LOCUS_01500 842 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 1105 4617 gene locus_tag LOCUS_01510 1105 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6008 4872 gene locus_tag LOCUS_01520 6008 4872 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_01520 6358 9879 gene locus_tag LOCUS_01530 6358 9879 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_01530 9943 10764 gene locus_tag LOCUS_01540 9943 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 10772 11449 gene locus_tag LOCUS_01550 10772 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 14426 11754 gene locus_tag LOCUS_01560 gene acnA 14426 11754 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_01560 15019 14690 gene locus_tag LOCUS_01570 15019 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 16257 15067 gene locus_tag LOCUS_01580 16257 15067 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_01580 17423 16371 gene locus_tag LOCUS_01590 17423 16371 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962511.1 protein_id gnl|my_center|LOCUS_01590 18489 17416 gene locus_tag LOCUS_01600 18489 17416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 18863 20155 gene locus_tag LOCUS_01610 18863 20155 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_01610 20929 20297 gene locus_tag LOCUS_01620 20929 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 21900 20998 gene locus_tag LOCUS_01630 21900 20998 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_01630 22608 21937 gene locus_tag LOCUS_01640 22608 21937 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202235.1 protein_id gnl|my_center|LOCUS_01640 24260 22620 gene locus_tag LOCUS_01650 24260 22620 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_01650 25420 24368 gene locus_tag LOCUS_01660 25420 24368 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_01660 26258 25470 gene locus_tag LOCUS_01670 26258 25470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 26714 27700 gene locus_tag LOCUS_01680 26714 27700 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616239.1 protein_id gnl|my_center|LOCUS_01680 28529 27762 gene locus_tag LOCUS_01690 28529 27762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 30526 28661 gene locus_tag LOCUS_01700 30526 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 31397 30843 gene locus_tag LOCUS_01710 31397 30843 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_01710 31440 32810 gene locus_tag LOCUS_01720 31440 32810 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876247.1 protein_id gnl|my_center|LOCUS_01720 33611 32856 gene locus_tag LOCUS_01730 gene hpaI 33611 32856 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446592.1 protein_id gnl|my_center|LOCUS_01730 34101 34463 gene locus_tag LOCUS_01740 34101 34463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 34972 34622 gene locus_tag LOCUS_01750 34972 34622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 35311 38022 gene locus_tag LOCUS_01760 35311 38022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 38067 39008 gene locus_tag LOCUS_01770 38067 39008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929005.1 protein_id gnl|my_center|LOCUS_01770 39240 40136 gene locus_tag LOCUS_01780 39240 40136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 40228 41400 gene locus_tag LOCUS_01790 40228 41400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_01790 41434 42108 gene locus_tag LOCUS_01800 41434 42108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_01800 42105 43565 gene locus_tag LOCUS_01810 42105 43565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 44261 43569 gene locus_tag LOCUS_01820 44261 43569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 44704 44393 gene locus_tag LOCUS_01830 44704 44393 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_01830 46326 44710 gene locus_tag LOCUS_01840 46326 44710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 47299 46427 gene locus_tag LOCUS_01850 47299 46427 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_01850 47914 47309 gene locus_tag LOCUS_01860 47914 47309 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_01860 48891 47917 gene locus_tag LOCUS_01870 48891 47917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 49709 49026 gene locus_tag LOCUS_01880 49709 49026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 49933 50895 gene locus_tag LOCUS_01890 49933 50895 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_01890 51413 50892 gene locus_tag LOCUS_01900 51413 50892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 53013 51442 gene locus_tag LOCUS_01910 53013 51442 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_01910 53292 54209 gene locus_tag LOCUS_01920 53292 54209 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_01920 54295 55203 gene locus_tag LOCUS_01930 gene pstC 54295 55203 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_01930 55330 56214 gene locus_tag LOCUS_01940 gene pstA 55330 56214 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788578.1 protein_id gnl|my_center|LOCUS_01940 56391 57131 gene locus_tag LOCUS_01950 56391 57131 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109281.1 protein_id gnl|my_center|LOCUS_01950 57137 57922 gene locus_tag LOCUS_01960 gene pstB 57137 57922 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432349.1 protein_id gnl|my_center|LOCUS_01960 58201 58986 gene locus_tag LOCUS_01970 gene pstB 58201 58986 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_01970 59118 59957 gene locus_tag LOCUS_01980 59118 59957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 60095 60871 gene locus_tag LOCUS_01990 gene pstB 60095 60871 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_01990 60890 61531 gene locus_tag LOCUS_02000 gene phoU 60890 61531 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_02000 61899 61741 gene locus_tag LOCUS_02010 61899 61741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 62574 62359 gene locus_tag LOCUS_02020 62574 62359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 63089 63535 gene locus_tag LOCUS_02030 63089 63535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 64800 63616 gene locus_tag LOCUS_02040 64800 63616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 67194 64933 gene locus_tag LOCUS_02050 67194 64933 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_02050 67572 67291 gene locus_tag LOCUS_02060 67572 67291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 68209 67694 gene locus_tag LOCUS_02070 68209 67694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 69634 68444 gene locus_tag LOCUS_02080 69634 68444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 71419 70322 gene locus_tag LOCUS_02090 71419 70322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 72645 71500 gene locus_tag LOCUS_02100 72645 71500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 73310 72642 gene locus_tag LOCUS_02110 73310 72642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 74628 73456 gene locus_tag LOCUS_02120 74628 73456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 75537 74635 gene locus_tag LOCUS_02130 75537 74635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 76430 75540 gene locus_tag LOCUS_02140 76430 75540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 77283 76477 gene locus_tag LOCUS_02150 77283 76477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 78759 77353 gene locus_tag LOCUS_02160 78759 77353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 79596 78844 gene locus_tag LOCUS_02170 79596 78844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 80703 79612 gene locus_tag LOCUS_02180 gene corA 80703 79612 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_02180 81443 80751 gene locus_tag LOCUS_02190 81443 80751 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_02190 82148 84268 gene locus_tag LOCUS_02200 82148 84268 CDS product transferrin receptor-like dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928760.1 protein_id gnl|my_center|LOCUS_02200 85381 84341 gene locus_tag LOCUS_02210 85381 84341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 protein_id gnl|my_center|LOCUS_02210 87379 85640 gene locus_tag LOCUS_02220 87379 85640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 89014 87464 gene locus_tag LOCUS_02230 89014 87464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 90161 89250 gene locus_tag LOCUS_02240 90161 89250 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_02240 90647 91525 gene locus_tag LOCUS_02250 90647 91525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 92061 91807 gene locus_tag LOCUS_02260 92061 91807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 92277 92462 gene locus_tag LOCUS_02270 92277 92462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 92548 92853 gene locus_tag LOCUS_02280 92548 92853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 93592 92861 gene locus_tag LOCUS_02290 93592 92861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 94913 93744 gene locus_tag LOCUS_02300 94913 93744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 96370 95615 gene locus_tag LOCUS_02310 96370 95615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 97339 96605 gene locus_tag LOCUS_02320 97339 96605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 101037 98566 gene locus_tag LOCUS_02330 101037 98566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 102947 101034 gene locus_tag LOCUS_02340 102947 101034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 103828 102998 gene locus_tag LOCUS_02350 103828 102998 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_02350 107408 103920 gene locus_tag LOCUS_02360 107408 103920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_02360 108240 107401 gene locus_tag LOCUS_02370 108240 107401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 109353 108697 gene locus_tag LOCUS_02380 109353 108697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 109868 109329 gene locus_tag LOCUS_02390 109868 109329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 110520 110783 gene locus_tag LOCUS_02400 110520 110783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 110834 111553 gene locus_tag LOCUS_02410 110834 111553 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258680.1 protein_id gnl|my_center|LOCUS_02410 111854 112888 gene locus_tag LOCUS_02420 gene mutY 111854 112888 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_02420 113827 112877 gene locus_tag LOCUS_02430 113827 112877 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_02430 114629 114003 gene locus_tag LOCUS_02440 114629 114003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 116343 114748 gene locus_tag LOCUS_02450 116343 114748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 116586 117668 gene locus_tag LOCUS_02460 gene hisC 116586 117668 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_02460 118001 119125 gene locus_tag LOCUS_02470 gene ispG 118001 119125 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_02470 119132 120649 gene locus_tag LOCUS_02480 119132 120649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 120777 121871 gene locus_tag LOCUS_02490 120777 121871 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772519.1 protein_id gnl|my_center|LOCUS_02490 122055 122948 gene locus_tag LOCUS_02500 122055 122948 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_02500 122938 123633 gene locus_tag LOCUS_02510 122938 123633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 124439 123582 gene locus_tag LOCUS_02520 124439 123582 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_02520 124591 124989 gene locus_tag LOCUS_02530 124591 124989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 125338 126114 gene locus_tag LOCUS_02540 125338 126114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 126171 126575 gene locus_tag LOCUS_02550 126171 126575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 126614 128524 gene locus_tag LOCUS_02560 126614 128524 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615739.1 protein_id gnl|my_center|LOCUS_02560 128752 128537 gene locus_tag LOCUS_02570 128752 128537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 130378 128771 gene locus_tag LOCUS_02580 130378 128771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 130646 130416 gene locus_tag LOCUS_02590 130646 130416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02590 131024 130662 gene locus_tag LOCUS_02600 131024 130662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 132062 131046 gene locus_tag LOCUS_02610 132062 131046 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938010.1 protein_id gnl|my_center|LOCUS_02610 132801 132310 gene locus_tag LOCUS_02620 132801 132310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 133488 132832 gene locus_tag LOCUS_02630 133488 132832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 134257 133508 gene locus_tag LOCUS_02640 134257 133508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 136044 134512 gene locus_tag LOCUS_02650 136044 134512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 136794 136603 gene locus_tag LOCUS_02660 136794 136603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 137077 138870 gene locus_tag LOCUS_02670 137077 138870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 139398 140171 gene locus_tag LOCUS_02680 139398 140171 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368402.1 protein_id gnl|my_center|LOCUS_02680 140190 140627 gene locus_tag LOCUS_02690 140190 140627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 141361 140651 gene locus_tag LOCUS_02700 141361 140651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 142692 141394 gene locus_tag LOCUS_02710 gene hisD 142692 141394 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_02710 144090 142825 gene locus_tag LOCUS_02720 gene murA 144090 142825 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_02720 144418 145470 gene locus_tag LOCUS_02730 144418 145470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 147725 145581 gene locus_tag LOCUS_02740 147725 145581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 147934 148033 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 149259 148396 gene locus_tag LOCUS_02750 149259 148396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 150607 149594 gene locus_tag LOCUS_02760 150607 149594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 151587 150835 gene locus_tag LOCUS_02770 gene truA 151587 150835 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_02770 152194 152976 gene locus_tag LOCUS_02780 152194 152976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence003 480 1664 gene locus_tag LOCUS_02790 480 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 1661 2785 gene locus_tag LOCUS_02800 1661 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2820 4292 gene locus_tag LOCUS_02810 2820 4292 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_02810 4657 4298 gene locus_tag LOCUS_02820 4657 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 4901 4659 gene locus_tag LOCUS_02830 4901 4659 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_02830 5103 5939 gene locus_tag LOCUS_02840 5103 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 6284 7234 gene locus_tag LOCUS_02850 6284 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7408 8316 gene locus_tag LOCUS_02860 7408 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8470 10554 gene locus_tag LOCUS_02870 8470 10554 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_02870 10606 11586 gene locus_tag LOCUS_02880 10606 11586 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_02880 11599 12036 gene locus_tag LOCUS_02890 11599 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 12389 12084 gene locus_tag LOCUS_02900 12389 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 12638 12808 gene locus_tag LOCUS_02910 12638 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 13319 12888 gene locus_tag LOCUS_02920 13319 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 13852 13412 gene locus_tag LOCUS_02930 13852 13412 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_02930 14969 14316 gene locus_tag LOCUS_02940 gene udk 14969 14316 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640313.1 protein_id gnl|my_center|LOCUS_02940 15226 15005 gene locus_tag LOCUS_02950 15226 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 15694 16710 gene locus_tag LOCUS_02960 gene aroF 15694 16710 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_02960 16932 18485 gene locus_tag LOCUS_02970 16932 18485 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_02970 20134 18620 gene locus_tag LOCUS_02980 20134 18620 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_02980 20484 20179 gene locus_tag LOCUS_02990 20484 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 20859 20668 gene locus_tag LOCUS_03000 20859 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 23626 20915 gene locus_tag LOCUS_03010 gene fdhF 23626 20915 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(22541..22543),aa:Sec) note codon on position 362 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_03010 24806 23763 gene locus_tag LOCUS_03020 24806 23763 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725771.1 protein_id gnl|my_center|LOCUS_03020 25278 26132 gene locus_tag LOCUS_03030 25278 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 26133 27746 gene locus_tag LOCUS_03040 26133 27746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_03040 27743 28819 gene locus_tag LOCUS_03050 27743 28819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_03050 29043 29972 gene locus_tag LOCUS_03060 29043 29972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_03060 33255 30112 gene locus_tag LOCUS_03070 33255 30112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 39987 33556 gene locus_tag LOCUS_03080 39987 33556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 40955 40086 gene locus_tag LOCUS_03090 40955 40086 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965376.1 protein_id gnl|my_center|LOCUS_03090 42951 41101 gene locus_tag LOCUS_03100 gene dxs 42951 41101 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_03100 43156 42968 gene locus_tag LOCUS_03110 43156 42968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 44587 43346 gene locus_tag LOCUS_03120 gene xseA 44587 43346 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_03120 45560 44784 gene locus_tag LOCUS_03130 45560 44784 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944383.1 protein_id gnl|my_center|LOCUS_03130 46181 45654 gene locus_tag LOCUS_03140 gene pyrE 46181 45654 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_03140 47189 46341 gene locus_tag LOCUS_03150 gene selD 47189 46341 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L4E1 protein_id gnl|my_center|LOCUS_03150 48352 47456 gene locus_tag LOCUS_03160 48352 47456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 49065 48349 gene locus_tag LOCUS_03170 49065 48349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 49393 50847 gene locus_tag LOCUS_03180 49393 50847 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 protein_id gnl|my_center|LOCUS_03180 51140 50934 gene locus_tag LOCUS_03190 51140 50934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 51340 51137 gene locus_tag LOCUS_03200 51340 51137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 55085 51969 gene locus_tag LOCUS_03210 55085 51969 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_03210 55630 56388 gene locus_tag LOCUS_03220 55630 56388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 56598 57572 gene locus_tag LOCUS_03230 56598 57572 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258307.1 protein_id gnl|my_center|LOCUS_03230 57935 59575 gene locus_tag LOCUS_03240 57935 59575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 59601 60770 gene locus_tag LOCUS_03250 59601 60770 CDS product DarT ssDNA thymidine ADP-ribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257834.1 protein_id gnl|my_center|LOCUS_03250 62946 60799 gene locus_tag LOCUS_03260 62946 60799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 63429 63088 gene locus_tag LOCUS_03270 63429 63088 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_03270 63703 64074 gene locus_tag LOCUS_03280 63703 64074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 64221 64901 gene locus_tag LOCUS_03290 64221 64901 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_03290 64910 66025 gene locus_tag LOCUS_03300 64910 66025 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_03300 66125 66481 gene locus_tag LOCUS_03310 66125 66481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 67571 66489 gene locus_tag LOCUS_03320 67571 66489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 67963 68856 gene locus_tag LOCUS_03330 gene rpsB 67963 68856 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_03330 69024 69617 gene locus_tag LOCUS_03340 gene tsf 69024 69617 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_03340 69873 70463 gene locus_tag LOCUS_03350 gene frr 69873 70463 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_03350 70631 71464 gene locus_tag LOCUS_03360 70631 71464 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_03360 71513 72703 gene locus_tag LOCUS_03370 71513 72703 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241803.1 protein_id gnl|my_center|LOCUS_03370 72749 74431 gene locus_tag LOCUS_03380 72749 74431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 74507 75226 gene locus_tag LOCUS_03390 74507 75226 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_03390 75311 77845 gene locus_tag LOCUS_03400 gene priA 75311 77845 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_03400 78060 79013 gene locus_tag LOCUS_03410 78060 79013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 79171 80082 gene locus_tag LOCUS_03420 79171 80082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03420 80128 80436 gene locus_tag LOCUS_03430 80128 80436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03430 80931 81128 gene locus_tag LOCUS_03440 80931 81128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 81779 81183 gene locus_tag LOCUS_03450 81779 81183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 82793 85327 gene locus_tag LOCUS_03460 82793 85327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 86392 85397 gene locus_tag LOCUS_03470 86392 85397 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290900.1 protein_id gnl|my_center|LOCUS_03470 87379 86453 gene locus_tag LOCUS_03480 87379 86453 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_03480 88088 87288 gene locus_tag LOCUS_03490 88088 87288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 88332 89468 gene locus_tag LOCUS_03500 gene mqnE 88332 89468 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339462.1 protein_id gnl|my_center|LOCUS_03500 89447 90286 gene locus_tag LOCUS_03510 89447 90286 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_03510 90299 90799 gene locus_tag LOCUS_03520 90299 90799 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021008.1 protein_id gnl|my_center|LOCUS_03520 90933 91304 gene locus_tag LOCUS_03530 gene nifU 90933 91304 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_03530 91310 91639 gene locus_tag LOCUS_03540 gene erpA 91310 91639 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209365.1 protein_id gnl|my_center|LOCUS_03540 91766 91930 gene locus_tag LOCUS_03550 91766 91930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 92697 91939 gene locus_tag LOCUS_03560 92697 91939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 96732 93088 gene locus_tag LOCUS_03570 96732 93088 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208688.1 protein_id gnl|my_center|LOCUS_03570 97931 96729 gene locus_tag LOCUS_03580 97931 96729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 98448 101648 gene locus_tag LOCUS_03590 98448 101648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 101792 101959 gene locus_tag LOCUS_03600 101792 101959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 101972 105700 gene locus_tag LOCUS_03610 101972 105700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 106180 105824 gene locus_tag LOCUS_03620 106180 105824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 106436 106161 gene locus_tag LOCUS_03630 106436 106161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 107397 110471 gene locus_tag LOCUS_03640 107397 110471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 110705 110932 gene locus_tag LOCUS_03650 110705 110932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 110951 111139 gene locus_tag LOCUS_03660 110951 111139 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_03660 111153 111392 gene locus_tag LOCUS_03670 111153 111392 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_03670 111471 111704 gene locus_tag LOCUS_03680 111471 111704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 112411 113613 gene locus_tag LOCUS_03690 112411 113613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 113630 114664 gene locus_tag LOCUS_03700 113630 114664 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228820.1 protein_id gnl|my_center|LOCUS_03700 114712 115938 gene locus_tag LOCUS_03710 114712 115938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 115944 117161 gene locus_tag LOCUS_03720 115944 117161 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_03720 117598 118509 gene locus_tag LOCUS_03730 117598 118509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 118617 119114 gene locus_tag LOCUS_03740 118617 119114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 119409 119218 gene locus_tag LOCUS_03750 119409 119218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 119501 120484 gene locus_tag LOCUS_03760 119501 120484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 120709 121719 gene locus_tag LOCUS_03770 120709 121719 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385771.1 protein_id gnl|my_center|LOCUS_03770 121756 123324 gene locus_tag LOCUS_03780 121756 123324 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840173.1 protein_id gnl|my_center|LOCUS_03780 123353 123793 gene locus_tag LOCUS_03790 123353 123793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 123884 124543 gene locus_tag LOCUS_03800 123884 124543 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_03800 124748 127222 gene locus_tag LOCUS_03810 124748 127222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 127405 128028 gene locus_tag LOCUS_03820 gene rpoE 127405 128028 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_03820 128018 128824 gene locus_tag LOCUS_03830 128018 128824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 128857 129954 gene locus_tag LOCUS_03840 128857 129954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 129964 130773 gene locus_tag LOCUS_03850 129964 130773 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531001.1 protein_id gnl|my_center|LOCUS_03850 130881 131219 gene locus_tag LOCUS_03860 130881 131219 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106968.1 protein_id gnl|my_center|LOCUS_03860 131224 131553 gene locus_tag LOCUS_03870 131224 131553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 131585 131737 gene locus_tag LOCUS_03880 131585 131737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 131750 132514 gene locus_tag LOCUS_03890 131750 132514 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_03890 132833 133153 gene locus_tag LOCUS_03900 132833 133153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence004 2 1039 gene locus_tag LOCUS_03910 2 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 1262 1450 gene locus_tag LOCUS_03920 1262 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1440 1958 gene locus_tag LOCUS_03930 gene nuoE 1440 1958 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_03930 1969 3444 gene locus_tag LOCUS_03940 gene nuoF 1969 3444 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_03940 3589 5238 gene locus_tag LOCUS_03950 3589 5238 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_03950 5284 6471 gene locus_tag LOCUS_03960 gene nuoH 5284 6471 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_03960 6483 7010 gene locus_tag LOCUS_03970 6483 7010 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329056.1 protein_id gnl|my_center|LOCUS_03970 7059 7358 gene locus_tag LOCUS_03980 gene nuoK 7059 7358 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_03980 7469 9358 gene locus_tag LOCUS_03990 gene nuoL 7469 9358 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_03990 9438 9857 gene locus_tag LOCUS_04000 9438 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9937 11505 gene locus_tag LOCUS_04010 9937 11505 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_04010 11506 12990 gene locus_tag LOCUS_04020 11506 12990 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937338.1 protein_id gnl|my_center|LOCUS_04020 13133 14563 gene locus_tag LOCUS_04030 13133 14563 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_04030 14685 14828 gene locus_tag LOCUS_04040 14685 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14859 15653 gene locus_tag LOCUS_04050 14859 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04050 15783 18017 gene locus_tag LOCUS_04060 15783 18017 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_04060 19098 18127 gene locus_tag LOCUS_04070 19098 18127 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032807985.1 protein_id gnl|my_center|LOCUS_04070 18995 19201 gene locus_tag LOCUS_04080 18995 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 20542 19298 gene locus_tag LOCUS_04090 20542 19298 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922385.1 protein_id gnl|my_center|LOCUS_04090 21603 20539 gene locus_tag LOCUS_04100 gene waaF 21603 20539 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_04100 21718 23610 gene locus_tag LOCUS_04110 21718 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 23977 23633 gene locus_tag LOCUS_04120 23977 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 24972 24028 gene locus_tag LOCUS_04130 24972 24028 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203177.1 protein_id gnl|my_center|LOCUS_04130 25299 26135 gene locus_tag LOCUS_04140 25299 26135 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_04140 26458 27561 gene locus_tag LOCUS_04150 gene bioB 26458 27561 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002111813.1 protein_id gnl|my_center|LOCUS_04150 27653 28069 gene locus_tag LOCUS_04160 27653 28069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 28086 28370 gene locus_tag LOCUS_04170 28086 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 28756 28460 gene locus_tag LOCUS_04180 28756 28460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 30507 28756 gene locus_tag LOCUS_04190 30507 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 32149 30860 gene locus_tag LOCUS_04200 gene serS 32149 30860 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_04200 32376 32300 gene locus_tag LOCUS_t00010 32376 32300 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 32468 32393 gene locus_tag LOCUS_t00020 32468 32393 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 33413 32709 gene locus_tag LOCUS_04210 33413 32709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 33498 33728 gene locus_tag LOCUS_04220 33498 33728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 33912 35330 gene locus_tag LOCUS_04230 33912 35330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 35330 37393 gene locus_tag LOCUS_04240 35330 37393 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928735.1 protein_id gnl|my_center|LOCUS_04240 37676 39139 gene locus_tag LOCUS_04250 gene betC 37676 39139 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_04250 39174 41180 gene locus_tag LOCUS_04260 39174 41180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 41177 41440 gene locus_tag LOCUS_04270 41177 41440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 41523 42758 gene locus_tag LOCUS_04280 41523 42758 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_04280 43818 42922 gene locus_tag LOCUS_04290 43818 42922 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_04290 44848 45354 gene locus_tag LOCUS_04300 44848 45354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 47112 45625 gene locus_tag LOCUS_04310 47112 45625 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_04310 48775 47339 gene locus_tag LOCUS_04320 48775 47339 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_04320 49365 48883 gene locus_tag LOCUS_04330 49365 48883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 50922 49429 gene locus_tag LOCUS_04340 gene gatA 50922 49429 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_04340 51449 51117 gene locus_tag LOCUS_04350 gene gatC 51449 51117 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_04350 53669 51471 gene locus_tag LOCUS_04360 gene pcrA 53669 51471 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_04360 57346 54476 gene locus_tag LOCUS_04370 gene uvrA 57346 54476 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_04370 57782 57357 gene locus_tag LOCUS_04380 57782 57357 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_04380 58021 57779 gene locus_tag LOCUS_04390 58021 57779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 58973 58062 gene locus_tag LOCUS_04400 58973 58062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 60220 59075 gene locus_tag LOCUS_04410 60220 59075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 59080 59179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60997 60230 gene locus_tag LOCUS_04420 60997 60230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 61628 61269 gene locus_tag LOCUS_04430 61628 61269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 64342 61619 gene locus_tag LOCUS_04440 64342 61619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 64405 64557 gene locus_tag LOCUS_04450 64405 64557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 68661 64729 gene locus_tag LOCUS_04460 68661 64729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 71033 68694 gene locus_tag LOCUS_04470 71033 68694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04470 72107 72328 gene locus_tag LOCUS_04480 72107 72328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 72333 73049 gene locus_tag LOCUS_04490 72333 73049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 73193 74032 gene locus_tag LOCUS_04500 73193 74032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 74029 75027 gene locus_tag LOCUS_04510 74029 75027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 75210 75503 gene locus_tag LOCUS_04520 75210 75503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 75817 76581 gene locus_tag LOCUS_04530 75817 76581 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_04530 76818 77504 gene locus_tag LOCUS_04540 76818 77504 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_04540 79591 77897 gene locus_tag LOCUS_04550 79591 77897 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_04550 80733 79588 gene locus_tag LOCUS_04560 80733 79588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 81576 80800 gene locus_tag LOCUS_04570 81576 80800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 83400 81670 gene locus_tag LOCUS_04580 83400 81670 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_04580 84843 83545 gene locus_tag LOCUS_04590 gene ftsZ 84843 83545 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_04590 86265 85042 gene locus_tag LOCUS_04600 gene ftsA 86265 85042 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_04600 87422 86436 gene locus_tag LOCUS_04610 87422 86436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 88888 87521 gene locus_tag LOCUS_04620 gene murC 88888 87521 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_04620 90245 89046 gene locus_tag LOCUS_04630 gene murG 90245 89046 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403336.1 protein_id gnl|my_center|LOCUS_04630 91759 90488 gene locus_tag LOCUS_04640 gene spoVE 91759 90488 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_04640 93180 91777 gene locus_tag LOCUS_04650 gene murD 93180 91777 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545218.1 protein_id gnl|my_center|LOCUS_04650 94390 93272 gene locus_tag LOCUS_04660 gene mraY 94390 93272 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_04660 95637 94432 gene locus_tag LOCUS_04670 95637 94432 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_04670 97422 95743 gene locus_tag LOCUS_04680 97422 95743 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_04680 98462 97701 gene locus_tag LOCUS_04690 98462 97701 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_04690 100034 98559 gene locus_tag LOCUS_04700 100034 98559 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_04700 101773 100031 gene locus_tag LOCUS_04710 101773 100031 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_04710 102202 101879 gene locus_tag LOCUS_04720 102202 101879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 103364 102408 gene locus_tag LOCUS_04730 gene rsmH 103364 102408 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_04730 104407 103442 gene locus_tag LOCUS_04740 104407 103442 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039877.1 protein_id gnl|my_center|LOCUS_04740 104699 106294 gene locus_tag LOCUS_04750 104699 106294 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_04750 110151 106996 gene locus_tag LOCUS_04760 110151 106996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 111531 110254 gene locus_tag LOCUS_04770 gene tyrS 111531 110254 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_04770 112408 111830 gene locus_tag LOCUS_04780 112408 111830 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_04780 113221 112487 gene locus_tag LOCUS_04790 113221 112487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 114277 113399 gene locus_tag LOCUS_04800 114277 113399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 114852 115802 gene locus_tag LOCUS_04810 114852 115802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 116285 116818 gene locus_tag LOCUS_04820 116285 116818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 116815 117495 gene locus_tag LOCUS_04830 116815 117495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 117492 118163 gene locus_tag LOCUS_04840 117492 118163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 118176 120281 gene locus_tag LOCUS_04850 118176 120281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 120348 120656 gene locus_tag LOCUS_04860 120348 120656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 120753 121295 gene locus_tag LOCUS_04870 120753 121295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 121840 123051 gene locus_tag LOCUS_04880 121840 123051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 123378 124178 gene locus_tag LOCUS_04890 123378 124178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 124350 124643 gene locus_tag LOCUS_04900 124350 124643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 124718 125125 gene locus_tag LOCUS_04910 124718 125125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 125202 126020 gene locus_tag LOCUS_04920 125202 126020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence005 124 1062 gene locus_tag LOCUS_04930 124 1062 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458883.1 protein_id gnl|my_center|LOCUS_04930 1069 2178 gene locus_tag LOCUS_04940 1069 2178 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_04940 2273 4591 gene locus_tag LOCUS_04950 2273 4591 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_04950 4658 4960 gene locus_tag LOCUS_04960 4658 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 5007 5204 gene locus_tag LOCUS_04970 5007 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5252 6082 gene locus_tag LOCUS_04980 5252 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 7401 6211 gene locus_tag LOCUS_04990 7401 6211 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_04990 7559 8470 gene locus_tag LOCUS_05000 7559 8470 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_05000 9870 8467 gene locus_tag LOCUS_05010 9870 8467 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_05010 10681 9881 gene locus_tag LOCUS_05020 10681 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12138 10786 gene locus_tag LOCUS_05030 12138 10786 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785076.1 protein_id gnl|my_center|LOCUS_05030 13295 12264 gene locus_tag LOCUS_05040 13295 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 14240 13302 gene locus_tag LOCUS_05050 gene uxuA 14240 13302 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_05050 15390 14383 gene locus_tag LOCUS_05060 15390 14383 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014888.1 protein_id gnl|my_center|LOCUS_05060 16408 15533 gene locus_tag LOCUS_05070 16408 15533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 18018 16624 gene locus_tag LOCUS_05080 18018 16624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 19394 18297 gene locus_tag LOCUS_05090 19394 18297 CDS product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482890.1 protein_id gnl|my_center|LOCUS_05090 20452 19454 gene locus_tag LOCUS_05100 20452 19454 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_05100 21713 20541 gene locus_tag LOCUS_05110 21713 20541 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_05110 22110 23084 gene locus_tag LOCUS_05120 22110 23084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 23658 23245 gene locus_tag LOCUS_05130 23658 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 23929 23651 gene locus_tag LOCUS_05140 23929 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 24331 24038 gene locus_tag LOCUS_05150 24331 24038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 26429 24705 gene locus_tag LOCUS_05160 26429 24705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 30080 26499 gene locus_tag LOCUS_05170 30080 26499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 30646 30179 gene locus_tag LOCUS_05180 30646 30179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 33930 30643 gene locus_tag LOCUS_05190 33930 30643 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_05190 34653 34036 gene locus_tag LOCUS_05200 34653 34036 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_05200 34730 34894 gene locus_tag LOCUS_05210 34730 34894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 35487 34906 gene locus_tag LOCUS_05220 35487 34906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 35961 36929 gene locus_tag LOCUS_05230 35961 36929 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_05230 36956 37777 gene locus_tag LOCUS_05240 36956 37777 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 protein_id gnl|my_center|LOCUS_05240 38320 37853 gene locus_tag LOCUS_05250 38320 37853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 38465 39289 gene locus_tag LOCUS_05260 38465 39289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 39309 39569 gene locus_tag LOCUS_05270 39309 39569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 40480 39584 gene locus_tag LOCUS_05280 gene prmA 40480 39584 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_05280 41698 40544 gene locus_tag LOCUS_05290 gene dnaJ 41698 40544 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_05290 42573 41719 gene locus_tag LOCUS_05300 42573 41719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 43544 42837 gene locus_tag LOCUS_05310 43544 42837 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_05310 44916 43696 gene locus_tag LOCUS_05320 44916 43696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 45761 44913 gene locus_tag LOCUS_05330 45761 44913 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_05330 47086 46040 gene locus_tag LOCUS_05340 gene lpxD 47086 46040 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_05340 47711 47151 gene locus_tag LOCUS_05350 47711 47151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 50270 47799 gene locus_tag LOCUS_05360 gene bamA 50270 47799 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_05360 51247 50366 gene locus_tag LOCUS_05370 gene ilvE 51247 50366 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_05370 52055 51330 gene locus_tag LOCUS_05380 52055 51330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_05380 53535 52075 gene locus_tag LOCUS_05390 53535 52075 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_05390 54108 53545 gene locus_tag LOCUS_05400 54108 53545 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771481.1 protein_id gnl|my_center|LOCUS_05400 54649 54086 gene locus_tag LOCUS_05410 54649 54086 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_05410 55197 54646 gene locus_tag LOCUS_05420 55197 54646 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267035.1 protein_id gnl|my_center|LOCUS_05420 56671 55199 gene locus_tag LOCUS_05430 gene lysS 56671 55199 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_05430 57827 57024 gene locus_tag LOCUS_05440 57827 57024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 59823 58147 gene locus_tag LOCUS_05450 gene lnt 59823 58147 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_05450 62022 59833 gene locus_tag LOCUS_05460 62022 59833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 62374 63498 gene locus_tag LOCUS_05470 gene porV 62374 63498 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_05470 63516 64334 gene locus_tag LOCUS_05480 63516 64334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 64346 65284 gene locus_tag LOCUS_05490 64346 65284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 65333 67042 gene locus_tag LOCUS_05500 65333 67042 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_05500 67292 68431 gene locus_tag LOCUS_05510 67292 68431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 69003 69731 gene locus_tag LOCUS_05520 69003 69731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 69943 71580 gene locus_tag LOCUS_05530 gene groL 69943 71580 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393619.1 protein_id gnl|my_center|LOCUS_05530 72088 71618 gene locus_tag LOCUS_05540 72088 71618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 72541 72167 gene locus_tag LOCUS_05550 72541 72167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 72932 75346 gene locus_tag LOCUS_05560 72932 75346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_05560 75538 76215 gene locus_tag LOCUS_05570 75538 76215 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_05570 76350 79967 gene locus_tag LOCUS_05580 76350 79967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839243.1 protein_id gnl|my_center|LOCUS_05580 80228 81244 gene locus_tag LOCUS_05590 80228 81244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 81452 82219 gene locus_tag LOCUS_05600 81452 82219 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_05600 82864 82241 gene locus_tag LOCUS_05610 82864 82241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 84164 83109 gene locus_tag LOCUS_05620 84164 83109 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_05620 84769 84296 gene locus_tag LOCUS_05630 84769 84296 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_05630 85417 86289 gene locus_tag LOCUS_05640 gene disA 85417 86289 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966464.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05640 86495 87823 gene locus_tag LOCUS_05650 86495 87823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 87857 89260 gene locus_tag LOCUS_05660 87857 89260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 89407 89823 gene locus_tag LOCUS_05670 89407 89823 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_05670 89871 90560 gene locus_tag LOCUS_05680 89871 90560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_05680 90735 93995 gene locus_tag LOCUS_05690 90735 93995 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_05690 94041 94643 gene locus_tag LOCUS_05700 94041 94643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 94682 95575 gene locus_tag LOCUS_05710 94682 95575 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_05710 95738 96925 gene locus_tag LOCUS_05720 95738 96925 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_05720 97068 99323 gene locus_tag LOCUS_05730 97068 99323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 99863 100711 gene locus_tag LOCUS_05740 99863 100711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 101943 100858 gene locus_tag LOCUS_05750 101943 100858 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_05750 103382 102297 gene locus_tag LOCUS_05760 103382 102297 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_05760 103640 104236 gene locus_tag LOCUS_05770 103640 104236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 104976 104419 gene locus_tag LOCUS_05780 104976 104419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 106135 105179 gene locus_tag LOCUS_05790 106135 105179 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_05790 107114 106161 gene locus_tag LOCUS_05800 107114 106161 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942015.1 protein_id gnl|my_center|LOCUS_05800 108093 108923 gene locus_tag LOCUS_05810 108093 108923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 108930 109733 gene locus_tag LOCUS_05820 108930 109733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 109975 109790 gene locus_tag LOCUS_05830 109975 109790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 109974 110705 gene locus_tag LOCUS_05840 109974 110705 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392169.1 protein_id gnl|my_center|LOCUS_05840 110947 111420 gene locus_tag LOCUS_05850 110947 111420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 111417 112736 gene locus_tag LOCUS_05860 111417 112736 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335012.1 protein_id gnl|my_center|LOCUS_05860 112898 115891 gene locus_tag LOCUS_05870 112898 115891 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_05870 116073 117401 gene locus_tag LOCUS_05880 116073 117401 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_05880 118197 117451 gene locus_tag LOCUS_05890 118197 117451 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_05890 118509 118201 gene locus_tag LOCUS_05900 118509 118201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 118794 118531 gene locus_tag LOCUS_05910 118794 118531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05910 120013 118784 gene locus_tag LOCUS_05920 120013 118784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 120255 120542 gene locus_tag LOCUS_05930 120255 120542 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970501.1 protein_id gnl|my_center|LOCUS_05930 120589 121536 gene locus_tag LOCUS_05940 120589 121536 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_05940 121562 122635 gene locus_tag LOCUS_05950 121562 122635 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_05950 123208 122687 gene locus_tag LOCUS_05960 123208 122687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 123579 123914 gene locus_tag LOCUS_05970 123579 123914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 123934 124941 gene locus_tag LOCUS_05980 gene dusB 123934 124941 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_05980 125037 125861 gene locus_tag LOCUS_05990 gene dapF 125037 125861 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence006 2418 1201 gene locus_tag LOCUS_06000 2418 1201 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_06000 3435 2623 gene locus_tag LOCUS_06010 3435 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3719 4891 gene locus_tag LOCUS_06020 3719 4891 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_06020 5074 5874 gene locus_tag LOCUS_06030 5074 5874 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_06030 6825 5917 gene locus_tag LOCUS_06040 6825 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7806 6997 gene locus_tag LOCUS_06050 7806 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 9852 8014 gene locus_tag LOCUS_06060 9852 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 10652 10122 gene locus_tag LOCUS_06070 10652 10122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 11860 10973 gene locus_tag LOCUS_06080 11860 10973 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846190.1 protein_id gnl|my_center|LOCUS_06080 12003 12224 gene locus_tag LOCUS_06090 12003 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 13731 12457 gene locus_tag LOCUS_06100 13731 12457 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_06100 14214 13786 gene locus_tag LOCUS_06110 14214 13786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 16250 14313 gene locus_tag LOCUS_06120 16250 14313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 16665 16417 gene locus_tag LOCUS_06130 16665 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 17282 16671 gene locus_tag LOCUS_06140 17282 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 17898 17563 gene locus_tag LOCUS_06150 17898 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 18543 17911 gene locus_tag LOCUS_06160 18543 17911 CDS product heme-copper oxidase subunit III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434085.1 protein_id gnl|my_center|LOCUS_06160 18894 18625 gene locus_tag LOCUS_06170 18894 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 19510 18917 gene locus_tag LOCUS_06180 19510 18917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 19796 19497 gene locus_tag LOCUS_06190 19796 19497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 20860 19934 gene locus_tag LOCUS_06200 gene cyoE 20860 19934 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_06200 21822 20872 gene locus_tag LOCUS_06210 21822 20872 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_06210 23746 21878 gene locus_tag LOCUS_06220 gene ctaD 23746 21878 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_06220 24432 23767 gene locus_tag LOCUS_06230 24432 23767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 25371 24556 gene locus_tag LOCUS_06240 25371 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 26392 25454 gene locus_tag LOCUS_06250 26392 25454 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_06250 27241 26459 gene locus_tag LOCUS_06260 27241 26459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 29049 27328 gene locus_tag LOCUS_06270 29049 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 29828 29052 gene locus_tag LOCUS_06280 29828 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 31413 29905 gene locus_tag LOCUS_06290 31413 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 33612 31711 gene locus_tag LOCUS_06300 33612 31711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 34503 33754 gene locus_tag LOCUS_06310 34503 33754 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_06310 35566 35210 gene locus_tag LOCUS_06320 35566 35210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 38773 35663 gene locus_tag LOCUS_06330 38773 35663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 39803 38937 gene locus_tag LOCUS_06340 39803 38937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 40713 39943 gene locus_tag LOCUS_06350 40713 39943 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_06350 41287 40799 gene locus_tag LOCUS_06360 41287 40799 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808186.1 protein_id gnl|my_center|LOCUS_06360 41744 42532 gene locus_tag LOCUS_06370 41744 42532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 44135 42675 gene locus_tag LOCUS_06380 44135 42675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 44437 44126 gene locus_tag LOCUS_06390 44437 44126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 45870 44782 gene locus_tag LOCUS_06400 45870 44782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 47423 45873 gene locus_tag LOCUS_06410 47423 45873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 50081 47619 gene locus_tag LOCUS_06420 50081 47619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 51838 50393 gene locus_tag LOCUS_06430 51838 50393 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118727.1 protein_id gnl|my_center|LOCUS_06430 54440 51939 gene locus_tag LOCUS_06440 54440 51939 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_06440 55578 54658 gene locus_tag LOCUS_06450 55578 54658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 56628 55771 gene locus_tag LOCUS_06460 56628 55771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 57470 56673 gene locus_tag LOCUS_06470 gene yhdJ 57470 56673 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258951.1 protein_id gnl|my_center|LOCUS_06470 59100 57652 gene locus_tag LOCUS_06480 59100 57652 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_06480 59274 59122 gene locus_tag LOCUS_06490 59274 59122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 60696 59293 gene locus_tag LOCUS_06500 60696 59293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 61008 61625 gene locus_tag LOCUS_06510 61008 61625 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_06510 61771 62676 gene locus_tag LOCUS_06520 61771 62676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 62834 66919 gene locus_tag LOCUS_06530 62834 66919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 66933 67505 gene locus_tag LOCUS_06540 66933 67505 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_06540 67691 68668 gene locus_tag LOCUS_06550 67691 68668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 68780 70573 gene locus_tag LOCUS_06560 68780 70573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 70629 71414 gene locus_tag LOCUS_06570 70629 71414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 71463 72239 gene locus_tag LOCUS_06580 71463 72239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 72338 73183 gene locus_tag LOCUS_06590 72338 73183 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_06590 74157 73324 gene locus_tag LOCUS_06600 74157 73324 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 protein_id gnl|my_center|LOCUS_06600 74622 75989 gene locus_tag LOCUS_06610 74622 75989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 76706 77107 gene locus_tag LOCUS_06620 76706 77107 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_06620 77232 78377 gene locus_tag LOCUS_06630 77232 78377 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_06630 78437 79678 gene locus_tag LOCUS_06640 gene lysA 78437 79678 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_06640 80732 79716 gene locus_tag LOCUS_06650 80732 79716 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398709.1 protein_id gnl|my_center|LOCUS_06650 80893 82941 gene locus_tag LOCUS_06660 80893 82941 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_06660 83030 84898 gene locus_tag LOCUS_06670 gene mutL 83030 84898 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_06670 85380 84922 gene locus_tag LOCUS_06680 85380 84922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 85746 87779 gene locus_tag LOCUS_06690 85746 87779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 88400 87972 gene locus_tag LOCUS_06700 88400 87972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 89952 88831 gene locus_tag LOCUS_06710 89952 88831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 90347 89982 gene locus_tag LOCUS_06720 90347 89982 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_06720 91048 90638 gene locus_tag LOCUS_06730 91048 90638 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479871.1 protein_id gnl|my_center|LOCUS_06730 91440 93602 gene locus_tag LOCUS_06740 91440 93602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 95495 93606 gene locus_tag LOCUS_06750 95495 93606 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_06750 96431 95754 gene locus_tag LOCUS_06760 96431 95754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 97509 96490 gene locus_tag LOCUS_06770 97509 96490 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_06770 98460 99164 gene locus_tag LOCUS_06780 98460 99164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 99174 101012 gene locus_tag LOCUS_06790 99174 101012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 101196 102089 gene locus_tag LOCUS_06800 101196 102089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 102129 103151 gene locus_tag LOCUS_06810 102129 103151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 103233 103448 gene locus_tag LOCUS_06820 103233 103448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 103847 104980 gene locus_tag LOCUS_06830 103847 104980 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_06830 105043 106380 gene locus_tag LOCUS_06840 105043 106380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 106707 108272 gene locus_tag LOCUS_06850 gene purH 106707 108272 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_06850 109043 108420 gene locus_tag LOCUS_06860 109043 108420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 109984 110376 gene locus_tag LOCUS_06870 109984 110376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 110658 111290 gene locus_tag LOCUS_06880 110658 111290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 111724 111320 gene locus_tag LOCUS_06890 111724 111320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 112219 111929 gene locus_tag LOCUS_06900 112219 111929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence007 1358 468 gene locus_tag LOCUS_06910 1358 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1884 1588 gene locus_tag LOCUS_06920 1884 1588 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_06920 4287 2032 gene locus_tag LOCUS_06930 4287 2032 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_06930 4787 4317 gene locus_tag LOCUS_06940 4787 4317 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_06940 5767 4889 gene locus_tag LOCUS_06950 5767 4889 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_06950 6156 8228 gene locus_tag LOCUS_06960 6156 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 9196 8246 gene locus_tag LOCUS_06970 9196 8246 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_06970 10295 9210 gene locus_tag LOCUS_06980 10295 9210 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205116563.1 protein_id gnl|my_center|LOCUS_06980 11312 10431 gene locus_tag LOCUS_06990 11312 10431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11452 12486 gene locus_tag LOCUS_07000 11452 12486 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_07000 14057 12651 gene locus_tag LOCUS_07010 14057 12651 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 protein_id gnl|my_center|LOCUS_07010 15055 14093 gene locus_tag LOCUS_07020 15055 14093 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_07020 15762 15052 gene locus_tag LOCUS_07030 15762 15052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 17715 16474 gene locus_tag LOCUS_07040 17715 16474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 19862 17712 gene locus_tag LOCUS_07050 19862 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 20939 19884 gene locus_tag LOCUS_07060 20939 19884 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106909.1 protein_id gnl|my_center|LOCUS_07060 21795 21214 gene locus_tag LOCUS_07070 21795 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 21969 23057 gene locus_tag LOCUS_07080 21969 23057 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_07080 23272 23099 gene locus_tag LOCUS_07090 23272 23099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 23858 23262 gene locus_tag LOCUS_07100 23858 23262 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_07100 24405 24073 gene locus_tag LOCUS_07110 24405 24073 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_07110 24833 24450 gene locus_tag LOCUS_07120 24833 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 25162 24860 gene locus_tag LOCUS_07130 25162 24860 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384190.1 protein_id gnl|my_center|LOCUS_07130 25524 25213 gene locus_tag LOCUS_07140 25524 25213 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010050.1 protein_id gnl|my_center|LOCUS_07140 25975 25583 gene locus_tag LOCUS_07150 25975 25583 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_07150 27216 25972 gene locus_tag LOCUS_07160 27216 25972 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_07160 27648 27307 gene locus_tag LOCUS_07170 27648 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 29155 27749 gene locus_tag LOCUS_07180 gene sufD 29155 27749 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_07180 30601 29183 gene locus_tag LOCUS_07190 gene sufB 30601 29183 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_07190 31388 30603 gene locus_tag LOCUS_07200 gene sufC 31388 30603 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_07200 32488 31493 gene locus_tag LOCUS_07210 gene moaA 32488 31493 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804484.1 protein_id gnl|my_center|LOCUS_07210 33157 32684 gene locus_tag LOCUS_07220 33157 32684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 33463 33825 gene locus_tag LOCUS_07230 33463 33825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 33905 34570 gene locus_tag LOCUS_07240 33905 34570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 35642 34689 gene locus_tag LOCUS_07250 35642 34689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 36836 35823 gene locus_tag LOCUS_07260 36836 35823 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_07260 38555 36840 gene locus_tag LOCUS_07270 38555 36840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 42530 39012 gene locus_tag LOCUS_07280 42530 39012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 42932 43957 gene locus_tag LOCUS_07290 gene iolG 42932 43957 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_07290 43950 44429 gene locus_tag LOCUS_07300 43950 44429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 44433 44696 gene locus_tag LOCUS_07310 44433 44696 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255960.1 protein_id gnl|my_center|LOCUS_07310 44779 45840 gene locus_tag LOCUS_07320 44779 45840 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_07320 46233 47717 gene locus_tag LOCUS_07330 46233 47717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 47799 48101 gene locus_tag LOCUS_07340 47799 48101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 48156 48839 gene locus_tag LOCUS_07350 48156 48839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 48970 51231 gene locus_tag LOCUS_07360 48970 51231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 51366 53924 gene locus_tag LOCUS_07370 51366 53924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 54009 55187 gene locus_tag LOCUS_07380 54009 55187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 55549 55202 gene locus_tag LOCUS_07390 55549 55202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 58590 55873 gene locus_tag LOCUS_07400 58590 55873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 59197 58628 gene locus_tag LOCUS_07410 59197 58628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 59496 60098 gene locus_tag LOCUS_07420 59496 60098 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_07420 60111 60704 gene locus_tag LOCUS_07430 60111 60704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 60785 61912 gene locus_tag LOCUS_07440 60785 61912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 62993 61926 gene locus_tag LOCUS_07450 62993 61926 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256684.1 protein_id gnl|my_center|LOCUS_07450 64007 63117 gene locus_tag LOCUS_07460 64007 63117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 66265 64193 gene locus_tag LOCUS_07470 66265 64193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 66790 67458 gene locus_tag LOCUS_07480 66790 67458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 67481 68086 gene locus_tag LOCUS_07490 67481 68086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 68064 68666 gene locus_tag LOCUS_07500 68064 68666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 68825 69196 gene locus_tag LOCUS_07510 68825 69196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 69245 69592 gene locus_tag LOCUS_07520 69245 69592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 69952 71007 gene locus_tag LOCUS_07530 69952 71007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 71079 72098 gene locus_tag LOCUS_07540 71079 72098 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_07540 72333 73871 gene locus_tag LOCUS_07550 72333 73871 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_07550 74041 75390 gene locus_tag LOCUS_07560 74041 75390 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_07560 75395 76138 gene locus_tag LOCUS_07570 75395 76138 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_07570 76193 77077 gene locus_tag LOCUS_07580 76193 77077 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877328.1 protein_id gnl|my_center|LOCUS_07580 77199 78173 gene locus_tag LOCUS_07590 77199 78173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_07590 78225 79496 gene locus_tag LOCUS_07600 78225 79496 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_07600 79794 80732 gene locus_tag LOCUS_07610 79794 80732 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877605.1 protein_id gnl|my_center|LOCUS_07610 80853 81602 gene locus_tag LOCUS_07620 80853 81602 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 protein_id gnl|my_center|LOCUS_07620 81639 84344 gene locus_tag LOCUS_07630 81639 84344 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_07630 84304 85104 gene locus_tag LOCUS_07640 84304 85104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 87255 85645 gene locus_tag LOCUS_07650 87255 85645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 87697 87533 gene locus_tag LOCUS_07660 87697 87533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 89642 87855 gene locus_tag LOCUS_07670 89642 87855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 90387 89941 gene locus_tag LOCUS_07680 90387 89941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 90638 92059 gene locus_tag LOCUS_07690 gene selA 90638 92059 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694593.1 protein_id gnl|my_center|LOCUS_07690 92056 92886 gene locus_tag LOCUS_07700 92056 92886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 92995 94068 gene locus_tag LOCUS_07710 92995 94068 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_07710 94154 97702 gene locus_tag LOCUS_07720 94154 97702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 97713 98432 gene locus_tag LOCUS_07730 97713 98432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 98717 99877 gene locus_tag LOCUS_07740 98717 99877 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031359.1 protein_id gnl|my_center|LOCUS_07740 99967 101793 gene locus_tag LOCUS_07750 99967 101793 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_07750 102093 102563 gene locus_tag LOCUS_07760 102093 102563 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963846.1 protein_id gnl|my_center|LOCUS_07760 102762 102914 gene locus_tag LOCUS_07770 102762 102914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 103383 104432 gene locus_tag LOCUS_07780 103383 104432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 104935 106098 gene locus_tag LOCUS_07790 104935 106098 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_07790 106190 106996 gene locus_tag LOCUS_07800 106190 106996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 107142 108278 gene locus_tag LOCUS_07810 gene dgoD 107142 108278 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence008 423 1109 gene locus_tag LOCUS_07820 423 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1177 4647 gene locus_tag LOCUS_07830 1177 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4728 5543 gene locus_tag LOCUS_07840 4728 5543 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_07840 5759 6538 gene locus_tag LOCUS_07850 5759 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 6685 7434 gene locus_tag LOCUS_07860 6685 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 7471 8289 gene locus_tag LOCUS_07870 7471 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 9946 8435 gene locus_tag LOCUS_07880 9946 8435 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_07880 10506 11165 gene locus_tag LOCUS_07890 10506 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 11188 12333 gene locus_tag LOCUS_07900 11188 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 12775 12554 gene locus_tag LOCUS_07910 12775 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 12774 14183 gene locus_tag LOCUS_07920 gene betC 12774 14183 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114636.1 protein_id gnl|my_center|LOCUS_07920 17235 14350 gene locus_tag LOCUS_07930 17235 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 18590 21547 gene locus_tag LOCUS_07940 18590 21547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 21839 21627 gene locus_tag LOCUS_07950 21839 21627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 22201 21851 gene locus_tag LOCUS_07960 22201 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 22576 22214 gene locus_tag LOCUS_07970 22576 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 22957 22586 gene locus_tag LOCUS_07980 22957 22586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 23336 22971 gene locus_tag LOCUS_07990 23336 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 23430 23660 gene locus_tag LOCUS_08000 23430 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 23978 23694 gene locus_tag LOCUS_08010 23978 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 25412 24033 gene locus_tag LOCUS_08020 25412 24033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 27169 25445 gene locus_tag LOCUS_08030 27169 25445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 27127 27363 gene locus_tag LOCUS_08040 27127 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 27980 29398 gene locus_tag LOCUS_08050 27980 29398 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_08050 30630 29686 gene locus_tag LOCUS_08060 30630 29686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 31315 30848 gene locus_tag LOCUS_08070 31315 30848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 33320 31425 gene locus_tag LOCUS_08080 33320 31425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 34347 33382 gene locus_tag LOCUS_08090 34347 33382 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229613.1 protein_id gnl|my_center|LOCUS_08090 34878 36263 gene locus_tag LOCUS_08100 34878 36263 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_08100 36295 37533 gene locus_tag LOCUS_08110 36295 37533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 37798 39042 gene locus_tag LOCUS_08120 37798 39042 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_08120 39216 40673 gene locus_tag LOCUS_08130 39216 40673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 40724 41272 gene locus_tag LOCUS_08140 40724 41272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 41291 42247 gene locus_tag LOCUS_08150 41291 42247 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390801.1 protein_id gnl|my_center|LOCUS_08150 42238 43974 gene locus_tag LOCUS_08160 42238 43974 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_08160 44275 45153 gene locus_tag LOCUS_08170 44275 45153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 45260 45874 gene locus_tag LOCUS_08180 gene rpoE 45260 45874 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_08180 46989 45994 gene locus_tag LOCUS_08190 gene ftsY 46989 45994 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392477.1 protein_id gnl|my_center|LOCUS_08190 47258 47830 gene locus_tag LOCUS_08200 47258 47830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 47847 49067 gene locus_tag LOCUS_08210 47847 49067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 49462 55095 gene locus_tag LOCUS_08220 49462 55095 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391582.1 protein_id gnl|my_center|LOCUS_08220 55092 57677 gene locus_tag LOCUS_08230 gene pbpC 55092 57677 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070480.1 protein_id gnl|my_center|LOCUS_08230 58473 57709 gene locus_tag LOCUS_08240 58473 57709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 59475 58624 gene locus_tag LOCUS_08250 59475 58624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 60197 59523 gene locus_tag LOCUS_08260 60197 59523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 60749 60378 gene locus_tag LOCUS_08270 60749 60378 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_08270 60953 63025 gene locus_tag LOCUS_08280 gene fusA 60953 63025 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_08280 64659 63208 gene locus_tag LOCUS_08290 64659 63208 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_08290 65847 64843 gene locus_tag LOCUS_08300 65847 64843 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_08300 66365 65913 gene locus_tag LOCUS_08310 gene gspG 66365 65913 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_08310 66771 67979 gene locus_tag LOCUS_08320 66771 67979 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_08320 67990 68889 gene locus_tag LOCUS_08330 67990 68889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 68997 69224 gene locus_tag LOCUS_08340 68997 69224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 71355 69181 gene locus_tag LOCUS_08350 71355 69181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 71922 74621 gene locus_tag LOCUS_08360 71922 74621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 76840 75386 gene locus_tag LOCUS_08370 76840 75386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 78413 76851 gene locus_tag LOCUS_08380 78413 76851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 78647 78429 gene locus_tag LOCUS_08390 78647 78429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 79578 79940 gene locus_tag LOCUS_08400 79578 79940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 80118 84911 gene locus_tag LOCUS_08410 80118 84911 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950644.1 protein_id gnl|my_center|LOCUS_08410 85093 86043 gene locus_tag LOCUS_08420 85093 86043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 86079 86297 gene locus_tag LOCUS_08430 86079 86297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 86302 86448 gene locus_tag LOCUS_08440 86302 86448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 86787 87629 gene locus_tag LOCUS_08450 86787 87629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 87763 89193 gene locus_tag LOCUS_08460 87763 89193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 89824 89228 gene locus_tag LOCUS_08470 89824 89228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08470 90361 90080 gene locus_tag LOCUS_08480 90361 90080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 90456 90878 gene locus_tag LOCUS_08490 90456 90878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 91222 91022 gene locus_tag LOCUS_08500 91222 91022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 92458 91250 gene locus_tag LOCUS_08510 92458 91250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 92997 92455 gene locus_tag LOCUS_08520 92997 92455 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287055.1 protein_id gnl|my_center|LOCUS_08520 93251 94090 gene locus_tag LOCUS_08530 93251 94090 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975555.1 protein_id gnl|my_center|LOCUS_08530 94218 95168 gene locus_tag LOCUS_08540 gene cysK 94218 95168 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_08540 95264 96037 gene locus_tag LOCUS_08550 95264 96037 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_08550 96163 96450 gene locus_tag LOCUS_08560 96163 96450 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_08560 96506 96982 gene locus_tag LOCUS_08570 96506 96982 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106151.1 protein_id gnl|my_center|LOCUS_08570 97017 99254 gene locus_tag LOCUS_08580 97017 99254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 100344 99280 gene locus_tag LOCUS_08590 100344 99280 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088184.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence009 2634 229 gene locus_tag LOCUS_08600 2634 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2921 2631 gene locus_tag LOCUS_08610 2921 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3551 3075 gene locus_tag LOCUS_08620 3551 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08620 4098 4808 gene locus_tag LOCUS_08630 4098 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6165 5032 gene locus_tag LOCUS_08640 6165 5032 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_08640 6282 7187 gene locus_tag LOCUS_08650 6282 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7834 7346 gene locus_tag LOCUS_08660 7834 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 8535 8008 gene locus_tag LOCUS_08670 8535 8008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 10079 8556 gene locus_tag LOCUS_08680 10079 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 10537 10385 gene locus_tag LOCUS_08690 10537 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 11458 10655 gene locus_tag LOCUS_08700 11458 10655 CDS product Stf0 sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727079.1 protein_id gnl|my_center|LOCUS_08700 12103 11471 gene locus_tag LOCUS_08710 12103 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 12362 13165 gene locus_tag LOCUS_08720 12362 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 13533 13162 gene locus_tag LOCUS_08730 13533 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 14921 13860 gene locus_tag LOCUS_08740 14921 13860 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083752.1 protein_id gnl|my_center|LOCUS_08740 15985 15212 gene locus_tag LOCUS_08750 15985 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 17586 16114 gene locus_tag LOCUS_08760 17586 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 19196 17688 gene locus_tag LOCUS_08770 19196 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 20545 19358 gene locus_tag LOCUS_08780 20545 19358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 22468 20996 gene locus_tag LOCUS_08790 22468 20996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 24078 22570 gene locus_tag LOCUS_08800 24078 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 25351 24137 gene locus_tag LOCUS_08810 25351 24137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 27133 25640 gene locus_tag LOCUS_08820 27133 25640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 27355 27227 gene locus_tag LOCUS_08830 27355 27227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 28430 27906 gene locus_tag LOCUS_08840 28430 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 29500 28526 gene locus_tag LOCUS_08850 29500 28526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 29978 30322 gene locus_tag LOCUS_08860 29978 30322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 30319 31209 gene locus_tag LOCUS_08870 30319 31209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 31342 32682 gene locus_tag LOCUS_08880 31342 32682 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_08880 34376 32703 gene locus_tag LOCUS_08890 34376 32703 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_08890 35616 34393 gene locus_tag LOCUS_08900 35616 34393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 37000 35984 gene locus_tag LOCUS_08910 37000 35984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 37383 37255 gene locus_tag LOCUS_08920 37383 37255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 38142 37462 gene locus_tag LOCUS_08930 38142 37462 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902491.1 protein_id gnl|my_center|LOCUS_08930 39332 38193 gene locus_tag LOCUS_08940 39332 38193 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583009.1 protein_id gnl|my_center|LOCUS_08940 42494 39516 gene locus_tag LOCUS_08950 42494 39516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 43501 42860 gene locus_tag LOCUS_08960 43501 42860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 44796 43417 gene locus_tag LOCUS_08970 44796 43417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 45200 44934 gene locus_tag LOCUS_08980 45200 44934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 45573 46610 gene locus_tag LOCUS_08990 45573 46610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 46647 47591 gene locus_tag LOCUS_09000 46647 47591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 47679 50087 gene locus_tag LOCUS_09010 47679 50087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 51175 50150 gene locus_tag LOCUS_09020 51175 50150 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090661.1 protein_id gnl|my_center|LOCUS_09020 51401 51192 gene locus_tag LOCUS_09030 51401 51192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 51762 54020 gene locus_tag LOCUS_09040 51762 54020 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_09040 54191 58567 gene locus_tag LOCUS_09050 54191 58567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 58601 60580 gene locus_tag LOCUS_09060 58601 60580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 61587 60604 gene locus_tag LOCUS_09070 61587 60604 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_09070 62009 62578 gene locus_tag LOCUS_09080 gene idi 62009 62578 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_09080 62664 63164 gene locus_tag LOCUS_09090 62664 63164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 63161 63844 gene locus_tag LOCUS_09100 63161 63844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 63834 65327 gene locus_tag LOCUS_09110 gene crtI 63834 65327 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_09110 65428 66909 gene locus_tag LOCUS_09120 65428 66909 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_09120 66956 67885 gene locus_tag LOCUS_09130 66956 67885 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_09130 67882 68538 gene locus_tag LOCUS_09140 gene cruD 67882 68538 CDS product hydroxychlorobactene glucoside lauroyltransferase CruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932647.1 protein_id gnl|my_center|LOCUS_09140 68568 69689 gene locus_tag LOCUS_09150 gene cruC 68568 69689 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_09150 69690 70349 gene locus_tag LOCUS_09160 69690 70349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 70346 71059 gene locus_tag LOCUS_09170 70346 71059 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530149.1 protein_id gnl|my_center|LOCUS_09170 72007 71090 gene locus_tag LOCUS_09180 72007 71090 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_09180 73202 72099 gene locus_tag LOCUS_09190 73202 72099 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_09190 73324 74109 gene locus_tag LOCUS_09200 73324 74109 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227774.1 protein_id gnl|my_center|LOCUS_09200 74785 74090 gene locus_tag LOCUS_09210 74785 74090 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617263.1 protein_id gnl|my_center|LOCUS_09210 75516 74926 gene locus_tag LOCUS_09220 gene leuD 75516 74926 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_09220 76983 75577 gene locus_tag LOCUS_09230 gene leuC 76983 75577 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_09230 78239 77091 gene locus_tag LOCUS_09240 78239 77091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_09240 80365 78563 gene locus_tag LOCUS_09250 80365 78563 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_09250 83100 80545 gene locus_tag LOCUS_09260 gene leuS 83100 80545 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775383.1 protein_id gnl|my_center|LOCUS_09260 83650 83459 gene locus_tag LOCUS_09270 83650 83459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 84221 83910 gene locus_tag LOCUS_09280 84221 83910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 85422 84409 gene locus_tag LOCUS_09290 85422 84409 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970647.1 protein_id gnl|my_center|LOCUS_09290 85745 87202 gene locus_tag LOCUS_09300 85745 87202 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_09300 87499 88368 gene locus_tag LOCUS_09310 87499 88368 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_09310 91333 88586 gene locus_tag LOCUS_09320 91333 88586 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_09320 92742 91501 gene locus_tag LOCUS_09330 92742 91501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_09330 93796 92762 gene locus_tag LOCUS_09340 93796 92762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence010 168 398 gene locus_tag LOCUS_09350 168 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1148 2698 gene locus_tag LOCUS_09360 1148 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2874 3908 gene locus_tag LOCUS_09370 2874 3908 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_09370 3927 5492 gene locus_tag LOCUS_09380 3927 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5655 6398 gene locus_tag LOCUS_09390 5655 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6540 7265 gene locus_tag LOCUS_09400 gene gldF 6540 7265 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_09400 7269 8867 gene locus_tag LOCUS_09410 7269 8867 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_09410 8864 10690 gene locus_tag LOCUS_09420 8864 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 10801 12012 gene locus_tag LOCUS_09430 10801 12012 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762377.1 protein_id gnl|my_center|LOCUS_09430 12229 12645 gene locus_tag LOCUS_09440 gene msrB 12229 12645 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144007.1 protein_id gnl|my_center|LOCUS_09440 12722 13942 gene locus_tag LOCUS_09450 12722 13942 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_09450 14122 14985 gene locus_tag LOCUS_09460 14122 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 15055 15984 gene locus_tag LOCUS_09470 15055 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 16111 16782 gene locus_tag LOCUS_09480 16111 16782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 17217 17885 gene locus_tag LOCUS_09490 17217 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 18129 19205 gene locus_tag LOCUS_09500 18129 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 19409 19969 gene locus_tag LOCUS_09510 19409 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 20104 21030 gene locus_tag LOCUS_09520 gene mdh 20104 21030 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_09520 21145 22617 gene locus_tag LOCUS_09530 21145 22617 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_09530 24606 22675 gene locus_tag LOCUS_09540 gene dnaK 24606 22675 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_09540 25847 25005 gene locus_tag LOCUS_09550 25847 25005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 26782 26060 gene locus_tag LOCUS_09560 26782 26060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 28479 26986 gene locus_tag LOCUS_09570 28479 26986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 29264 28536 gene locus_tag LOCUS_09580 29264 28536 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_09580 29739 29335 gene locus_tag LOCUS_09590 29739 29335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 30959 29766 gene locus_tag LOCUS_09600 30959 29766 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_09600 31707 31246 gene locus_tag LOCUS_09610 31707 31246 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_09610 31986 33008 gene locus_tag LOCUS_09620 gene bdhA 31986 33008 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 protein_id gnl|my_center|LOCUS_09620 33012 34406 gene locus_tag LOCUS_09630 33012 34406 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_09630 34841 34446 gene locus_tag LOCUS_09640 34841 34446 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_09640 35047 34841 gene locus_tag LOCUS_09650 35047 34841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 36343 35525 gene locus_tag LOCUS_09660 36343 35525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 36578 37390 gene locus_tag LOCUS_09670 36578 37390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 37413 38180 gene locus_tag LOCUS_09680 37413 38180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 38167 38574 gene locus_tag LOCUS_09690 38167 38574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 38595 39509 gene locus_tag LOCUS_09700 38595 39509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 41217 39604 gene locus_tag LOCUS_09710 41217 39604 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_09710 41499 42470 gene locus_tag LOCUS_09720 41499 42470 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_09720 42801 44156 gene locus_tag LOCUS_09730 gene mtaB 42801 44156 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_09730 46847 44160 gene locus_tag LOCUS_09740 gene mutS 46847 44160 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_09740 50501 47511 gene locus_tag LOCUS_09750 50501 47511 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_09750 51640 50498 gene locus_tag LOCUS_09760 51640 50498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 52659 51727 gene locus_tag LOCUS_09770 52659 51727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 53188 52838 gene locus_tag LOCUS_09780 53188 52838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 56506 53537 gene locus_tag LOCUS_09790 56506 53537 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_09790 56627 57100 gene locus_tag LOCUS_09800 56627 57100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 58805 57027 gene locus_tag LOCUS_09810 58805 57027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 59851 59231 gene locus_tag LOCUS_09820 59851 59231 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086438.1 protein_id gnl|my_center|LOCUS_09820 60097 61554 gene locus_tag LOCUS_09830 60097 61554 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_09830 61612 62478 gene locus_tag LOCUS_09840 61612 62478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 62684 64084 gene locus_tag LOCUS_09850 62684 64084 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_09850 65315 64287 gene locus_tag LOCUS_09860 65315 64287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 66752 65736 gene locus_tag LOCUS_09870 66752 65736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 68801 66873 gene locus_tag LOCUS_09880 68801 66873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 69265 68966 gene locus_tag LOCUS_09890 69265 68966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 69607 69278 gene locus_tag LOCUS_09900 69607 69278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 71112 69868 gene locus_tag LOCUS_09910 gene icd 71112 69868 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_09910 72818 71262 gene locus_tag LOCUS_09920 72818 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 73428 73721 gene locus_tag LOCUS_09930 73428 73721 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_09930 73881 75311 gene locus_tag LOCUS_09940 73881 75311 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_09940 75487 77505 gene locus_tag LOCUS_09950 gene ligA 75487 77505 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_09950 78216 77524 gene locus_tag LOCUS_09960 78216 77524 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393069.1 protein_id gnl|my_center|LOCUS_09960 78254 79132 gene locus_tag LOCUS_09970 78254 79132 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_09970 79273 80334 gene locus_tag LOCUS_09980 79273 80334 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_09980 80349 81800 gene locus_tag LOCUS_09990 80349 81800 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_09990 81806 82321 gene locus_tag LOCUS_10000 81806 82321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 82399 83199 gene locus_tag LOCUS_10010 82399 83199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 83298 84029 gene locus_tag LOCUS_10020 83298 84029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 85268 84231 gene locus_tag LOCUS_10030 85268 84231 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529637.1 protein_id gnl|my_center|LOCUS_10030 85789 85535 gene locus_tag LOCUS_10040 85789 85535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 85741 88890 gene locus_tag LOCUS_10050 85741 88890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 89768 89103 gene locus_tag LOCUS_10060 89768 89103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 <91945 90053 gene locus_tag LOCUS_10070 <91945 90053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989462.1:class 1 internalin InlA >Feature sequence011 570 319 gene locus_tag LOCUS_10080 570 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 794 3217 gene locus_tag LOCUS_10090 794 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 4208 3405 gene locus_tag LOCUS_10100 4208 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 5033 4230 gene locus_tag LOCUS_10110 5033 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7108 5288 gene locus_tag LOCUS_10120 7108 5288 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817390.1 protein_id gnl|my_center|LOCUS_10120 9387 7147 gene locus_tag LOCUS_10130 9387 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9976 9497 gene locus_tag LOCUS_10140 9976 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 10079 10282 gene locus_tag LOCUS_10150 10079 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 12022 11132 gene locus_tag LOCUS_10160 12022 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 12211 13020 gene locus_tag LOCUS_10170 12211 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 14899 13166 gene locus_tag LOCUS_10180 14899 13166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 15288 16604 gene locus_tag LOCUS_10190 15288 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 17708 17367 gene locus_tag LOCUS_10200 17708 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 18084 18929 gene locus_tag LOCUS_10210 18084 18929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 19199 21121 gene locus_tag LOCUS_10220 19199 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 21165 22655 gene locus_tag LOCUS_10230 21165 22655 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_10230 25856 22713 gene locus_tag LOCUS_10240 25856 22713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 27624 26863 gene locus_tag LOCUS_10250 gene arsM 27624 26863 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_10250 29146 27689 gene locus_tag LOCUS_10260 29146 27689 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_10260 29902 29180 gene locus_tag LOCUS_10270 29902 29180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 30339 29956 gene locus_tag LOCUS_10280 30339 29956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 30682 31257 gene locus_tag LOCUS_10290 30682 31257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10290 31404 32048 gene locus_tag LOCUS_10300 31404 32048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10300 33113 32052 gene locus_tag LOCUS_10310 33113 32052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 33657 33094 gene locus_tag LOCUS_10320 33657 33094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 33867 34904 gene locus_tag LOCUS_10330 33867 34904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 34975 36126 gene locus_tag LOCUS_10340 34975 36126 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_10340 36361 36134 gene locus_tag LOCUS_10350 36361 36134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 36645 36358 gene locus_tag LOCUS_10360 36645 36358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 37006 39051 gene locus_tag LOCUS_10370 37006 39051 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_10370 39262 40476 gene locus_tag LOCUS_10380 39262 40476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 40705 41457 gene locus_tag LOCUS_10390 40705 41457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 41755 44742 gene locus_tag LOCUS_10400 41755 44742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 45745 44966 gene locus_tag LOCUS_10410 45745 44966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 46632 45769 gene locus_tag LOCUS_10420 46632 45769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 47497 46643 gene locus_tag LOCUS_10430 47497 46643 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_10430 47820 48998 gene locus_tag LOCUS_10440 47820 48998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 49428 50870 gene locus_tag LOCUS_10450 49428 50870 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_10450 50940 51920 gene locus_tag LOCUS_10460 50940 51920 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_10460 51963 55307 gene locus_tag LOCUS_10470 51963 55307 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_10470 55403 58111 gene locus_tag LOCUS_10480 55403 58111 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_10480 58206 59087 gene locus_tag LOCUS_10490 58206 59087 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_10490 60215 59325 gene locus_tag LOCUS_10500 60215 59325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 61264 60239 gene locus_tag LOCUS_10510 61264 60239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 61596 61261 gene locus_tag LOCUS_10520 61596 61261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 61766 62188 gene locus_tag LOCUS_10530 61766 62188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 63031 63621 gene locus_tag LOCUS_10540 63031 63621 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883398.1 protein_id gnl|my_center|LOCUS_10540 63605 63991 gene locus_tag LOCUS_10550 63605 63991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 64010 64699 gene locus_tag LOCUS_10560 64010 64699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 64925 65824 gene locus_tag LOCUS_10570 64925 65824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 65867 66418 gene locus_tag LOCUS_10580 65867 66418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 66484 67086 gene locus_tag LOCUS_10590 66484 67086 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_10590 67073 67768 gene locus_tag LOCUS_10600 67073 67768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 68134 69597 gene locus_tag LOCUS_10610 68134 69597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 69608 70210 gene locus_tag LOCUS_10620 gene purN 69608 70210 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_10620 70297 71220 gene locus_tag LOCUS_10630 70297 71220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 71213 71584 gene locus_tag LOCUS_10640 71213 71584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 75532 71621 gene locus_tag LOCUS_10650 75532 71621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 77683 75605 gene locus_tag LOCUS_10660 77683 75605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 78502 79338 gene locus_tag LOCUS_10670 78502 79338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 79395 80234 gene locus_tag LOCUS_10680 79395 80234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 80345 81130 gene locus_tag LOCUS_10690 80345 81130 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_10690 81720 84302 gene locus_tag LOCUS_10700 gene clpB 81720 84302 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_10700 84524 84775 gene locus_tag LOCUS_10710 84524 84775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 84785 85159 gene locus_tag LOCUS_10720 gene mazF 84785 85159 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_10720 85172 85471 gene locus_tag LOCUS_10730 85172 85471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 85474 85737 gene locus_tag LOCUS_10740 85474 85737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 86589 87338 gene locus_tag LOCUS_10750 86589 87338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 87946 87395 gene locus_tag LOCUS_10760 87946 87395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 88533 87955 gene locus_tag LOCUS_10770 88533 87955 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_10770 88805 89605 gene locus_tag LOCUS_10780 gene trpA 88805 89605 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_10780 89642 90247 gene locus_tag LOCUS_10790 89642 90247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 90463 90257 gene locus_tag LOCUS_10800 90463 90257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence012 455 240 gene locus_tag LOCUS_10810 455 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2286 871 gene locus_tag LOCUS_10820 2286 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2906 2346 gene locus_tag LOCUS_10830 2906 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3354 2932 gene locus_tag LOCUS_10840 3354 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3620 3931 gene locus_tag LOCUS_10850 3620 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4347 4580 gene locus_tag LOCUS_10860 4347 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 6220 5486 gene locus_tag LOCUS_10870 6220 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6965 6252 gene locus_tag LOCUS_10880 6965 6252 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944972.1 protein_id gnl|my_center|LOCUS_10880 7316 7041 gene locus_tag LOCUS_10890 7316 7041 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836567.1 protein_id gnl|my_center|LOCUS_10890 8348 7461 gene locus_tag LOCUS_10900 8348 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 9376 8378 gene locus_tag LOCUS_10910 9376 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 10390 9383 gene locus_tag LOCUS_10920 10390 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 11358 10399 gene locus_tag LOCUS_10930 gene msrP 11358 10399 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_10930 12142 11900 gene locus_tag LOCUS_10940 12142 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 12491 13426 gene locus_tag LOCUS_10950 12491 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 13558 14190 gene locus_tag LOCUS_10960 13558 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 14333 15685 gene locus_tag LOCUS_10970 14333 15685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 15666 17261 gene locus_tag LOCUS_10980 15666 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 17341 19206 gene locus_tag LOCUS_10990 17341 19206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 19328 22996 gene locus_tag LOCUS_11000 19328 22996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 23043 23657 gene locus_tag LOCUS_11010 23043 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 23809 24801 gene locus_tag LOCUS_11020 23809 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 25052 26329 gene locus_tag LOCUS_11030 25052 26329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 27344 26334 gene locus_tag LOCUS_11040 27344 26334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 28674 27550 gene locus_tag LOCUS_11050 28674 27550 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037244312.1 protein_id gnl|my_center|LOCUS_11050 29884 28727 gene locus_tag LOCUS_11060 29884 28727 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_11060 30773 29976 gene locus_tag LOCUS_11070 30773 29976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 31059 30862 gene locus_tag LOCUS_11080 31059 30862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 31898 31314 gene locus_tag LOCUS_11090 31898 31314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 32493 32729 gene locus_tag LOCUS_11100 32493 32729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 33217 32759 gene locus_tag LOCUS_11110 33217 32759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 34686 33241 gene locus_tag LOCUS_11120 34686 33241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 35754 34768 gene locus_tag LOCUS_11130 gene pdhA 35754 34768 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_11130 36526 35831 gene locus_tag LOCUS_11140 36526 35831 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_11140 37559 36720 gene locus_tag LOCUS_11150 gene fabG 37559 36720 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_11150 37666 38025 gene locus_tag LOCUS_11160 37666 38025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 38037 38831 gene locus_tag LOCUS_11170 38037 38831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 39647 38850 gene locus_tag LOCUS_11180 39647 38850 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_11180 40573 39674 gene locus_tag LOCUS_11190 40573 39674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 40791 41885 gene locus_tag LOCUS_11200 40791 41885 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_11200 42057 44504 gene locus_tag LOCUS_11210 42057 44504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 45071 45280 gene locus_tag LOCUS_11220 45071 45280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 45443 46234 gene locus_tag LOCUS_11230 45443 46234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 46380 46601 gene locus_tag LOCUS_11240 46380 46601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 46676 47254 gene locus_tag LOCUS_11250 46676 47254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 47260 48066 gene locus_tag LOCUS_11260 gene thiF 47260 48066 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_11260 50473 48341 gene locus_tag LOCUS_11270 50473 48341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 51825 50647 gene locus_tag LOCUS_11280 51825 50647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 52245 51859 gene locus_tag LOCUS_11290 52245 51859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 53837 52500 gene locus_tag LOCUS_11300 53837 52500 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258743.1 protein_id gnl|my_center|LOCUS_11300 54772 53864 gene locus_tag LOCUS_11310 54772 53864 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_11310 55521 54793 gene locus_tag LOCUS_11320 55521 54793 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_11320 55896 57386 gene locus_tag LOCUS_11330 55896 57386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 57462 59063 gene locus_tag LOCUS_11340 57462 59063 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_11340 59311 60873 gene locus_tag LOCUS_11350 gene rng 59311 60873 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_11350 60994 61320 gene locus_tag LOCUS_11360 gene rplU 60994 61320 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_11360 61325 61591 gene locus_tag LOCUS_11370 gene rpmA 61325 61591 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_11370 61738 62142 gene locus_tag LOCUS_11380 61738 62142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 62153 63799 gene locus_tag LOCUS_11390 62153 63799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 63806 64093 gene locus_tag LOCUS_11400 63806 64093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 64119 65690 gene locus_tag LOCUS_11410 gene guaA 64119 65690 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_11410 66888 65713 gene locus_tag LOCUS_11420 66888 65713 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_11420 71751 67051 gene locus_tag LOCUS_11430 71751 67051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 72924 71929 gene locus_tag LOCUS_11440 72924 71929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 73590 73006 gene locus_tag LOCUS_11450 gene rpoE 73590 73006 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420724.1 protein_id gnl|my_center|LOCUS_11450 74322 73870 gene locus_tag LOCUS_11460 74322 73870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 75097 74441 gene locus_tag LOCUS_11470 75097 74441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 76129 75764 gene locus_tag LOCUS_11480 76129 75764 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_11480 77248 76244 gene locus_tag LOCUS_11490 gene dprA 77248 76244 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_11490 77587 78369 gene locus_tag LOCUS_11500 77587 78369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_11500 78362 79066 gene locus_tag LOCUS_11510 78362 79066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_11510 79229 80059 gene locus_tag LOCUS_11520 gene lgt 79229 80059 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 protein_id gnl|my_center|LOCUS_11520 80328 81059 gene locus_tag LOCUS_11530 80328 81059 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_11530 81495 81136 gene locus_tag LOCUS_11540 81495 81136 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_11540 84588 81577 gene locus_tag LOCUS_11550 84588 81577 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_11550 84761 85651 gene locus_tag LOCUS_11560 84761 85651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence013 916 125 gene locus_tag LOCUS_11570 916 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3492 1228 gene locus_tag LOCUS_11580 3492 1228 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816832.1 protein_id gnl|my_center|LOCUS_11580 5913 3514 gene locus_tag LOCUS_11590 gene lon 5913 3514 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_11590 8014 6041 gene locus_tag LOCUS_11600 8014 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 9280 8075 gene locus_tag LOCUS_11610 9280 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9938 9267 gene locus_tag LOCUS_11620 9938 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 10922 10023 gene locus_tag LOCUS_11630 10922 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 11368 11499 gene locus_tag LOCUS_11640 11368 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 11594 12985 gene locus_tag LOCUS_11650 gene fumC 11594 12985 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_11650 18900 13141 gene locus_tag LOCUS_11660 18900 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 24216 18982 gene locus_tag LOCUS_11670 24216 18982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 24553 25101 gene locus_tag LOCUS_11680 24553 25101 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_11680 25085 26266 gene locus_tag LOCUS_11690 25085 26266 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_11690 28403 26274 gene locus_tag LOCUS_11700 gene fusA 28403 26274 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_11700 29423 28425 gene locus_tag LOCUS_11710 29423 28425 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404258.1 protein_id gnl|my_center|LOCUS_11710 31107 29548 gene locus_tag LOCUS_11720 31107 29548 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_11720 31635 31285 gene locus_tag LOCUS_11730 31635 31285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 32091 32876 gene locus_tag LOCUS_11740 32091 32876 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_11740 33299 33372 gene locus_tag LOCUS_t00030 33299 33372 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 33531 34853 gene locus_tag LOCUS_11750 33531 34853 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_11750 34966 35511 gene locus_tag LOCUS_11760 34966 35511 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_11760 36019 37014 gene locus_tag LOCUS_11770 36019 37014 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_11770 37124 38062 gene locus_tag LOCUS_11780 gene fabD 37124 38062 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_11780 38068 38844 gene locus_tag LOCUS_11790 gene fabG 38068 38844 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_11790 38954 39187 gene locus_tag LOCUS_11800 gene acpP 38954 39187 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942249.1 protein_id gnl|my_center|LOCUS_11800 39412 40656 gene locus_tag LOCUS_11810 gene fabF 39412 40656 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438103.1 protein_id gnl|my_center|LOCUS_11810 40607 40876 gene locus_tag LOCUS_11820 40607 40876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 40873 41109 gene locus_tag LOCUS_11830 40873 41109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 41146 41679 gene locus_tag LOCUS_11840 gene folK 41146 41679 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_11840 42033 41746 gene locus_tag LOCUS_11850 42033 41746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 42474 43658 gene locus_tag LOCUS_11860 gene sucC 42474 43658 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_11860 43822 45012 gene locus_tag LOCUS_11870 43822 45012 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_11870 45036 46472 gene locus_tag LOCUS_11880 gene proS 45036 46472 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_11880 46612 47484 gene locus_tag LOCUS_11890 gene sucD 46612 47484 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_11890 47528 48358 gene locus_tag LOCUS_11900 gene panB 47528 48358 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082243.1 protein_id gnl|my_center|LOCUS_11900 49032 48370 gene locus_tag LOCUS_11910 49032 48370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705382.1 protein_id gnl|my_center|LOCUS_11910 49792 49025 gene locus_tag LOCUS_11920 49792 49025 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_11920 50377 49814 gene locus_tag LOCUS_11930 gene pabA 50377 49814 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 protein_id gnl|my_center|LOCUS_11930 51988 50486 gene locus_tag LOCUS_11940 gene trpE 51988 50486 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_11940 52652 52272 gene locus_tag LOCUS_11950 gene hisI 52652 52272 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403778.1 protein_id gnl|my_center|LOCUS_11950 53530 54873 gene locus_tag LOCUS_11960 53530 54873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 54916 56838 gene locus_tag LOCUS_11970 54916 56838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 56955 58652 gene locus_tag LOCUS_11980 56955 58652 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020917.1 protein_id gnl|my_center|LOCUS_11980 58745 59950 gene locus_tag LOCUS_11990 58745 59950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 60331 60134 gene locus_tag LOCUS_12000 60331 60134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 60594 60355 gene locus_tag LOCUS_12010 60594 60355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 61091 61927 gene locus_tag LOCUS_12020 61091 61927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 62162 64852 gene locus_tag LOCUS_12030 62162 64852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 64901 65467 gene locus_tag LOCUS_12040 64901 65467 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_12040 65528 67492 gene locus_tag LOCUS_12050 gene yagF 65528 67492 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_12050 67816 69030 gene locus_tag LOCUS_12060 67816 69030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 69113 69640 gene locus_tag LOCUS_12070 gene purE 69113 69640 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141251.1 protein_id gnl|my_center|LOCUS_12070 69798 70478 gene locus_tag LOCUS_12080 69798 70478 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_12080 70528 70857 gene locus_tag LOCUS_12090 70528 70857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 77372 71076 gene locus_tag LOCUS_12100 77372 71076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 78530 77493 gene locus_tag LOCUS_12110 gene pdxA 78530 77493 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392248.1 protein_id gnl|my_center|LOCUS_12110 79065 78805 gene locus_tag LOCUS_12120 79065 78805 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356255.1 protein_id gnl|my_center|LOCUS_12120 81837 79396 gene locus_tag LOCUS_12130 gene lon 81837 79396 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_12130 83483 81984 gene locus_tag LOCUS_12140 gene clpX 83483 81984 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_12140 84233 83631 gene locus_tag LOCUS_12150 gene clpP 84233 83631 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_12150 85609 84290 gene locus_tag LOCUS_12160 gene tig 85609 84290 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence014 1128 421 gene locus_tag LOCUS_12170 1128 421 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207615.1 protein_id gnl|my_center|LOCUS_12170 3511 1139 gene locus_tag LOCUS_12180 3511 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4282 3869 gene locus_tag LOCUS_12190 4282 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 5158 4337 gene locus_tag LOCUS_12200 5158 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 5570 5226 gene locus_tag LOCUS_12210 5570 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5938 5579 gene locus_tag LOCUS_12220 5938 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 6805 5969 gene locus_tag LOCUS_12230 6805 5969 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484942.1 protein_id gnl|my_center|LOCUS_12230 8289 6844 gene locus_tag LOCUS_12240 8289 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 9287 8403 gene locus_tag LOCUS_12250 9287 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9867 9301 gene locus_tag LOCUS_12260 9867 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 12508 10040 gene locus_tag LOCUS_12270 12508 10040 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944365.1 protein_id gnl|my_center|LOCUS_12270 12737 13243 gene locus_tag LOCUS_12280 12737 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 13322 13248 gene locus_tag LOCUS_t00040 13322 13248 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 13393 14229 gene locus_tag LOCUS_12290 13393 14229 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_12290 14534 15955 gene locus_tag LOCUS_12300 14534 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 15952 16944 gene locus_tag LOCUS_12310 15952 16944 CDS product CfrBI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546529.1 protein_id gnl|my_center|LOCUS_12310 16941 17621 gene locus_tag LOCUS_12320 gene tsaB 16941 17621 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_12320 17665 17937 gene locus_tag LOCUS_12330 17665 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 17934 18182 gene locus_tag LOCUS_12340 17934 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 18198 19622 gene locus_tag LOCUS_12350 18198 19622 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901985.1 protein_id gnl|my_center|LOCUS_12350 19721 22828 gene locus_tag LOCUS_12360 19721 22828 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_12360 24057 22906 gene locus_tag LOCUS_12370 24057 22906 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921367.1 protein_id gnl|my_center|LOCUS_12370 25440 24169 gene locus_tag LOCUS_12380 gene aroA 25440 24169 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445261.1 protein_id gnl|my_center|LOCUS_12380 26534 25635 gene locus_tag LOCUS_12390 26534 25635 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_12390 26982 28808 gene locus_tag LOCUS_12400 gene phoR 26982 28808 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_12400 29482 28805 gene locus_tag LOCUS_12410 gene tenA 29482 28805 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 protein_id gnl|my_center|LOCUS_12410 29560 30447 gene locus_tag LOCUS_12420 29560 30447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 31362 30553 gene locus_tag LOCUS_12430 31362 30553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 33467 31365 gene locus_tag LOCUS_12440 33467 31365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 34493 33648 gene locus_tag LOCUS_12450 34493 33648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 35011 36687 gene locus_tag LOCUS_12460 35011 36687 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_12460 36689 37177 gene locus_tag LOCUS_12470 gene tsaE 36689 37177 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_12470 37221 38309 gene locus_tag LOCUS_12480 37221 38309 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973141.1 protein_id gnl|my_center|LOCUS_12480 38331 39359 gene locus_tag LOCUS_12490 38331 39359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 39620 41563 gene locus_tag LOCUS_12500 39620 41563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 41790 42479 gene locus_tag LOCUS_12510 41790 42479 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_12510 42499 43230 gene locus_tag LOCUS_12520 42499 43230 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976186.1 protein_id gnl|my_center|LOCUS_12520 43251 44471 gene locus_tag LOCUS_12530 43251 44471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 45260 44466 gene locus_tag LOCUS_12540 45260 44466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 45425 45835 gene locus_tag LOCUS_12550 45425 45835 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_12550 47336 45990 gene locus_tag LOCUS_12560 47336 45990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 47528 48280 gene locus_tag LOCUS_12570 47528 48280 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762140.1 protein_id gnl|my_center|LOCUS_12570 49344 48499 gene locus_tag LOCUS_12580 49344 48499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 49867 50685 gene locus_tag LOCUS_12590 49867 50685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 50797 51816 gene locus_tag LOCUS_12600 50797 51816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 51829 52662 gene locus_tag LOCUS_12610 51829 52662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 52720 53487 gene locus_tag LOCUS_12620 52720 53487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 53647 54495 gene locus_tag LOCUS_12630 53647 54495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 54511 55338 gene locus_tag LOCUS_12640 54511 55338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 55430 56761 gene locus_tag LOCUS_12650 55430 56761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 56988 59882 gene locus_tag LOCUS_12660 56988 59882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 59887 60318 gene locus_tag LOCUS_12670 59887 60318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 60236 60592 gene locus_tag LOCUS_12680 60236 60592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 64440 60652 gene locus_tag LOCUS_12690 64440 60652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 65576 64524 gene locus_tag LOCUS_12700 65576 64524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 66306 65578 gene locus_tag LOCUS_12710 66306 65578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 67466 66414 gene locus_tag LOCUS_12720 gene glcK 67466 66414 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_12720 68818 67508 gene locus_tag LOCUS_12730 gene galK 68818 67508 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259543.1 protein_id gnl|my_center|LOCUS_12730 69640 68918 gene locus_tag LOCUS_12740 69640 68918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 70155 69790 gene locus_tag LOCUS_12750 70155 69790 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406877.1 protein_id gnl|my_center|LOCUS_12750 70802 70374 gene locus_tag LOCUS_12760 gene rsbW 70802 70374 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829903.1 protein_id gnl|my_center|LOCUS_12760 72365 71157 gene locus_tag LOCUS_12770 72365 71157 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_12770 74787 72358 gene locus_tag LOCUS_12780 74787 72358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 75139 74801 gene locus_tag LOCUS_12790 75139 74801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 75947 75261 gene locus_tag LOCUS_12800 gene rsmG 75947 75261 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048453.1 protein_id gnl|my_center|LOCUS_12800 77863 75959 gene locus_tag LOCUS_12810 gene mnmG 77863 75959 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_12810 78817 77903 gene locus_tag LOCUS_12820 78817 77903 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_12820 79489 78875 gene locus_tag LOCUS_12830 gene recR 79489 78875 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_12830 80001 79693 gene locus_tag LOCUS_12840 80001 79693 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_12840 81941 80139 gene locus_tag LOCUS_12850 gene dnaX 81941 80139 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence015 339 2438 gene locus_tag LOCUS_12860 339 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2492 3703 gene locus_tag LOCUS_12870 2492 3703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_12870 4066 4782 gene locus_tag LOCUS_12880 4066 4782 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_12880 6214 4916 gene locus_tag LOCUS_12890 6214 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 6402 7610 gene locus_tag LOCUS_12900 6402 7610 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_12900 7684 8577 gene locus_tag LOCUS_12910 7684 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 9445 9729 gene locus_tag LOCUS_12920 9445 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 10670 11470 gene locus_tag LOCUS_12930 10670 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 11754 13436 gene locus_tag LOCUS_12940 11754 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 13980 13441 gene locus_tag LOCUS_12950 13980 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 17214 15643 gene locus_tag LOCUS_12960 17214 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 17141 17314 gene locus_tag LOCUS_12970 17141 17314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 17683 19059 gene locus_tag LOCUS_12980 17683 19059 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_12980 19062 21032 gene locus_tag LOCUS_12990 19062 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 21176 21880 gene locus_tag LOCUS_13000 21176 21880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_13000 22077 23045 gene locus_tag LOCUS_13010 22077 23045 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065872.1 protein_id gnl|my_center|LOCUS_13010 23713 23099 gene locus_tag LOCUS_13020 gene nfuA 23713 23099 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_13020 24686 23736 gene locus_tag LOCUS_13030 24686 23736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 25481 24987 gene locus_tag LOCUS_13040 25481 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 27526 25583 gene locus_tag LOCUS_13050 gene acs 27526 25583 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_13050 28980 30926 gene locus_tag LOCUS_13060 28980 30926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 32355 30973 gene locus_tag LOCUS_13070 32355 30973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 33008 32355 gene locus_tag LOCUS_13080 33008 32355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 35098 33011 gene locus_tag LOCUS_13090 35098 33011 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_13090 36803 35511 gene locus_tag LOCUS_13100 36803 35511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 37181 36912 gene locus_tag LOCUS_13110 37181 36912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_13110 37618 37178 gene locus_tag LOCUS_13120 37618 37178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 38361 37627 gene locus_tag LOCUS_13130 38361 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 38468 39493 gene locus_tag LOCUS_13140 38468 39493 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525200.1 protein_id gnl|my_center|LOCUS_13140 39487 40995 gene locus_tag LOCUS_13150 39487 40995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 40976 41656 gene locus_tag LOCUS_13160 40976 41656 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262999.1 protein_id gnl|my_center|LOCUS_13160 42995 41667 gene locus_tag LOCUS_13170 42995 41667 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_13170 43651 42992 gene locus_tag LOCUS_13180 43651 42992 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403271.1 protein_id gnl|my_center|LOCUS_13180 43827 44249 gene locus_tag LOCUS_13190 43827 44249 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_13190 44515 44964 gene locus_tag LOCUS_13200 gene rimP 44515 44964 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_13200 45074 46417 gene locus_tag LOCUS_13210 gene nusA 45074 46417 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_13210 46816 48855 gene locus_tag LOCUS_13220 gene infB 46816 48855 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388357.1 protein_id gnl|my_center|LOCUS_13220 48936 49220 gene locus_tag LOCUS_13230 48936 49220 CDS product DUF503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964058.1 protein_id gnl|my_center|LOCUS_13230 49249 49632 gene locus_tag LOCUS_13240 gene rbfA 49249 49632 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_13240 49629 50663 gene locus_tag LOCUS_13250 49629 50663 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_13250 50668 51636 gene locus_tag LOCUS_13260 gene ribF 50668 51636 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957546.1 protein_id gnl|my_center|LOCUS_13260 51899 52189 gene locus_tag LOCUS_13270 gene rpsO 51899 52189 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409373.1 protein_id gnl|my_center|LOCUS_13270 52404 54731 gene locus_tag LOCUS_13280 gene pnp 52404 54731 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_13280 55030 55290 gene locus_tag LOCUS_13290 55030 55290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 55386 55904 gene locus_tag LOCUS_13300 55386 55904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 55988 56980 gene locus_tag LOCUS_13310 55988 56980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 57004 57756 gene locus_tag LOCUS_13320 57004 57756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 57847 58932 gene locus_tag LOCUS_13330 gene gcvT 57847 58932 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082884.1 protein_id gnl|my_center|LOCUS_13330 58965 59351 gene locus_tag LOCUS_13340 gene gcvH 58965 59351 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_13340 59470 62343 gene locus_tag LOCUS_13350 gene gcvP 59470 62343 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_13350 62356 63762 gene locus_tag LOCUS_13360 gene trkA 62356 63762 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_13360 63855 65303 gene locus_tag LOCUS_13370 63855 65303 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_13370 65320 65964 gene locus_tag LOCUS_13380 gene pdxH 65320 65964 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_13380 66659 66453 gene locus_tag LOCUS_13390 66659 66453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 66960 67637 gene locus_tag LOCUS_13400 66960 67637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 68114 68926 gene locus_tag LOCUS_13410 gene rpoH 68114 68926 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021274.1 protein_id gnl|my_center|LOCUS_13410 69565 69768 gene locus_tag LOCUS_13420 69565 69768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 69880 70077 gene locus_tag LOCUS_13430 69880 70077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 70393 71142 gene locus_tag LOCUS_13440 70393 71142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 71164 72873 gene locus_tag LOCUS_13450 71164 72873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 72941 74623 gene locus_tag LOCUS_13460 72941 74623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 74800 76422 gene locus_tag LOCUS_13470 74800 76422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 76658 77557 gene locus_tag LOCUS_13480 76658 77557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 77662 78360 gene locus_tag LOCUS_13490 77662 78360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 78357 79832 gene locus_tag LOCUS_13500 gene cpsG 78357 79832 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954427.1 protein_id gnl|my_center|LOCUS_13500 79890 80624 gene locus_tag LOCUS_13510 79890 80624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 80674 81405 gene locus_tag LOCUS_13520 80674 81405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence016 <1 683 gene locus_tag LOCUS_13530 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein 2848 941 gene locus_tag LOCUS_13540 2848 941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583190.1 protein_id gnl|my_center|LOCUS_13540 4045 2990 gene locus_tag LOCUS_13550 4045 2990 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496787.1 protein_id gnl|my_center|LOCUS_13550 4920 4054 gene locus_tag LOCUS_13560 gene sppA 4920 4054 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_13560 5649 4996 gene locus_tag LOCUS_13570 5649 4996 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_13570 7689 5671 gene locus_tag LOCUS_13580 7689 5671 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_13580 8876 7935 gene locus_tag LOCUS_13590 8876 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 9417 9223 gene locus_tag LOCUS_13600 9417 9223 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_13600 12258 9466 gene locus_tag LOCUS_13610 gene secA 12258 9466 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_13610 13396 12287 gene locus_tag LOCUS_13620 13396 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 14584 13586 gene locus_tag LOCUS_13630 14584 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 15013 14585 gene locus_tag LOCUS_13640 15013 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 15878 15177 gene locus_tag LOCUS_13650 15878 15177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 16673 15930 gene locus_tag LOCUS_13660 16673 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 17392 16697 gene locus_tag LOCUS_13670 17392 16697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 18327 17572 gene locus_tag LOCUS_13680 18327 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 19993 18392 gene locus_tag LOCUS_13690 19993 18392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 19974 20129 gene locus_tag LOCUS_13700 19974 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 20325 20251 gene locus_tag LOCUS_t00050 20325 20251 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20410 20335 gene locus_tag LOCUS_t00060 20410 20335 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 21835 20555 gene locus_tag LOCUS_13710 21835 20555 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_13710 22276 21881 gene locus_tag LOCUS_13720 gene rpsI 22276 21881 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421105.1 protein_id gnl|my_center|LOCUS_13720 22870 22433 gene locus_tag LOCUS_13730 gene rplM 22870 22433 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_13730 23485 23150 gene locus_tag LOCUS_13740 23485 23150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 24299 25492 gene locus_tag LOCUS_13750 24299 25492 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880406.1 protein_id gnl|my_center|LOCUS_13750 25511 26260 gene locus_tag LOCUS_13760 25511 26260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 26499 27035 gene locus_tag LOCUS_13770 gene hslV 26499 27035 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881090.1 protein_id gnl|my_center|LOCUS_13770 27217 28704 gene locus_tag LOCUS_13780 gene hslU 27217 28704 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932863.1 protein_id gnl|my_center|LOCUS_13780 28937 30202 gene locus_tag LOCUS_13790 28937 30202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 30260 32353 gene locus_tag LOCUS_13800 30260 32353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 32355 34439 gene locus_tag LOCUS_13810 32355 34439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 34607 36475 gene locus_tag LOCUS_13820 gene sppA 34607 36475 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_13820 36479 37285 gene locus_tag LOCUS_13830 36479 37285 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_13830 37390 38427 gene locus_tag LOCUS_13840 37390 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250381.1 protein_id gnl|my_center|LOCUS_13840 38437 38925 gene locus_tag LOCUS_13850 38437 38925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 38927 39172 gene locus_tag LOCUS_13860 38927 39172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 39179 40063 gene locus_tag LOCUS_13870 gene rimK 39179 40063 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349212.1 protein_id gnl|my_center|LOCUS_13870 40663 41829 gene locus_tag LOCUS_13880 40663 41829 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_13880 41935 43368 gene locus_tag LOCUS_13890 41935 43368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 44521 43574 gene locus_tag LOCUS_13900 44521 43574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 44836 46206 gene locus_tag LOCUS_13910 44836 46206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 46534 47298 gene locus_tag LOCUS_13920 46534 47298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 47573 50950 gene locus_tag LOCUS_13930 47573 50950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 51021 52256 gene locus_tag LOCUS_13940 51021 52256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 53794 52319 gene locus_tag LOCUS_13950 53794 52319 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040461.1 protein_id gnl|my_center|LOCUS_13950 54127 55086 gene locus_tag LOCUS_13960 54127 55086 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_13960 55158 56369 gene locus_tag LOCUS_13970 55158 56369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 56557 58017 gene locus_tag LOCUS_13980 56557 58017 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_13980 58462 59865 gene locus_tag LOCUS_13990 58462 59865 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533131.1 protein_id gnl|my_center|LOCUS_13990 61193 60048 gene locus_tag LOCUS_14000 61193 60048 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_14000 61428 62447 gene locus_tag LOCUS_14010 61428 62447 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_14010 62451 63353 gene locus_tag LOCUS_14020 62451 63353 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_14020 63534 65585 gene locus_tag LOCUS_14030 63534 65585 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_14030 65585 67873 gene locus_tag LOCUS_14040 65585 67873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_14040 67918 71313 gene locus_tag LOCUS_14050 67918 71313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922196.1 protein_id gnl|my_center|LOCUS_14050 71350 72297 gene locus_tag LOCUS_14060 71350 72297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 72366 73433 gene locus_tag LOCUS_14070 72366 73433 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_14070 73468 76002 gene locus_tag LOCUS_14080 73468 76002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 76227 78140 gene locus_tag LOCUS_14090 76227 78140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 78608 78309 gene locus_tag LOCUS_14100 78608 78309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 79477 78692 gene locus_tag LOCUS_14110 79477 78692 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970853.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence017 266 1348 gene locus_tag LOCUS_14120 266 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1357 2241 gene locus_tag LOCUS_14130 1357 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2894 2505 gene locus_tag LOCUS_14140 2894 2505 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_14140 3725 3069 gene locus_tag LOCUS_14150 3725 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4762 3722 gene locus_tag LOCUS_14160 4762 3722 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986537.1 protein_id gnl|my_center|LOCUS_14160 5588 4782 gene locus_tag LOCUS_14170 5588 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 6991 5912 gene locus_tag LOCUS_14180 6991 5912 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_14180 10501 7421 gene locus_tag LOCUS_14190 10501 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 11566 10592 gene locus_tag LOCUS_14200 11566 10592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 12607 11633 gene locus_tag LOCUS_14210 12607 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 13669 12674 gene locus_tag LOCUS_14220 13669 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 14695 13709 gene locus_tag LOCUS_14230 14695 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 15763 14762 gene locus_tag LOCUS_14240 15763 14762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 16793 15810 gene locus_tag LOCUS_14250 16793 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 17878 16901 gene locus_tag LOCUS_14260 17878 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 18775 17945 gene locus_tag LOCUS_14270 18775 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 20184 19216 gene locus_tag LOCUS_14280 20184 19216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21543 20521 gene locus_tag LOCUS_14290 21543 20521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 22790 21735 gene locus_tag LOCUS_14300 22790 21735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 23805 22810 gene locus_tag LOCUS_14310 23805 22810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 24928 23855 gene locus_tag LOCUS_14320 24928 23855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 28302 25207 gene locus_tag LOCUS_14330 28302 25207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 30869 28908 gene locus_tag LOCUS_14340 30869 28908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 32104 31013 gene locus_tag LOCUS_14350 32104 31013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 33526 32138 gene locus_tag LOCUS_14360 33526 32138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 33998 35332 gene locus_tag LOCUS_14370 33998 35332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 34058 34119 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35419 36552 gene locus_tag LOCUS_14380 35419 36552 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_14380 36574 37587 gene locus_tag LOCUS_14390 36574 37587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 37904 38542 gene locus_tag LOCUS_14400 37904 38542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 38539 39168 gene locus_tag LOCUS_14410 38539 39168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 39212 40135 gene locus_tag LOCUS_14420 39212 40135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 40167 41060 gene locus_tag LOCUS_14430 40167 41060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 41062 41658 gene locus_tag LOCUS_14440 41062 41658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 41690 42541 gene locus_tag LOCUS_14450 41690 42541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 42563 43525 gene locus_tag LOCUS_14460 42563 43525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 43560 44525 gene locus_tag LOCUS_14470 43560 44525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 46906 44522 gene locus_tag LOCUS_14480 46906 44522 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_14480 47029 49143 gene locus_tag LOCUS_14490 47029 49143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 49179 50021 gene locus_tag LOCUS_14500 gene fdhD 49179 50021 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_14500 50139 50426 gene locus_tag LOCUS_14510 50139 50426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 50497 51549 gene locus_tag LOCUS_14520 50497 51549 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967895.1 protein_id gnl|my_center|LOCUS_14520 51640 52659 gene locus_tag LOCUS_14530 gene wlbA 51640 52659 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_14530 52711 53472 gene locus_tag LOCUS_14540 52711 53472 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_14540 53741 54481 gene locus_tag LOCUS_14550 53741 54481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 55563 54769 gene locus_tag LOCUS_14560 55563 54769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 55964 55578 gene locus_tag LOCUS_14570 55964 55578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 57057 56212 gene locus_tag LOCUS_14580 57057 56212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 57991 57146 gene locus_tag LOCUS_14590 57991 57146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 59817 58132 gene locus_tag LOCUS_14600 59817 58132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 61409 59814 gene locus_tag LOCUS_14610 61409 59814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 62641 61406 gene locus_tag LOCUS_14620 62641 61406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 62823 63599 gene locus_tag LOCUS_14630 62823 63599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 63646 64155 gene locus_tag LOCUS_14640 63646 64155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 64312 65385 gene locus_tag LOCUS_14650 64312 65385 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043445520.1 protein_id gnl|my_center|LOCUS_14650 65829 65536 gene locus_tag LOCUS_14660 65829 65536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 66490 65876 gene locus_tag LOCUS_14670 66490 65876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 67107 66487 gene locus_tag LOCUS_14680 67107 66487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 67505 67164 gene locus_tag LOCUS_14690 67505 67164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 67932 69197 gene locus_tag LOCUS_14700 67932 69197 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731603.1 protein_id gnl|my_center|LOCUS_14700 69390 70199 gene locus_tag LOCUS_14710 69390 70199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 71081 70206 gene locus_tag LOCUS_14720 71081 70206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 71991 71116 gene locus_tag LOCUS_14730 71991 71116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 72597 72028 gene locus_tag LOCUS_14740 72597 72028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 73997 72603 gene locus_tag LOCUS_14750 73997 72603 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_14750 74517 74032 gene locus_tag LOCUS_14760 74517 74032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 74992 74585 gene locus_tag LOCUS_14770 74992 74585 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023352.1 protein_id gnl|my_center|LOCUS_14770 75884 75003 gene locus_tag LOCUS_14780 75884 75003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 76330 75881 gene locus_tag LOCUS_14790 76330 75881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 78098 76416 gene locus_tag LOCUS_14800 78098 76416 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_14800 78612 78166 gene locus_tag LOCUS_14810 78612 78166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 79021 78614 gene locus_tag LOCUS_14820 79021 78614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence018 4726 230 gene locus_tag LOCUS_14830 gene gltB 4726 230 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_14830 6738 5128 gene locus_tag LOCUS_14840 gene ggt 6738 5128 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133817160.1 protein_id gnl|my_center|LOCUS_14840 6984 8372 gene locus_tag LOCUS_14850 gene lpdA 6984 8372 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_14850 9274 8369 gene locus_tag LOCUS_14860 9274 8369 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_14860 10883 9621 gene locus_tag LOCUS_14870 gene ahcY 10883 9621 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_14870 12050 10926 gene locus_tag LOCUS_14880 gene metK 12050 10926 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_14880 14510 12291 gene locus_tag LOCUS_14890 14510 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 14799 15143 gene locus_tag LOCUS_14900 14799 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 15163 15618 gene locus_tag LOCUS_14910 15163 15618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 16805 15621 gene locus_tag LOCUS_14920 16805 15621 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075445.1 protein_id gnl|my_center|LOCUS_14920 17221 16802 gene locus_tag LOCUS_14930 17221 16802 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_14930 19632 17293 gene locus_tag LOCUS_14940 19632 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 20458 19697 gene locus_tag LOCUS_14950 20458 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 20900 20550 gene locus_tag LOCUS_14960 20900 20550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 21457 21110 gene locus_tag LOCUS_14970 21457 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 21847 22593 gene locus_tag LOCUS_14980 gene radC 21847 22593 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_14980 23347 22607 gene locus_tag LOCUS_14990 gene rlmB 23347 22607 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_14990 23625 23386 gene locus_tag LOCUS_15000 23625 23386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 25523 23658 gene locus_tag LOCUS_15010 gene iolD 25523 23658 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_15010 26669 25635 gene locus_tag LOCUS_15020 26669 25635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 27439 26666 gene locus_tag LOCUS_15030 27439 26666 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_15030 29388 27451 gene locus_tag LOCUS_15040 29388 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 30165 29473 gene locus_tag LOCUS_15050 gene eda 30165 29473 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_15050 30388 31737 gene locus_tag LOCUS_15060 30388 31737 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_15060 31839 33191 gene locus_tag LOCUS_15070 31839 33191 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_15070 33985 33233 gene locus_tag LOCUS_15080 33985 33233 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172835.1 protein_id gnl|my_center|LOCUS_15080 34668 34084 gene locus_tag LOCUS_15090 gene folE 34668 34084 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216616.1 protein_id gnl|my_center|LOCUS_15090 35535 34708 gene locus_tag LOCUS_15100 35535 34708 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258499.1 protein_id gnl|my_center|LOCUS_15100 35864 35571 gene locus_tag LOCUS_15110 35864 35571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 36969 36103 gene locus_tag LOCUS_15120 36969 36103 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 protein_id gnl|my_center|LOCUS_15120 37911 37207 gene locus_tag LOCUS_15130 37911 37207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 38790 38002 gene locus_tag LOCUS_15140 38790 38002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 39931 39338 gene locus_tag LOCUS_15150 39931 39338 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_15150 41274 39946 gene locus_tag LOCUS_15160 41274 39946 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921463.1 protein_id gnl|my_center|LOCUS_15160 43285 41276 gene locus_tag LOCUS_15170 43285 41276 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921462.1 protein_id gnl|my_center|LOCUS_15170 45814 43403 gene locus_tag LOCUS_15180 45814 43403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 46409 45942 gene locus_tag LOCUS_15190 46409 45942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 47197 46424 gene locus_tag LOCUS_15200 47197 46424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 47687 47202 gene locus_tag LOCUS_15210 47687 47202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 48257 47739 gene locus_tag LOCUS_15220 48257 47739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 49107 48247 gene locus_tag LOCUS_15230 49107 48247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 51207 49930 gene locus_tag LOCUS_15240 51207 49930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 51832 53076 gene locus_tag LOCUS_15250 51832 53076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 53121 53459 gene locus_tag LOCUS_15260 53121 53459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 54684 53446 gene locus_tag LOCUS_15270 54684 53446 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_15270 54790 56142 gene locus_tag LOCUS_15280 54790 56142 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_15280 56473 56117 gene locus_tag LOCUS_15290 56473 56117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 57351 59642 gene locus_tag LOCUS_15300 57351 59642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 59655 60128 gene locus_tag LOCUS_15310 59655 60128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 60130 61185 gene locus_tag LOCUS_15320 60130 61185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 61198 62217 gene locus_tag LOCUS_15330 61198 62217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 64396 62792 gene locus_tag LOCUS_15340 64396 62792 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_15340 65354 64476 gene locus_tag LOCUS_15350 65354 64476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 66223 65420 gene locus_tag LOCUS_15360 66223 65420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 67097 66327 gene locus_tag LOCUS_15370 67097 66327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 67166 67369 gene locus_tag LOCUS_15380 67166 67369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 67380 68144 gene locus_tag LOCUS_15390 67380 68144 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284299.1 protein_id gnl|my_center|LOCUS_15390 68201 69016 gene locus_tag LOCUS_15400 68201 69016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 68991 69962 gene locus_tag LOCUS_15410 68991 69962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 70636 69965 gene locus_tag LOCUS_15420 70636 69965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 70780 71322 gene locus_tag LOCUS_15430 gene msrA 70780 71322 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_15430 71354 72934 gene locus_tag LOCUS_15440 71354 72934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 74840 73065 gene locus_tag LOCUS_15450 74840 73065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 76233 76640 gene locus_tag LOCUS_15460 76233 76640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 76674 77045 gene locus_tag LOCUS_15470 76674 77045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 77050 77232 gene locus_tag LOCUS_15480 77050 77232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence019 924 154 gene locus_tag LOCUS_15490 924 154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229088.1 protein_id gnl|my_center|LOCUS_15490 1932 937 gene locus_tag LOCUS_15500 1932 937 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229087.1 protein_id gnl|my_center|LOCUS_15500 2953 1964 gene locus_tag LOCUS_15510 2953 1964 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229086.1 protein_id gnl|my_center|LOCUS_15510 3948 3226 gene locus_tag LOCUS_15520 3948 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 4313 4083 gene locus_tag LOCUS_15530 4313 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 5001 4348 gene locus_tag LOCUS_15540 5001 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 7045 5039 gene locus_tag LOCUS_15550 7045 5039 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449670.1 protein_id gnl|my_center|LOCUS_15550 7767 7066 gene locus_tag LOCUS_15560 7767 7066 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203432.1 protein_id gnl|my_center|LOCUS_15560 8363 8007 gene locus_tag LOCUS_15570 8363 8007 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258292.1 protein_id gnl|my_center|LOCUS_15570 10208 8808 gene locus_tag LOCUS_15580 10208 8808 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403605.1 protein_id gnl|my_center|LOCUS_15580 11692 10244 gene locus_tag LOCUS_15590 11692 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219770990.1 protein_id gnl|my_center|LOCUS_15590 13137 11815 gene locus_tag LOCUS_15600 13137 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036676.1 protein_id gnl|my_center|LOCUS_15600 15778 13262 gene locus_tag LOCUS_15610 15778 13262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403608.1 protein_id gnl|my_center|LOCUS_15610 16050 15799 gene locus_tag LOCUS_15620 16050 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 17548 16148 gene locus_tag LOCUS_15630 17548 16148 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457832.1 protein_id gnl|my_center|LOCUS_15630 18755 17685 gene locus_tag LOCUS_15640 18755 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 20178 18952 gene locus_tag LOCUS_15650 20178 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_15650 21799 20654 gene locus_tag LOCUS_15660 21799 20654 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061916.1 protein_id gnl|my_center|LOCUS_15660 22680 21949 gene locus_tag LOCUS_15670 22680 21949 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_15670 23866 22862 gene locus_tag LOCUS_15680 23866 22862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 24169 23945 gene locus_tag LOCUS_15690 24169 23945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 24562 24284 gene locus_tag LOCUS_15700 24562 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 24925 24662 gene locus_tag LOCUS_15710 24925 24662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 25791 24961 gene locus_tag LOCUS_15720 25791 24961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 27416 26133 gene locus_tag LOCUS_15730 27416 26133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 27578 28210 gene locus_tag LOCUS_15740 27578 28210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 28627 30975 gene locus_tag LOCUS_15750 28627 30975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 31225 32367 gene locus_tag LOCUS_15760 31225 32367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 32470 33540 gene locus_tag LOCUS_15770 32470 33540 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_15770 33568 34803 gene locus_tag LOCUS_15780 33568 34803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_15780 34968 36014 gene locus_tag LOCUS_15790 34968 36014 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_15790 36011 36826 gene locus_tag LOCUS_15800 36011 36826 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674906.1 protein_id gnl|my_center|LOCUS_15800 36844 37644 gene locus_tag LOCUS_15810 36844 37644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_15810 37821 38837 gene locus_tag LOCUS_15820 37821 38837 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_15820 38998 39771 gene locus_tag LOCUS_15830 38998 39771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 39876 40823 gene locus_tag LOCUS_15840 gene galU 39876 40823 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_15840 41539 40829 gene locus_tag LOCUS_15850 41539 40829 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_15850 42782 41658 gene locus_tag LOCUS_15860 42782 41658 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_15860 43782 42970 gene locus_tag LOCUS_15870 43782 42970 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_15870 44404 43907 gene locus_tag LOCUS_15880 44404 43907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 45600 44563 gene locus_tag LOCUS_15890 45600 44563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 47726 45738 gene locus_tag LOCUS_15900 47726 45738 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_15900 47995 47807 gene locus_tag LOCUS_15910 47995 47807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 55307 48039 gene locus_tag LOCUS_15920 55307 48039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 55795 56199 gene locus_tag LOCUS_15930 55795 56199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 57269 56205 gene locus_tag LOCUS_15940 57269 56205 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_15940 58104 57283 gene locus_tag LOCUS_15950 58104 57283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 58993 58166 gene locus_tag LOCUS_15960 58993 58166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 59428 59093 gene locus_tag LOCUS_15970 59428 59093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 63537 59563 gene locus_tag LOCUS_15980 63537 59563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 61612 61711 gene locus_tag LOCUS_t00070 61612 61711 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 64782 63637 gene locus_tag LOCUS_15990 64782 63637 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_15990 65856 64888 gene locus_tag LOCUS_16000 65856 64888 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_16000 66329 65859 gene locus_tag LOCUS_16010 66329 65859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 67903 66344 gene locus_tag LOCUS_16020 67903 66344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 68630 68073 gene locus_tag LOCUS_16030 68630 68073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 70723 68891 gene locus_tag LOCUS_16040 70723 68891 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257894.1 protein_id gnl|my_center|LOCUS_16040 71273 70830 gene locus_tag LOCUS_16050 71273 70830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 71500 71261 gene locus_tag LOCUS_16060 71500 71261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 72470 71658 gene locus_tag LOCUS_16070 72470 71658 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_16070 73281 72481 gene locus_tag LOCUS_16080 73281 72481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 74619 73516 gene locus_tag LOCUS_16090 gene dgoD 74619 73516 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_16090 74977 76203 gene locus_tag LOCUS_16100 74977 76203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 76235 77539 gene locus_tag LOCUS_16110 76235 77539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence020 1915 542 gene locus_tag LOCUS_16120 1915 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2354 3073 gene locus_tag LOCUS_16130 2354 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3203 4540 gene locus_tag LOCUS_16140 3203 4540 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_16140 5050 6414 gene locus_tag LOCUS_16150 5050 6414 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739890.1 protein_id gnl|my_center|LOCUS_16150 6731 6555 gene locus_tag LOCUS_16160 6731 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 9137 7086 gene locus_tag LOCUS_16170 9137 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_16170 9435 9220 gene locus_tag LOCUS_16180 9435 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 9795 11069 gene locus_tag LOCUS_16190 gene purD 9795 11069 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_16190 11371 11889 gene locus_tag LOCUS_16200 11371 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 11973 13181 gene locus_tag LOCUS_16210 11973 13181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 13359 14165 gene locus_tag LOCUS_16220 gene kduD 13359 14165 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 protein_id gnl|my_center|LOCUS_16220 14166 14402 gene locus_tag LOCUS_16230 14166 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 14612 14824 gene locus_tag LOCUS_16240 14612 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 14790 15731 gene locus_tag LOCUS_16250 14790 15731 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_16250 15931 17385 gene locus_tag LOCUS_16260 15931 17385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 17651 18715 gene locus_tag LOCUS_16270 gene crtE 17651 18715 CDS product geranylgeranyl diphosphate synthase CrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888034.1 protein_id gnl|my_center|LOCUS_16270 18909 19973 gene locus_tag LOCUS_16280 18909 19973 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404751.1 protein_id gnl|my_center|LOCUS_16280 20636 20133 gene locus_tag LOCUS_16290 20636 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 20925 22010 gene locus_tag LOCUS_16300 gene lptF 20925 22010 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_16300 22061 23122 gene locus_tag LOCUS_16310 22061 23122 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055867.1 protein_id gnl|my_center|LOCUS_16310 23153 23728 gene locus_tag LOCUS_16320 23153 23728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 23907 24596 gene locus_tag LOCUS_16330 23907 24596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 25600 24647 gene locus_tag LOCUS_16340 25600 24647 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174325.1 protein_id gnl|my_center|LOCUS_16340 26001 25675 gene locus_tag LOCUS_16350 26001 25675 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184916.1 protein_id gnl|my_center|LOCUS_16350 26987 26196 gene locus_tag LOCUS_16360 26987 26196 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218136709.1 protein_id gnl|my_center|LOCUS_16360 28601 27000 gene locus_tag LOCUS_16370 gene ggt 28601 27000 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_16370 29473 29889 gene locus_tag LOCUS_16380 gene nusB 29473 29889 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276210.1 protein_id gnl|my_center|LOCUS_16380 29941 31752 gene locus_tag LOCUS_16390 29941 31752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 31975 32826 gene locus_tag LOCUS_16400 31975 32826 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_16400 32833 33816 gene locus_tag LOCUS_16410 32833 33816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 34006 34887 gene locus_tag LOCUS_16420 34006 34887 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173962.1 protein_id gnl|my_center|LOCUS_16420 36180 35089 gene locus_tag LOCUS_16430 36180 35089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 39312 36370 gene locus_tag LOCUS_16440 39312 36370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 40184 39309 gene locus_tag LOCUS_16450 40184 39309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 40763 40524 gene locus_tag LOCUS_16460 40763 40524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 40962 40711 gene locus_tag LOCUS_16470 40962 40711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 41215 41856 gene locus_tag LOCUS_16480 41215 41856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 41853 42584 gene locus_tag LOCUS_16490 41853 42584 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_16490 43355 42618 gene locus_tag LOCUS_16500 43355 42618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 43579 44634 gene locus_tag LOCUS_16510 43579 44634 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_16510 44846 45745 gene locus_tag LOCUS_16520 44846 45745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 46938 45910 gene locus_tag LOCUS_16530 46938 45910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 48274 47114 gene locus_tag LOCUS_16540 48274 47114 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529510.1 protein_id gnl|my_center|LOCUS_16540 49466 48417 gene locus_tag LOCUS_16550 49466 48417 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529509.1 protein_id gnl|my_center|LOCUS_16550 49680 50540 gene locus_tag LOCUS_16560 49680 50540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 50545 51351 gene locus_tag LOCUS_16570 50545 51351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867541.1 protein_id gnl|my_center|LOCUS_16570 51735 54995 gene locus_tag LOCUS_16580 51735 54995 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_16580 55099 55488 gene locus_tag LOCUS_16590 55099 55488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 55565 56053 gene locus_tag LOCUS_16600 55565 56053 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_16600 56129 57757 gene locus_tag LOCUS_16610 56129 57757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 57772 59688 gene locus_tag LOCUS_16620 57772 59688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 59752 61479 gene locus_tag LOCUS_16630 59752 61479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 61534 61872 gene locus_tag LOCUS_16640 61534 61872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 61889 62218 gene locus_tag LOCUS_16650 61889 62218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 62215 62715 gene locus_tag LOCUS_16660 62215 62715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 63676 62756 gene locus_tag LOCUS_16670 63676 62756 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_16670 64535 63732 gene locus_tag LOCUS_16680 64535 63732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 64700 64963 gene locus_tag LOCUS_16690 gene infA 64700 64963 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_16690 65107 66096 gene locus_tag LOCUS_16700 gene rsgA 65107 66096 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_16700 66038 66865 gene locus_tag LOCUS_16710 66038 66865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 67868 68242 gene locus_tag LOCUS_16720 67868 68242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 68541 69728 gene locus_tag LOCUS_16730 68541 69728 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_16730 69729 71018 gene locus_tag LOCUS_16740 69729 71018 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133853294.1 protein_id gnl|my_center|LOCUS_16740 71289 73796 gene locus_tag LOCUS_16750 71289 73796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence021 390 3131 gene locus_tag LOCUS_16760 390 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3181 3621 gene locus_tag LOCUS_16770 gene lspA 3181 3621 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724127.1 protein_id gnl|my_center|LOCUS_16770 3813 4373 gene locus_tag LOCUS_16780 3813 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 4411 5364 gene locus_tag LOCUS_16790 gene fmt 4411 5364 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_16790 5357 6334 gene locus_tag LOCUS_16800 5357 6334 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678383.1 protein_id gnl|my_center|LOCUS_16800 6450 7016 gene locus_tag LOCUS_16810 gene rpe 6450 7016 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_16810 7060 7833 gene locus_tag LOCUS_16820 7060 7833 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_16820 8022 9146 gene locus_tag LOCUS_16830 8022 9146 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616070.1 protein_id gnl|my_center|LOCUS_16830 9702 9250 gene locus_tag LOCUS_16840 9702 9250 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_16840 9949 9695 gene locus_tag LOCUS_16850 gene moaD 9949 9695 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880693.1 protein_id gnl|my_center|LOCUS_16850 10408 11019 gene locus_tag LOCUS_16860 10408 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 11060 11419 gene locus_tag LOCUS_16870 gene folB 11060 11419 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809748.1 protein_id gnl|my_center|LOCUS_16870 11448 12605 gene locus_tag LOCUS_16880 11448 12605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 12634 13671 gene locus_tag LOCUS_16890 12634 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 13846 14400 gene locus_tag LOCUS_16900 13846 14400 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_16900 14527 14784 gene locus_tag LOCUS_16910 14527 14784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 15083 16537 gene locus_tag LOCUS_16920 15083 16537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 17853 16567 gene locus_tag LOCUS_16930 17853 16567 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932280.1 protein_id gnl|my_center|LOCUS_16930 18287 17961 gene locus_tag LOCUS_16940 gene trxA 18287 17961 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_16940 18685 19320 gene locus_tag LOCUS_16950 18685 19320 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036293.1 protein_id gnl|my_center|LOCUS_16950 19395 21515 gene locus_tag LOCUS_16960 19395 21515 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969633.1 protein_id gnl|my_center|LOCUS_16960 21527 22507 gene locus_tag LOCUS_16970 21527 22507 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_16970 22520 22759 gene locus_tag LOCUS_16980 22520 22759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 23526 24344 gene locus_tag LOCUS_16990 23526 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 24328 24687 gene locus_tag LOCUS_17000 24328 24687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 25771 24764 gene locus_tag LOCUS_17010 25771 24764 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 protein_id gnl|my_center|LOCUS_17010 26718 25987 gene locus_tag LOCUS_17020 gene fabG 26718 25987 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_17020 26944 27918 gene locus_tag LOCUS_17030 26944 27918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 28303 30834 gene locus_tag LOCUS_17040 28303 30834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 30924 31730 gene locus_tag LOCUS_17050 30924 31730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 31750 32667 gene locus_tag LOCUS_17060 31750 32667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 34248 32680 gene locus_tag LOCUS_17070 34248 32680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 35073 34264 gene locus_tag LOCUS_17080 35073 34264 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_17080 35338 36684 gene locus_tag LOCUS_17090 35338 36684 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_17090 36834 37817 gene locus_tag LOCUS_17100 36834 37817 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_17100 37842 38597 gene locus_tag LOCUS_17110 37842 38597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 38585 38842 gene locus_tag LOCUS_17120 38585 38842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 40135 38894 gene locus_tag LOCUS_17130 40135 38894 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 protein_id gnl|my_center|LOCUS_17130 41007 40180 gene locus_tag LOCUS_17140 41007 40180 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_17140 41221 42249 gene locus_tag LOCUS_17150 41221 42249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 42285 42602 gene locus_tag LOCUS_17160 42285 42602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810433.1 protein_id gnl|my_center|LOCUS_17160 42674 44272 gene locus_tag LOCUS_17170 42674 44272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 44555 46003 gene locus_tag LOCUS_17180 44555 46003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 46121 47113 gene locus_tag LOCUS_17190 46121 47113 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_17190 47129 47941 gene locus_tag LOCUS_17200 47129 47941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 48049 48666 gene locus_tag LOCUS_17210 48049 48666 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_17210 48772 49818 gene locus_tag LOCUS_17220 48772 49818 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_17220 49964 50563 gene locus_tag LOCUS_17230 49964 50563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 50582 51259 gene locus_tag LOCUS_17240 50582 51259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 51294 51896 gene locus_tag LOCUS_17250 51294 51896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 52281 53297 gene locus_tag LOCUS_17260 52281 53297 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392130.1 protein_id gnl|my_center|LOCUS_17260 53303 53755 gene locus_tag LOCUS_17270 gene ybeY 53303 53755 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_17270 53937 55205 gene locus_tag LOCUS_17280 53937 55205 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_17280 55349 55423 gene locus_tag LOCUS_t00080 55349 55423 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 55568 56353 gene locus_tag LOCUS_17290 gene recO 55568 56353 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518908.1 protein_id gnl|my_center|LOCUS_17290 56440 59508 gene locus_tag LOCUS_17300 56440 59508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 59513 59803 gene locus_tag LOCUS_17310 59513 59803 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_17310 59814 60188 gene locus_tag LOCUS_17320 59814 60188 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_17320 60334 61185 gene locus_tag LOCUS_17330 60334 61185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 61204 61830 gene locus_tag LOCUS_17340 61204 61830 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272031.1 protein_id gnl|my_center|LOCUS_17340 61860 62240 gene locus_tag LOCUS_17350 61860 62240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 62321 62791 gene locus_tag LOCUS_17360 62321 62791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 62748 62957 gene locus_tag LOCUS_17370 62748 62957 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_17370 63327 65219 gene locus_tag LOCUS_17380 63327 65219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 65248 68229 gene locus_tag LOCUS_17390 65248 68229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 68312 69418 gene locus_tag LOCUS_17400 gene porV 68312 69418 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_17400 69429 70832 gene locus_tag LOCUS_17410 69429 70832 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_17410 71153 71380 gene locus_tag LOCUS_17420 71153 71380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 71380 71787 gene locus_tag LOCUS_17430 71380 71787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence022 372 181 gene locus_tag LOCUS_17440 372 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1000 2715 gene locus_tag LOCUS_17450 1000 2715 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_17450 2712 4190 gene locus_tag LOCUS_17460 gene gltX 2712 4190 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_17460 4230 5519 gene locus_tag LOCUS_17470 4230 5519 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101025.1 protein_id gnl|my_center|LOCUS_17470 6436 5609 gene locus_tag LOCUS_17480 6436 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 8255 6807 gene locus_tag LOCUS_17490 8255 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 9236 8313 gene locus_tag LOCUS_17500 9236 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 10331 9252 gene locus_tag LOCUS_17510 10331 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 10575 11984 gene locus_tag LOCUS_17520 gene ffh 10575 11984 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_17520 12053 12457 gene locus_tag LOCUS_17530 12053 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 12524 12778 gene locus_tag LOCUS_17540 12524 12778 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_17540 12852 13580 gene locus_tag LOCUS_17550 gene trmD 12852 13580 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 protein_id gnl|my_center|LOCUS_17550 13670 14014 gene locus_tag LOCUS_17560 gene rplS 13670 14014 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_17560 14019 14636 gene locus_tag LOCUS_17570 14019 14636 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_17570 14670 15044 gene locus_tag LOCUS_17580 14670 15044 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_17580 15711 15088 gene locus_tag LOCUS_17590 15711 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 16265 15720 gene locus_tag LOCUS_17600 16265 15720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 16969 17044 gene locus_tag LOCUS_t00090 16969 17044 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17152 18036 gene locus_tag LOCUS_17610 17152 18036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 18036 18476 gene locus_tag LOCUS_17620 gene dut 18036 18476 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 protein_id gnl|my_center|LOCUS_17620 18479 19276 gene locus_tag LOCUS_17630 18479 19276 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 protein_id gnl|my_center|LOCUS_17630 19313 20122 gene locus_tag LOCUS_17640 19313 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 20150 20647 gene locus_tag LOCUS_17650 20150 20647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 20648 21142 gene locus_tag LOCUS_17660 gene dfrA 20648 21142 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637198.1 protein_id gnl|my_center|LOCUS_17660 21180 21812 gene locus_tag LOCUS_17670 21180 21812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 21838 23097 gene locus_tag LOCUS_17680 gene nagA 21838 23097 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905894.1 protein_id gnl|my_center|LOCUS_17680 23344 23715 gene locus_tag LOCUS_17690 gene rpsL 23344 23715 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656492.1 protein_id gnl|my_center|LOCUS_17690 23734 24204 gene locus_tag LOCUS_17700 gene rpsG 23734 24204 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_17700 24264 26381 gene locus_tag LOCUS_17710 gene fusA 24264 26381 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_17710 26606 27814 gene locus_tag LOCUS_17720 gene tuf 26606 27814 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_17720 28051 28362 gene locus_tag LOCUS_17730 gene rpsJ 28051 28362 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_17730 28474 29115 gene locus_tag LOCUS_17740 gene rplC 28474 29115 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173714.1 protein_id gnl|my_center|LOCUS_17740 29168 29815 gene locus_tag LOCUS_17750 gene rplD 29168 29815 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_17750 29821 30120 gene locus_tag LOCUS_17760 gene rplW 29821 30120 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_17760 30144 30959 gene locus_tag LOCUS_17770 gene rplB 30144 30959 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_17770 31022 31291 gene locus_tag LOCUS_17780 gene rpsS 31022 31291 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583349.1 protein_id gnl|my_center|LOCUS_17780 31413 31766 gene locus_tag LOCUS_17790 gene rplV 31413 31766 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549029.1 protein_id gnl|my_center|LOCUS_17790 31849 32655 gene locus_tag LOCUS_17800 gene rpsC 31849 32655 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_17800 32689 33102 gene locus_tag LOCUS_17810 gene rplP 32689 33102 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966405.1 protein_id gnl|my_center|LOCUS_17810 33187 33375 gene locus_tag LOCUS_17820 gene rpmC 33187 33375 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_17820 33844 34212 gene locus_tag LOCUS_17830 gene rplN 33844 34212 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_17830 34223 34456 gene locus_tag LOCUS_17840 34223 34456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 34546 35085 gene locus_tag LOCUS_17850 gene rplE 34546 35085 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_17850 35491 35892 gene locus_tag LOCUS_17860 gene rpsH 35491 35892 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_17860 35930 36496 gene locus_tag LOCUS_17870 gene rplF 35930 36496 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_17870 36579 36947 gene locus_tag LOCUS_17880 gene rplR 36579 36947 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943470.1 protein_id gnl|my_center|LOCUS_17880 37034 37546 gene locus_tag LOCUS_17890 gene rpsE 37034 37546 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896437.1 protein_id gnl|my_center|LOCUS_17890 37763 38239 gene locus_tag LOCUS_17900 gene rplO 37763 38239 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_17900 38270 39601 gene locus_tag LOCUS_17910 gene secY 38270 39601 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_17910 40086 40478 gene locus_tag LOCUS_17920 gene rpsM 40086 40478 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_17920 40674 41045 gene locus_tag LOCUS_17930 gene rpsK 40674 41045 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_17930 41055 41690 gene locus_tag LOCUS_17940 gene rpsD 41055 41690 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_17940 42061 43080 gene locus_tag LOCUS_17950 42061 43080 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_17950 43114 43518 gene locus_tag LOCUS_17960 gene rplQ 43114 43518 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049717.1 protein_id gnl|my_center|LOCUS_17960 44989 43709 gene locus_tag LOCUS_17970 44989 43709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 45387 45142 gene locus_tag LOCUS_17980 45387 45142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 45965 46882 gene locus_tag LOCUS_17990 45965 46882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 46892 48814 gene locus_tag LOCUS_18000 46892 48814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 48941 49771 gene locus_tag LOCUS_18010 48941 49771 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_18010 50611 49760 gene locus_tag LOCUS_18020 50611 49760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 50956 51750 gene locus_tag LOCUS_18030 50956 51750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 51789 52766 gene locus_tag LOCUS_18040 51789 52766 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_18040 52845 53015 gene locus_tag LOCUS_18050 52845 53015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 53123 54109 gene locus_tag LOCUS_18060 53123 54109 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_18060 55346 54177 gene locus_tag LOCUS_18070 55346 54177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 56647 55616 gene locus_tag LOCUS_18080 56647 55616 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868678.1 protein_id gnl|my_center|LOCUS_18080 57026 58168 gene locus_tag LOCUS_18090 57026 58168 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_18090 60365 58425 gene locus_tag LOCUS_18100 60365 58425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 60519 61661 gene locus_tag LOCUS_18110 60519 61661 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969230.1 protein_id gnl|my_center|LOCUS_18110 61892 61668 gene locus_tag LOCUS_18120 61892 61668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 62854 61907 gene locus_tag LOCUS_18130 62854 61907 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_18130 63751 66438 gene locus_tag LOCUS_18140 63751 66438 CDS product DUF5695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084882.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence023 628 170 gene locus_tag LOCUS_18150 gene smpB 628 170 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259157.1 protein_id gnl|my_center|LOCUS_18150 862 2148 gene locus_tag LOCUS_18160 gene hflX 862 2148 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_18160 2224 4140 gene locus_tag LOCUS_18170 2224 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 4343 4591 gene locus_tag LOCUS_18180 4343 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 4588 5379 gene locus_tag LOCUS_18190 4588 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 5508 5424 gene locus_tag LOCUS_t00100 5508 5424 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5597 6448 gene locus_tag LOCUS_18200 5597 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 7517 6336 gene locus_tag LOCUS_18210 7517 6336 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_18210 11435 8346 gene locus_tag LOCUS_18220 11435 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 11786 12130 gene locus_tag LOCUS_18230 11786 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 12145 12852 gene locus_tag LOCUS_18240 12145 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 12956 13441 gene locus_tag LOCUS_18250 12956 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 13438 13782 gene locus_tag LOCUS_18260 13438 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 16672 14051 gene locus_tag LOCUS_18270 16672 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 18784 16910 gene locus_tag LOCUS_18280 gene uvrC 18784 16910 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_18280 19415 18828 gene locus_tag LOCUS_18290 19415 18828 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_18290 20145 19441 gene locus_tag LOCUS_18300 gene trmB 20145 19441 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334207.1 protein_id gnl|my_center|LOCUS_18300 20926 20168 gene locus_tag LOCUS_18310 20926 20168 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_18310 23682 20968 gene locus_tag LOCUS_18320 gene glnD 23682 20968 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_18320 24104 25126 gene locus_tag LOCUS_18330 24104 25126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 25180 26907 gene locus_tag LOCUS_18340 25180 26907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 27511 28299 gene locus_tag LOCUS_18350 27511 28299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 28336 29283 gene locus_tag LOCUS_18360 28336 29283 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_18360 29505 30329 gene locus_tag LOCUS_18370 29505 30329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 30482 31228 gene locus_tag LOCUS_18380 30482 31228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 31419 32873 gene locus_tag LOCUS_18390 31419 32873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 33514 34563 gene locus_tag LOCUS_18400 33514 34563 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_18400 34683 35666 gene locus_tag LOCUS_18410 34683 35666 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_18410 35775 36902 gene locus_tag LOCUS_18420 35775 36902 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_18420 36980 37570 gene locus_tag LOCUS_18430 36980 37570 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_18430 37784 39043 gene locus_tag LOCUS_18440 37784 39043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 39305 40687 gene locus_tag LOCUS_18450 39305 40687 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_18450 40722 41729 gene locus_tag LOCUS_18460 40722 41729 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030183075.1 protein_id gnl|my_center|LOCUS_18460 41783 42976 gene locus_tag LOCUS_18470 gene trpB 41783 42976 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_18470 43135 43344 gene locus_tag LOCUS_18480 43135 43344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 43345 43599 gene locus_tag LOCUS_18490 43345 43599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_18490 43726 44340 gene locus_tag LOCUS_18500 43726 44340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 44503 45417 gene locus_tag LOCUS_18510 gene era 44503 45417 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080230.1 protein_id gnl|my_center|LOCUS_18510 45557 51376 gene locus_tag LOCUS_18520 45557 51376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 51550 52410 gene locus_tag LOCUS_18530 51550 52410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 52470 53357 gene locus_tag LOCUS_18540 52470 53357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 53534 54283 gene locus_tag LOCUS_18550 53534 54283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 54610 55725 gene locus_tag LOCUS_18560 gene solA 54610 55725 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_18560 55722 57191 gene locus_tag LOCUS_18570 55722 57191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 59160 57229 gene locus_tag LOCUS_18580 59160 57229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 59629 60741 gene locus_tag LOCUS_18590 gene dnaN 59629 60741 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_18590 61858 60914 gene locus_tag LOCUS_18600 61858 60914 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_18600 62973 61855 gene locus_tag LOCUS_18610 62973 61855 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683404.1 protein_id gnl|my_center|LOCUS_18610 63909 63064 gene locus_tag LOCUS_18620 gene nadC 63909 63064 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_18620 64984 64070 gene locus_tag LOCUS_18630 64984 64070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 <65894 65105 gene locus_tag LOCUS_18640 <65894 65105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141145.1:glycerol acyltransferase >Feature sequence024 483 1457 gene locus_tag LOCUS_18650 483 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1494 1784 gene locus_tag LOCUS_18660 1494 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1875 2204 gene locus_tag LOCUS_18670 1875 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2812 3927 gene locus_tag LOCUS_18680 2812 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3954 4145 gene locus_tag LOCUS_18690 3954 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4054 5274 gene locus_tag LOCUS_18700 4054 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 6521 7345 gene locus_tag LOCUS_18710 6521 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 7588 8415 gene locus_tag LOCUS_18720 7588 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 8646 9917 gene locus_tag LOCUS_18730 8646 9917 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731603.1 protein_id gnl|my_center|LOCUS_18730 10437 12302 gene locus_tag LOCUS_18740 10437 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 12854 12435 gene locus_tag LOCUS_18750 12854 12435 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_18750 13190 13903 gene locus_tag LOCUS_18760 13190 13903 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189570.1 protein_id gnl|my_center|LOCUS_18760 13906 15234 gene locus_tag LOCUS_18770 13906 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 15517 16749 gene locus_tag LOCUS_18780 gene thrC 15517 16749 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_18780 16862 17431 gene locus_tag LOCUS_18790 16862 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 17631 20021 gene locus_tag LOCUS_18800 17631 20021 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_18800 20832 21404 gene locus_tag LOCUS_18810 20832 21404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 21648 22394 gene locus_tag LOCUS_18820 21648 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 22442 23986 gene locus_tag LOCUS_18830 22442 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 24123 25265 gene locus_tag LOCUS_18840 24123 25265 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_18840 26869 25391 gene locus_tag LOCUS_18850 26869 25391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 27098 28267 gene locus_tag LOCUS_18860 gene rhmD 27098 28267 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297916.1 protein_id gnl|my_center|LOCUS_18860 28269 29237 gene locus_tag LOCUS_18870 28269 29237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 29242 30978 gene locus_tag LOCUS_18880 29242 30978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 31184 31546 gene locus_tag LOCUS_18890 31184 31546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 31795 32559 gene locus_tag LOCUS_18900 31795 32559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 34413 32647 gene locus_tag LOCUS_18910 34413 32647 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256397.1 protein_id gnl|my_center|LOCUS_18910 35427 34501 gene locus_tag LOCUS_18920 35427 34501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 36499 35651 gene locus_tag LOCUS_18930 36499 35651 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_18930 37697 36594 gene locus_tag LOCUS_18940 37697 36594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 38807 37788 gene locus_tag LOCUS_18950 gene yiaK 38807 37788 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869006.1 protein_id gnl|my_center|LOCUS_18950 39065 41458 gene locus_tag LOCUS_18960 39065 41458 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372678.1 protein_id gnl|my_center|LOCUS_18960 42342 41485 gene locus_tag LOCUS_18970 42342 41485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 42518 43891 gene locus_tag LOCUS_18980 42518 43891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 protein_id gnl|my_center|LOCUS_18980 43978 45336 gene locus_tag LOCUS_18990 43978 45336 CDS product CUAEP/CCAEP-tail radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257877.1 protein_id gnl|my_center|LOCUS_18990 45468 46220 gene locus_tag LOCUS_19000 45468 46220 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065272.1 protein_id gnl|my_center|LOCUS_19000 46355 47164 gene locus_tag LOCUS_19010 46355 47164 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_19010 47261 47713 gene locus_tag LOCUS_19020 47261 47713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 48992 47910 gene locus_tag LOCUS_19030 48992 47910 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_19030 49512 50057 gene locus_tag LOCUS_19040 49512 50057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 50223 51092 gene locus_tag LOCUS_19050 50223 51092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 51987 51127 gene locus_tag LOCUS_19060 51987 51127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 52948 52181 gene locus_tag LOCUS_19070 52948 52181 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888848.1 protein_id gnl|my_center|LOCUS_19070 53188 54402 gene locus_tag LOCUS_19080 53188 54402 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_19080 55778 54444 gene locus_tag LOCUS_19090 55778 54444 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_19090 56093 57238 gene locus_tag LOCUS_19100 gene dgoD 56093 57238 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_19100 58022 57276 gene locus_tag LOCUS_19110 58022 57276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 58400 58077 gene locus_tag LOCUS_19120 58400 58077 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226613.1 protein_id gnl|my_center|LOCUS_19120 62592 58735 gene locus_tag LOCUS_19130 62592 58735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 <65774 62686 gene locus_tag LOCUS_19140 <65774 62686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010725349.1:glycine--tRNA ligase >Feature sequence025 403 642 gene locus_tag LOCUS_19150 403 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1576 1675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2730 5672 gene locus_tag LOCUS_19160 2730 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5702 6133 gene locus_tag LOCUS_19170 5702 6133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6764 6147 gene locus_tag LOCUS_19180 6764 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7587 8798 gene locus_tag LOCUS_19190 7587 8798 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_19190 9075 9275 gene locus_tag LOCUS_19200 9075 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 9306 10265 gene locus_tag LOCUS_19210 9306 10265 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_19210 10412 12580 gene locus_tag LOCUS_19220 10412 12580 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_19220 12806 13999 gene locus_tag LOCUS_19230 12806 13999 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_19230 14910 13996 gene locus_tag LOCUS_19240 gene murB 14910 13996 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_19240 15437 15928 gene locus_tag LOCUS_19250 15437 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 18581 16128 gene locus_tag LOCUS_19260 18581 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 19771 18614 gene locus_tag LOCUS_19270 19771 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 21239 20079 gene locus_tag LOCUS_19280 21239 20079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 22891 21413 gene locus_tag LOCUS_19290 22891 21413 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_19290 26870 23055 gene locus_tag LOCUS_19300 26870 23055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 27854 27084 gene locus_tag LOCUS_19310 27854 27084 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_19310 28901 27858 gene locus_tag LOCUS_19320 28901 27858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 29909 29070 gene locus_tag LOCUS_19330 29909 29070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 30284 31198 gene locus_tag LOCUS_19340 30284 31198 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_19340 31217 32392 gene locus_tag LOCUS_19350 gene bioF 31217 32392 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_19350 32529 32942 gene locus_tag LOCUS_19360 32529 32942 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253940.1 protein_id gnl|my_center|LOCUS_19360 32964 34202 gene locus_tag LOCUS_19370 32964 34202 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_19370 34328 35467 gene locus_tag LOCUS_19380 34328 35467 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_19380 35464 36075 gene locus_tag LOCUS_19390 35464 36075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 36370 37272 gene locus_tag LOCUS_19400 36370 37272 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_19400 38171 37317 gene locus_tag LOCUS_19410 38171 37317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 38864 38175 gene locus_tag LOCUS_19420 gene rpiA 38864 38175 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_19420 39056 40012 gene locus_tag LOCUS_19430 39056 40012 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903551.1 protein_id gnl|my_center|LOCUS_19430 40056 41363 gene locus_tag LOCUS_19440 gene pepP 40056 41363 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_19440 41405 42094 gene locus_tag LOCUS_19450 41405 42094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 42181 42747 gene locus_tag LOCUS_19460 42181 42747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 42781 43278 gene locus_tag LOCUS_19470 42781 43278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 43393 43950 gene locus_tag LOCUS_19480 gene rpoE 43393 43950 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658683.1 protein_id gnl|my_center|LOCUS_19480 43966 44688 gene locus_tag LOCUS_19490 43966 44688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 44925 45965 gene locus_tag LOCUS_19500 44925 45965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584052.1 protein_id gnl|my_center|LOCUS_19500 45979 46977 gene locus_tag LOCUS_19510 45979 46977 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082545.1 protein_id gnl|my_center|LOCUS_19510 47187 48992 gene locus_tag LOCUS_19520 47187 48992 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582700.1 protein_id gnl|my_center|LOCUS_19520 49207 50133 gene locus_tag LOCUS_19530 49207 50133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584054.1 protein_id gnl|my_center|LOCUS_19530 50126 51229 gene locus_tag LOCUS_19540 50126 51229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082547.1 protein_id gnl|my_center|LOCUS_19540 51347 52174 gene locus_tag LOCUS_19550 gene fabG 51347 52174 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_19550 53119 52190 gene locus_tag LOCUS_19560 53119 52190 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_19560 53378 54817 gene locus_tag LOCUS_19570 53378 54817 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011190648.1 protein_id gnl|my_center|LOCUS_19570 55743 54931 gene locus_tag LOCUS_19580 55743 54931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 55872 56573 gene locus_tag LOCUS_19590 55872 56573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 56563 57501 gene locus_tag LOCUS_19600 56563 57501 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929692.1 protein_id gnl|my_center|LOCUS_19600 57494 58168 gene locus_tag LOCUS_19610 57494 58168 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088191.1 protein_id gnl|my_center|LOCUS_19610 58274 59248 gene locus_tag LOCUS_19620 58274 59248 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024326.1 protein_id gnl|my_center|LOCUS_19620 59366 60235 gene locus_tag LOCUS_19630 59366 60235 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404098.1 protein_id gnl|my_center|LOCUS_19630 60340 60816 gene locus_tag LOCUS_19640 60340 60816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 60756 60968 gene locus_tag LOCUS_19650 60756 60968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 60911 62251 gene locus_tag LOCUS_19660 gene ahbD 60911 62251 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_19660 62312 63037 gene locus_tag LOCUS_19670 62312 63037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 63091 63810 gene locus_tag LOCUS_19680 63091 63810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 63955 64368 gene locus_tag LOCUS_19690 63955 64368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 64580 64960 gene locus_tag LOCUS_19700 64580 64960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence026 990 166 gene locus_tag LOCUS_19710 990 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2013 1141 gene locus_tag LOCUS_19720 2013 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 3052 2069 gene locus_tag LOCUS_19730 3052 2069 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_19730 3992 3156 gene locus_tag LOCUS_19740 3992 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5122 4049 gene locus_tag LOCUS_19750 5122 4049 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583847.1 protein_id gnl|my_center|LOCUS_19750 5330 6355 gene locus_tag LOCUS_19760 gene iolG 5330 6355 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_19760 7100 6372 gene locus_tag LOCUS_19770 7100 6372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_19770 7878 7201 gene locus_tag LOCUS_19780 7878 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 8165 8725 gene locus_tag LOCUS_19790 8165 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 9499 8750 gene locus_tag LOCUS_19800 gene larB 9499 8750 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964094.1 protein_id gnl|my_center|LOCUS_19800 10030 9620 gene locus_tag LOCUS_19810 10030 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 10824 10207 gene locus_tag LOCUS_19820 10824 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 13553 10896 gene locus_tag LOCUS_19830 gene alaS 13553 10896 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_19830 14326 13646 gene locus_tag LOCUS_19840 14326 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 15109 14477 gene locus_tag LOCUS_19850 15109 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 15285 15797 gene locus_tag LOCUS_19860 gene coaD 15285 15797 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_19860 18168 15856 gene locus_tag LOCUS_19870 18168 15856 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_19870 18526 18714 gene locus_tag LOCUS_19880 18526 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 18795 19796 gene locus_tag LOCUS_19890 18795 19796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 19958 20722 gene locus_tag LOCUS_19900 19958 20722 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327800.1 protein_id gnl|my_center|LOCUS_19900 20722 21492 gene locus_tag LOCUS_19910 20722 21492 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_19910 21760 22755 gene locus_tag LOCUS_19920 21760 22755 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_19920 22797 25292 gene locus_tag LOCUS_19930 22797 25292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 25340 26314 gene locus_tag LOCUS_19940 25340 26314 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_19940 26880 26359 gene locus_tag LOCUS_19950 26880 26359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 27753 28709 gene locus_tag LOCUS_19960 27753 28709 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228899.1 protein_id gnl|my_center|LOCUS_19960 29004 29462 gene locus_tag LOCUS_19970 29004 29462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 29563 30096 gene locus_tag LOCUS_19980 29563 30096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 30197 31120 gene locus_tag LOCUS_19990 30197 31120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 31038 31709 gene locus_tag LOCUS_20000 31038 31709 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_20000 31936 33573 gene locus_tag LOCUS_20010 31936 33573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 33549 35267 gene locus_tag LOCUS_20020 33549 35267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 35430 35714 gene locus_tag LOCUS_20030 35430 35714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 36004 36750 gene locus_tag LOCUS_20040 36004 36750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 36762 38384 gene locus_tag LOCUS_20050 gene gpmI 36762 38384 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_20050 38419 38739 gene locus_tag LOCUS_20060 38419 38739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 38837 39832 gene locus_tag LOCUS_20070 38837 39832 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173595.1 protein_id gnl|my_center|LOCUS_20070 39867 40958 gene locus_tag LOCUS_20080 39867 40958 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_20080 41021 41881 gene locus_tag LOCUS_20090 41021 41881 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_20090 42176 42015 gene locus_tag LOCUS_20100 42176 42015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 42386 42195 gene locus_tag LOCUS_20110 42386 42195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 42712 42551 gene locus_tag LOCUS_20120 42712 42551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 42943 42731 gene locus_tag LOCUS_20130 42943 42731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 44127 43387 gene locus_tag LOCUS_20140 44127 43387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 44271 45017 gene locus_tag LOCUS_20150 44271 45017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 45024 45980 gene locus_tag LOCUS_20160 45024 45980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 45985 47304 gene locus_tag LOCUS_20170 45985 47304 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_20170 47301 47579 gene locus_tag LOCUS_20180 47301 47579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 47649 47906 gene locus_tag LOCUS_20190 47649 47906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 47930 48742 gene locus_tag LOCUS_20200 47930 48742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 48769 49755 gene locus_tag LOCUS_20210 48769 49755 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229937.1 protein_id gnl|my_center|LOCUS_20210 50656 49895 gene locus_tag LOCUS_20220 50656 49895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 51791 50658 gene locus_tag LOCUS_20230 51791 50658 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_20230 52727 51939 gene locus_tag LOCUS_20240 52727 51939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 53606 52803 gene locus_tag LOCUS_20250 53606 52803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 54319 56175 gene locus_tag LOCUS_20260 54319 56175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 56297 57700 gene locus_tag LOCUS_20270 56297 57700 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_20270 57779 59386 gene locus_tag LOCUS_20280 57779 59386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 59607 61193 gene locus_tag LOCUS_20290 59607 61193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 61442 62965 gene locus_tag LOCUS_20300 gene galK 61442 62965 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816804.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence027 2615 666 gene locus_tag LOCUS_20310 2615 666 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201781412.1 protein_id gnl|my_center|LOCUS_20310 2996 3916 gene locus_tag LOCUS_20320 gene moeB 2996 3916 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970838.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20320 3938 4183 gene locus_tag LOCUS_20330 3938 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20330 4218 4460 gene locus_tag LOCUS_20340 4218 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4580 5284 gene locus_tag LOCUS_20350 4580 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 5597 6214 gene locus_tag LOCUS_20360 gene cysC 5597 6214 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643136.1 protein_id gnl|my_center|LOCUS_20360 6269 7087 gene locus_tag LOCUS_20370 6269 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 7115 8068 gene locus_tag LOCUS_20380 7115 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 8081 9208 gene locus_tag LOCUS_20390 8081 9208 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_20390 9208 9528 gene locus_tag LOCUS_20400 9208 9528 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173319.1 protein_id gnl|my_center|LOCUS_20400 9625 10803 gene locus_tag LOCUS_20410 9625 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 10905 12479 gene locus_tag LOCUS_20420 10905 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 12493 13467 gene locus_tag LOCUS_20430 12493 13467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 14577 13546 gene locus_tag LOCUS_20440 14577 13546 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_20440 15115 15696 gene locus_tag LOCUS_20450 gene rpoE 15115 15696 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_20450 15712 16335 gene locus_tag LOCUS_20460 15712 16335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 16338 18329 gene locus_tag LOCUS_20470 16338 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 19708 18326 gene locus_tag LOCUS_20480 19708 18326 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880656.1 protein_id gnl|my_center|LOCUS_20480 22050 19705 gene locus_tag LOCUS_20490 22050 19705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 23718 22324 gene locus_tag LOCUS_20500 23718 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 25448 23841 gene locus_tag LOCUS_20510 25448 23841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 26986 25628 gene locus_tag LOCUS_20520 gene accC 26986 25628 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_20520 27686 27168 gene locus_tag LOCUS_20530 gene accB 27686 27168 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009516.1 protein_id gnl|my_center|LOCUS_20530 28447 27890 gene locus_tag LOCUS_20540 gene efp 28447 27890 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_20540 29425 28715 gene locus_tag LOCUS_20550 29425 28715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20550 30158 29400 gene locus_tag LOCUS_20560 gene rph 30158 29400 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_20560 30624 30397 gene locus_tag LOCUS_20570 30624 30397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 31531 30614 gene locus_tag LOCUS_20580 31531 30614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 33795 31648 gene locus_tag LOCUS_20590 33795 31648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 34881 33910 gene locus_tag LOCUS_20600 34881 33910 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_20600 36861 34921 gene locus_tag LOCUS_20610 36861 34921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 37349 37008 gene locus_tag LOCUS_20620 37349 37008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 37947 37516 gene locus_tag LOCUS_20630 37947 37516 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892343.1 protein_id gnl|my_center|LOCUS_20630 38264 39163 gene locus_tag LOCUS_20640 38264 39163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 39763 39209 gene locus_tag LOCUS_20650 39763 39209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 40412 39822 gene locus_tag LOCUS_20660 40412 39822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 41050 40445 gene locus_tag LOCUS_20670 41050 40445 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257063.1 protein_id gnl|my_center|LOCUS_20670 41732 41511 gene locus_tag LOCUS_20680 41732 41511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 41628 44681 gene locus_tag LOCUS_20690 41628 44681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 44987 45793 gene locus_tag LOCUS_20700 44987 45793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 45843 47237 gene locus_tag LOCUS_20710 45843 47237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 47310 48131 gene locus_tag LOCUS_20720 47310 48131 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_20720 48161 50557 gene locus_tag LOCUS_20730 gene purL 48161 50557 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120422.1 protein_id gnl|my_center|LOCUS_20730 50617 51420 gene locus_tag LOCUS_20740 gene purQ 50617 51420 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256638.1 protein_id gnl|my_center|LOCUS_20740 51488 51844 gene locus_tag LOCUS_20750 51488 51844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 51820 53574 gene locus_tag LOCUS_20760 51820 53574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 53766 53975 gene locus_tag LOCUS_20770 53766 53975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 54048 54452 gene locus_tag LOCUS_20780 54048 54452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 54470 54967 gene locus_tag LOCUS_20790 54470 54967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 54992 55840 gene locus_tag LOCUS_20800 54992 55840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 55943 57109 gene locus_tag LOCUS_20810 55943 57109 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_20810 57109 57486 gene locus_tag LOCUS_20820 57109 57486 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730101.1 protein_id gnl|my_center|LOCUS_20820 57707 58480 gene locus_tag LOCUS_20830 57707 58480 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584085.1 protein_id gnl|my_center|LOCUS_20830 58504 59007 gene locus_tag LOCUS_20840 58504 59007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 59029 59484 gene locus_tag LOCUS_20850 59029 59484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 59622 60065 gene locus_tag LOCUS_20860 59622 60065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 60102 60824 gene locus_tag LOCUS_20870 60102 60824 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249637.1 protein_id gnl|my_center|LOCUS_20870 60876 61877 gene locus_tag LOCUS_20880 60876 61877 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_20880 61878 63374 gene locus_tag LOCUS_20890 61878 63374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence028 122 1132 gene locus_tag LOCUS_20900 122 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1342 3654 gene locus_tag LOCUS_20910 1342 3654 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_20910 4584 3661 gene locus_tag LOCUS_20920 4584 3661 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_20920 5025 4642 gene locus_tag LOCUS_20930 5025 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 6258 5041 gene locus_tag LOCUS_20940 6258 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 7341 6316 gene locus_tag LOCUS_20950 7341 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 8364 7399 gene locus_tag LOCUS_20960 8364 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 9407 8370 gene locus_tag LOCUS_20970 gene rfbB 9407 8370 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_20970 9894 10832 gene locus_tag LOCUS_20980 9894 10832 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_20980 10843 11148 gene locus_tag LOCUS_20990 10843 11148 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_20990 11413 12105 gene locus_tag LOCUS_21000 11413 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 12311 13543 gene locus_tag LOCUS_21010 12311 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 14489 13638 gene locus_tag LOCUS_21020 14489 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 15460 14567 gene locus_tag LOCUS_21030 gene garR 15460 14567 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771929.1 protein_id gnl|my_center|LOCUS_21030 15789 16817 gene locus_tag LOCUS_21040 15789 16817 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_21040 16906 17922 gene locus_tag LOCUS_21050 16906 17922 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_21050 18163 19002 gene locus_tag LOCUS_21060 18163 19002 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941197.1 protein_id gnl|my_center|LOCUS_21060 19007 19213 gene locus_tag LOCUS_21070 gene copZ 19007 19213 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832344.1 protein_id gnl|my_center|LOCUS_21070 19357 20646 gene locus_tag LOCUS_21080 gene obgE 19357 20646 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_21080 20597 21763 gene locus_tag LOCUS_21090 gene proB 20597 21763 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_21090 22560 21811 gene locus_tag LOCUS_21100 22560 21811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 23161 22565 gene locus_tag LOCUS_21110 23161 22565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 23922 24131 gene locus_tag LOCUS_21120 23922 24131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 24941 24165 gene locus_tag LOCUS_21130 24941 24165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_21130 25247 26509 gene locus_tag LOCUS_21140 25247 26509 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_21140 26638 27066 gene locus_tag LOCUS_21150 26638 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 28315 27227 gene locus_tag LOCUS_21160 28315 27227 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_21160 29106 28459 gene locus_tag LOCUS_21170 29106 28459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 29320 30225 gene locus_tag LOCUS_21180 29320 30225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 31090 30251 gene locus_tag LOCUS_21190 31090 30251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 31155 33194 gene locus_tag LOCUS_21200 31155 33194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 33852 33355 gene locus_tag LOCUS_21210 33852 33355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 34014 35024 gene locus_tag LOCUS_21220 gene trpD 34014 35024 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_21220 35120 35899 gene locus_tag LOCUS_21230 gene trpC 35120 35899 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_21230 36385 36026 gene locus_tag LOCUS_21240 36385 36026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 37124 36447 gene locus_tag LOCUS_21250 37124 36447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 40077 37129 gene locus_tag LOCUS_21260 40077 37129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 41066 40104 gene locus_tag LOCUS_21270 gene rbsK 41066 40104 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_21270 41344 42924 gene locus_tag LOCUS_21280 41344 42924 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_21280 43018 43836 gene locus_tag LOCUS_21290 43018 43836 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_21290 43892 44308 gene locus_tag LOCUS_21300 43892 44308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 44488 46944 gene locus_tag LOCUS_21310 44488 46944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_21310 47027 47536 gene locus_tag LOCUS_21320 47027 47536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 47691 48815 gene locus_tag LOCUS_21330 47691 48815 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980657.1 protein_id gnl|my_center|LOCUS_21330 48872 49609 gene locus_tag LOCUS_21340 48872 49609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 49820 50284 gene locus_tag LOCUS_21350 49820 50284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 50313 50960 gene locus_tag LOCUS_21360 50313 50960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 51070 52194 gene locus_tag LOCUS_21370 51070 52194 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928643.1 protein_id gnl|my_center|LOCUS_21370 53114 52257 gene locus_tag LOCUS_21380 53114 52257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 54373 53207 gene locus_tag LOCUS_21390 54373 53207 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_21390 55741 54575 gene locus_tag LOCUS_21400 55741 54575 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_21400 55960 56961 gene locus_tag LOCUS_21410 55960 56961 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118196.1 protein_id gnl|my_center|LOCUS_21410 56972 58162 gene locus_tag LOCUS_21420 56972 58162 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_21420 58394 58185 gene locus_tag LOCUS_21430 58394 58185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 58782 58564 gene locus_tag LOCUS_21440 58782 58564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21440 59005 58748 gene locus_tag LOCUS_21450 59005 58748 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_21450 60144 59080 gene locus_tag LOCUS_21460 60144 59080 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398939.1 protein_id gnl|my_center|LOCUS_21460 61440 60178 gene locus_tag LOCUS_21470 61440 60178 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_21470 63065 61488 gene locus_tag LOCUS_21480 63065 61488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 63630 62959 gene locus_tag LOCUS_21490 63630 62959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence029 610 945 gene locus_tag LOCUS_21500 610 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 959 1675 gene locus_tag LOCUS_21510 959 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1688 4738 gene locus_tag LOCUS_21520 1688 4738 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_21520 4829 7990 gene locus_tag LOCUS_21530 4829 7990 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_21530 8288 8413 gene locus_tag LOCUS_21540 8288 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 8644 9711 gene locus_tag LOCUS_21550 gene pheA 8644 9711 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_21550 9711 10841 gene locus_tag LOCUS_21560 gene queG 9711 10841 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819425.1 protein_id gnl|my_center|LOCUS_21560 10864 11484 gene locus_tag LOCUS_21570 10864 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 11735 14512 gene locus_tag LOCUS_21580 11735 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 14618 15721 gene locus_tag LOCUS_21590 14618 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 15768 16670 gene locus_tag LOCUS_21600 15768 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 19316 16809 gene locus_tag LOCUS_21610 19316 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 20082 19345 gene locus_tag LOCUS_21620 20082 19345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 20424 20867 gene locus_tag LOCUS_21630 20424 20867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 21681 20941 gene locus_tag LOCUS_21640 21681 20941 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_21640 22086 22901 gene locus_tag LOCUS_21650 22086 22901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 23995 22916 gene locus_tag LOCUS_21660 23995 22916 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090631.1 protein_id gnl|my_center|LOCUS_21660 25568 24207 gene locus_tag LOCUS_21670 25568 24207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 25983 25597 gene locus_tag LOCUS_21680 25983 25597 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_21680 26792 25980 gene locus_tag LOCUS_21690 26792 25980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 27010 27843 gene locus_tag LOCUS_21700 27010 27843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 29182 28019 gene locus_tag LOCUS_21710 29182 28019 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966124.1 protein_id gnl|my_center|LOCUS_21710 30189 29218 gene locus_tag LOCUS_21720 30189 29218 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528474.1 protein_id gnl|my_center|LOCUS_21720 31811 30324 gene locus_tag LOCUS_21730 31811 30324 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508949.1 protein_id gnl|my_center|LOCUS_21730 32105 32953 gene locus_tag LOCUS_21740 32105 32953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 33158 34186 gene locus_tag LOCUS_21750 33158 34186 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_21750 34810 34412 gene locus_tag LOCUS_21760 gene queF 34810 34412 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_21760 35738 34842 gene locus_tag LOCUS_21770 gene prmC 35738 34842 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_21770 36832 35765 gene locus_tag LOCUS_21780 gene prfA 36832 35765 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_21780 37181 36966 gene locus_tag LOCUS_21790 gene rpmE 37181 36966 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632496.1 protein_id gnl|my_center|LOCUS_21790 38616 37285 gene locus_tag LOCUS_21800 gene rho 38616 37285 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179608.1 protein_id gnl|my_center|LOCUS_21800 41259 39274 gene locus_tag LOCUS_21810 41259 39274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 42460 41324 gene locus_tag LOCUS_21820 42460 41324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 43334 42594 gene locus_tag LOCUS_21830 43334 42594 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_21830 45336 43504 gene locus_tag LOCUS_21840 45336 43504 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_21840 46196 45384 gene locus_tag LOCUS_21850 46196 45384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_21850 47123 46386 gene locus_tag LOCUS_21860 47123 46386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 48092 47205 gene locus_tag LOCUS_21870 48092 47205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 49000 48170 gene locus_tag LOCUS_21880 49000 48170 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651943.1 protein_id gnl|my_center|LOCUS_21880 49132 49731 gene locus_tag LOCUS_21890 49132 49731 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390240.1 protein_id gnl|my_center|LOCUS_21890 49731 50945 gene locus_tag LOCUS_21900 gene rhaI 49731 50945 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_21900 51003 51962 gene locus_tag LOCUS_21910 51003 51962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 52744 52049 gene locus_tag LOCUS_21920 52744 52049 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_21920 53662 54144 gene locus_tag LOCUS_21930 53662 54144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 54367 57999 gene locus_tag LOCUS_21940 gene smc 54367 57999 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478987.1 protein_id gnl|my_center|LOCUS_21940 58022 58990 gene locus_tag LOCUS_21950 58022 58990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 59308 59051 gene locus_tag LOCUS_21960 59308 59051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 60003 59308 gene locus_tag LOCUS_21970 60003 59308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 62805 60019 gene locus_tag LOCUS_21980 gene recG 62805 60019 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence030 <1 607 gene locus_tag LOCUS_21990 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099258551.1:cadherin domain-containing protein 1125 2417 gene locus_tag LOCUS_22000 1125 2417 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_22000 2532 3131 gene locus_tag LOCUS_22010 2532 3131 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_22010 3118 3324 gene locus_tag LOCUS_22020 3118 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 3404 5671 gene locus_tag LOCUS_22030 3404 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 5778 6551 gene locus_tag LOCUS_22040 5778 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 6568 7698 gene locus_tag LOCUS_22050 6568 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 9545 7833 gene locus_tag LOCUS_22060 9545 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 9960 11396 gene locus_tag LOCUS_22070 gene hisS 9960 11396 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_22070 11455 12234 gene locus_tag LOCUS_22080 11455 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 12355 13686 gene locus_tag LOCUS_22090 gene hisS 12355 13686 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258794.1 protein_id gnl|my_center|LOCUS_22090 13738 14925 gene locus_tag LOCUS_22100 13738 14925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 15649 15320 gene locus_tag LOCUS_22110 15649 15320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 15901 15665 gene locus_tag LOCUS_22120 15901 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 16764 15997 gene locus_tag LOCUS_22130 16764 15997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 18254 16863 gene locus_tag LOCUS_22140 18254 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 18466 18284 gene locus_tag LOCUS_22150 18466 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 20912 18477 gene locus_tag LOCUS_22160 20912 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 21994 21023 gene locus_tag LOCUS_22170 21994 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 22170 22352 gene locus_tag LOCUS_22180 22170 22352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 22475 23203 gene locus_tag LOCUS_22190 22475 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 24405 23230 gene locus_tag LOCUS_22200 24405 23230 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_22200 25576 24638 gene locus_tag LOCUS_22210 25576 24638 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004530.1 protein_id gnl|my_center|LOCUS_22210 26146 25661 gene locus_tag LOCUS_22220 26146 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 27734 26829 gene locus_tag LOCUS_22230 27734 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 29556 27820 gene locus_tag LOCUS_22240 29556 27820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 30713 29643 gene locus_tag LOCUS_22250 30713 29643 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_22250 30941 30741 gene locus_tag LOCUS_22260 30941 30741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 31163 33595 gene locus_tag LOCUS_22270 31163 33595 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_22270 33618 34667 gene locus_tag LOCUS_22280 33618 34667 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_22280 34978 36327 gene locus_tag LOCUS_22290 34978 36327 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_22290 36961 36479 gene locus_tag LOCUS_22300 36961 36479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 39143 37233 gene locus_tag LOCUS_22310 39143 37233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 41264 39180 gene locus_tag LOCUS_22320 41264 39180 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_22320 42069 41302 gene locus_tag LOCUS_22330 42069 41302 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_22330 43159 42107 gene locus_tag LOCUS_22340 43159 42107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 44142 43336 gene locus_tag LOCUS_22350 44142 43336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 46888 44309 gene locus_tag LOCUS_22360 46888 44309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 47998 46997 gene locus_tag LOCUS_22370 47998 46997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 49012 48089 gene locus_tag LOCUS_22380 49012 48089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22380 49032 49131 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51490 51983 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgcgtcaagtttgcgagtggtgtgatgtc 53644 52277 gene locus_tag LOCUS_22390 53644 52277 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_22390 54425 53898 gene locus_tag LOCUS_22400 54425 53898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 57368 54435 gene locus_tag LOCUS_22410 57368 54435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence031 221 583 gene locus_tag LOCUS_22420 221 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 734 1879 gene locus_tag LOCUS_22430 734 1879 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_22430 2018 2545 gene locus_tag LOCUS_22440 2018 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3909 2533 gene locus_tag LOCUS_22450 3909 2533 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038799.1 protein_id gnl|my_center|LOCUS_22450 5452 3914 gene locus_tag LOCUS_22460 5452 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 6456 5524 gene locus_tag LOCUS_22470 6456 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 6734 8920 gene locus_tag LOCUS_22480 6734 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 9035 10159 gene locus_tag LOCUS_22490 9035 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 10284 11486 gene locus_tag LOCUS_22500 10284 11486 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_22500 11572 12423 gene locus_tag LOCUS_22510 11572 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 12564 12875 gene locus_tag LOCUS_22520 12564 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 13435 14247 gene locus_tag LOCUS_22530 13435 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 15831 14389 gene locus_tag LOCUS_22540 15831 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 16617 15886 gene locus_tag LOCUS_22550 16617 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 17697 16633 gene locus_tag LOCUS_22560 17697 16633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 18603 17887 gene locus_tag LOCUS_22570 18603 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 19709 18867 gene locus_tag LOCUS_22580 19709 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 20090 20146 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21209 20511 gene locus_tag LOCUS_22590 21209 20511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 21163 21172 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22069 21266 gene locus_tag LOCUS_22600 22069 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 23531 22071 gene locus_tag LOCUS_22610 23531 22071 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839239.1 protein_id gnl|my_center|LOCUS_22610 24185 23556 gene locus_tag LOCUS_22620 gene thiE 24185 23556 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404299.1 protein_id gnl|my_center|LOCUS_22620 24292 24927 gene locus_tag LOCUS_22630 24292 24927 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_22630 25843 24983 gene locus_tag LOCUS_22640 25843 24983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 26763 25846 gene locus_tag LOCUS_22650 26763 25846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 27254 26760 gene locus_tag LOCUS_22660 gene cvpA 27254 26760 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262102.1 protein_id gnl|my_center|LOCUS_22660 28383 27292 gene locus_tag LOCUS_22670 28383 27292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 29019 28402 gene locus_tag LOCUS_22680 29019 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 29475 29041 gene locus_tag LOCUS_22690 29475 29041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 29494 29539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30991 29891 gene locus_tag LOCUS_22700 gene truD 30991 29891 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941188.1 protein_id gnl|my_center|LOCUS_22700 31256 32515 gene locus_tag LOCUS_22710 31256 32515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 32537 33883 gene locus_tag LOCUS_22720 gene bioA 32537 33883 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144314.1 protein_id gnl|my_center|LOCUS_22720 36085 33950 gene locus_tag LOCUS_22730 36085 33950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 38113 36272 gene locus_tag LOCUS_22740 38113 36272 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_22740 38843 40384 gene locus_tag LOCUS_22750 gene glpK 38843 40384 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_22750 40386 42095 gene locus_tag LOCUS_22760 40386 42095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 42128 43519 gene locus_tag LOCUS_22770 42128 43519 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_22770 43920 43603 gene locus_tag LOCUS_22780 43920 43603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 44191 43889 gene locus_tag LOCUS_22790 44191 43889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 44662 44219 gene locus_tag LOCUS_22800 44662 44219 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329766.1 protein_id gnl|my_center|LOCUS_22800 46770 44740 gene locus_tag LOCUS_22810 46770 44740 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_22810 47291 49033 gene locus_tag LOCUS_22820 gene shc 47291 49033 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_22820 49040 49726 gene locus_tag LOCUS_22830 49040 49726 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_22830 50732 49761 gene locus_tag LOCUS_22840 50732 49761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 51870 51004 gene locus_tag LOCUS_22850 51870 51004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 52834 51962 gene locus_tag LOCUS_22860 52834 51962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 53644 52916 gene locus_tag LOCUS_22870 53644 52916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence032 90 989 gene locus_tag LOCUS_22880 gene lipA 90 989 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_22880 2412 1771 gene locus_tag LOCUS_22890 2412 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3236 4966 gene locus_tag LOCUS_22900 3236 4966 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_22900 4987 5862 gene locus_tag LOCUS_22910 4987 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 5859 6812 gene locus_tag LOCUS_22920 5859 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 7030 7836 gene locus_tag LOCUS_22930 gene dapB 7030 7836 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_22930 7867 8676 gene locus_tag LOCUS_22940 gene dapB 7867 8676 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_22940 8807 10714 gene locus_tag LOCUS_22950 8807 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 10747 11490 gene locus_tag LOCUS_22960 10747 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 11572 12186 gene locus_tag LOCUS_22970 11572 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 12300 13475 gene locus_tag LOCUS_22980 12300 13475 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_22980 13691 17572 gene locus_tag LOCUS_22990 13691 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 19557 17638 gene locus_tag LOCUS_23000 19557 17638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 22112 19683 gene locus_tag LOCUS_23010 22112 19683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 22658 23494 gene locus_tag LOCUS_23020 22658 23494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 23575 25371 gene locus_tag LOCUS_23030 23575 25371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 26506 25361 gene locus_tag LOCUS_23040 26506 25361 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_23040 26952 26509 gene locus_tag LOCUS_23050 26952 26509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 27367 27732 gene locus_tag LOCUS_23060 27367 27732 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 protein_id gnl|my_center|LOCUS_23060 27887 28915 gene locus_tag LOCUS_23070 27887 28915 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_23070 29013 29783 gene locus_tag LOCUS_23080 29013 29783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 29822 31219 gene locus_tag LOCUS_23090 29822 31219 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_23090 31251 32270 gene locus_tag LOCUS_23100 31251 32270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 32426 33709 gene locus_tag LOCUS_23110 32426 33709 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_23110 33810 35195 gene locus_tag LOCUS_23120 33810 35195 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_23120 36313 35225 gene locus_tag LOCUS_23130 36313 35225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 37687 36428 gene locus_tag LOCUS_23140 37687 36428 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784326.1 protein_id gnl|my_center|LOCUS_23140 38781 37888 gene locus_tag LOCUS_23150 38781 37888 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039135.1 protein_id gnl|my_center|LOCUS_23150 39516 38800 gene locus_tag LOCUS_23160 39516 38800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 40705 39662 gene locus_tag LOCUS_23170 40705 39662 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086741.1 protein_id gnl|my_center|LOCUS_23170 45018 41068 gene locus_tag LOCUS_23180 45018 41068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 45924 46514 gene locus_tag LOCUS_23190 45924 46514 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_23190 46966 46613 gene locus_tag LOCUS_23200 46966 46613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 48030 47206 gene locus_tag LOCUS_23210 48030 47206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 48858 48127 gene locus_tag LOCUS_23220 48858 48127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 52975 48878 gene locus_tag LOCUS_23230 52975 48878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 54300 53017 gene locus_tag LOCUS_23240 54300 53017 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028539.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence033 778 2139 gene locus_tag LOCUS_23250 778 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 2142 3407 gene locus_tag LOCUS_23260 2142 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3468 4265 gene locus_tag LOCUS_23270 3468 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4680 4366 gene locus_tag LOCUS_23280 4680 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 5175 4690 gene locus_tag LOCUS_23290 5175 4690 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_23290 6460 5195 gene locus_tag LOCUS_23300 6460 5195 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_23300 6702 6520 gene locus_tag LOCUS_23310 6702 6520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 7766 6981 gene locus_tag LOCUS_23320 7766 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 8419 7877 gene locus_tag LOCUS_23330 8419 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 11485 8459 gene locus_tag LOCUS_23340 11485 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 13682 11841 gene locus_tag LOCUS_23350 13682 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 14461 13802 gene locus_tag LOCUS_23360 14461 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 15481 14480 gene locus_tag LOCUS_23370 15481 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 16367 15771 gene locus_tag LOCUS_23380 16367 15771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 17436 16516 gene locus_tag LOCUS_23390 17436 16516 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976936.1 protein_id gnl|my_center|LOCUS_23390 18293 17496 gene locus_tag LOCUS_23400 18293 17496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 19224 18400 gene locus_tag LOCUS_23410 19224 18400 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777099.1 protein_id gnl|my_center|LOCUS_23410 19600 19373 gene locus_tag LOCUS_23420 19600 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 20381 19626 gene locus_tag LOCUS_23430 20381 19626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444927.1 protein_id gnl|my_center|LOCUS_23430 22777 20480 gene locus_tag LOCUS_23440 22777 20480 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258859.1 protein_id gnl|my_center|LOCUS_23440 23433 22954 gene locus_tag LOCUS_23450 23433 22954 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_23450 24377 23529 gene locus_tag LOCUS_23460 24377 23529 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_23460 25756 24512 gene locus_tag LOCUS_23470 25756 24512 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_23470 26535 25870 gene locus_tag LOCUS_23480 26535 25870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 26757 27584 gene locus_tag LOCUS_23490 26757 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 27597 28358 gene locus_tag LOCUS_23500 27597 28358 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251678.1 protein_id gnl|my_center|LOCUS_23500 29103 28384 gene locus_tag LOCUS_23510 29103 28384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23510 29412 29125 gene locus_tag LOCUS_23520 29412 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 30447 29638 gene locus_tag LOCUS_23530 30447 29638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 31943 30507 gene locus_tag LOCUS_23540 31943 30507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 32283 33098 gene locus_tag LOCUS_23550 32283 33098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 33391 35835 gene locus_tag LOCUS_23560 33391 35835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 36052 36714 gene locus_tag LOCUS_23570 36052 36714 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_23570 36825 37772 gene locus_tag LOCUS_23580 gene porV 36825 37772 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_23580 37789 39174 gene locus_tag LOCUS_23590 37789 39174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 39496 40659 gene locus_tag LOCUS_23600 39496 40659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 40807 41979 gene locus_tag LOCUS_23610 40807 41979 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_23610 42089 43036 gene locus_tag LOCUS_23620 gene thrB 42089 43036 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_23620 43143 45956 gene locus_tag LOCUS_23630 43143 45956 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294372.1 protein_id gnl|my_center|LOCUS_23630 47996 46017 gene locus_tag LOCUS_23640 47996 46017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 48309 49145 gene locus_tag LOCUS_23650 48309 49145 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480324.1 protein_id gnl|my_center|LOCUS_23650 49239 50006 gene locus_tag LOCUS_23660 49239 50006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 50134 51006 gene locus_tag LOCUS_23670 gene rsgA 50134 51006 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_23670 51715 51026 gene locus_tag LOCUS_23680 51715 51026 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence034 121 3231 gene locus_tag LOCUS_23690 121 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3406 4011 gene locus_tag LOCUS_23700 3406 4011 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 protein_id gnl|my_center|LOCUS_23700 4625 6301 gene locus_tag LOCUS_23710 gene ilvB 4625 6301 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880257.1 protein_id gnl|my_center|LOCUS_23710 6629 7126 gene locus_tag LOCUS_23720 gene ilvN 6629 7126 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_23720 7257 8249 gene locus_tag LOCUS_23730 gene ilvC 7257 8249 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_23730 8301 8735 gene locus_tag LOCUS_23740 8301 8735 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 protein_id gnl|my_center|LOCUS_23740 8900 10021 gene locus_tag LOCUS_23750 8900 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 11174 10041 gene locus_tag LOCUS_23760 11174 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 11603 12451 gene locus_tag LOCUS_23770 11603 12451 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_23770 13246 12524 gene locus_tag LOCUS_23780 13246 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 14756 13287 gene locus_tag LOCUS_23790 14756 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 16279 14792 gene locus_tag LOCUS_23800 16279 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 17614 16352 gene locus_tag LOCUS_23810 17614 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 18688 17888 gene locus_tag LOCUS_23820 18688 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 19912 18719 gene locus_tag LOCUS_23830 19912 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 20966 19941 gene locus_tag LOCUS_23840 20966 19941 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_23840 22565 20973 gene locus_tag LOCUS_23850 22565 20973 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_23850 22777 24078 gene locus_tag LOCUS_23860 22777 24078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_23860 24462 26462 gene locus_tag LOCUS_23870 24462 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 30327 26470 gene locus_tag LOCUS_23880 30327 26470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 30528 32165 gene locus_tag LOCUS_23890 30528 32165 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 protein_id gnl|my_center|LOCUS_23890 32492 33532 gene locus_tag LOCUS_23900 gene mtnA 32492 33532 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_23900 34840 33554 gene locus_tag LOCUS_23910 34840 33554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 35375 36316 gene locus_tag LOCUS_23920 35375 36316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 36325 36894 gene locus_tag LOCUS_23930 36325 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 37588 37331 gene locus_tag LOCUS_23940 37588 37331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 38080 37856 gene locus_tag LOCUS_23950 38080 37856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 38109 40688 gene locus_tag LOCUS_23960 38109 40688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 40648 42855 gene locus_tag LOCUS_23970 40648 42855 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_23970 43484 44773 gene locus_tag LOCUS_23980 43484 44773 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_23980 44835 45311 gene locus_tag LOCUS_23990 44835 45311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 45477 46091 gene locus_tag LOCUS_24000 45477 46091 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680233.1 protein_id gnl|my_center|LOCUS_24000 46173 47588 gene locus_tag LOCUS_24010 46173 47588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 47590 47958 gene locus_tag LOCUS_24020 47590 47958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 48097 48348 gene locus_tag LOCUS_24030 48097 48348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 48739 49134 gene locus_tag LOCUS_24040 48739 49134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 49577 49164 gene locus_tag LOCUS_24050 49577 49164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 50735 49728 gene locus_tag LOCUS_24060 50735 49728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 51325 50777 gene locus_tag LOCUS_24070 51325 50777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence035 1887 928 gene locus_tag LOCUS_24080 1887 928 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073550.1 protein_id gnl|my_center|LOCUS_24080 2470 1904 gene locus_tag LOCUS_24090 2470 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 3813 3100 gene locus_tag LOCUS_24100 3813 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 4576 3815 gene locus_tag LOCUS_24110 4576 3815 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_24110 6098 4653 gene locus_tag LOCUS_24120 gene gatB 6098 4653 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_24120 6961 6188 gene locus_tag LOCUS_24130 6961 6188 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004889.1 protein_id gnl|my_center|LOCUS_24130 7459 9492 gene locus_tag LOCUS_24140 7459 9492 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 protein_id gnl|my_center|LOCUS_24140 11274 9556 gene locus_tag LOCUS_24150 gene nadB 11274 9556 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_24150 11851 11390 gene locus_tag LOCUS_24160 11851 11390 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_24160 14522 11853 gene locus_tag LOCUS_24170 14522 11853 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_24170 15130 14570 gene locus_tag LOCUS_24180 gene raiA 15130 14570 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938920.1 protein_id gnl|my_center|LOCUS_24180 17111 15228 gene locus_tag LOCUS_24190 17111 15228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 18058 17258 gene locus_tag LOCUS_24200 gene lptB 18058 17258 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_24200 19127 18282 gene locus_tag LOCUS_24210 19127 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 19860 19186 gene locus_tag LOCUS_24220 19860 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 20554 19757 gene locus_tag LOCUS_24230 20554 19757 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_24230 20928 22247 gene locus_tag LOCUS_24240 20928 22247 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_24240 22362 23213 gene locus_tag LOCUS_24250 22362 23213 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_24250 23288 26251 gene locus_tag LOCUS_24260 23288 26251 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672241.1 protein_id gnl|my_center|LOCUS_24260 27288 26338 gene locus_tag LOCUS_24270 27288 26338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 27684 28124 gene locus_tag LOCUS_24280 27684 28124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 28219 29793 gene locus_tag LOCUS_24290 28219 29793 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_24290 29797 30576 gene locus_tag LOCUS_24300 29797 30576 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546419.1 protein_id gnl|my_center|LOCUS_24300 30612 31655 gene locus_tag LOCUS_24310 30612 31655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 31659 32387 gene locus_tag LOCUS_24320 31659 32387 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391476.1 protein_id gnl|my_center|LOCUS_24320 33342 32554 gene locus_tag LOCUS_24330 33342 32554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 33531 34313 gene locus_tag LOCUS_24340 33531 34313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 34596 34751 gene locus_tag LOCUS_24350 34596 34751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 34736 35200 gene locus_tag LOCUS_24360 34736 35200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 35490 36131 gene locus_tag LOCUS_24370 gene pyrR 35490 36131 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_24370 36128 37426 gene locus_tag LOCUS_24380 36128 37426 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_24380 37524 38615 gene locus_tag LOCUS_24390 gene carA 37524 38615 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_24390 38760 42032 gene locus_tag LOCUS_24400 gene carB 38760 42032 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_24400 42126 42899 gene locus_tag LOCUS_24410 42126 42899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 43621 42968 gene locus_tag LOCUS_24420 43621 42968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 43926 45362 gene locus_tag LOCUS_24430 43926 45362 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_24430 46221 45406 gene locus_tag LOCUS_24440 gene nagB 46221 45406 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246480.1 protein_id gnl|my_center|LOCUS_24440 47028 46240 gene locus_tag LOCUS_24450 47028 46240 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_24450 48348 47059 gene locus_tag LOCUS_24460 48348 47059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 48831 48493 gene locus_tag LOCUS_24470 48831 48493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 48812 48821 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence036 141 302 gene locus_tag LOCUS_24480 141 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 356 3130 gene locus_tag LOCUS_24490 356 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3242 4351 gene locus_tag LOCUS_24500 3242 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 4439 5542 gene locus_tag LOCUS_24510 gene hisC 4439 5542 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_24510 6814 5537 gene locus_tag LOCUS_24520 6814 5537 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_24520 7687 9066 gene locus_tag LOCUS_24530 gene dnaA 7687 9066 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_24530 9587 10966 gene locus_tag LOCUS_24540 gene recF 9587 10966 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475454.1 protein_id gnl|my_center|LOCUS_24540 10975 11466 gene locus_tag LOCUS_24550 10975 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 11688 14234 gene locus_tag LOCUS_24560 gene gyrB 11688 14234 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_24560 14562 17090 gene locus_tag LOCUS_24570 gene gyrA 14562 17090 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_24570 17134 18828 gene locus_tag LOCUS_24580 17134 18828 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_24580 19101 20645 gene locus_tag LOCUS_24590 19101 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 20755 21720 gene locus_tag LOCUS_24600 20755 21720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_24600 21999 22766 gene locus_tag LOCUS_24610 21999 22766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 23550 23059 gene locus_tag LOCUS_24620 23550 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 24046 25029 gene locus_tag LOCUS_24630 24046 25029 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_24630 25109 31444 gene locus_tag LOCUS_24640 25109 31444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 31692 32690 gene locus_tag LOCUS_24650 31692 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 33460 32783 gene locus_tag LOCUS_24660 33460 32783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 34221 33514 gene locus_tag LOCUS_24670 34221 33514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 35860 34235 gene locus_tag LOCUS_24680 35860 34235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 36781 35906 gene locus_tag LOCUS_24690 36781 35906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 38037 36841 gene locus_tag LOCUS_24700 gene anmK 38037 36841 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_24700 39350 38151 gene locus_tag LOCUS_24710 39350 38151 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_24710 40386 39355 gene locus_tag LOCUS_24720 40386 39355 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963505.1 protein_id gnl|my_center|LOCUS_24720 40627 40992 gene locus_tag LOCUS_24730 40627 40992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 41012 42568 gene locus_tag LOCUS_24740 41012 42568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 42700 44793 gene locus_tag LOCUS_24750 42700 44793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 44836 46251 gene locus_tag LOCUS_24760 44836 46251 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_24760 46307 46741 gene locus_tag LOCUS_24770 46307 46741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 47161 47688 gene locus_tag LOCUS_24780 47161 47688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence037 1842 622 gene locus_tag LOCUS_24790 1842 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2718 1915 gene locus_tag LOCUS_24800 2718 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2933 3790 gene locus_tag LOCUS_24810 2933 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3811 4683 gene locus_tag LOCUS_24820 3811 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4677 5495 gene locus_tag LOCUS_24830 4677 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 5760 7394 gene locus_tag LOCUS_24840 5760 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 7395 8585 gene locus_tag LOCUS_24850 7395 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 8624 9151 gene locus_tag LOCUS_24860 8624 9151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 9245 9931 gene locus_tag LOCUS_24870 gene queC 9245 9931 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_24870 9952 10659 gene locus_tag LOCUS_24880 9952 10659 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980712.1 protein_id gnl|my_center|LOCUS_24880 10677 11375 gene locus_tag LOCUS_24890 10677 11375 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980712.1 protein_id gnl|my_center|LOCUS_24890 11383 12093 gene locus_tag LOCUS_24900 11383 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 14967 12148 gene locus_tag LOCUS_24910 14967 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 19461 15070 gene locus_tag LOCUS_24920 19461 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 22330 19538 gene locus_tag LOCUS_24930 22330 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 23827 23324 gene locus_tag LOCUS_24940 23827 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 24091 23915 gene locus_tag LOCUS_24950 24091 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 24898 24212 gene locus_tag LOCUS_24960 24898 24212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 26197 24920 gene locus_tag LOCUS_24970 26197 24920 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_24970 27032 26280 gene locus_tag LOCUS_24980 27032 26280 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 protein_id gnl|my_center|LOCUS_24980 27605 28648 gene locus_tag LOCUS_24990 gene argC 27605 28648 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_24990 28827 29981 gene locus_tag LOCUS_25000 gene lpxB 28827 29981 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_25000 30122 31231 gene locus_tag LOCUS_25010 gene lpxK 30122 31231 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_25010 33943 31424 gene locus_tag LOCUS_25020 33943 31424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 34819 33959 gene locus_tag LOCUS_25030 34819 33959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 38389 34916 gene locus_tag LOCUS_25040 38389 34916 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_25040 39340 38624 gene locus_tag LOCUS_25050 39340 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 40970 39540 gene locus_tag LOCUS_25060 40970 39540 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_25060 42506 41127 gene locus_tag LOCUS_25070 42506 41127 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903474.1 protein_id gnl|my_center|LOCUS_25070 43338 42457 gene locus_tag LOCUS_25080 43338 42457 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_25080 45094 44027 gene locus_tag LOCUS_25090 45094 44027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003909837.1 protein_id gnl|my_center|LOCUS_25090 45426 45175 gene locus_tag LOCUS_25100 45426 45175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 46318 45608 gene locus_tag LOCUS_25110 46318 45608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 46812 47012 gene locus_tag LOCUS_25120 46812 47012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence038 2143 296 gene locus_tag LOCUS_25130 gene dsbD 2143 296 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_25130 3804 2161 gene locus_tag LOCUS_25140 3804 2161 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_25140 5320 3968 gene locus_tag LOCUS_25150 5320 3968 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_25150 6823 5387 gene locus_tag LOCUS_25160 6823 5387 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257998.1 protein_id gnl|my_center|LOCUS_25160 7044 7823 gene locus_tag LOCUS_25170 7044 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 7894 8631 gene locus_tag LOCUS_25180 7894 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 8752 11979 gene locus_tag LOCUS_25190 8752 11979 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_25190 12099 15329 gene locus_tag LOCUS_25200 12099 15329 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_25200 15400 16359 gene locus_tag LOCUS_25210 15400 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 16879 16373 gene locus_tag LOCUS_25220 16879 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 18383 16854 gene locus_tag LOCUS_25230 18383 16854 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_25230 19776 18406 gene locus_tag LOCUS_25240 19776 18406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 20332 19826 gene locus_tag LOCUS_25250 20332 19826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 20615 21775 gene locus_tag LOCUS_25260 gene tuf 20615 21775 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_25260 23058 21805 gene locus_tag LOCUS_25270 23058 21805 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_25270 23358 23122 gene locus_tag LOCUS_25280 23358 23122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 24747 23407 gene locus_tag LOCUS_25290 24747 23407 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_25290 26041 24884 gene locus_tag LOCUS_25300 26041 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 27146 26025 gene locus_tag LOCUS_25310 27146 26025 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_25310 27741 27403 gene locus_tag LOCUS_25320 27741 27403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 28100 28405 gene locus_tag LOCUS_25330 28100 28405 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259346.1 protein_id gnl|my_center|LOCUS_25330 28398 28712 gene locus_tag LOCUS_25340 28398 28712 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_25340 29911 28826 gene locus_tag LOCUS_25350 29911 28826 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_25350 30643 30023 gene locus_tag LOCUS_25360 30643 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25360 31451 30603 gene locus_tag LOCUS_25370 31451 30603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25370 32466 31813 gene locus_tag LOCUS_25380 32466 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 32742 32548 gene locus_tag LOCUS_25390 32742 32548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 34210 32804 gene locus_tag LOCUS_25400 34210 32804 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_25400 35146 34451 gene locus_tag LOCUS_25410 35146 34451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 36336 35491 gene locus_tag LOCUS_25420 36336 35491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 37459 36386 gene locus_tag LOCUS_25430 37459 36386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_25430 38910 37456 gene locus_tag LOCUS_25440 38910 37456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 40056 39100 gene locus_tag LOCUS_25450 40056 39100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25450 41379 40060 gene locus_tag LOCUS_25460 41379 40060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 41635 41883 gene locus_tag LOCUS_25470 41635 41883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 42924 42139 gene locus_tag LOCUS_25480 42924 42139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 43849 43004 gene locus_tag LOCUS_25490 43849 43004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 44210 45883 gene locus_tag LOCUS_25500 44210 45883 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence039 775 981 gene locus_tag LOCUS_25510 775 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 1515 907 gene locus_tag LOCUS_25520 1515 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1684 1526 gene locus_tag LOCUS_25530 1684 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2484 3269 gene locus_tag LOCUS_25540 2484 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3420 4205 gene locus_tag LOCUS_25550 3420 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 4361 4167 gene locus_tag LOCUS_25560 4361 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 4442 5461 gene locus_tag LOCUS_25570 4442 5461 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_25570 5661 6581 gene locus_tag LOCUS_25580 5661 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 6755 7408 gene locus_tag LOCUS_25590 6755 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 7472 8158 gene locus_tag LOCUS_25600 7472 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 8759 9886 gene locus_tag LOCUS_25610 gene nadA 8759 9886 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853488.1 protein_id gnl|my_center|LOCUS_25610 11046 10054 gene locus_tag LOCUS_25620 gene porV 11046 10054 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_25620 17430 11134 gene locus_tag LOCUS_25630 17430 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 18791 17784 gene locus_tag LOCUS_25640 18791 17784 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_25640 19803 18838 gene locus_tag LOCUS_25650 gene comC 19803 18838 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_25650 19990 20397 gene locus_tag LOCUS_25660 19990 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 20417 21991 gene locus_tag LOCUS_25670 20417 21991 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_25670 22257 23039 gene locus_tag LOCUS_25680 22257 23039 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_25680 23152 23562 gene locus_tag LOCUS_25690 23152 23562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 23622 25037 gene locus_tag LOCUS_25700 23622 25037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 25060 26061 gene locus_tag LOCUS_25710 25060 26061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 26361 27776 gene locus_tag LOCUS_25720 26361 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 28125 29453 gene locus_tag LOCUS_25730 28125 29453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 29518 30447 gene locus_tag LOCUS_25740 29518 30447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 30463 31185 gene locus_tag LOCUS_25750 30463 31185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 31274 32185 gene locus_tag LOCUS_25760 31274 32185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 32201 32518 gene locus_tag LOCUS_25770 32201 32518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 32611 34086 gene locus_tag LOCUS_25780 32611 34086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 34300 35859 gene locus_tag LOCUS_25790 34300 35859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 36034 37743 gene locus_tag LOCUS_25800 36034 37743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 37929 38840 gene locus_tag LOCUS_25810 37929 38840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 39158 39892 gene locus_tag LOCUS_25820 39158 39892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_25820 39913 42306 gene locus_tag LOCUS_25830 39913 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 42316 43701 gene locus_tag LOCUS_25840 42316 43701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 45313 43862 gene locus_tag LOCUS_25850 45313 43862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence040 164 838 gene locus_tag LOCUS_25860 164 838 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082103.1 protein_id gnl|my_center|LOCUS_25860 819 2018 gene locus_tag LOCUS_25870 819 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2514 3107 gene locus_tag LOCUS_25880 2514 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3141 3728 gene locus_tag LOCUS_25890 gene pth 3141 3728 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_25890 3956 5065 gene locus_tag LOCUS_25900 3956 5065 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_25900 7036 5084 gene locus_tag LOCUS_25910 7036 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 7210 7518 gene locus_tag LOCUS_25920 7210 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 7526 8134 gene locus_tag LOCUS_25930 7526 8134 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_25930 8121 8795 gene locus_tag LOCUS_25940 8121 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 9136 8834 gene locus_tag LOCUS_25950 gene yajC 9136 8834 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064323.1 protein_id gnl|my_center|LOCUS_25950 10039 9158 gene locus_tag LOCUS_25960 gene queA 10039 9158 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_25960 11232 10219 gene locus_tag LOCUS_25970 gene ruvB 11232 10219 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772105.1 protein_id gnl|my_center|LOCUS_25970 11926 11330 gene locus_tag LOCUS_25980 gene ruvA 11926 11330 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_25980 12846 12100 gene locus_tag LOCUS_25990 12846 12100 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_25990 13362 14141 gene locus_tag LOCUS_26000 13362 14141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 14817 14203 gene locus_tag LOCUS_26010 14817 14203 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932444.1 protein_id gnl|my_center|LOCUS_26010 15009 14821 gene locus_tag LOCUS_26020 15009 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 15525 15145 gene locus_tag LOCUS_26030 15525 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 15834 15595 gene locus_tag LOCUS_26040 15834 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26040 16851 15985 gene locus_tag LOCUS_26050 16851 15985 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_26050 17853 16900 gene locus_tag LOCUS_26060 17853 16900 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259737.1 protein_id gnl|my_center|LOCUS_26060 18234 19061 gene locus_tag LOCUS_26070 18234 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 19193 20224 gene locus_tag LOCUS_26080 19193 20224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 20221 20547 gene locus_tag LOCUS_26090 20221 20547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 20690 22720 gene locus_tag LOCUS_26100 20690 22720 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_26100 22704 22904 gene locus_tag LOCUS_26110 22704 22904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 22901 24346 gene locus_tag LOCUS_26120 22901 24346 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_26120 24394 25173 gene locus_tag LOCUS_26130 24394 25173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 26106 25219 gene locus_tag LOCUS_26140 gene rsmA 26106 25219 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_26140 27356 26121 gene locus_tag LOCUS_26150 gene coaBC 27356 26121 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_26150 28333 27674 gene locus_tag LOCUS_26160 gene gmk 28333 27674 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_26160 28838 28380 gene locus_tag LOCUS_26170 28838 28380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 29207 29977 gene locus_tag LOCUS_26180 29207 29977 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_26180 30094 30468 gene locus_tag LOCUS_26190 30094 30468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 30792 32132 gene locus_tag LOCUS_26200 30792 32132 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117943.1 protein_id gnl|my_center|LOCUS_26200 32284 32883 gene locus_tag LOCUS_26210 gene rsmD 32284 32883 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_26210 32936 33679 gene locus_tag LOCUS_26220 32936 33679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 33891 36440 gene locus_tag LOCUS_26230 33891 36440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 36514 37146 gene locus_tag LOCUS_26240 36514 37146 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_26240 37290 38264 gene locus_tag LOCUS_26250 37290 38264 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_26250 38472 39434 gene locus_tag LOCUS_26260 38472 39434 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 protein_id gnl|my_center|LOCUS_26260 39748 40710 gene locus_tag LOCUS_26270 39748 40710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 41891 40842 gene locus_tag LOCUS_26280 41891 40842 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_26280 41949 42581 gene locus_tag LOCUS_26290 41949 42581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 43102 42614 gene locus_tag LOCUS_26300 43102 42614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 44552 43089 gene locus_tag LOCUS_26310 44552 43089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence041 1550 282 gene locus_tag LOCUS_26320 1550 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1824 2639 gene locus_tag LOCUS_26330 1824 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 4315 2636 gene locus_tag LOCUS_26340 4315 2636 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_26340 5210 10015 gene locus_tag LOCUS_26350 5210 10015 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202675.1 protein_id gnl|my_center|LOCUS_26350 12507 10072 gene locus_tag LOCUS_26360 12507 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 13421 13609 gene locus_tag LOCUS_26370 13421 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 13756 15630 gene locus_tag LOCUS_26380 13756 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 18808 15860 gene locus_tag LOCUS_26390 18808 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 20243 18945 gene locus_tag LOCUS_26400 20243 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 22200 20422 gene locus_tag LOCUS_26410 22200 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 23914 22352 gene locus_tag LOCUS_26420 23914 22352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 24885 23926 gene locus_tag LOCUS_26430 24885 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 25350 24940 gene locus_tag LOCUS_26440 25350 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 26062 25385 gene locus_tag LOCUS_26450 26062 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 26522 26067 gene locus_tag LOCUS_26460 gene xcpT 26522 26067 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_26460 27944 26718 gene locus_tag LOCUS_26470 27944 26718 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_26470 29763 27994 gene locus_tag LOCUS_26480 29763 27994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 31119 29971 gene locus_tag LOCUS_26490 31119 29971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 33019 31325 gene locus_tag LOCUS_26500 33019 31325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 34798 33101 gene locus_tag LOCUS_26510 34798 33101 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_26510 35759 35172 gene locus_tag LOCUS_26520 gene gmhA 35759 35172 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_26520 37605 35806 gene locus_tag LOCUS_26530 37605 35806 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_26530 37871 38998 gene locus_tag LOCUS_26540 gene ugpC 37871 38998 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_26540 39367 41019 gene locus_tag LOCUS_26550 39367 41019 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086842967.1 protein_id gnl|my_center|LOCUS_26550 42712 41156 gene locus_tag LOCUS_26560 42712 41156 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_26560 43734 42838 gene locus_tag LOCUS_26570 43734 42838 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140159.1 protein_id gnl|my_center|LOCUS_26570 44397 43837 gene locus_tag LOCUS_26580 44397 43837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence042 3856 1862 gene locus_tag LOCUS_26590 3856 1862 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_26590 5246 4425 gene locus_tag LOCUS_26600 5246 4425 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 protein_id gnl|my_center|LOCUS_26600 6211 5390 gene locus_tag LOCUS_26610 6211 5390 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 protein_id gnl|my_center|LOCUS_26610 7028 6270 gene locus_tag LOCUS_26620 7028 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 7278 7075 gene locus_tag LOCUS_26630 7278 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 8584 8315 gene locus_tag LOCUS_26640 8584 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 8932 8702 gene locus_tag LOCUS_26650 8932 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 9963 8944 gene locus_tag LOCUS_26660 9963 8944 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_26660 10741 10022 gene locus_tag LOCUS_26670 10741 10022 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 protein_id gnl|my_center|LOCUS_26670 11747 11097 gene locus_tag LOCUS_26680 gene rpoE 11747 11097 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_26680 13491 12385 gene locus_tag LOCUS_26690 gene thiO 13491 12385 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_26690 13967 14254 gene locus_tag LOCUS_26700 13967 14254 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_26700 14283 14849 gene locus_tag LOCUS_26710 14283 14849 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437817.1 protein_id gnl|my_center|LOCUS_26710 15258 14860 gene locus_tag LOCUS_26720 15258 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 16933 15251 gene locus_tag LOCUS_26730 16933 15251 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_26730 18224 16917 gene locus_tag LOCUS_26740 18224 16917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 18358 19383 gene locus_tag LOCUS_26750 gene allD 18358 19383 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706746.1 protein_id gnl|my_center|LOCUS_26750 19445 20941 gene locus_tag LOCUS_26760 19445 20941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 22655 21129 gene locus_tag LOCUS_26770 gene cobA 22655 21129 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_26770 23577 22666 gene locus_tag LOCUS_26780 gene hemC 23577 22666 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_26780 24930 23629 gene locus_tag LOCUS_26790 gene hemA 24930 23629 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_26790 25879 25037 gene locus_tag LOCUS_26800 gene ccsB 25879 25037 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_26800 27058 25898 gene locus_tag LOCUS_26810 27058 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 28126 27146 gene locus_tag LOCUS_26820 28126 27146 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_26820 29482 28172 gene locus_tag LOCUS_26830 gene hemL 29482 28172 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_26830 30576 29599 gene locus_tag LOCUS_26840 gene hemB 30576 29599 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_26840 31496 30573 gene locus_tag LOCUS_26850 31496 30573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 32696 31611 gene locus_tag LOCUS_26860 32696 31611 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_26860 33223 32738 gene locus_tag LOCUS_26870 33223 32738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 33437 35056 gene locus_tag LOCUS_26880 33437 35056 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812114.1 protein_id gnl|my_center|LOCUS_26880 35081 36514 gene locus_tag LOCUS_26890 35081 36514 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941969.1 protein_id gnl|my_center|LOCUS_26890 38252 36783 gene locus_tag LOCUS_26900 38252 36783 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_26900 38859 38254 gene locus_tag LOCUS_26910 38859 38254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 39078 39524 gene locus_tag LOCUS_26920 39078 39524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 40399 39575 gene locus_tag LOCUS_26930 40399 39575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 41297 40485 gene locus_tag LOCUS_26940 41297 40485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 42850 41681 gene locus_tag LOCUS_26950 42850 41681 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence043 1914 751 gene locus_tag LOCUS_26960 1914 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2016 2079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2654 2283 gene locus_tag LOCUS_26970 2654 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 4276 2711 gene locus_tag LOCUS_26980 4276 2711 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_26980 4549 4307 gene locus_tag LOCUS_26990 4549 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 5483 4680 gene locus_tag LOCUS_27000 5483 4680 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 protein_id gnl|my_center|LOCUS_27000 6330 5557 gene locus_tag LOCUS_27010 gene fabG 6330 5557 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_27010 6668 6342 gene locus_tag LOCUS_27020 6668 6342 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_27020 7035 6652 gene locus_tag LOCUS_27030 7035 6652 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_27030 11457 7279 gene locus_tag LOCUS_27040 11457 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 12770 11466 gene locus_tag LOCUS_27050 12770 11466 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103188.1 protein_id gnl|my_center|LOCUS_27050 13907 12837 gene locus_tag LOCUS_27060 13907 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 14949 13978 gene locus_tag LOCUS_27070 14949 13978 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_27070 18587 15081 gene locus_tag LOCUS_27080 gene mfd 18587 15081 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_27080 19549 18761 gene locus_tag LOCUS_27090 19549 18761 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_27090 20421 19762 gene locus_tag LOCUS_27100 20421 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 21234 20437 gene locus_tag LOCUS_27110 21234 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 21538 22035 gene locus_tag LOCUS_27120 21538 22035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 22101 23399 gene locus_tag LOCUS_27130 22101 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 26507 23418 gene locus_tag LOCUS_27140 26507 23418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 27929 26565 gene locus_tag LOCUS_27150 27929 26565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 29906 28032 gene locus_tag LOCUS_27160 29906 28032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 30114 29908 gene locus_tag LOCUS_27170 30114 29908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 31465 30272 gene locus_tag LOCUS_27180 31465 30272 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_27180 32045 31494 gene locus_tag LOCUS_27190 32045 31494 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206205.1 protein_id gnl|my_center|LOCUS_27190 32894 32112 gene locus_tag LOCUS_27200 32894 32112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 34080 33244 gene locus_tag LOCUS_27210 34080 33244 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275434.1 protein_id gnl|my_center|LOCUS_27210 35312 34140 gene locus_tag LOCUS_27220 35312 34140 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_27220 35852 36577 gene locus_tag LOCUS_27230 35852 36577 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929296.1 protein_id gnl|my_center|LOCUS_27230 36619 37452 gene locus_tag LOCUS_27240 gene folD 36619 37452 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_27240 37456 38220 gene locus_tag LOCUS_27250 37456 38220 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_27250 38432 40534 gene locus_tag LOCUS_27260 38432 40534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 41752 40646 gene locus_tag LOCUS_27270 41752 40646 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530306.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence044 391 104 gene locus_tag LOCUS_27280 391 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1863 562 gene locus_tag LOCUS_27290 gene eno 1863 562 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 protein_id gnl|my_center|LOCUS_27290 2606 1914 gene locus_tag LOCUS_27300 2606 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3354 2644 gene locus_tag LOCUS_27310 3354 2644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_27310 4411 3503 gene locus_tag LOCUS_27320 4411 3503 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_27320 6210 4429 gene locus_tag LOCUS_27330 6210 4429 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_27330 7044 6436 gene locus_tag LOCUS_27340 7044 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 7445 7050 gene locus_tag LOCUS_27350 7445 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 8754 7438 gene locus_tag LOCUS_27360 8754 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 9100 8756 gene locus_tag LOCUS_27370 9100 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 9696 9148 gene locus_tag LOCUS_27380 9696 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 11732 9714 gene locus_tag LOCUS_27390 11732 9714 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391272.1 protein_id gnl|my_center|LOCUS_27390 12248 11802 gene locus_tag LOCUS_27400 12248 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 12561 13508 gene locus_tag LOCUS_27410 12561 13508 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_27410 13684 14898 gene locus_tag LOCUS_27420 13684 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 14945 15919 gene locus_tag LOCUS_27430 14945 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 15955 16956 gene locus_tag LOCUS_27440 15955 16956 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_27440 17064 19439 gene locus_tag LOCUS_27450 17064 19439 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921971.1 protein_id gnl|my_center|LOCUS_27450 19796 19587 gene locus_tag LOCUS_27460 19796 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 19912 20478 gene locus_tag LOCUS_27470 19912 20478 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_27470 20600 21958 gene locus_tag LOCUS_27480 20600 21958 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921686.1 protein_id gnl|my_center|LOCUS_27480 22047 23039 gene locus_tag LOCUS_27490 22047 23039 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_27490 23150 24439 gene locus_tag LOCUS_27500 23150 24439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 25784 24546 gene locus_tag LOCUS_27510 25784 24546 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_27510 26189 26821 gene locus_tag LOCUS_27520 26189 26821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 26821 27606 gene locus_tag LOCUS_27530 26821 27606 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141109.1 protein_id gnl|my_center|LOCUS_27530 27762 28841 gene locus_tag LOCUS_27540 27762 28841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 28938 29786 gene locus_tag LOCUS_27550 28938 29786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 30073 32295 gene locus_tag LOCUS_27560 30073 32295 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_27560 32320 34437 gene locus_tag LOCUS_27570 32320 34437 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_27570 34540 36798 gene locus_tag LOCUS_27580 34540 36798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 37217 38167 gene locus_tag LOCUS_27590 37217 38167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 38966 38205 gene locus_tag LOCUS_27600 38966 38205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 39993 38953 gene locus_tag LOCUS_27610 gene purM 39993 38953 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_27610 40291 39983 gene locus_tag LOCUS_27620 40291 39983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 41776 40343 gene locus_tag LOCUS_27630 gene purF 41776 40343 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_27630 42365 41823 gene locus_tag LOCUS_27640 42365 41823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence045 <1 818 gene locus_tag LOCUS_27650 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546244.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase 954 1757 gene locus_tag LOCUS_27660 gene lpxI 954 1757 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930695.1 protein_id gnl|my_center|LOCUS_27660 2016 1843 gene locus_tag LOCUS_27670 2016 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2343 3095 gene locus_tag LOCUS_27680 2343 3095 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 protein_id gnl|my_center|LOCUS_27680 4295 3513 gene locus_tag LOCUS_27690 4295 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 5439 4327 gene locus_tag LOCUS_27700 5439 4327 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_27700 7460 5754 gene locus_tag LOCUS_27710 7460 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 8622 7621 gene locus_tag LOCUS_27720 8622 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 9708 8743 gene locus_tag LOCUS_27730 9708 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 11424 9853 gene locus_tag LOCUS_27740 11424 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 12782 11421 gene locus_tag LOCUS_27750 12782 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 13839 12913 gene locus_tag LOCUS_27760 13839 12913 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 protein_id gnl|my_center|LOCUS_27760 14771 13812 gene locus_tag LOCUS_27770 14771 13812 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140467.1 protein_id gnl|my_center|LOCUS_27770 16099 14786 gene locus_tag LOCUS_27780 16099 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 17124 16129 gene locus_tag LOCUS_27790 17124 16129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_27790 18347 17142 gene locus_tag LOCUS_27800 18347 17142 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928857.1 protein_id gnl|my_center|LOCUS_27800 19309 18395 gene locus_tag LOCUS_27810 19309 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 22006 19439 gene locus_tag LOCUS_27820 22006 19439 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_27820 23430 22003 gene locus_tag LOCUS_27830 23430 22003 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_27830 23947 23528 gene locus_tag LOCUS_27840 23947 23528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 24241 23954 gene locus_tag LOCUS_27850 24241 23954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 24420 25268 gene locus_tag LOCUS_27860 24420 25268 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064422.1 protein_id gnl|my_center|LOCUS_27860 26239 25403 gene locus_tag LOCUS_27870 gene fabG 26239 25403 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_27870 26403 26702 gene locus_tag LOCUS_27880 26403 26702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 27461 30529 gene locus_tag LOCUS_27890 27461 30529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 33307 31379 gene locus_tag LOCUS_27900 33307 31379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 34807 33428 gene locus_tag LOCUS_27910 34807 33428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 35833 35039 gene locus_tag LOCUS_27920 35833 35039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 36963 36190 gene locus_tag LOCUS_27930 36963 36190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 37811 37023 gene locus_tag LOCUS_27940 37811 37023 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_27940 38598 37882 gene locus_tag LOCUS_27950 38598 37882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 39667 38759 gene locus_tag LOCUS_27960 39667 38759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 40404 39646 gene locus_tag LOCUS_27970 40404 39646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 41403 40552 gene locus_tag LOCUS_27980 41403 40552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 41588 41409 gene locus_tag LOCUS_27990 41588 41409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence046 239 2656 gene locus_tag LOCUS_28000 239 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2784 4256 gene locus_tag LOCUS_28010 2784 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 4249 4410 gene locus_tag LOCUS_28020 4249 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 4426 4716 gene locus_tag LOCUS_28030 4426 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 4713 5201 gene locus_tag LOCUS_28040 4713 5201 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_28040 5210 6676 gene locus_tag LOCUS_28050 5210 6676 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_28050 6677 9112 gene locus_tag LOCUS_28060 6677 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 10494 9181 gene locus_tag LOCUS_28070 10494 9181 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_28070 12091 10604 gene locus_tag LOCUS_28080 12091 10604 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_28080 12735 13340 gene locus_tag LOCUS_28090 12735 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 13393 13617 gene locus_tag LOCUS_28100 13393 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 13580 14572 gene locus_tag LOCUS_28110 13580 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 14596 15789 gene locus_tag LOCUS_28120 14596 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 16885 15755 gene locus_tag LOCUS_28130 16885 15755 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_28130 17181 17447 gene locus_tag LOCUS_28140 17181 17447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 17451 18494 gene locus_tag LOCUS_28150 17451 18494 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_28150 18507 19514 gene locus_tag LOCUS_28160 18507 19514 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_28160 20719 19586 gene locus_tag LOCUS_28170 20719 19586 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_28170 21949 21020 gene locus_tag LOCUS_28180 21949 21020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 22532 21966 gene locus_tag LOCUS_28190 22532 21966 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_28190 23946 22708 gene locus_tag LOCUS_28200 23946 22708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_28200 25206 23956 gene locus_tag LOCUS_28210 25206 23956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_28210 25575 27410 gene locus_tag LOCUS_28220 25575 27410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 27453 29012 gene locus_tag LOCUS_28230 27453 29012 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_28230 29062 30264 gene locus_tag LOCUS_28240 29062 30264 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583737.1 protein_id gnl|my_center|LOCUS_28240 31473 30307 gene locus_tag LOCUS_28250 31473 30307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 32328 31630 gene locus_tag LOCUS_28260 32328 31630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 32816 32325 gene locus_tag LOCUS_28270 32816 32325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 33146 32838 gene locus_tag LOCUS_28280 33146 32838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 33713 33225 gene locus_tag LOCUS_28290 33713 33225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 34242 33700 gene locus_tag LOCUS_28300 34242 33700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 35462 34239 gene locus_tag LOCUS_28310 35462 34239 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391496.1 protein_id gnl|my_center|LOCUS_28310 36435 35503 gene locus_tag LOCUS_28320 36435 35503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 36804 36514 gene locus_tag LOCUS_28330 36804 36514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 37530 37345 gene locus_tag LOCUS_28340 37530 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 37581 38075 gene locus_tag LOCUS_28350 37581 38075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 38276 38977 gene locus_tag LOCUS_28360 38276 38977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 38984 39157 gene locus_tag LOCUS_28370 38984 39157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence047 1847 489 gene locus_tag LOCUS_28380 gene pafA 1847 489 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_28380 2648 1926 gene locus_tag LOCUS_28390 gene prcA 2648 1926 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_28390 3527 2733 gene locus_tag LOCUS_28400 gene prcB 3527 2733 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_28400 3727 3530 gene locus_tag LOCUS_28410 3727 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 5305 3788 gene locus_tag LOCUS_28420 gene dop 5305 3788 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_28420 7139 5355 gene locus_tag LOCUS_28430 gene arc 7139 5355 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_28430 8609 7563 gene locus_tag LOCUS_28440 gene recA 8609 7563 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_28440 9171 8671 gene locus_tag LOCUS_28450 gene thpR 9171 8671 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_28450 9776 9252 gene locus_tag LOCUS_28460 gene pgsA 9776 9252 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_28460 10655 9918 gene locus_tag LOCUS_28470 10655 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 11390 11010 gene locus_tag LOCUS_28480 11390 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 11745 15419 gene locus_tag LOCUS_28490 gene metH 11745 15419 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704023.1 protein_id gnl|my_center|LOCUS_28490 15912 15553 gene locus_tag LOCUS_28500 15912 15553 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_28500 16675 16313 gene locus_tag LOCUS_28510 16675 16313 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_28510 17049 16696 gene locus_tag LOCUS_28520 17049 16696 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928433.1 protein_id gnl|my_center|LOCUS_28520 17033 17260 gene locus_tag LOCUS_28530 17033 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 17390 18280 gene locus_tag LOCUS_28540 17390 18280 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_28540 22033 18311 gene locus_tag LOCUS_28550 22033 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 22302 23453 gene locus_tag LOCUS_28560 22302 23453 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067163.1 protein_id gnl|my_center|LOCUS_28560 24491 23532 gene locus_tag LOCUS_28570 24491 23532 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_28570 24664 25059 gene locus_tag LOCUS_28580 24664 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 26044 25331 gene locus_tag LOCUS_28590 26044 25331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 27555 26113 gene locus_tag LOCUS_28600 27555 26113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 29585 27549 gene locus_tag LOCUS_28610 29585 27549 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_28610 30015 29656 gene locus_tag LOCUS_28620 30015 29656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 30863 32788 gene locus_tag LOCUS_28630 30863 32788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 32983 33717 gene locus_tag LOCUS_28640 32983 33717 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763098.1 protein_id gnl|my_center|LOCUS_28640 33710 35635 gene locus_tag LOCUS_28650 33710 35635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 35971 36831 gene locus_tag LOCUS_28660 35971 36831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 36880 37458 gene locus_tag LOCUS_28670 36880 37458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 39338 37530 gene locus_tag LOCUS_28680 39338 37530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_28680 40837 39353 gene locus_tag LOCUS_28690 40837 39353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence048 475 3174 gene locus_tag LOCUS_28700 475 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 3186 4022 gene locus_tag LOCUS_28710 3186 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 4036 4896 gene locus_tag LOCUS_28720 4036 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 5234 5608 gene locus_tag LOCUS_28730 5234 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 5743 6216 gene locus_tag LOCUS_28740 5743 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 6366 6566 gene locus_tag LOCUS_28750 6366 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 6626 7072 gene locus_tag LOCUS_28760 gene rplI 6626 7072 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_28760 7075 8406 gene locus_tag LOCUS_28770 gene dnaB 7075 8406 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_28770 8746 9240 gene locus_tag LOCUS_28780 8746 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 9349 10128 gene locus_tag LOCUS_28790 9349 10128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_28790 10130 11692 gene locus_tag LOCUS_28800 10130 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 11716 13119 gene locus_tag LOCUS_28810 gene radA 11716 13119 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_28810 13448 14572 gene locus_tag LOCUS_28820 13448 14572 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919677.1 protein_id gnl|my_center|LOCUS_28820 14583 15233 gene locus_tag LOCUS_28830 gene ispD 14583 15233 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_28830 15314 15811 gene locus_tag LOCUS_28840 gene ispF 15314 15811 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_28840 15855 17279 gene locus_tag LOCUS_28850 gene cysS 15855 17279 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459084.1 protein_id gnl|my_center|LOCUS_28850 17340 17978 gene locus_tag LOCUS_28860 17340 17978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 18236 18826 gene locus_tag LOCUS_28870 18236 18826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 18901 20118 gene locus_tag LOCUS_28880 gene dprA 18901 20118 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403940.1 protein_id gnl|my_center|LOCUS_28880 20321 20653 gene locus_tag LOCUS_28890 20321 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 20638 20877 gene locus_tag LOCUS_28900 20638 20877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 20952 22055 gene locus_tag LOCUS_28910 gene tsaD 20952 22055 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_28910 22071 22682 gene locus_tag LOCUS_28920 22071 22682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 22664 23248 gene locus_tag LOCUS_28930 22664 23248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 24293 23250 gene locus_tag LOCUS_28940 24293 23250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 24728 26227 gene locus_tag LOCUS_28950 gene guaB 24728 26227 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_28950 26441 26971 gene locus_tag LOCUS_28960 26441 26971 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_28960 26993 27544 gene locus_tag LOCUS_28970 26993 27544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 27908 30712 gene locus_tag LOCUS_28980 27908 30712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 30861 31769 gene locus_tag LOCUS_28990 gene mdh 30861 31769 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528846.1 protein_id gnl|my_center|LOCUS_28990 31805 32914 gene locus_tag LOCUS_29000 31805 32914 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_29000 32917 33267 gene locus_tag LOCUS_29010 32917 33267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 33322 34218 gene locus_tag LOCUS_29020 33322 34218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 34747 34331 gene locus_tag LOCUS_29030 34747 34331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 35640 34762 gene locus_tag LOCUS_29040 35640 34762 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_29040 36487 35684 gene locus_tag LOCUS_29050 36487 35684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 37576 36605 gene locus_tag LOCUS_29060 37576 36605 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705390.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence049 319 1110 gene locus_tag LOCUS_29070 319 1110 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_29070 1216 1752 gene locus_tag LOCUS_29080 1216 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 1852 2895 gene locus_tag LOCUS_29090 1852 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 3025 3372 gene locus_tag LOCUS_29100 3025 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3369 3920 gene locus_tag LOCUS_29110 3369 3920 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095605.1 protein_id gnl|my_center|LOCUS_29110 3925 4335 gene locus_tag LOCUS_29120 3925 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 4402 4501 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4779 4603 gene locus_tag LOCUS_29130 4779 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 4927 6510 gene locus_tag LOCUS_29140 4927 6510 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003677.1 protein_id gnl|my_center|LOCUS_29140 6835 8136 gene locus_tag LOCUS_29150 6835 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 8295 9641 gene locus_tag LOCUS_29160 8295 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 9614 10705 gene locus_tag LOCUS_29170 9614 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 10705 11280 gene locus_tag LOCUS_29180 10705 11280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 11381 11848 gene locus_tag LOCUS_29190 11381 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 11860 12588 gene locus_tag LOCUS_29200 11860 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 12599 13003 gene locus_tag LOCUS_29210 12599 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 13164 13523 gene locus_tag LOCUS_29220 13164 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 13538 13699 gene locus_tag LOCUS_29230 13538 13699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 13704 16253 gene locus_tag LOCUS_29240 13704 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 16579 16433 gene locus_tag LOCUS_29250 16579 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 16728 20222 gene locus_tag LOCUS_29260 16728 20222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 20232 20603 gene locus_tag LOCUS_29270 20232 20603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 20739 25436 gene locus_tag LOCUS_29280 20739 25436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 22157 22256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26140 26292 gene locus_tag LOCUS_29290 26140 26292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 26376 26549 gene locus_tag LOCUS_29300 26376 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 26643 26918 gene locus_tag LOCUS_29310 26643 26918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 27012 27629 gene locus_tag LOCUS_29320 27012 27629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 28029 28175 gene locus_tag LOCUS_29330 28029 28175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 28792 28391 gene locus_tag LOCUS_29340 28792 28391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 30638 28797 gene locus_tag LOCUS_29350 30638 28797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 30877 30638 gene locus_tag LOCUS_29360 30877 30638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 31174 30959 gene locus_tag LOCUS_29370 31174 30959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 31855 31178 gene locus_tag LOCUS_29380 31855 31178 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106289931.1 protein_id gnl|my_center|LOCUS_29380 32958 32053 gene locus_tag LOCUS_29390 32958 32053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 34333 32948 gene locus_tag LOCUS_29400 34333 32948 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_29400 34637 34284 gene locus_tag LOCUS_29410 34637 34284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 35323 34628 gene locus_tag LOCUS_29420 35323 34628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 35577 35320 gene locus_tag LOCUS_29430 35577 35320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 36258 35704 gene locus_tag LOCUS_29440 36258 35704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 37125 36376 gene locus_tag LOCUS_29450 37125 36376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 37525 37112 gene locus_tag LOCUS_29460 37525 37112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 37997 37527 gene locus_tag LOCUS_29470 37997 37527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 38206 37994 gene locus_tag LOCUS_29480 38206 37994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 39213 38293 gene locus_tag LOCUS_29490 39213 38293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 39809 39333 gene locus_tag LOCUS_29500 39809 39333 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_29500 >Feature sequence050 87 692 gene locus_tag LOCUS_29510 87 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 507 516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 646 1335 gene locus_tag LOCUS_29520 646 1335 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_29520 2264 1332 gene locus_tag LOCUS_29530 gene porV 2264 1332 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_29530 2982 2539 gene locus_tag LOCUS_29540 2982 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3329 2979 gene locus_tag LOCUS_29550 3329 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 6428 3354 gene locus_tag LOCUS_29560 6428 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 6820 6422 gene locus_tag LOCUS_29570 6820 6422 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_29570 7994 6873 gene locus_tag LOCUS_29580 7994 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 8681 8334 gene locus_tag LOCUS_29590 8681 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 9946 9125 gene locus_tag LOCUS_29600 9946 9125 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_29600 11058 10060 gene locus_tag LOCUS_29610 11058 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 11664 12644 gene locus_tag LOCUS_29620 11664 12644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808460.1 protein_id gnl|my_center|LOCUS_29620 14163 13123 gene locus_tag LOCUS_29630 14163 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 15190 14327 gene locus_tag LOCUS_29640 15190 14327 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_29640 15569 16750 gene locus_tag LOCUS_29650 15569 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 17629 16856 gene locus_tag LOCUS_29660 17629 16856 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_29660 17779 18561 gene locus_tag LOCUS_29670 17779 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 18569 19693 gene locus_tag LOCUS_29680 18569 19693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 19795 21117 gene locus_tag LOCUS_29690 19795 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 22152 21214 gene locus_tag LOCUS_29700 22152 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 22470 23693 gene locus_tag LOCUS_29710 22470 23693 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_29710 23762 25573 gene locus_tag LOCUS_29720 23762 25573 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401279.1 protein_id gnl|my_center|LOCUS_29720 25613 26380 gene locus_tag LOCUS_29730 gene hisN 25613 26380 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081049.1 protein_id gnl|my_center|LOCUS_29730 27290 26397 gene locus_tag LOCUS_29740 27290 26397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 27798 28478 gene locus_tag LOCUS_29750 27798 28478 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_29750 28537 29988 gene locus_tag LOCUS_29760 28537 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 30064 30747 gene locus_tag LOCUS_29770 30064 30747 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942478.1 protein_id gnl|my_center|LOCUS_29770 30836 31687 gene locus_tag LOCUS_29780 30836 31687 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_29780 31699 32337 gene locus_tag LOCUS_29790 gene scpB 31699 32337 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404243.1 protein_id gnl|my_center|LOCUS_29790 32337 33665 gene locus_tag LOCUS_29800 gene thrC 32337 33665 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_29800 33849 34478 gene locus_tag LOCUS_29810 33849 34478 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068736.1 protein_id gnl|my_center|LOCUS_29810 34711 35880 gene locus_tag LOCUS_29820 gene xylA 34711 35880 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_29820 36099 37991 gene locus_tag LOCUS_29830 36099 37991 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_29830 38175 38354 gene locus_tag LOCUS_29840 38175 38354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 38358 38750 gene locus_tag LOCUS_29850 38358 38750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence051 1043 117 gene locus_tag LOCUS_29860 1043 117 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_29860 1396 1172 gene locus_tag LOCUS_29870 1396 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 2016 1438 gene locus_tag LOCUS_29880 2016 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 2382 3164 gene locus_tag LOCUS_29890 2382 3164 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_29890 3142 3387 gene locus_tag LOCUS_29900 3142 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 3738 3421 gene locus_tag LOCUS_29910 3738 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 6185 4245 gene locus_tag LOCUS_29920 6185 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 6384 6602 gene locus_tag LOCUS_29930 6384 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 7341 6652 gene locus_tag LOCUS_29940 7341 6652 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072533.1 protein_id gnl|my_center|LOCUS_29940 7472 8557 gene locus_tag LOCUS_29950 gene aroC 7472 8557 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_29950 8779 9240 gene locus_tag LOCUS_29960 8779 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 9259 9780 gene locus_tag LOCUS_29970 9259 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 9890 10864 gene locus_tag LOCUS_29980 gene glcK 9890 10864 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_29980 10918 12597 gene locus_tag LOCUS_29990 10918 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 12693 13520 gene locus_tag LOCUS_30000 12693 13520 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_30000 13544 14569 gene locus_tag LOCUS_30010 13544 14569 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_30010 15668 14574 gene locus_tag LOCUS_30020 gene ugpC 15668 14574 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_30020 16732 15695 gene locus_tag LOCUS_30030 16732 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 17361 16771 gene locus_tag LOCUS_30040 17361 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 17523 17879 gene locus_tag LOCUS_30050 17523 17879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 18243 18671 gene locus_tag LOCUS_30060 gene infC 18243 18671 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 protein_id gnl|my_center|LOCUS_30060 19070 19417 gene locus_tag LOCUS_30070 gene rplT 19070 19417 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_30070 19770 20786 gene locus_tag LOCUS_30080 gene pheS 19770 20786 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_30080 20904 23312 gene locus_tag LOCUS_30090 gene pheT 20904 23312 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_30090 23309 24028 gene locus_tag LOCUS_30100 gene ubiE 23309 24028 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392794.1 protein_id gnl|my_center|LOCUS_30100 24991 24062 gene locus_tag LOCUS_30110 24991 24062 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_30110 25192 26682 gene locus_tag LOCUS_30120 25192 26682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 27528 26758 gene locus_tag LOCUS_30130 27528 26758 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584085.1 protein_id gnl|my_center|LOCUS_30130 28016 29269 gene locus_tag LOCUS_30140 28016 29269 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_30140 29448 30296 gene locus_tag LOCUS_30150 gene ubiA 29448 30296 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_30150 30381 31202 gene locus_tag LOCUS_30160 30381 31202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 31233 32747 gene locus_tag LOCUS_30170 31233 32747 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_30170 32953 33765 gene locus_tag LOCUS_30180 32953 33765 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_30180 33795 35624 gene locus_tag LOCUS_30190 33795 35624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 36944 35643 gene locus_tag LOCUS_30200 gene larC 36944 35643 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_30200 38591 36960 gene locus_tag LOCUS_30210 38591 36960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence052 <1 630 gene locus_tag LOCUS_30220 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393979.1:ABC transporter substrate-binding protein 784 1836 gene locus_tag LOCUS_30230 784 1836 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_30230 2468 1941 gene locus_tag LOCUS_30240 2468 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 4121 2496 gene locus_tag LOCUS_30250 4121 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 4840 4151 gene locus_tag LOCUS_30260 4840 4151 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227774.1 protein_id gnl|my_center|LOCUS_30260 6644 4944 gene locus_tag LOCUS_30270 6644 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 7360 6755 gene locus_tag LOCUS_30280 7360 6755 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 protein_id gnl|my_center|LOCUS_30280 8246 7488 gene locus_tag LOCUS_30290 8246 7488 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_30290 8670 8281 gene locus_tag LOCUS_30300 8670 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 8954 10048 gene locus_tag LOCUS_30310 gene ychF 8954 10048 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_30310 10691 10041 gene locus_tag LOCUS_30320 10691 10041 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_30320 11405 10734 gene locus_tag LOCUS_30330 gene cmk 11405 10734 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_30330 12309 11413 gene locus_tag LOCUS_30340 12309 11413 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_30340 14223 12460 gene locus_tag LOCUS_30350 14223 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 14538 15269 gene locus_tag LOCUS_30360 14538 15269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 16123 15374 gene locus_tag LOCUS_30370 16123 15374 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062236.1 protein_id gnl|my_center|LOCUS_30370 17830 16394 gene locus_tag LOCUS_30380 17830 16394 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937687.1 protein_id gnl|my_center|LOCUS_30380 18539 17835 gene locus_tag LOCUS_30390 gene pyrF 18539 17835 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_30390 19549 18800 gene locus_tag LOCUS_30400 19549 18800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 21135 19621 gene locus_tag LOCUS_30410 gene argH 21135 19621 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_30410 22079 21231 gene locus_tag LOCUS_30420 22079 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 23008 22136 gene locus_tag LOCUS_30430 23008 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 23110 23967 gene locus_tag LOCUS_30440 23110 23967 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_30440 26244 24061 gene locus_tag LOCUS_30450 26244 24061 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 protein_id gnl|my_center|LOCUS_30450 26612 28552 gene locus_tag LOCUS_30460 gene thiC 26612 28552 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_30460 28841 29920 gene locus_tag LOCUS_30470 28841 29920 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_30470 30152 31231 gene locus_tag LOCUS_30480 30152 31231 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086176.1 protein_id gnl|my_center|LOCUS_30480 33235 31430 gene locus_tag LOCUS_30490 33235 31430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 34619 33663 gene locus_tag LOCUS_30500 gene hflC 34619 33663 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_30500 35609 34641 gene locus_tag LOCUS_30510 gene hflK 35609 34641 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_30510 36268 36960 gene locus_tag LOCUS_30520 36268 36960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 37400 37756 gene locus_tag LOCUS_30530 37400 37756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 37753 38022 gene locus_tag LOCUS_30540 37753 38022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 >Feature sequence053 1123 293 gene locus_tag LOCUS_30550 1123 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1502 1104 gene locus_tag LOCUS_30560 1502 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1805 2920 gene locus_tag LOCUS_30570 1805 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 3086 3418 gene locus_tag LOCUS_30580 3086 3418 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073636.1 protein_id gnl|my_center|LOCUS_30580 4385 3795 gene locus_tag LOCUS_30590 4385 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 5361 4390 gene locus_tag LOCUS_30600 5361 4390 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_30600 6164 5358 gene locus_tag LOCUS_30610 6164 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 7115 6885 gene locus_tag LOCUS_30620 7115 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 7657 9579 gene locus_tag LOCUS_30630 7657 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 9590 10888 gene locus_tag LOCUS_30640 9590 10888 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003683.1 protein_id gnl|my_center|LOCUS_30640 10863 13103 gene locus_tag LOCUS_30650 10863 13103 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_30650 16985 13608 gene locus_tag LOCUS_30660 16985 13608 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090811.1 protein_id gnl|my_center|LOCUS_30660 19654 16985 gene locus_tag LOCUS_30670 19654 16985 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494176.1 protein_id gnl|my_center|LOCUS_30670 20353 20099 gene locus_tag LOCUS_30680 20353 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 20893 21192 gene locus_tag LOCUS_30690 20893 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 22056 22397 gene locus_tag LOCUS_30700 22056 22397 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533331.1 protein_id gnl|my_center|LOCUS_30700 22397 23653 gene locus_tag LOCUS_30710 22397 23653 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019197495.1 protein_id gnl|my_center|LOCUS_30710 24712 25986 gene locus_tag LOCUS_30720 24712 25986 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_30720 25989 29549 gene locus_tag LOCUS_30730 25989 29549 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_30730 31593 29899 gene locus_tag LOCUS_30740 31593 29899 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023602.1 protein_id gnl|my_center|LOCUS_30740 32840 31674 gene locus_tag LOCUS_30750 32840 31674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 34595 33069 gene locus_tag LOCUS_30760 34595 33069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 36673 34598 gene locus_tag LOCUS_30770 gene dndD 36673 34598 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_30770 36876 36673 gene locus_tag LOCUS_30780 36876 36673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 37440 37141 gene locus_tag LOCUS_30790 37440 37141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence054 <1 1206 gene locus_tag LOCUS_30800 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034260979.1:DEAD/DEAH box helicase family protein 1233 2084 gene locus_tag LOCUS_30810 1233 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 2149 3387 gene locus_tag LOCUS_30820 2149 3387 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_30820 3399 4022 gene locus_tag LOCUS_30830 3399 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 4120 5343 gene locus_tag LOCUS_30840 4120 5343 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931301.1 protein_id gnl|my_center|LOCUS_30840 5437 6840 gene locus_tag LOCUS_30850 5437 6840 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_30850 7024 7872 gene locus_tag LOCUS_30860 7024 7872 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066198.1 protein_id gnl|my_center|LOCUS_30860 7929 9848 gene locus_tag LOCUS_30870 7929 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 9908 10846 gene locus_tag LOCUS_30880 9908 10846 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337437.1 protein_id gnl|my_center|LOCUS_30880 10962 11966 gene locus_tag LOCUS_30890 10962 11966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_30890 13296 12127 gene locus_tag LOCUS_30900 gene tgt 13296 12127 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_30900 14482 14288 gene locus_tag LOCUS_30910 14482 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 14756 17563 gene locus_tag LOCUS_30920 14756 17563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 18314 18721 gene locus_tag LOCUS_30930 18314 18721 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_30930 18898 19611 gene locus_tag LOCUS_30940 18898 19611 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_30940 19654 20379 gene locus_tag LOCUS_30950 19654 20379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 20451 21218 gene locus_tag LOCUS_30960 20451 21218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 21230 22570 gene locus_tag LOCUS_30970 21230 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615918.1 protein_id gnl|my_center|LOCUS_30970 23434 22685 gene locus_tag LOCUS_30980 23434 22685 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_30980 24348 23446 gene locus_tag LOCUS_30990 24348 23446 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209809385.1 protein_id gnl|my_center|LOCUS_30990 24641 25102 gene locus_tag LOCUS_31000 24641 25102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 25153 25527 gene locus_tag LOCUS_31010 25153 25527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 25726 25499 gene locus_tag LOCUS_31020 25726 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 26118 25744 gene locus_tag LOCUS_31030 26118 25744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 27023 26664 gene locus_tag LOCUS_31040 27023 26664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 27311 27730 gene locus_tag LOCUS_31050 gene tnpA 27311 27730 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435056.1 protein_id gnl|my_center|LOCUS_31050 27727 28842 gene locus_tag LOCUS_31060 27727 28842 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403412.1 protein_id gnl|my_center|LOCUS_31060 28823 28960 gene locus_tag LOCUS_31070 28823 28960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 29731 28970 gene locus_tag LOCUS_31080 29731 28970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 30785 29778 gene locus_tag LOCUS_31090 30785 29778 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_31090 31789 30791 gene locus_tag LOCUS_31100 31789 30791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 32400 33230 gene locus_tag LOCUS_31110 32400 33230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 33671 34288 gene locus_tag LOCUS_31120 33671 34288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 34355 36205 gene locus_tag LOCUS_31130 34355 36205 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_31130 36268 36636 gene locus_tag LOCUS_31140 36268 36636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 36744 37181 gene locus_tag LOCUS_31150 36744 37181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence055 86 547 gene locus_tag LOCUS_31160 86 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1811 627 gene locus_tag LOCUS_31170 1811 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2924 1812 gene locus_tag LOCUS_31180 gene xylF 2924 1812 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_31180 4210 2945 gene locus_tag LOCUS_31190 4210 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 4379 4478 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4683 5744 gene locus_tag LOCUS_31200 4683 5744 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256666.1 protein_id gnl|my_center|LOCUS_31200 6114 6881 gene locus_tag LOCUS_31210 6114 6881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 protein_id gnl|my_center|LOCUS_31210 6871 7902 gene locus_tag LOCUS_31220 6871 7902 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693803.1 protein_id gnl|my_center|LOCUS_31220 8097 9233 gene locus_tag LOCUS_31230 gene thiO 8097 9233 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_31230 9298 9504 gene locus_tag LOCUS_31240 gene thiS 9298 9504 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062394.1 protein_id gnl|my_center|LOCUS_31240 9619 10044 gene locus_tag LOCUS_31250 9619 10044 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_31250 10047 10352 gene locus_tag LOCUS_31260 10047 10352 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_31260 10369 11139 gene locus_tag LOCUS_31270 10369 11139 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403988.1 protein_id gnl|my_center|LOCUS_31270 11132 11632 gene locus_tag LOCUS_31280 11132 11632 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_31280 11607 12056 gene locus_tag LOCUS_31290 11607 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 12084 13319 gene locus_tag LOCUS_31300 12084 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 14890 13361 gene locus_tag LOCUS_31310 14890 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 15114 16448 gene locus_tag LOCUS_31320 gene glnT 15114 16448 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_31320 16775 17929 gene locus_tag LOCUS_31330 16775 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 18325 18014 gene locus_tag LOCUS_31340 18325 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 18583 18383 gene locus_tag LOCUS_31350 18583 18383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 19870 18824 gene locus_tag LOCUS_31360 19870 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 21824 19944 gene locus_tag LOCUS_31370 21824 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 24347 21897 gene locus_tag LOCUS_31380 24347 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 26868 24370 gene locus_tag LOCUS_31390 26868 24370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31390 27987 26893 gene locus_tag LOCUS_31400 27987 26893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31400 29001 28402 gene locus_tag LOCUS_31410 29001 28402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 30745 29099 gene locus_tag LOCUS_31420 30745 29099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 29107 29206 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33320 30747 gene locus_tag LOCUS_31430 33320 30747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 30753 30852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 33962 33585 gene locus_tag LOCUS_31440 33962 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 34218 34000 gene locus_tag LOCUS_31450 34218 34000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 35976 34312 gene locus_tag LOCUS_31460 35976 34312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 36824 36027 gene locus_tag LOCUS_31470 36824 36027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 37116 36874 gene locus_tag LOCUS_31480 37116 36874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence056 1586 2824 gene locus_tag LOCUS_31490 1586 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 2951 5305 gene locus_tag LOCUS_31500 gene vpsO 2951 5305 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_31500 6171 5329 gene locus_tag LOCUS_31510 6171 5329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356209.1 protein_id gnl|my_center|LOCUS_31510 7361 6279 gene locus_tag LOCUS_31520 7361 6279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583515.1 protein_id gnl|my_center|LOCUS_31520 7543 8955 gene locus_tag LOCUS_31530 7543 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 8975 10669 gene locus_tag LOCUS_31540 8975 10669 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_31540 10681 11718 gene locus_tag LOCUS_31550 10681 11718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 11779 12810 gene locus_tag LOCUS_31560 11779 12810 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933927.1 protein_id gnl|my_center|LOCUS_31560 13850 12852 gene locus_tag LOCUS_31570 13850 12852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_31570 14748 13852 gene locus_tag LOCUS_31580 14748 13852 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_31580 16031 14835 gene locus_tag LOCUS_31590 16031 14835 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_31590 17026 16223 gene locus_tag LOCUS_31600 17026 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 17718 17131 gene locus_tag LOCUS_31610 17718 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 17972 18262 gene locus_tag LOCUS_31620 17972 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 19143 18340 gene locus_tag LOCUS_31630 19143 18340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 19404 20135 gene locus_tag LOCUS_31640 gene kdsB 19404 20135 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_31640 20273 21928 gene locus_tag LOCUS_31650 20273 21928 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947977.1 protein_id gnl|my_center|LOCUS_31650 22096 23361 gene locus_tag LOCUS_31660 22096 23361 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877563.1 protein_id gnl|my_center|LOCUS_31660 23498 24757 gene locus_tag LOCUS_31670 23498 24757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 24764 25330 gene locus_tag LOCUS_31680 24764 25330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 25330 26616 gene locus_tag LOCUS_31690 25330 26616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 27507 26716 gene locus_tag LOCUS_31700 27507 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 27816 27568 gene locus_tag LOCUS_31710 27816 27568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 28343 27813 gene locus_tag LOCUS_31720 28343 27813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 29784 28642 gene locus_tag LOCUS_31730 29784 28642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 30498 29824 gene locus_tag LOCUS_31740 30498 29824 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_31740 31332 30700 gene locus_tag LOCUS_31750 31332 30700 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090877.1 protein_id gnl|my_center|LOCUS_31750 32110 31322 gene locus_tag LOCUS_31760 32110 31322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 34420 32627 gene locus_tag LOCUS_31770 34420 32627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 34558 34764 gene locus_tag LOCUS_31780 34558 34764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 35639 34782 gene locus_tag LOCUS_31790 35639 34782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence057 1708 704 gene locus_tag LOCUS_31800 1708 704 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_31800 3026 1869 gene locus_tag LOCUS_31810 3026 1869 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_31810 3206 3964 gene locus_tag LOCUS_31820 3206 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3983 5002 gene locus_tag LOCUS_31830 3983 5002 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_31830 5510 6208 gene locus_tag LOCUS_31840 5510 6208 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_31840 9449 6336 gene locus_tag LOCUS_31850 9449 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 11512 10541 gene locus_tag LOCUS_31860 11512 10541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 12324 11539 gene locus_tag LOCUS_31870 12324 11539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 14726 12519 gene locus_tag LOCUS_31880 14726 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 17139 14902 gene locus_tag LOCUS_31890 17139 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 18326 17490 gene locus_tag LOCUS_31900 18326 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 19270 18431 gene locus_tag LOCUS_31910 19270 18431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 20635 19283 gene locus_tag LOCUS_31920 20635 19283 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966541.1 protein_id gnl|my_center|LOCUS_31920 21583 20864 gene locus_tag LOCUS_31930 21583 20864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 21793 22728 gene locus_tag LOCUS_31940 21793 22728 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_31940 25929 22912 gene locus_tag LOCUS_31950 25929 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 26811 26071 gene locus_tag LOCUS_31960 26811 26071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 28146 27118 gene locus_tag LOCUS_31970 28146 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 29680 28280 gene locus_tag LOCUS_31980 29680 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 33741 29914 gene locus_tag LOCUS_31990 33741 29914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 35140 33914 gene locus_tag LOCUS_32000 35140 33914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence058 344 1132 gene locus_tag LOCUS_32010 344 1132 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 protein_id gnl|my_center|LOCUS_32010 1831 1205 gene locus_tag LOCUS_32020 1831 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 4852 1940 gene locus_tag LOCUS_32030 4852 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 5820 4990 gene locus_tag LOCUS_32040 gene srlD 5820 4990 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_32040 6033 5842 gene locus_tag LOCUS_32050 6033 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 7769 6018 gene locus_tag LOCUS_32060 7769 6018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_32060 9523 7766 gene locus_tag LOCUS_32070 9523 7766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_32070 10508 9753 gene locus_tag LOCUS_32080 10508 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 10649 10783 gene locus_tag LOCUS_32090 10649 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 10831 11520 gene locus_tag LOCUS_32100 gene coaE 10831 11520 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_32100 11523 12455 gene locus_tag LOCUS_32110 11523 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 12641 14275 gene locus_tag LOCUS_32120 12641 14275 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_32120 15711 14638 gene locus_tag LOCUS_32130 gene modC 15711 14638 CDS product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694180.1 protein_id gnl|my_center|LOCUS_32130 16511 15846 gene locus_tag LOCUS_32140 gene modB 16511 15846 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_32140 17293 16508 gene locus_tag LOCUS_32150 gene modA 17293 16508 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 protein_id gnl|my_center|LOCUS_32150 17596 18402 gene locus_tag LOCUS_32160 17596 18402 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877687.1 protein_id gnl|my_center|LOCUS_32160 18457 19083 gene locus_tag LOCUS_32170 18457 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 19111 20040 gene locus_tag LOCUS_32180 19111 20040 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_32180 20213 21475 gene locus_tag LOCUS_32190 20213 21475 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_32190 21506 22546 gene locus_tag LOCUS_32200 21506 22546 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_32200 22560 23351 gene locus_tag LOCUS_32210 22560 23351 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_32210 23461 23826 gene locus_tag LOCUS_32220 23461 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 23953 24768 gene locus_tag LOCUS_32230 23953 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 24787 25521 gene locus_tag LOCUS_32240 24787 25521 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_32240 26591 25539 gene locus_tag LOCUS_32250 26591 25539 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_32250 27092 26595 gene locus_tag LOCUS_32260 27092 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 27442 27095 gene locus_tag LOCUS_32270 27442 27095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 29246 27561 gene locus_tag LOCUS_32280 29246 27561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 29495 31294 gene locus_tag LOCUS_32290 29495 31294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 31496 32164 gene locus_tag LOCUS_32300 31496 32164 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_32300 32194 34374 gene locus_tag LOCUS_32310 32194 34374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence059 109 711 gene locus_tag LOCUS_32320 109 711 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_32320 744 1967 gene locus_tag LOCUS_32330 744 1967 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_32330 1973 2263 gene locus_tag LOCUS_32340 1973 2263 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_32340 2232 2471 gene locus_tag LOCUS_32350 2232 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2679 4787 gene locus_tag LOCUS_32360 2679 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 4888 6771 gene locus_tag LOCUS_32370 4888 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 7003 7341 gene locus_tag LOCUS_32380 7003 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 7400 8023 gene locus_tag LOCUS_32390 7400 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 8393 9943 gene locus_tag LOCUS_32400 8393 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 9969 11000 gene locus_tag LOCUS_32410 9969 11000 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_32410 11008 12573 gene locus_tag LOCUS_32420 11008 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 12653 13399 gene locus_tag LOCUS_32430 12653 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 13436 14161 gene locus_tag LOCUS_32440 13436 14161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_32440 14165 15817 gene locus_tag LOCUS_32450 14165 15817 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_32450 15814 17646 gene locus_tag LOCUS_32460 15814 17646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 17650 18873 gene locus_tag LOCUS_32470 17650 18873 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 protein_id gnl|my_center|LOCUS_32470 18992 19405 gene locus_tag LOCUS_32480 gene msrB 18992 19405 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144007.1 protein_id gnl|my_center|LOCUS_32480 19563 20783 gene locus_tag LOCUS_32490 19563 20783 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890820.1 protein_id gnl|my_center|LOCUS_32490 21042 21905 gene locus_tag LOCUS_32500 21042 21905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 21971 22900 gene locus_tag LOCUS_32510 21971 22900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 23067 23852 gene locus_tag LOCUS_32520 23067 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 25965 23863 gene locus_tag LOCUS_32530 25965 23863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 27075 27656 gene locus_tag LOCUS_32540 27075 27656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 28196 28014 gene locus_tag LOCUS_32550 28196 28014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 28766 28359 gene locus_tag LOCUS_32560 28766 28359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 29432 28893 gene locus_tag LOCUS_32570 29432 28893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 30064 31281 gene locus_tag LOCUS_32580 30064 31281 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 protein_id gnl|my_center|LOCUS_32580 31325 32269 gene locus_tag LOCUS_32590 gene mdh 31325 32269 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_32590 32455 32943 gene locus_tag LOCUS_32600 32455 32943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 32936 33181 gene locus_tag LOCUS_32610 32936 33181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 33749 34018 gene locus_tag LOCUS_32620 33749 34018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 34262 34690 gene locus_tag LOCUS_32630 34262 34690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence060 1586 816 gene locus_tag LOCUS_32640 1586 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 3346 1712 gene locus_tag LOCUS_32650 3346 1712 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085891.1 protein_id gnl|my_center|LOCUS_32650 4215 3403 gene locus_tag LOCUS_32660 4215 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 5052 4240 gene locus_tag LOCUS_32670 5052 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 6158 5124 gene locus_tag LOCUS_32680 6158 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 6356 7483 gene locus_tag LOCUS_32690 6356 7483 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_32690 7712 8512 gene locus_tag LOCUS_32700 7712 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 8646 9707 gene locus_tag LOCUS_32710 8646 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 9812 11425 gene locus_tag LOCUS_32720 9812 11425 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_32720 12313 11486 gene locus_tag LOCUS_32730 12313 11486 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_32730 12664 13707 gene locus_tag LOCUS_32740 12664 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 13815 14447 gene locus_tag LOCUS_32750 13815 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 14465 14989 gene locus_tag LOCUS_32760 14465 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 15111 16184 gene locus_tag LOCUS_32770 15111 16184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 16685 16329 gene locus_tag LOCUS_32780 16685 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32780 17000 16806 gene locus_tag LOCUS_32790 17000 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 17271 19400 gene locus_tag LOCUS_32800 17271 19400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 19477 21102 gene locus_tag LOCUS_32810 19477 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 21214 23004 gene locus_tag LOCUS_32820 21214 23004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 23069 23299 gene locus_tag LOCUS_32830 23069 23299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 24498 23323 gene locus_tag LOCUS_32840 24498 23323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 25832 24639 gene locus_tag LOCUS_32850 25832 24639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 26506 26015 gene locus_tag LOCUS_32860 26506 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 27437 26499 gene locus_tag LOCUS_32870 27437 26499 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_32870 27928 27509 gene locus_tag LOCUS_32880 27928 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 29764 27935 gene locus_tag LOCUS_32890 29764 27935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 30202 29795 gene locus_tag LOCUS_32900 30202 29795 CDS product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259009.1 protein_id gnl|my_center|LOCUS_32900 30477 30190 gene locus_tag LOCUS_32910 30477 30190 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_32910 31878 30490 gene locus_tag LOCUS_32920 31878 30490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 32374 32072 gene locus_tag LOCUS_32930 32374 32072 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704380.1 protein_id gnl|my_center|LOCUS_32930 32515 33102 gene locus_tag LOCUS_32940 32515 33102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence061 378 148 gene locus_tag LOCUS_32950 378 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 687 400 gene locus_tag LOCUS_32960 687 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 1045 713 gene locus_tag LOCUS_32970 1045 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 1579 2304 gene locus_tag LOCUS_32980 1579 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 2453 3712 gene locus_tag LOCUS_32990 2453 3712 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_32990 5078 3951 gene locus_tag LOCUS_33000 gene ogl 5078 3951 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_33000 5400 5158 gene locus_tag LOCUS_33010 5400 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 5601 5413 gene locus_tag LOCUS_33020 5601 5413 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_33020 6516 5689 gene locus_tag LOCUS_33030 6516 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 6657 7565 gene locus_tag LOCUS_33040 6657 7565 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_33040 7549 8349 gene locus_tag LOCUS_33050 7549 8349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256330.1 protein_id gnl|my_center|LOCUS_33050 9313 8423 gene locus_tag LOCUS_33060 9313 8423 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 protein_id gnl|my_center|LOCUS_33060 10907 9354 gene locus_tag LOCUS_33070 10907 9354 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_33070 11347 12174 gene locus_tag LOCUS_33080 11347 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 13979 12390 gene locus_tag LOCUS_33090 13979 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 14307 15065 gene locus_tag LOCUS_33100 14307 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 15084 16064 gene locus_tag LOCUS_33110 15084 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 16121 16333 gene locus_tag LOCUS_33120 16121 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 17335 16283 gene locus_tag LOCUS_33130 17335 16283 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930984.1 protein_id gnl|my_center|LOCUS_33130 18435 17449 gene locus_tag LOCUS_33140 18435 17449 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123020.1 protein_id gnl|my_center|LOCUS_33140 18684 19523 gene locus_tag LOCUS_33150 18684 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 19670 20428 gene locus_tag LOCUS_33160 19670 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 20659 22077 gene locus_tag LOCUS_33170 gene betC 20659 22077 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_33170 22677 22210 gene locus_tag LOCUS_33180 22677 22210 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_33180 24145 22718 gene locus_tag LOCUS_33190 24145 22718 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461040.1 protein_id gnl|my_center|LOCUS_33190 24523 27606 gene locus_tag LOCUS_33200 24523 27606 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_33200 27661 29100 gene locus_tag LOCUS_33210 27661 29100 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_33210 29157 30440 gene locus_tag LOCUS_33220 29157 30440 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_33220 30516 31547 gene locus_tag LOCUS_33230 30516 31547 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_33230 32617 31766 gene locus_tag LOCUS_33240 32617 31766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 >Feature sequence062 1018 239 gene locus_tag LOCUS_33250 1018 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 3162 1015 gene locus_tag LOCUS_33260 3162 1015 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840110.1 protein_id gnl|my_center|LOCUS_33260 4559 3162 gene locus_tag LOCUS_33270 4559 3162 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_33270 5120 4863 gene locus_tag LOCUS_33280 5120 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 7361 5310 gene locus_tag LOCUS_33290 gene uvrB 7361 5310 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_33290 8632 8015 gene locus_tag LOCUS_33300 gene rpoE 8632 8015 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_33300 10042 8666 gene locus_tag LOCUS_33310 10042 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 12395 10140 gene locus_tag LOCUS_33320 12395 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 13213 12479 gene locus_tag LOCUS_33330 13213 12479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_33330 14687 13257 gene locus_tag LOCUS_33340 14687 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 15169 17889 gene locus_tag LOCUS_33350 15169 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 20615 18144 gene locus_tag LOCUS_33360 20615 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 21369 20674 gene locus_tag LOCUS_33370 21369 20674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 21545 22210 gene locus_tag LOCUS_33380 gene lexA 21545 22210 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_33380 23024 22275 gene locus_tag LOCUS_33390 23024 22275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 24038 23055 gene locus_tag LOCUS_33400 gene waaF 24038 23055 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_33400 25004 24129 gene locus_tag LOCUS_33410 25004 24129 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_33410 26258 25383 gene locus_tag LOCUS_33420 26258 25383 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_33420 26626 26967 gene locus_tag LOCUS_33430 26626 26967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 29866 27245 gene locus_tag LOCUS_33440 29866 27245 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_33440 >Feature sequence063 601 1881 gene locus_tag LOCUS_33450 gene larA 601 1881 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_33450 2070 2630 gene locus_tag LOCUS_33460 2070 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 2648 3442 gene locus_tag LOCUS_33470 gene minD 2648 3442 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_33470 3454 3726 gene locus_tag LOCUS_33480 gene minE 3454 3726 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869948.1 protein_id gnl|my_center|LOCUS_33480 4609 3794 gene locus_tag LOCUS_33490 4609 3794 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_33490 5751 4633 gene locus_tag LOCUS_33500 5751 4633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970664.1 protein_id gnl|my_center|LOCUS_33500 6444 5866 gene locus_tag LOCUS_33510 6444 5866 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023081.1 protein_id gnl|my_center|LOCUS_33510 7114 9957 gene locus_tag LOCUS_33520 7114 9957 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_33520 10388 11761 gene locus_tag LOCUS_33530 10388 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202177.1 protein_id gnl|my_center|LOCUS_33530 11748 12266 gene locus_tag LOCUS_33540 11748 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 12385 13302 gene locus_tag LOCUS_33550 12385 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 14817 13510 gene locus_tag LOCUS_33560 14817 13510 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_33560 15328 15717 gene locus_tag LOCUS_33570 15328 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 18015 15826 gene locus_tag LOCUS_33580 gene katG 18015 15826 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_33580 18394 20634 gene locus_tag LOCUS_33590 18394 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 20754 21872 gene locus_tag LOCUS_33600 20754 21872 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_33600 22271 24592 gene locus_tag LOCUS_33610 22271 24592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_33610 24595 25164 gene locus_tag LOCUS_33620 24595 25164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 25275 26654 gene locus_tag LOCUS_33630 25275 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 26998 26651 gene locus_tag LOCUS_33640 26998 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 27917 27093 gene locus_tag LOCUS_33650 27917 27093 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065132.1 protein_id gnl|my_center|LOCUS_33650 29036 27966 gene locus_tag LOCUS_33660 29036 27966 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_33660 31026 29167 gene locus_tag LOCUS_33670 31026 29167 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403201.1 protein_id gnl|my_center|LOCUS_33670 31631 31098 gene locus_tag LOCUS_33680 31631 31098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 32071 31643 gene locus_tag LOCUS_33690 32071 31643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 32289 32110 gene locus_tag LOCUS_33700 32289 32110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence064 638 976 gene locus_tag LOCUS_33710 638 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 1045 2148 gene locus_tag LOCUS_33720 gene ribD 1045 2148 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_33720 2150 2821 gene locus_tag LOCUS_33730 2150 2821 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392433.1 protein_id gnl|my_center|LOCUS_33730 3094 4326 gene locus_tag LOCUS_33740 3094 4326 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_33740 4520 5005 gene locus_tag LOCUS_33750 gene ribE 4520 5005 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_33750 5065 5679 gene locus_tag LOCUS_33760 gene hisH 5065 5679 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937594.1 protein_id gnl|my_center|LOCUS_33760 5850 7427 gene locus_tag LOCUS_33770 5850 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 7478 8896 gene locus_tag LOCUS_33780 gene gnfM 7478 8896 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_33780 9047 9361 gene locus_tag LOCUS_33790 gene pduN 9047 9361 CDS product propanediol utilization microcompartment protein PduN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549827.1 protein_id gnl|my_center|LOCUS_33790 9544 9849 gene locus_tag LOCUS_33800 9544 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 9846 10442 gene locus_tag LOCUS_33810 9846 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 10670 15757 gene locus_tag LOCUS_33820 10670 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 16637 16861 gene locus_tag LOCUS_33830 16637 16861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 17120 17833 gene locus_tag LOCUS_33840 17120 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 17830 18426 gene locus_tag LOCUS_33850 17830 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 19311 19410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19489 19821 gene locus_tag LOCUS_33860 19489 19821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 19830 20609 gene locus_tag LOCUS_33870 19830 20609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 20606 21967 gene locus_tag LOCUS_33880 20606 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 23097 22120 gene locus_tag LOCUS_33890 23097 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 23687 23127 gene locus_tag LOCUS_33900 23687 23127 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206978.1 protein_id gnl|my_center|LOCUS_33900 23861 24325 gene locus_tag LOCUS_33910 gene ndk 23861 24325 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_33910 24485 25255 gene locus_tag LOCUS_33920 24485 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 25327 26097 gene locus_tag LOCUS_33930 25327 26097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 27785 26190 gene locus_tag LOCUS_33940 27785 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 29464 27782 gene locus_tag LOCUS_33950 29464 27782 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_33950 29831 30589 gene locus_tag LOCUS_33960 29831 30589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 31115 30837 gene locus_tag LOCUS_33970 31115 30837 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_33970 >Feature sequence065 192 31 gene locus_tag LOCUS_33980 192 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 1190 375 gene locus_tag LOCUS_33990 1190 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 2188 1433 gene locus_tag LOCUS_34000 2188 1433 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_34000 3205 2240 gene locus_tag LOCUS_34010 3205 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3665 4459 gene locus_tag LOCUS_34020 3665 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 4681 6501 gene locus_tag LOCUS_34030 4681 6501 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_34030 6930 7760 gene locus_tag LOCUS_34040 6930 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 8171 8998 gene locus_tag LOCUS_34050 8171 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 9181 10257 gene locus_tag LOCUS_34060 9181 10257 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_34060 10517 11350 gene locus_tag LOCUS_34070 10517 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 11452 12084 gene locus_tag LOCUS_34080 11452 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 12098 13792 gene locus_tag LOCUS_34090 12098 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 13985 14491 gene locus_tag LOCUS_34100 13985 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 15508 16383 gene locus_tag LOCUS_34110 gene yhdJ 15508 16383 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258951.1 protein_id gnl|my_center|LOCUS_34110 16939 17286 gene locus_tag LOCUS_34120 16939 17286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 17321 18073 gene locus_tag LOCUS_34130 gene cas6 17321 18073 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_34130 18150 19526 gene locus_tag LOCUS_34140 gene cas8a1 18150 19526 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023575.1 protein_id gnl|my_center|LOCUS_34140 19547 20587 gene locus_tag LOCUS_34150 gene cas7i 19547 20587 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_34150 20578 21306 gene locus_tag LOCUS_34160 gene cas5b 20578 21306 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023573.1 protein_id gnl|my_center|LOCUS_34160 22058 24310 gene locus_tag LOCUS_34170 22058 24310 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065767.1 protein_id gnl|my_center|LOCUS_34170 24336 24845 gene locus_tag LOCUS_34180 gene cas4 24336 24845 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545751.1 protein_id gnl|my_center|LOCUS_34180 24923 25939 gene locus_tag LOCUS_34190 gene cas1b 24923 25939 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_34190 26051 25887 gene locus_tag LOCUS_34200 26051 25887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 26050 26313 gene locus_tag LOCUS_34210 gene cas2 26050 26313 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249400.1 protein_id gnl|my_center|LOCUS_34210 26572 29856 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttaatcgaaccagtatggaatcgaaac >Feature sequence066 1549 950 gene locus_tag LOCUS_34220 1549 950 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085955.1 protein_id gnl|my_center|LOCUS_34220 2966 1572 gene locus_tag LOCUS_34230 2966 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 4129 3101 gene locus_tag LOCUS_34240 4129 3101 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_34240 5496 4264 gene locus_tag LOCUS_34250 5496 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 6493 5765 gene locus_tag LOCUS_34260 6493 5765 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_34260 7354 6497 gene locus_tag LOCUS_34270 gene yihU 7354 6497 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099368.1 protein_id gnl|my_center|LOCUS_34270 7962 9359 gene locus_tag LOCUS_34280 7962 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 9552 9794 gene locus_tag LOCUS_34290 9552 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 10822 10001 gene locus_tag LOCUS_34300 10822 10001 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271588.1 protein_id gnl|my_center|LOCUS_34300 10908 11765 gene locus_tag LOCUS_34310 gene mtnP 10908 11765 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_34310 13079 11742 gene locus_tag LOCUS_34320 13079 11742 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886456.1 protein_id gnl|my_center|LOCUS_34320 14937 13228 gene locus_tag LOCUS_34330 gene argS 14937 13228 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_34330 16229 15519 gene locus_tag LOCUS_34340 16229 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 17419 16217 gene locus_tag LOCUS_34350 17419 16217 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391496.1 protein_id gnl|my_center|LOCUS_34350 18898 17492 gene locus_tag LOCUS_34360 18898 17492 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072626.1 protein_id gnl|my_center|LOCUS_34360 19500 18898 gene locus_tag LOCUS_34370 19500 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 21604 19502 gene locus_tag LOCUS_34380 21604 19502 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_34380 21784 22599 gene locus_tag LOCUS_34390 gene dppA 21784 22599 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 protein_id gnl|my_center|LOCUS_34390 23018 22596 gene locus_tag LOCUS_34400 gene gloA 23018 22596 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017084654.1 protein_id gnl|my_center|LOCUS_34400 23216 24595 gene locus_tag LOCUS_34410 23216 24595 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_34410 24605 25768 gene locus_tag LOCUS_34420 24605 25768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 25749 26420 gene locus_tag LOCUS_34430 25749 26420 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_34430 26626 27621 gene locus_tag LOCUS_34440 26626 27621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 27745 29730 gene locus_tag LOCUS_34450 27745 29730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 29786 30052 gene locus_tag LOCUS_34460 29786 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence067 536 1489 gene locus_tag LOCUS_34470 536 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 4618 1574 gene locus_tag LOCUS_34480 4618 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 5902 4814 gene locus_tag LOCUS_34490 5902 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 7564 6248 gene locus_tag LOCUS_34500 7564 6248 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_34500 9199 7757 gene locus_tag LOCUS_34510 9199 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 10083 9313 gene locus_tag LOCUS_34520 10083 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 11050 10229 gene locus_tag LOCUS_34530 gene prcB 11050 10229 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_34530 11320 11123 gene locus_tag LOCUS_34540 11320 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 12965 11451 gene locus_tag LOCUS_34550 gene dop 12965 11451 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_34550 14936 13113 gene locus_tag LOCUS_34560 gene arc 14936 13113 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_34560 15281 17056 gene locus_tag LOCUS_34570 15281 17056 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_34570 18254 17307 gene locus_tag LOCUS_34580 18254 17307 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226710.1 protein_id gnl|my_center|LOCUS_34580 22508 18387 gene locus_tag LOCUS_34590 22508 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 25098 22876 gene locus_tag LOCUS_34600 25098 22876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 26390 25452 gene locus_tag LOCUS_34610 26390 25452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 27463 26420 gene locus_tag LOCUS_34620 27463 26420 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887392.1 protein_id gnl|my_center|LOCUS_34620 28247 27636 gene locus_tag LOCUS_34630 28247 27636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 29615 28437 gene locus_tag LOCUS_34640 29615 28437 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_34640 >Feature sequence068 334 1140 gene locus_tag LOCUS_34650 334 1140 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_34650 1426 3348 gene locus_tag LOCUS_34660 1426 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 3578 4735 gene locus_tag LOCUS_34670 3578 4735 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_34670 5819 4890 gene locus_tag LOCUS_34680 5819 4890 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338290.1 protein_id gnl|my_center|LOCUS_34680 6040 5825 gene locus_tag LOCUS_34690 6040 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 7037 6153 gene locus_tag LOCUS_34700 7037 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 8346 7186 gene locus_tag LOCUS_34710 gene dgoD 8346 7186 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_34710 8586 9428 gene locus_tag LOCUS_34720 8586 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 9458 10711 gene locus_tag LOCUS_34730 9458 10711 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_34730 10708 11184 gene locus_tag LOCUS_34740 10708 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 11955 11203 gene locus_tag LOCUS_34750 11955 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 12828 11959 gene locus_tag LOCUS_34760 12828 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 12812 14422 gene locus_tag LOCUS_34770 12812 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 14482 15546 gene locus_tag LOCUS_34780 14482 15546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 15557 16681 gene locus_tag LOCUS_34790 gene dgoD 15557 16681 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_34790 17001 16711 gene locus_tag LOCUS_34800 17001 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 17627 17058 gene locus_tag LOCUS_34810 17627 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 19022 17643 gene locus_tag LOCUS_34820 19022 17643 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_34820 19348 19130 gene locus_tag LOCUS_34830 19348 19130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 20422 19370 gene locus_tag LOCUS_34840 20422 19370 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338403.1 protein_id gnl|my_center|LOCUS_34840 21459 20401 gene locus_tag LOCUS_34850 21459 20401 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_34850 22051 21770 gene locus_tag LOCUS_34860 22051 21770 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_34860 22757 23758 gene locus_tag LOCUS_34870 22757 23758 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_34870 23775 24911 gene locus_tag LOCUS_34880 gene mtnK 23775 24911 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542720.1 protein_id gnl|my_center|LOCUS_34880 24949 25815 gene locus_tag LOCUS_34890 24949 25815 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261738.1 protein_id gnl|my_center|LOCUS_34890 25973 26230 gene locus_tag LOCUS_34900 25973 26230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 26236 26811 gene locus_tag LOCUS_34910 gene ymdB 26236 26811 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203944.1 protein_id gnl|my_center|LOCUS_34910 26886 28028 gene locus_tag LOCUS_34920 26886 28028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 28025 29212 gene locus_tag LOCUS_34930 28025 29212 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_34930 >Feature sequence069 719 51 gene locus_tag LOCUS_34940 719 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 3060 1117 gene locus_tag LOCUS_34950 3060 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 3096 3515 gene locus_tag LOCUS_34960 3096 3515 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640094.1 protein_id gnl|my_center|LOCUS_34960 3557 3892 gene locus_tag LOCUS_34970 3557 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34970 5049 3853 gene locus_tag LOCUS_34980 5049 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 6306 5317 gene locus_tag LOCUS_34990 6306 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 7787 6345 gene locus_tag LOCUS_35000 7787 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 9641 8385 gene locus_tag LOCUS_35010 9641 8385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 12720 9673 gene locus_tag LOCUS_35020 12720 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 13246 12989 gene locus_tag LOCUS_35030 13246 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 14072 13731 gene locus_tag LOCUS_35040 14072 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 15236 14580 gene locus_tag LOCUS_35050 15236 14580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 17123 15282 gene locus_tag LOCUS_35060 17123 15282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_35060 18973 17138 gene locus_tag LOCUS_35070 18973 17138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_35070 19134 19952 gene locus_tag LOCUS_35080 19134 19952 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098362.1 protein_id gnl|my_center|LOCUS_35080 20168 21172 gene locus_tag LOCUS_35090 20168 21172 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_35090 22399 21230 gene locus_tag LOCUS_35100 22399 21230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 23482 22607 gene locus_tag LOCUS_35110 gene argB 23482 22607 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_35110 23678 24769 gene locus_tag LOCUS_35120 23678 24769 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120643.1 protein_id gnl|my_center|LOCUS_35120 27420 24991 gene locus_tag LOCUS_35130 27420 24991 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_35130 27907 29265 gene locus_tag LOCUS_35140 27907 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence070 848 126 gene locus_tag LOCUS_35150 848 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 1473 910 gene locus_tag LOCUS_35160 1473 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 2172 1765 gene locus_tag LOCUS_35170 2172 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 3279 2668 gene locus_tag LOCUS_35180 3279 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 4446 3295 gene locus_tag LOCUS_35190 4446 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 6125 4470 gene locus_tag LOCUS_35200 6125 4470 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_35200 7183 6131 gene locus_tag LOCUS_35210 7183 6131 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969225.1 protein_id gnl|my_center|LOCUS_35210 8168 7314 gene locus_tag LOCUS_35220 8168 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 9931 8303 gene locus_tag LOCUS_35230 gene ggt 9931 8303 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808651.1 protein_id gnl|my_center|LOCUS_35230 11395 10325 gene locus_tag LOCUS_35240 11395 10325 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061829.1 protein_id gnl|my_center|LOCUS_35240 12712 11558 gene locus_tag LOCUS_35250 12712 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 13408 13055 gene locus_tag LOCUS_35260 13408 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 14995 13538 gene locus_tag LOCUS_35270 14995 13538 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_35270 16309 15131 gene locus_tag LOCUS_35280 16309 15131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 17389 16409 gene locus_tag LOCUS_35290 17389 16409 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_35290 19029 17509 gene locus_tag LOCUS_35300 19029 17509 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_35300 20588 19299 gene locus_tag LOCUS_35310 20588 19299 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_35310 22991 21015 gene locus_tag LOCUS_35320 22991 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 24123 23035 gene locus_tag LOCUS_35330 24123 23035 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787054.1 protein_id gnl|my_center|LOCUS_35330 24430 24648 gene locus_tag LOCUS_35340 24430 24648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 24645 24914 gene locus_tag LOCUS_35350 24645 24914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_35350 25060 25623 gene locus_tag LOCUS_35360 25060 25623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 25667 26224 gene locus_tag LOCUS_35370 25667 26224 CDS product aminoglycoside nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123821061.1 protein_id gnl|my_center|LOCUS_35370 26916 26263 gene locus_tag LOCUS_35380 26916 26263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256632.1 protein_id gnl|my_center|LOCUS_35380 28374 26986 gene locus_tag LOCUS_35390 28374 26986 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256631.1 protein_id gnl|my_center|LOCUS_35390 >Feature sequence071 795 1907 gene locus_tag LOCUS_35400 795 1907 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_35400 2012 2833 gene locus_tag LOCUS_35410 2012 2833 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098513.1 protein_id gnl|my_center|LOCUS_35410 3347 4648 gene locus_tag LOCUS_35420 3347 4648 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_35420 4979 6280 gene locus_tag LOCUS_35430 4979 6280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_35430 6670 7974 gene locus_tag LOCUS_35440 6670 7974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_35440 7987 9306 gene locus_tag LOCUS_35450 gene skiZ 7987 9306 CDS product sporulation-delaying-protein transporter subunit SkiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232354.1 protein_id gnl|my_center|LOCUS_35450 9549 11462 gene locus_tag LOCUS_35460 9549 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 12310 11510 gene locus_tag LOCUS_35470 12310 11510 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_35470 12361 13122 gene locus_tag LOCUS_35480 12361 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 14390 13131 gene locus_tag LOCUS_35490 14390 13131 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870020.1 protein_id gnl|my_center|LOCUS_35490 15650 14700 gene locus_tag LOCUS_35500 15650 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 15868 15662 gene locus_tag LOCUS_35510 15868 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 17030 16350 gene locus_tag LOCUS_35520 17030 16350 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039537.1 protein_id gnl|my_center|LOCUS_35520 21427 17042 gene locus_tag LOCUS_35530 21427 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 21625 22824 gene locus_tag LOCUS_35540 21625 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 24051 22855 gene locus_tag LOCUS_35550 24051 22855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 24260 25822 gene locus_tag LOCUS_35560 24260 25822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 25797 26744 gene locus_tag LOCUS_35570 25797 26744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_35570 27018 26821 gene locus_tag LOCUS_35580 27018 26821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 27608 27060 gene locus_tag LOCUS_35590 27608 27060 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195801.1 protein_id gnl|my_center|LOCUS_35590 28317 27721 gene locus_tag LOCUS_35600 28317 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 >Feature sequence072 1116 412 gene locus_tag LOCUS_35610 1116 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 1613 1128 gene locus_tag LOCUS_35620 1613 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 2113 1694 gene locus_tag LOCUS_35630 2113 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 5581 2312 gene locus_tag LOCUS_35640 5581 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 7097 5661 gene locus_tag LOCUS_35650 7097 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 7782 7297 gene locus_tag LOCUS_35660 7782 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 8891 7779 gene locus_tag LOCUS_35670 8891 7779 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_35670 9498 8929 gene locus_tag LOCUS_35680 9498 8929 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926813.1 protein_id gnl|my_center|LOCUS_35680 9897 9628 gene locus_tag LOCUS_35690 9897 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 10313 12421 gene locus_tag LOCUS_35700 10313 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 13081 12452 gene locus_tag LOCUS_35710 13081 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 13767 13249 gene locus_tag LOCUS_35720 13767 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35720 14264 13854 gene locus_tag LOCUS_35730 14264 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35730 15402 14338 gene locus_tag LOCUS_35740 15402 14338 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089310.1 protein_id gnl|my_center|LOCUS_35740 15981 15493 gene locus_tag LOCUS_35750 15981 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 16621 16112 gene locus_tag LOCUS_35760 16621 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 16812 18428 gene locus_tag LOCUS_35770 16812 18428 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_35770 18851 18534 gene locus_tag LOCUS_35780 18851 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 19410 18877 gene locus_tag LOCUS_35790 19410 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 20224 19427 gene locus_tag LOCUS_35800 20224 19427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 20516 20241 gene locus_tag LOCUS_35810 20516 20241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 21235 20513 gene locus_tag LOCUS_35820 21235 20513 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_35820 22129 21296 gene locus_tag LOCUS_35830 22129 21296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 22986 22273 gene locus_tag LOCUS_35840 22986 22273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 23746 22976 gene locus_tag LOCUS_35850 23746 22976 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584085.1 protein_id gnl|my_center|LOCUS_35850 24464 23805 gene locus_tag LOCUS_35860 24464 23805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 24893 24519 gene locus_tag LOCUS_35870 24893 24519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 25220 24900 gene locus_tag LOCUS_35880 25220 24900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 26119 25352 gene locus_tag LOCUS_35890 26119 25352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 27604 27464 gene locus_tag LOCUS_35900 27604 27464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 >Feature sequence073 953 324 gene locus_tag LOCUS_35910 953 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 1412 1029 gene locus_tag LOCUS_35920 1412 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 2118 3533 gene locus_tag LOCUS_35930 2118 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 3605 5905 gene locus_tag LOCUS_35940 3605 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 6258 7289 gene locus_tag LOCUS_35950 6258 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 7282 9435 gene locus_tag LOCUS_35960 7282 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 9676 10728 gene locus_tag LOCUS_35970 9676 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 12774 10810 gene locus_tag LOCUS_35980 12774 10810 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_35980 14332 12992 gene locus_tag LOCUS_35990 14332 12992 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940757.1 protein_id gnl|my_center|LOCUS_35990 16259 14460 gene locus_tag LOCUS_36000 16259 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 17812 16340 gene locus_tag LOCUS_36010 17812 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 18095 19048 gene locus_tag LOCUS_36020 18095 19048 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_36020 19158 20627 gene locus_tag LOCUS_36030 19158 20627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 20687 21883 gene locus_tag LOCUS_36040 20687 21883 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021436.1 protein_id gnl|my_center|LOCUS_36040 21930 25100 gene locus_tag LOCUS_36050 21930 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 25085 27424 gene locus_tag LOCUS_36060 25085 27424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence074 1546 4011 gene locus_tag LOCUS_36070 1546 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 4261 4500 gene locus_tag LOCUS_36080 4261 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 4479 4823 gene locus_tag LOCUS_36090 4479 4823 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_36090 4866 7349 gene locus_tag LOCUS_36100 4866 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 8552 7359 gene locus_tag LOCUS_36110 8552 7359 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_36110 9058 8555 gene locus_tag LOCUS_36120 9058 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 9586 10254 gene locus_tag LOCUS_36130 9586 10254 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_36130 10349 10960 gene locus_tag LOCUS_36140 10349 10960 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881413.1 protein_id gnl|my_center|LOCUS_36140 11035 11955 gene locus_tag LOCUS_36150 11035 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 11978 12847 gene locus_tag LOCUS_36160 11978 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 12867 14246 gene locus_tag LOCUS_36170 12867 14246 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921686.1 protein_id gnl|my_center|LOCUS_36170 14376 15611 gene locus_tag LOCUS_36180 14376 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 15601 16410 gene locus_tag LOCUS_36190 15601 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 18553 16607 gene locus_tag LOCUS_36200 18553 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 19532 18726 gene locus_tag LOCUS_36210 19532 18726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 19665 20855 gene locus_tag LOCUS_36220 19665 20855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 21188 21400 gene locus_tag LOCUS_36230 gene tatA 21188 21400 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631606.1 protein_id gnl|my_center|LOCUS_36230 21428 22249 gene locus_tag LOCUS_36240 21428 22249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 22249 23022 gene locus_tag LOCUS_36250 22249 23022 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228813.1 protein_id gnl|my_center|LOCUS_36250 23101 24252 gene locus_tag LOCUS_36260 23101 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 24273 24599 gene locus_tag LOCUS_36270 24273 24599 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_36270 24596 25351 gene locus_tag LOCUS_36280 gene pgeF 24596 25351 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_36280 25602 25904 gene locus_tag LOCUS_36290 25602 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 25970 26695 gene locus_tag LOCUS_36300 25970 26695 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_36300 26759 27571 gene locus_tag LOCUS_36310 gene proC 26759 27571 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_36310 >Feature sequence075 63 1577 gene locus_tag LOCUS_36320 63 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 2073 2432 gene locus_tag LOCUS_36330 2073 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 2444 2869 gene locus_tag LOCUS_36340 2444 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 3496 4539 gene locus_tag LOCUS_36350 3496 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 4556 5161 gene locus_tag LOCUS_36360 4556 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 5158 5865 gene locus_tag LOCUS_36370 5158 5865 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_36370 8500 5879 gene locus_tag LOCUS_36380 8500 5879 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928590.1 protein_id gnl|my_center|LOCUS_36380 9445 8681 gene locus_tag LOCUS_36390 9445 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 9824 10798 gene locus_tag LOCUS_36400 9824 10798 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700809.1 protein_id gnl|my_center|LOCUS_36400 12174 10825 gene locus_tag LOCUS_36410 12174 10825 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892321.1 protein_id gnl|my_center|LOCUS_36410 12781 12203 gene locus_tag LOCUS_36420 12781 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 13219 12806 gene locus_tag LOCUS_36430 13219 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 15486 13336 gene locus_tag LOCUS_36440 15486 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 17943 16399 gene locus_tag LOCUS_36450 17943 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 18407 18574 gene locus_tag LOCUS_36460 18407 18574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 18634 18861 gene locus_tag LOCUS_36470 18634 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 19037 18879 gene locus_tag LOCUS_36480 19037 18879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 19168 20334 gene locus_tag LOCUS_36490 gene rhmD 19168 20334 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297916.1 protein_id gnl|my_center|LOCUS_36490 20331 21104 gene locus_tag LOCUS_36500 20331 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 21138 21575 gene locus_tag LOCUS_36510 21138 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 21630 22583 gene locus_tag LOCUS_36520 21630 22583 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681076.1 protein_id gnl|my_center|LOCUS_36520 23396 22998 gene locus_tag LOCUS_36530 23396 22998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 23761 23429 gene locus_tag LOCUS_36540 23761 23429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 23849 24139 gene locus_tag LOCUS_36550 23849 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 24310 24822 gene locus_tag LOCUS_36560 24310 24822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 24997 25374 gene locus_tag LOCUS_36570 24997 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 25426 26064 gene locus_tag LOCUS_36580 25426 26064 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939026.1 protein_id gnl|my_center|LOCUS_36580 27059 26355 gene locus_tag LOCUS_36590 27059 26355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 >Feature sequence076 1554 2549 gene locus_tag LOCUS_36600 1554 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 2562 3137 gene locus_tag LOCUS_36610 gene gmhB 2562 3137 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259582.1 protein_id gnl|my_center|LOCUS_36610 3158 4495 gene locus_tag LOCUS_36620 3158 4495 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_36620 4526 6151 gene locus_tag LOCUS_36630 4526 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 6421 7680 gene locus_tag LOCUS_36640 6421 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 7699 9657 gene locus_tag LOCUS_36650 7699 9657 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945510.1 protein_id gnl|my_center|LOCUS_36650 11574 9676 gene locus_tag LOCUS_36660 gene polX 11574 9676 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_36660 12458 11601 gene locus_tag LOCUS_36670 12458 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 13202 12531 gene locus_tag LOCUS_36680 gene ftsE 13202 12531 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_36680 15560 13272 gene locus_tag LOCUS_36690 gene topA 15560 13272 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_36690 16615 15842 gene locus_tag LOCUS_36700 gene accD 16615 15842 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_36700 17499 16723 gene locus_tag LOCUS_36710 17499 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 19441 17627 gene locus_tag LOCUS_36720 19441 17627 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_36720 20328 19540 gene locus_tag LOCUS_36730 20328 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 20576 21949 gene locus_tag LOCUS_36740 20576 21949 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_36740 22075 22776 gene locus_tag LOCUS_36750 22075 22776 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838531.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36750 23955 23389 gene locus_tag LOCUS_36760 23955 23389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 25015 24173 gene locus_tag LOCUS_36770 25015 24173 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_36770 26240 25038 gene locus_tag LOCUS_36780 26240 25038 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence077 854 450 gene locus_tag LOCUS_36790 854 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 1763 858 gene locus_tag LOCUS_36800 gene larE 1763 858 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_36800 2382 1783 gene locus_tag LOCUS_36810 gene def 2382 1783 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_36810 4331 2793 gene locus_tag LOCUS_36820 4331 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 5449 4373 gene locus_tag LOCUS_36830 5449 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 5737 6159 gene locus_tag LOCUS_36840 5737 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 6156 6488 gene locus_tag LOCUS_36850 6156 6488 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973340.1 protein_id gnl|my_center|LOCUS_36850 6512 7345 gene locus_tag LOCUS_36860 6512 7345 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_36860 7476 8336 gene locus_tag LOCUS_36870 7476 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 8406 9206 gene locus_tag LOCUS_36880 8406 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 9235 10338 gene locus_tag LOCUS_36890 9235 10338 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729610.1 protein_id gnl|my_center|LOCUS_36890 10569 11345 gene locus_tag LOCUS_36900 10569 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 12209 11403 gene locus_tag LOCUS_36910 12209 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 12697 12383 gene locus_tag LOCUS_36920 12697 12383 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_36920 13014 12694 gene locus_tag LOCUS_36930 13014 12694 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_36930 13922 13068 gene locus_tag LOCUS_36940 13922 13068 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_36940 14800 14090 gene locus_tag LOCUS_36950 14800 14090 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_36950 15973 14909 gene locus_tag LOCUS_36960 15973 14909 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_36960 16637 16074 gene locus_tag LOCUS_36970 16637 16074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 19552 16760 gene locus_tag LOCUS_36980 19552 16760 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_36980 20022 21581 gene locus_tag LOCUS_36990 20022 21581 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225847.1 protein_id gnl|my_center|LOCUS_36990 21745 22842 gene locus_tag LOCUS_37000 21745 22842 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047756.1 protein_id gnl|my_center|LOCUS_37000 23348 24073 gene locus_tag LOCUS_37010 23348 24073 CDS product chlorinating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_37010 24098 25102 gene locus_tag LOCUS_37020 24098 25102 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966893.1 protein_id gnl|my_center|LOCUS_37020 26179 25235 gene locus_tag LOCUS_37030 26179 25235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 26272 26787 gene locus_tag LOCUS_37040 26272 26787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 27120 27482 gene locus_tag LOCUS_37050 27120 27482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 >Feature sequence078 235 1164 gene locus_tag LOCUS_37060 235 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 1185 2144 gene locus_tag LOCUS_37070 1185 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 2365 4041 gene locus_tag LOCUS_37080 2365 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 4065 5300 gene locus_tag LOCUS_37090 4065 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 5316 6389 gene locus_tag LOCUS_37100 5316 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 7528 6773 gene locus_tag LOCUS_37110 7528 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 8351 7584 gene locus_tag LOCUS_37120 8351 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 10910 8577 gene locus_tag LOCUS_37130 10910 8577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 11746 11042 gene locus_tag LOCUS_37140 11746 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 12652 11879 gene locus_tag LOCUS_37150 12652 11879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 13861 12656 gene locus_tag LOCUS_37160 13861 12656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 14145 15224 gene locus_tag LOCUS_37170 14145 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 18315 15337 gene locus_tag LOCUS_37180 18315 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 20660 18480 gene locus_tag LOCUS_37190 20660 18480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 21571 20765 gene locus_tag LOCUS_37200 21571 20765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170564.1 protein_id gnl|my_center|LOCUS_37200 23363 22365 gene locus_tag LOCUS_37210 23363 22365 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_37210 25608 24151 gene locus_tag LOCUS_37220 25608 24151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 <26871 25664 gene locus_tag LOCUS_37230 <26871 25664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024238.1:ABC transporter permease >Feature sequence079 602 162 gene locus_tag LOCUS_37240 602 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 1146 604 gene locus_tag LOCUS_37250 1146 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 1870 1148 gene locus_tag LOCUS_37260 1870 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 3343 1982 gene locus_tag LOCUS_37270 3343 1982 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162146334.1 protein_id gnl|my_center|LOCUS_37270 4646 3486 gene locus_tag LOCUS_37280 4646 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37280 5906 4737 gene locus_tag LOCUS_37290 5906 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37290 6365 5964 gene locus_tag LOCUS_37300 6365 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 7610 6507 gene locus_tag LOCUS_37310 7610 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 7869 7582 gene locus_tag LOCUS_37320 7869 7582 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_37320 8957 8136 gene locus_tag LOCUS_37330 8957 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 10020 9265 gene locus_tag LOCUS_37340 10020 9265 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_37340 11046 10081 gene locus_tag LOCUS_37350 11046 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 11390 12181 gene locus_tag LOCUS_37360 11390 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 12232 14049 gene locus_tag LOCUS_37370 12232 14049 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_37370 14306 15142 gene locus_tag LOCUS_37380 14306 15142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 15336 16160 gene locus_tag LOCUS_37390 15336 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 16545 17174 gene locus_tag LOCUS_37400 16545 17174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 17194 18960 gene locus_tag LOCUS_37410 17194 18960 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_37410 18988 19494 gene locus_tag LOCUS_37420 18988 19494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 20066 19572 gene locus_tag LOCUS_37430 20066 19572 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_37430 20992 20069 gene locus_tag LOCUS_37440 20992 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 21610 21299 gene locus_tag LOCUS_37450 21610 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 21914 21612 gene locus_tag LOCUS_37460 21914 21612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 22748 23500 gene locus_tag LOCUS_37470 gene cas6 22748 23500 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_37470 23577 24992 gene locus_tag LOCUS_37480 gene cas8a1 23577 24992 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023575.1 protein_id gnl|my_center|LOCUS_37480 24992 26023 gene locus_tag LOCUS_37490 gene cas7i 24992 26023 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_37490 >Feature sequence080 87 1190 gene locus_tag LOCUS_37500 87 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 1222 2250 gene locus_tag LOCUS_37510 1222 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 2279 4735 gene locus_tag LOCUS_37520 2279 4735 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893750.1 protein_id gnl|my_center|LOCUS_37520 4819 6630 gene locus_tag LOCUS_37530 gene dnaG 4819 6630 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_37530 6779 8317 gene locus_tag LOCUS_37540 gene rpoD 6779 8317 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_37540 8646 9719 gene locus_tag LOCUS_37550 8646 9719 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966124.1 protein_id gnl|my_center|LOCUS_37550 9893 10972 gene locus_tag LOCUS_37560 9893 10972 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_37560 11152 11589 gene locus_tag LOCUS_37570 11152 11589 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_37570 12607 11807 gene locus_tag LOCUS_37580 12607 11807 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_37580 13297 14071 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttgcataccctttcccgctcgaagggaattgaaac 14502 15008 gene locus_tag LOCUS_37590 14502 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 15038 16891 gene locus_tag LOCUS_37600 15038 16891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 16974 17807 gene locus_tag LOCUS_37610 16974 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 17817 19724 gene locus_tag LOCUS_37620 gene cas10 17817 19724 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880206.1 protein_id gnl|my_center|LOCUS_37620 19699 20784 gene locus_tag LOCUS_37630 gene cmr3 19699 20784 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879359.1 protein_id gnl|my_center|LOCUS_37630 20806 21786 gene locus_tag LOCUS_37640 gene cmr4 20806 21786 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_37640 21804 22202 gene locus_tag LOCUS_37650 21804 22202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 22202 23539 gene locus_tag LOCUS_37660 22202 23539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 23553 24695 gene locus_tag LOCUS_37670 23553 24695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 24754 25773 gene locus_tag LOCUS_37680 gene cas6 24754 25773 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence081 68 643 gene locus_tag LOCUS_37690 68 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 2086 965 gene locus_tag LOCUS_37700 2086 965 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_37700 3320 2511 gene locus_tag LOCUS_37710 3320 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 3863 6097 gene locus_tag LOCUS_37720 3863 6097 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 protein_id gnl|my_center|LOCUS_37720 6960 10127 gene locus_tag LOCUS_37730 gene ileS 6960 10127 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_37730 10197 11144 gene locus_tag LOCUS_37740 10197 11144 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681076.1 protein_id gnl|my_center|LOCUS_37740 13489 11720 gene locus_tag LOCUS_37750 13489 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 14244 14516 gene locus_tag LOCUS_37760 14244 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 14732 16135 gene locus_tag LOCUS_37770 gene rsmB 14732 16135 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_37770 16375 16977 gene locus_tag LOCUS_37780 gene thiE 16375 16977 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941250.1 protein_id gnl|my_center|LOCUS_37780 16997 17779 gene locus_tag LOCUS_37790 gene thiD 16997 17779 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403990.1 protein_id gnl|my_center|LOCUS_37790 18266 17886 gene locus_tag LOCUS_37800 18266 17886 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_37800 18618 20261 gene locus_tag LOCUS_37810 gene murJ 18618 20261 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_37810 20285 21064 gene locus_tag LOCUS_37820 gene hisF 20285 21064 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937595.1 protein_id gnl|my_center|LOCUS_37820 21200 22102 gene locus_tag LOCUS_37830 21200 22102 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_37830 23647 22241 gene locus_tag LOCUS_37840 23647 22241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 25311 23818 gene locus_tag LOCUS_37850 25311 23818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 25833 25318 gene locus_tag LOCUS_37860 25833 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence082 300 2972 gene locus_tag LOCUS_37870 300 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3282 5762 gene locus_tag LOCUS_37880 3282 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 5850 9896 gene locus_tag LOCUS_37890 5850 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 10145 13108 gene locus_tag LOCUS_37900 10145 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 14383 13139 gene locus_tag LOCUS_37910 14383 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 15629 14571 gene locus_tag LOCUS_37920 15629 14571 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965454.1 protein_id gnl|my_center|LOCUS_37920 16205 17398 gene locus_tag LOCUS_37930 16205 17398 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_37930 17423 18193 gene locus_tag LOCUS_37940 17423 18193 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267778.1 protein_id gnl|my_center|LOCUS_37940 18230 19267 gene locus_tag LOCUS_37950 18230 19267 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_37950 19374 20414 gene locus_tag LOCUS_37960 19374 20414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 20457 21494 gene locus_tag LOCUS_37970 20457 21494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 21824 22093 gene locus_tag LOCUS_37980 21824 22093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 22192 23229 gene locus_tag LOCUS_37990 22192 23229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 23330 24058 gene locus_tag LOCUS_38000 23330 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 24064 24915 gene locus_tag LOCUS_38010 24064 24915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 >Feature sequence083 2459 294 gene locus_tag LOCUS_38020 2459 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 2373 2633 gene locus_tag LOCUS_38030 2373 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 3599 2817 gene locus_tag LOCUS_38040 3599 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 4114 3713 gene locus_tag LOCUS_38050 4114 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4321 4545 gene locus_tag LOCUS_38060 4321 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 5681 5932 gene locus_tag LOCUS_38070 5681 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 5962 7347 gene locus_tag LOCUS_38080 5962 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 8150 7434 gene locus_tag LOCUS_38090 8150 7434 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_38090 8211 8447 gene locus_tag LOCUS_38100 8211 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 9885 8674 gene locus_tag LOCUS_38110 9885 8674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_38110 12047 9942 gene locus_tag LOCUS_38120 12047 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 13189 12176 gene locus_tag LOCUS_38130 13189 12176 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_38130 14250 13204 gene locus_tag LOCUS_38140 14250 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 15939 14461 gene locus_tag LOCUS_38150 15939 14461 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_38150 16060 16227 gene locus_tag LOCUS_38160 16060 16227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 16367 16588 gene locus_tag LOCUS_38170 16367 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 16838 16686 gene locus_tag LOCUS_38180 16838 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 17190 16813 gene locus_tag LOCUS_38190 17190 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 18355 17171 gene locus_tag LOCUS_38200 18355 17171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 19681 18833 gene locus_tag LOCUS_38210 19681 18833 CDS product DUF2806 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279526.1 protein_id gnl|my_center|LOCUS_38210 22037 19776 gene locus_tag LOCUS_38220 22037 19776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 22403 22128 gene locus_tag LOCUS_38230 22403 22128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 23156 24220 gene locus_tag LOCUS_38240 23156 24220 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence084 86 1195 gene locus_tag LOCUS_38250 86 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1265 1274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2877 1774 gene locus_tag LOCUS_38260 gene dnaN 2877 1774 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_38260 6055 3023 gene locus_tag LOCUS_38270 6055 3023 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_38270 7189 6164 gene locus_tag LOCUS_38280 7189 6164 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_38280 8584 7298 gene locus_tag LOCUS_38290 8584 7298 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_38290 12693 8701 gene locus_tag LOCUS_38300 12693 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 13035 12835 gene locus_tag LOCUS_38310 13035 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 13508 13149 gene locus_tag LOCUS_38320 13508 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 13892 13701 gene locus_tag LOCUS_38330 13892 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 14645 13905 gene locus_tag LOCUS_38340 14645 13905 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_38340 15618 14809 gene locus_tag LOCUS_38350 gene hisA 15618 14809 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_38350 16581 15637 gene locus_tag LOCUS_38360 16581 15637 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229507.1 protein_id gnl|my_center|LOCUS_38360 18023 16665 gene locus_tag LOCUS_38370 18023 16665 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_38370 18180 18497 gene locus_tag LOCUS_38380 18180 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 18560 19507 gene locus_tag LOCUS_38390 18560 19507 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_38390 20064 19522 gene locus_tag LOCUS_38400 20064 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 21549 20512 gene locus_tag LOCUS_38410 21549 20512 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_38410 22041 21643 gene locus_tag LOCUS_38420 gene glxB 22041 21643 CDS product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 protein_id gnl|my_center|LOCUS_38420 22746 23021 gene locus_tag LOCUS_38430 22746 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 24028 23477 gene locus_tag LOCUS_38440 24028 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38440 >Feature sequence085 105 353 gene locus_tag LOCUS_38450 105 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 346 2889 gene locus_tag LOCUS_38460 346 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 2932 3660 gene locus_tag LOCUS_38470 2932 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 3848 4621 gene locus_tag LOCUS_38480 3848 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 5493 4678 gene locus_tag LOCUS_38490 5493 4678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 6639 6097 gene locus_tag LOCUS_38500 6639 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 7141 6629 gene locus_tag LOCUS_38510 7141 6629 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586891.1 protein_id gnl|my_center|LOCUS_38510 7977 7141 gene locus_tag LOCUS_38520 7977 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 8748 7990 gene locus_tag LOCUS_38530 8748 7990 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_38530 9550 8762 gene locus_tag LOCUS_38540 9550 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 9922 10899 gene locus_tag LOCUS_38550 9922 10899 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844796.1 protein_id gnl|my_center|LOCUS_38550 11152 11976 gene locus_tag LOCUS_38560 11152 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 11998 12891 gene locus_tag LOCUS_38570 11998 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 14070 12919 gene locus_tag LOCUS_38580 14070 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 15119 14070 gene locus_tag LOCUS_38590 15119 14070 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224004.1 protein_id gnl|my_center|LOCUS_38590 15309 15127 gene locus_tag LOCUS_38600 15309 15127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 16159 15383 gene locus_tag LOCUS_38610 16159 15383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 16505 18397 gene locus_tag LOCUS_38620 gene ftsH 16505 18397 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_38620 18394 19218 gene locus_tag LOCUS_38630 gene folP 18394 19218 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_38630 19223 19615 gene locus_tag LOCUS_38640 gene acpS 19223 19615 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583384.1 protein_id gnl|my_center|LOCUS_38640 19680 20777 gene locus_tag LOCUS_38650 19680 20777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 20874 21140 gene locus_tag LOCUS_38660 20874 21140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 21188 21628 gene locus_tag LOCUS_38670 21188 21628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 21706 22545 gene locus_tag LOCUS_38680 21706 22545 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_38680 22612 22818 gene locus_tag LOCUS_38690 22612 22818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 23733 22861 gene locus_tag LOCUS_38700 23733 22861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 >Feature sequence086 <1 632 gene locus_tag LOCUS_38710 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090339627.1:ThuA domain-containing protein 862 1941 gene locus_tag LOCUS_38720 gene dgoD 862 1941 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_38720 1971 2756 gene locus_tag LOCUS_38730 1971 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 2768 3493 gene locus_tag LOCUS_38740 2768 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 3511 4485 gene locus_tag LOCUS_38750 3511 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 4656 5066 gene locus_tag LOCUS_38760 gene ndhC 4656 5066 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_38760 5056 5655 gene locus_tag LOCUS_38770 5056 5655 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_38770 5716 6201 gene locus_tag LOCUS_38780 5716 6201 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932450.1 protein_id gnl|my_center|LOCUS_38780 6506 7711 gene locus_tag LOCUS_38790 6506 7711 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_38790 7736 8020 gene locus_tag LOCUS_38800 7736 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 8095 9363 gene locus_tag LOCUS_38810 8095 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 9524 10243 gene locus_tag LOCUS_38820 9524 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 10261 10779 gene locus_tag LOCUS_38830 10261 10779 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_38830 10796 11104 gene locus_tag LOCUS_38840 gene nuoK 10796 11104 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_38840 11327 13540 gene locus_tag LOCUS_38850 11327 13540 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_38850 13757 15268 gene locus_tag LOCUS_38860 13757 15268 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_38860 15285 16775 gene locus_tag LOCUS_38870 15285 16775 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_38870 16853 16923 gene locus_tag LOCUS_t00110 16853 16923 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16941 17014 gene locus_tag LOCUS_t00120 16941 17014 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17112 19175 gene locus_tag LOCUS_38880 17112 19175 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_38880 19484 22165 gene locus_tag LOCUS_38890 19484 22165 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_38890 22292 22753 gene locus_tag LOCUS_38900 22292 22753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 22797 23426 gene locus_tag LOCUS_38910 22797 23426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 >Feature sequence087 612 88 gene locus_tag LOCUS_38920 612 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 1734 964 gene locus_tag LOCUS_38930 1734 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 2414 1851 gene locus_tag LOCUS_38940 gene hpt 2414 1851 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_38940 3855 2389 gene locus_tag LOCUS_38950 gene tilS 3855 2389 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_38950 3986 3913 gene locus_tag LOCUS_t00130 3986 3913 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4820 4152 gene locus_tag LOCUS_38960 4820 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 5040 5111 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5473 6141 gene locus_tag LOCUS_38970 5473 6141 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968957.1 protein_id gnl|my_center|LOCUS_38970 6199 7482 gene locus_tag LOCUS_38980 6199 7482 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_38980 7541 8953 gene locus_tag LOCUS_38990 gene gnfM 7541 8953 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_38990 8979 9695 gene locus_tag LOCUS_39000 8979 9695 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_39000 11085 9721 gene locus_tag LOCUS_39010 11085 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 12556 11279 gene locus_tag LOCUS_39020 12556 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 13483 12701 gene locus_tag LOCUS_39030 13483 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 14681 13686 gene locus_tag LOCUS_39040 14681 13686 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_39040 14882 16438 gene locus_tag LOCUS_39050 14882 16438 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_39050 16431 17144 gene locus_tag LOCUS_39060 16431 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 17148 18764 gene locus_tag LOCUS_39070 17148 18764 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_39070 18782 19993 gene locus_tag LOCUS_39080 18782 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 20005 20646 gene locus_tag LOCUS_39090 20005 20646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 20752 21855 gene locus_tag LOCUS_39100 gene iolG 20752 21855 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_39100 21988 22785 gene locus_tag LOCUS_39110 21988 22785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence088 58 564 gene locus_tag LOCUS_39120 58 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 645 3212 gene locus_tag LOCUS_39130 645 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 3193 5118 gene locus_tag LOCUS_39140 3193 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 5115 5591 gene locus_tag LOCUS_39150 5115 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 5591 6394 gene locus_tag LOCUS_39160 5591 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 6375 7310 gene locus_tag LOCUS_39170 6375 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 7303 7800 gene locus_tag LOCUS_39180 7303 7800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 7805 8794 gene locus_tag LOCUS_39190 7805 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 8807 9427 gene locus_tag LOCUS_39200 8807 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 9456 10670 gene locus_tag LOCUS_39210 9456 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 10667 11020 gene locus_tag LOCUS_39220 10667 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 11014 12153 gene locus_tag LOCUS_39230 11014 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 12297 13394 gene locus_tag LOCUS_39240 12297 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 13467 14453 gene locus_tag LOCUS_39250 gene cas6 13467 14453 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_39250 14697 14464 gene locus_tag LOCUS_39260 14697 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 15000 15275 gene locus_tag LOCUS_39270 gene cas2 15000 15275 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259224.1 protein_id gnl|my_center|LOCUS_39270 15277 16704 gene locus_tag LOCUS_39280 15277 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 18446 16809 gene locus_tag LOCUS_39290 18446 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 19219 20637 gene locus_tag LOCUS_39300 19219 20637 CDS product reverse transcriptase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259222.1 protein_id gnl|my_center|LOCUS_39300 20861 21853 gene locus_tag LOCUS_39310 gene cas1 20861 21853 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_39310 22226 23159 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttggatacgctttcccgtttgaagggaattgaaac >Feature sequence089 1518 1171 gene locus_tag LOCUS_39320 1518 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 2718 3161 gene locus_tag LOCUS_39330 2718 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 3711 7493 gene locus_tag LOCUS_39340 3711 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 8104 8577 gene locus_tag LOCUS_39350 8104 8577 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_39350 8820 11543 gene locus_tag LOCUS_39360 8820 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 11812 13635 gene locus_tag LOCUS_39370 11812 13635 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_39370 13799 14263 gene locus_tag LOCUS_39380 13799 14263 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269020.1 protein_id gnl|my_center|LOCUS_39380 15453 14401 gene locus_tag LOCUS_39390 15453 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 15641 16342 gene locus_tag LOCUS_39400 15641 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 17143 16619 gene locus_tag LOCUS_39410 17143 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 17393 17163 gene locus_tag LOCUS_39420 17393 17163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 17640 18464 gene locus_tag LOCUS_39430 17640 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 18754 19908 gene locus_tag LOCUS_39440 18754 19908 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082376.1 protein_id gnl|my_center|LOCUS_39440 19995 20984 gene locus_tag LOCUS_39450 19995 20984 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583009.1 protein_id gnl|my_center|LOCUS_39450 21334 21624 gene locus_tag LOCUS_39460 gene groES 21334 21624 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804491.1 protein_id gnl|my_center|LOCUS_39460 >Feature sequence090 384 575 gene locus_tag LOCUS_39470 384 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 810 1304 gene locus_tag LOCUS_39480 810 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 2050 1337 gene locus_tag LOCUS_39490 2050 1337 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 protein_id gnl|my_center|LOCUS_39490 2731 2090 gene locus_tag LOCUS_39500 2731 2090 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013545.1 protein_id gnl|my_center|LOCUS_39500 3480 2728 gene locus_tag LOCUS_39510 3480 2728 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865287.1 protein_id gnl|my_center|LOCUS_39510 4951 3530 gene locus_tag LOCUS_39520 4951 3530 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_39520 5919 5059 gene locus_tag LOCUS_39530 5919 5059 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_39530 7052 6009 gene locus_tag LOCUS_39540 7052 6009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 10287 7120 gene locus_tag LOCUS_39550 gene glnE 10287 7120 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943989.1 protein_id gnl|my_center|LOCUS_39550 10806 11033 gene locus_tag LOCUS_39560 10806 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 10954 11469 gene locus_tag LOCUS_39570 10954 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 11545 12426 gene locus_tag LOCUS_39580 11545 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 12578 13663 gene locus_tag LOCUS_39590 12578 13663 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 protein_id gnl|my_center|LOCUS_39590 13857 14567 gene locus_tag LOCUS_39600 13857 14567 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065489.1 protein_id gnl|my_center|LOCUS_39600 14731 15495 gene locus_tag LOCUS_39610 14731 15495 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_39610 15513 16607 gene locus_tag LOCUS_39620 gene gguB 15513 16607 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974840.1 protein_id gnl|my_center|LOCUS_39620 16813 18222 gene locus_tag LOCUS_39630 16813 18222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 19612 18275 gene locus_tag LOCUS_39640 19612 18275 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_39640 20702 19731 gene locus_tag LOCUS_39650 20702 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 21214 21080 gene locus_tag LOCUS_39660 21214 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence091 312 387 gene locus_tag LOCUS_t00140 312 387 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 404 841 gene locus_tag LOCUS_39670 404 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 872 1456 gene locus_tag LOCUS_39680 gene nusG 872 1456 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215369.1 protein_id gnl|my_center|LOCUS_39680 1520 1942 gene locus_tag LOCUS_39690 gene rplK 1520 1942 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931845.1 protein_id gnl|my_center|LOCUS_39690 2039 2737 gene locus_tag LOCUS_39700 gene rplA 2039 2737 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_39700 3034 3600 gene locus_tag LOCUS_39710 gene rplJ 3034 3600 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_39710 3731 4129 gene locus_tag LOCUS_39720 gene rplL 3731 4129 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 protein_id gnl|my_center|LOCUS_39720 4426 5178 gene locus_tag LOCUS_39730 4426 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 5340 6410 gene locus_tag LOCUS_39740 5340 6410 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_39740 6424 6768 gene locus_tag LOCUS_39750 6424 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 6765 7613 gene locus_tag LOCUS_39760 6765 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 7708 8712 gene locus_tag LOCUS_39770 gene hemE 7708 8712 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_39770 8721 10178 gene locus_tag LOCUS_39780 8721 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 10192 11139 gene locus_tag LOCUS_39790 10192 11139 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_39790 11213 12628 gene locus_tag LOCUS_39800 gene hemG 11213 12628 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_39800 12637 13656 gene locus_tag LOCUS_39810 12637 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 14437 13697 gene locus_tag LOCUS_39820 14437 13697 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_39820 15565 15664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15703 21177 gene locus_tag LOCUS_39830 15703 21177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 >Feature sequence092 <1 515 gene locus_tag LOCUS_39840 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000206268.1:L-seryl-tRNA(Sec) selenium transferase 512 1324 gene locus_tag LOCUS_39850 512 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 1405 2484 gene locus_tag LOCUS_39860 1405 2484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804129.1 protein_id gnl|my_center|LOCUS_39860 2658 6164 gene locus_tag LOCUS_39870 2658 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 6161 6862 gene locus_tag LOCUS_39880 6161 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 6879 7010 gene locus_tag LOCUS_39890 6879 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 6995 8656 gene locus_tag LOCUS_39900 6995 8656 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_39900 9088 8696 gene locus_tag LOCUS_39910 9088 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 9457 10674 gene locus_tag LOCUS_39920 9457 10674 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039844899.1 protein_id gnl|my_center|LOCUS_39920 10671 11171 gene locus_tag LOCUS_39930 10671 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 11254 14541 gene locus_tag LOCUS_39940 11254 14541 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_39940 14699 15592 gene locus_tag LOCUS_39950 14699 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 15592 15816 gene locus_tag LOCUS_39960 15592 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 15821 18616 gene locus_tag LOCUS_39970 15821 18616 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_39970 18665 19042 gene locus_tag LOCUS_39980 18665 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 20409 20987 gene locus_tag LOCUS_39990 20409 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084912.1 protein_id gnl|my_center|LOCUS_39990 >Feature sequence093 1422 631 gene locus_tag LOCUS_40000 1422 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 1883 2452 gene locus_tag LOCUS_40010 1883 2452 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_40010 2427 3248 gene locus_tag LOCUS_40020 2427 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 3272 4429 gene locus_tag LOCUS_40030 gene thiI 3272 4429 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_40030 4516 5523 gene locus_tag LOCUS_40040 gene waaF 4516 5523 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_40040 6616 5543 gene locus_tag LOCUS_40050 6616 5543 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_40050 7689 6628 gene locus_tag LOCUS_40060 7689 6628 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_40060 8874 7717 gene locus_tag LOCUS_40070 8874 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 9116 9823 gene locus_tag LOCUS_40080 9116 9823 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_40080 9153 9162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10336 9869 gene locus_tag LOCUS_40090 gene rsfS 10336 9869 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_40090 10995 10405 gene locus_tag LOCUS_40100 gene yqeK 10995 10405 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140790.1 protein_id gnl|my_center|LOCUS_40100 11313 11080 gene locus_tag LOCUS_40110 11313 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 11995 11354 gene locus_tag LOCUS_40120 gene nadD 11995 11354 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_40120 12828 12061 gene locus_tag LOCUS_40130 12828 12061 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_40130 13183 14793 gene locus_tag LOCUS_40140 13183 14793 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_40140 14808 15902 gene locus_tag LOCUS_40150 14808 15902 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_40150 15965 17233 gene locus_tag LOCUS_40160 15965 17233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 17261 19108 gene locus_tag LOCUS_40170 17261 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 19122 19820 gene locus_tag LOCUS_40180 19122 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 20545 20787 gene locus_tag LOCUS_40190 20545 20787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence094 41 610 gene locus_tag LOCUS_40200 41 610 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243940.1 protein_id gnl|my_center|LOCUS_40200 1576 749 gene locus_tag LOCUS_40210 1576 749 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_40210 1685 2374 gene locus_tag LOCUS_40220 1685 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 3683 2274 gene locus_tag LOCUS_40230 3683 2274 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_40230 5077 3854 gene locus_tag LOCUS_40240 5077 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 5663 5193 gene locus_tag LOCUS_40250 gene qcrA 5663 5193 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290418.1 protein_id gnl|my_center|LOCUS_40250 6851 5787 gene locus_tag LOCUS_40260 6851 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 7132 8460 gene locus_tag LOCUS_40270 7132 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 8842 9939 gene locus_tag LOCUS_40280 gene dgoD 8842 9939 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526152.1 protein_id gnl|my_center|LOCUS_40280 10274 12709 gene locus_tag LOCUS_40290 10274 12709 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_40290 12759 15743 gene locus_tag LOCUS_40300 12759 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 16081 18663 gene locus_tag LOCUS_40310 16081 18663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 18709 19680 gene locus_tag LOCUS_40320 18709 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 >Feature sequence095 <1 2061 gene locus_tag LOCUS_40330 <1 2061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 3297 2167 gene locus_tag LOCUS_40340 3297 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 4412 3333 gene locus_tag LOCUS_40350 4412 3333 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_40350 5291 4500 gene locus_tag LOCUS_40360 5291 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 7154 5883 gene locus_tag LOCUS_40370 7154 5883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_40370 7485 7249 gene locus_tag LOCUS_40380 7485 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 8442 7615 gene locus_tag LOCUS_40390 8442 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 9861 8449 gene locus_tag LOCUS_40400 9861 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 11589 10003 gene locus_tag LOCUS_40410 gene serA 11589 10003 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_40410 11873 12076 gene locus_tag LOCUS_40420 11873 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 12209 12529 gene locus_tag LOCUS_40430 12209 12529 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_40430 12657 13817 gene locus_tag LOCUS_40440 12657 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 13828 15528 gene locus_tag LOCUS_40450 13828 15528 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_40450 15598 16371 gene locus_tag LOCUS_40460 15598 16371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 16461 17225 gene locus_tag LOCUS_40470 16461 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 17474 17875 gene locus_tag LOCUS_40480 17474 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 17970 18752 gene locus_tag LOCUS_40490 17970 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 18749 19573 gene locus_tag LOCUS_40500 18749 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 >Feature sequence096 1996 50 gene locus_tag LOCUS_40510 1996 50 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201781412.1 protein_id gnl|my_center|LOCUS_40510 3380 2049 gene locus_tag LOCUS_40520 3380 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 4879 4016 gene locus_tag LOCUS_40530 4879 4016 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_40530 4933 5097 gene locus_tag LOCUS_40540 4933 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 5276 5644 gene locus_tag LOCUS_40550 5276 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 6437 5676 gene locus_tag LOCUS_40560 6437 5676 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_40560 7671 6490 gene locus_tag LOCUS_40570 7671 6490 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_40570 9000 7813 gene locus_tag LOCUS_40580 9000 7813 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_40580 10340 9318 gene locus_tag LOCUS_40590 10340 9318 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_40590 10751 11989 gene locus_tag LOCUS_40600 10751 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 13174 11969 gene locus_tag LOCUS_40610 gene megL 13174 11969 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_40610 13992 13441 gene locus_tag LOCUS_40620 13992 13441 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828387.1 protein_id gnl|my_center|LOCUS_40620 14043 14441 gene locus_tag LOCUS_40630 14043 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 14459 15247 gene locus_tag LOCUS_40640 14459 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 15295 15726 gene locus_tag LOCUS_40650 15295 15726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 16657 15962 gene locus_tag LOCUS_40660 16657 15962 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_40660 17289 17843 gene locus_tag LOCUS_40670 17289 17843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 17855 18346 gene locus_tag LOCUS_40680 17855 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 18343 20097 gene locus_tag LOCUS_40690 18343 20097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence097 95 253 gene locus_tag LOCUS_40700 95 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 341 748 gene locus_tag LOCUS_40710 341 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 980 1387 gene locus_tag LOCUS_40720 980 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 1589 1404 gene locus_tag LOCUS_40730 1589 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 4696 1730 gene locus_tag LOCUS_40740 4696 1730 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_40740 5299 5024 gene locus_tag LOCUS_40750 5299 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 6947 5571 gene locus_tag LOCUS_40760 6947 5571 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_40760 8647 7178 gene locus_tag LOCUS_40770 8647 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021016.1 protein_id gnl|my_center|LOCUS_40770 10008 8647 gene locus_tag LOCUS_40780 10008 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 10675 10331 gene locus_tag LOCUS_40790 10675 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 11398 11015 gene locus_tag LOCUS_40800 11398 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 12048 11677 gene locus_tag LOCUS_40810 12048 11677 CDS product clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327109.1 protein_id gnl|my_center|LOCUS_40810 12314 12045 gene locus_tag LOCUS_40820 12314 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 12703 12527 gene locus_tag LOCUS_40830 12703 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 14831 13086 gene locus_tag LOCUS_40840 14831 13086 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124860.1 protein_id gnl|my_center|LOCUS_40840 16066 15128 gene locus_tag LOCUS_40850 16066 15128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 16705 17397 gene locus_tag LOCUS_40860 gene bioD 16705 17397 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 protein_id gnl|my_center|LOCUS_40860 17398 18792 gene locus_tag LOCUS_40870 17398 18792 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250139.1 protein_id gnl|my_center|LOCUS_40870 19345 18932 gene locus_tag LOCUS_40880 19345 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence098 422 3094 gene locus_tag LOCUS_40890 422 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 3225 5639 gene locus_tag LOCUS_40900 3225 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 12515 5754 gene locus_tag LOCUS_40910 12515 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 13828 12821 gene locus_tag LOCUS_40920 13828 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 14050 14871 gene locus_tag LOCUS_40930 14050 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 14991 16028 gene locus_tag LOCUS_40940 14991 16028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 16160 16876 gene locus_tag LOCUS_40950 gene rpe 16160 16876 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_40950 16956 18011 gene locus_tag LOCUS_40960 16956 18011 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728808.1 protein_id gnl|my_center|LOCUS_40960 18139 19197 gene locus_tag LOCUS_40970 18139 19197 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_40970 19197 19712 gene locus_tag LOCUS_40980 19197 19712 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256182.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence099 <1 1458 gene locus_tag LOCUS_40990 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230365.1:NADP-dependent phosphogluconate dehydrogenase 1694 2590 gene locus_tag LOCUS_41000 1694 2590 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228638.1 protein_id gnl|my_center|LOCUS_41000 2696 3646 gene locus_tag LOCUS_41010 2696 3646 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_41010 6057 3895 gene locus_tag LOCUS_41020 6057 3895 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_41020 7621 6269 gene locus_tag LOCUS_41030 7621 6269 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_41030 9293 7698 gene locus_tag LOCUS_41040 9293 7698 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_41040 10330 9728 gene locus_tag LOCUS_41050 10330 9728 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_41050 11270 10584 gene locus_tag LOCUS_41060 11270 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 12343 11309 gene locus_tag LOCUS_41070 12343 11309 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_41070 14283 12355 gene locus_tag LOCUS_41080 14283 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 16180 14315 gene locus_tag LOCUS_41090 16180 14315 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_41090 17848 16235 gene locus_tag LOCUS_41100 17848 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 18605 17880 gene locus_tag LOCUS_41110 18605 17880 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_41110 19448 18633 gene locus_tag LOCUS_41120 19448 18633 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_41120 >Feature sequence100 1556 678 gene locus_tag LOCUS_41130 1556 678 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 protein_id gnl|my_center|LOCUS_41130 1778 3391 gene locus_tag LOCUS_41140 1778 3391 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_41140 4273 3476 gene locus_tag LOCUS_41150 4273 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 4974 4285 gene locus_tag LOCUS_41160 4974 4285 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_41160 5881 5051 gene locus_tag LOCUS_41170 5881 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 6633 5914 gene locus_tag LOCUS_41180 6633 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 7420 6656 gene locus_tag LOCUS_41190 7420 6656 CDS product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584085.1 protein_id gnl|my_center|LOCUS_41190 8087 7479 gene locus_tag LOCUS_41200 8087 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 8511 8140 gene locus_tag LOCUS_41210 8511 8140 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208305.1 protein_id gnl|my_center|LOCUS_41210 8838 8518 gene locus_tag LOCUS_41220 8838 8518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 9252 10298 gene locus_tag LOCUS_41230 gene pelA 9252 10298 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427768.1 protein_id gnl|my_center|LOCUS_41230 11117 10362 gene locus_tag LOCUS_41240 11117 10362 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_41240 11809 11336 gene locus_tag LOCUS_41250 11809 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 13740 11965 gene locus_tag LOCUS_41260 13740 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 14714 14199 gene locus_tag LOCUS_41270 14714 14199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 14945 14733 gene locus_tag LOCUS_41280 14945 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 16262 15066 gene locus_tag LOCUS_41290 16262 15066 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402980.1 protein_id gnl|my_center|LOCUS_41290 16832 16407 gene locus_tag LOCUS_41300 16832 16407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 17765 17025 gene locus_tag LOCUS_41310 17765 17025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 18982 17903 gene locus_tag LOCUS_41320 18982 17903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 >Feature sequence101 1099 53 gene locus_tag LOCUS_41330 1099 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 1894 3297 gene locus_tag LOCUS_41340 1894 3297 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_41340 3344 4861 gene locus_tag LOCUS_41350 3344 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 5003 6439 gene locus_tag LOCUS_41360 5003 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 6759 7886 gene locus_tag LOCUS_41370 6759 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 8017 8940 gene locus_tag LOCUS_41380 8017 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 10231 8996 gene locus_tag LOCUS_41390 10231 8996 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_41390 10982 10221 gene locus_tag LOCUS_41400 10982 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 13745 11142 gene locus_tag LOCUS_41410 13745 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 14505 13966 gene locus_tag LOCUS_41420 14505 13966 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_41420 15346 14564 gene locus_tag LOCUS_41430 15346 14564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 16212 15550 gene locus_tag LOCUS_41440 16212 15550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 16690 16181 gene locus_tag LOCUS_41450 16690 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 17402 16809 gene locus_tag LOCUS_41460 17402 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 18098 17565 gene locus_tag LOCUS_41470 18098 17565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 18859 18750 gene locus_tag LOCUS_r00010 18859 18750 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence102 131 334 gene locus_tag LOCUS_41480 131 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 346 1503 gene locus_tag LOCUS_41490 346 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 2596 1628 gene locus_tag LOCUS_41500 2596 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 2710 3663 gene locus_tag LOCUS_41510 2710 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 3919 3728 gene locus_tag LOCUS_41520 3919 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 4254 4541 gene locus_tag LOCUS_41530 4254 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 4592 5377 gene locus_tag LOCUS_41540 4592 5377 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 protein_id gnl|my_center|LOCUS_41540 5779 5943 gene locus_tag LOCUS_41550 5779 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 6131 6970 gene locus_tag LOCUS_41560 6131 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 7555 7292 gene locus_tag LOCUS_41570 7555 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 9941 7872 gene locus_tag LOCUS_41580 9941 7872 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_41580 10003 11067 gene locus_tag LOCUS_41590 10003 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 11085 11738 gene locus_tag LOCUS_41600 11085 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 12949 11729 gene locus_tag LOCUS_41610 12949 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 13783 13079 gene locus_tag LOCUS_41620 13783 13079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_41620 15013 13784 gene locus_tag LOCUS_41630 15013 13784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_41630 16446 15232 gene locus_tag LOCUS_41640 16446 15232 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_41640 17413 16622 gene locus_tag LOCUS_41650 17413 16622 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_41650 >Feature sequence103 947 807 gene locus_tag LOCUS_41660 947 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 1001 3118 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcccttcaaacgggaaagcgtatccaaag 3424 3552 gene locus_tag LOCUS_41670 3424 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 5060 3963 gene locus_tag LOCUS_41680 5060 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 6252 5242 gene locus_tag LOCUS_41690 6252 5242 CDS product CRISPR-associated protein Csx14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258164.1 protein_id gnl|my_center|LOCUS_41690 7462 6344 gene locus_tag LOCUS_41700 7462 6344 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258161.1 protein_id gnl|my_center|LOCUS_41700 8100 7462 gene locus_tag LOCUS_41710 8100 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 9053 8097 gene locus_tag LOCUS_41720 9053 8097 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258159.1 protein_id gnl|my_center|LOCUS_41720 9916 9056 gene locus_tag LOCUS_41730 gene csx7 9916 9056 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258158.1 protein_id gnl|my_center|LOCUS_41730 10639 9980 gene locus_tag LOCUS_41740 10639 9980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 11094 10636 gene locus_tag LOCUS_41750 11094 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 12326 11091 gene locus_tag LOCUS_41760 gene csx10 12326 11091 CDS product CRISPR-associated RAMP protein Csx10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258156.1 protein_id gnl|my_center|LOCUS_41760 13072 12323 gene locus_tag LOCUS_41770 13072 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 14718 13087 gene locus_tag LOCUS_41780 14718 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 16521 14746 gene locus_tag LOCUS_41790 16521 14746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 17617 16973 gene locus_tag LOCUS_41800 17617 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 17969 17619 gene locus_tag LOCUS_41810 17969 17619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 >Feature sequence104 83 2239 gene locus_tag LOCUS_41820 83 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 2252 5269 gene locus_tag LOCUS_41830 2252 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 5439 5978 gene locus_tag LOCUS_41840 5439 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 5981 8590 gene locus_tag LOCUS_41850 5981 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 8844 9611 gene locus_tag LOCUS_41860 8844 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 9935 9663 gene locus_tag LOCUS_41870 9935 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 11874 10330 gene locus_tag LOCUS_41880 11874 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 14176 11867 gene locus_tag LOCUS_41890 14176 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41890 11880 11979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18821 14571 gene locus_tag LOCUS_41900 18821 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 >Feature sequence105 131 769 gene locus_tag LOCUS_41910 131 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 2957 891 gene locus_tag LOCUS_41920 2957 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 3579 4841 gene locus_tag LOCUS_41930 3579 4841 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_41930 5012 6373 gene locus_tag LOCUS_41940 5012 6373 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_41940 6582 8942 gene locus_tag LOCUS_41950 6582 8942 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_41950 9044 10723 gene locus_tag LOCUS_41960 gene ilvD 9044 10723 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_41960 10902 11189 gene locus_tag LOCUS_41970 10902 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 11241 11645 gene locus_tag LOCUS_41980 11241 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 11689 12678 gene locus_tag LOCUS_41990 11689 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 12675 13865 gene locus_tag LOCUS_42000 12675 13865 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_42000 13970 14983 gene locus_tag LOCUS_42010 13970 14983 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967441.1 protein_id gnl|my_center|LOCUS_42010 14995 15609 gene locus_tag LOCUS_42020 gene tmk 14995 15609 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_42020 15688 16656 gene locus_tag LOCUS_42030 gene holB 15688 16656 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_42030 16805 18700 gene locus_tag LOCUS_42040 gene metG 16805 18700 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080396.1 protein_id gnl|my_center|LOCUS_42040 >Feature sequence106 272 33 gene locus_tag LOCUS_42050 272 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 1941 1183 gene locus_tag LOCUS_42060 1941 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 2958 2182 gene locus_tag LOCUS_42070 2958 2182 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_42070 3309 4112 gene locus_tag LOCUS_42080 3309 4112 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_42080 5829 4189 gene locus_tag LOCUS_42090 5829 4189 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_42090 6701 5901 gene locus_tag LOCUS_42100 6701 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 7282 6776 gene locus_tag LOCUS_42110 7282 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 8035 7298 gene locus_tag LOCUS_42120 8035 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 9086 8121 gene locus_tag LOCUS_42130 9086 8121 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_42130 9609 9160 gene locus_tag LOCUS_42140 gene dtd 9609 9160 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_42140 10607 9633 gene locus_tag LOCUS_42150 10607 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 11996 10884 gene locus_tag LOCUS_42160 11996 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 12619 12077 gene locus_tag LOCUS_42170 12619 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 12879 13715 gene locus_tag LOCUS_42180 12879 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 14597 13779 gene locus_tag LOCUS_42190 14597 13779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 14872 14594 gene locus_tag LOCUS_42200 14872 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 15693 14908 gene locus_tag LOCUS_42210 15693 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 17038 15746 gene locus_tag LOCUS_42220 17038 15746 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_42220 17679 17092 gene locus_tag LOCUS_42230 gene hisB 17679 17092 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence107 919 11 gene locus_tag LOCUS_42240 919 11 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_42240 1413 937 gene locus_tag LOCUS_42250 1413 937 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861143.1 protein_id gnl|my_center|LOCUS_42250 2499 1453 gene locus_tag LOCUS_42260 2499 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 3983 2502 gene locus_tag LOCUS_42270 3983 2502 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_42270 4175 5230 gene locus_tag LOCUS_42280 4175 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 5614 6045 gene locus_tag LOCUS_42290 5614 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 7423 6302 gene locus_tag LOCUS_42300 7423 6302 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704265.1 protein_id gnl|my_center|LOCUS_42300 8841 7891 gene locus_tag LOCUS_42310 8841 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 9129 9794 gene locus_tag LOCUS_42320 9129 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 11161 10160 gene locus_tag LOCUS_42330 11161 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 12683 15607 gene locus_tag LOCUS_42340 12683 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 15836 17041 gene locus_tag LOCUS_42350 gene argJ 15836 17041 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_42350 17069 17482 gene locus_tag LOCUS_42360 17069 17482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 >Feature sequence108 201 1034 gene locus_tag LOCUS_42370 201 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 2040 1186 gene locus_tag LOCUS_42380 2040 1186 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_42380 3622 2246 gene locus_tag LOCUS_42390 3622 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 6937 3866 gene locus_tag LOCUS_42400 6937 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 7166 8191 gene locus_tag LOCUS_42410 7166 8191 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014292.1 protein_id gnl|my_center|LOCUS_42410 8356 9237 gene locus_tag LOCUS_42420 8356 9237 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_42420 9438 11144 gene locus_tag LOCUS_42430 gene recN 9438 11144 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_42430 11263 14844 gene locus_tag LOCUS_42440 11263 14844 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115449.1 protein_id gnl|my_center|LOCUS_42440 14866 15726 gene locus_tag LOCUS_42450 gene aroE 14866 15726 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_42450 15795 16112 gene locus_tag LOCUS_42460 15795 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 17510 16158 gene locus_tag LOCUS_42470 17510 16158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 >Feature sequence109 721 1248 gene locus_tag LOCUS_42480 721 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 2135 2713 gene locus_tag LOCUS_42490 2135 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 2735 2971 gene locus_tag LOCUS_42500 2735 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 3282 4928 gene locus_tag LOCUS_42510 3282 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 7199 5373 gene locus_tag LOCUS_42520 7199 5373 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_42520 8941 7196 gene locus_tag LOCUS_42530 8941 7196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_42530 9270 11369 gene locus_tag LOCUS_42540 9270 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 11495 12460 gene locus_tag LOCUS_42550 11495 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 12651 13766 gene locus_tag LOCUS_42560 12651 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 13956 14969 gene locus_tag LOCUS_42570 gene tdh 13956 14969 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_42570 15006 16058 gene locus_tag LOCUS_42580 15006 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 17118 16180 gene locus_tag LOCUS_42590 17118 16180 CDS product CmcJ/NvfI family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107935.1 protein_id gnl|my_center|LOCUS_42590 >Feature sequence110 305 679 gene locus_tag LOCUS_42600 305 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 2141 1020 gene locus_tag LOCUS_42610 2141 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 4066 2216 gene locus_tag LOCUS_42620 gene dsbD 4066 2216 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862442.1 protein_id gnl|my_center|LOCUS_42620 5739 4084 gene locus_tag LOCUS_42630 5739 4084 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_42630 7246 5903 gene locus_tag LOCUS_42640 7246 5903 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_42640 7522 7280 gene locus_tag LOCUS_42650 7522 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 7856 7530 gene locus_tag LOCUS_42660 7856 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 9290 7857 gene locus_tag LOCUS_42670 9290 7857 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_42670 9624 10358 gene locus_tag LOCUS_42680 9624 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 10511 13738 gene locus_tag LOCUS_42690 10511 13738 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_42690 13911 15194 gene locus_tag LOCUS_42700 13911 15194 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_42700 15199 15840 gene locus_tag LOCUS_42710 15199 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 >Feature sequence111 1566 178 gene locus_tag LOCUS_42720 gene mnmE 1566 178 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_42720 2279 1656 gene locus_tag LOCUS_42730 2279 1656 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393997.1 protein_id gnl|my_center|LOCUS_42730 4180 2345 gene locus_tag LOCUS_42740 gene yidC 4180 2345 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_42740 5441 4929 gene locus_tag LOCUS_42750 5441 4929 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_42750 5905 7512 gene locus_tag LOCUS_42760 5905 7512 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_42760 8711 7932 gene locus_tag LOCUS_42770 8711 7932 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_42770 9183 8701 gene locus_tag LOCUS_42780 gene rimI 9183 8701 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_42780 9515 10660 gene locus_tag LOCUS_42790 9515 10660 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_42790 10734 12101 gene locus_tag LOCUS_42800 10734 12101 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_42800 12137 13129 gene locus_tag LOCUS_42810 12137 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 13192 13893 gene locus_tag LOCUS_42820 13192 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 13915 15048 gene locus_tag LOCUS_42830 gene waaF 13915 15048 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_42830 <16515 15193 gene locus_tag LOCUS_42840 <16515 15193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545192.1:chaperonin GroEL >Feature sequence112 3 221 gene locus_tag LOCUS_42850 3 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 373 1335 gene locus_tag LOCUS_42860 gene trxB 373 1335 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_42860 1612 3246 gene locus_tag LOCUS_42870 1612 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 3404 3946 gene locus_tag LOCUS_42880 gene moaC 3404 3946 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_42880 4017 6971 gene locus_tag LOCUS_42890 4017 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 7127 8134 gene locus_tag LOCUS_42900 7127 8134 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_42900 8419 9054 gene locus_tag LOCUS_42910 8419 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 9322 9573 gene locus_tag LOCUS_42920 9322 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 9962 11071 gene locus_tag LOCUS_42930 9962 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 11079 13334 gene locus_tag LOCUS_42940 11079 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 13426 13929 gene locus_tag LOCUS_42950 13426 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 13933 14997 gene locus_tag LOCUS_42960 13933 14997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 15930 16343 gene locus_tag LOCUS_42970 15930 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 >Feature sequence113 786 319 gene locus_tag LOCUS_42980 786 319 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888871.1 protein_id gnl|my_center|LOCUS_42980 1557 856 gene locus_tag LOCUS_42990 1557 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 2389 1679 gene locus_tag LOCUS_43000 2389 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 3400 2636 gene locus_tag LOCUS_43010 3400 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 3870 6611 gene locus_tag LOCUS_43020 3870 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 6799 8019 gene locus_tag LOCUS_43030 6799 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_43030 8187 9194 gene locus_tag LOCUS_43040 8187 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 9360 11462 gene locus_tag LOCUS_43050 gene nadE 9360 11462 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_43050 11610 13148 gene locus_tag LOCUS_43060 11610 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 13268 13942 gene locus_tag LOCUS_43070 13268 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 14456 15178 gene locus_tag LOCUS_43080 14456 15178 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143627.1 protein_id gnl|my_center|LOCUS_43080 >Feature sequence114 1166 303 gene locus_tag LOCUS_43090 1166 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 1960 2196 gene locus_tag LOCUS_43100 1960 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 5814 3310 gene locus_tag LOCUS_43110 5814 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 10637 6387 gene locus_tag LOCUS_43120 10637 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 11829 12005 gene locus_tag LOCUS_43130 11829 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 12011 12400 gene locus_tag LOCUS_43140 12011 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 13874 13404 gene locus_tag LOCUS_43150 13874 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 14709 15182 gene locus_tag LOCUS_43160 14709 15182 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036240.1 protein_id gnl|my_center|LOCUS_43160 >Feature sequence115 1895 3061 gene locus_tag LOCUS_43170 1895 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 3141 3887 gene locus_tag LOCUS_43180 3141 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 4079 4366 gene locus_tag LOCUS_43190 4079 4366 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_43190 4338 5450 gene locus_tag LOCUS_43200 4338 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 5794 7452 gene locus_tag LOCUS_43210 5794 7452 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_43210 8261 7539 gene locus_tag LOCUS_43220 8261 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 8819 9520 gene locus_tag LOCUS_43230 8819 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 9715 11928 gene locus_tag LOCUS_43240 9715 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 12103 13278 gene locus_tag LOCUS_43250 12103 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 13383 13904 gene locus_tag LOCUS_43260 13383 13904 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256302.1 protein_id gnl|my_center|LOCUS_43260 14483 14070 gene locus_tag LOCUS_43270 14483 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 15725 14868 gene locus_tag LOCUS_43280 15725 14868 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020913.1 protein_id gnl|my_center|LOCUS_43280 >Feature sequence116 3079 182 gene locus_tag LOCUS_43290 gene polA 3079 182 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175760.1 protein_id gnl|my_center|LOCUS_43290 4167 3097 gene locus_tag LOCUS_43300 gene trxB 4167 3097 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722610.1 protein_id gnl|my_center|LOCUS_43300 5631 4186 gene locus_tag LOCUS_43310 5631 4186 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_43310 7595 5715 gene locus_tag LOCUS_43320 7595 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 8314 7631 gene locus_tag LOCUS_43330 8314 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 8707 9681 gene locus_tag LOCUS_43340 8707 9681 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_43340 9687 11240 gene locus_tag LOCUS_43350 9687 11240 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_43350 11290 12123 gene locus_tag LOCUS_43360 11290 12123 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_43360 12264 12917 gene locus_tag LOCUS_43370 12264 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 13019 13258 gene locus_tag LOCUS_43380 13019 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 13258 13500 gene locus_tag LOCUS_43390 13258 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 13801 14655 gene locus_tag LOCUS_43400 gene thpD 13801 14655 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804195.1 protein_id gnl|my_center|LOCUS_43400 14747 15598 gene locus_tag LOCUS_43410 14747 15598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence117 128 469 gene locus_tag LOCUS_43420 128 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 659 1027 gene locus_tag LOCUS_43430 659 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 1576 1142 gene locus_tag LOCUS_43440 1576 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43440 4254 1498 gene locus_tag LOCUS_43450 4254 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43450 5496 4495 gene locus_tag LOCUS_43460 gene hemW 5496 4495 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_43460 6724 5621 gene locus_tag LOCUS_43470 6724 5621 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728652.1 protein_id gnl|my_center|LOCUS_43470 7074 6751 gene locus_tag LOCUS_43480 7074 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 7432 7058 gene locus_tag LOCUS_43490 7432 7058 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368791.1 protein_id gnl|my_center|LOCUS_43490 7912 7514 gene locus_tag LOCUS_43500 7912 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 9237 7909 gene locus_tag LOCUS_43510 9237 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 9806 9300 gene locus_tag LOCUS_43520 9806 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 10890 9907 gene locus_tag LOCUS_43530 10890 9907 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_43530 12940 11123 gene locus_tag LOCUS_43540 12940 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 <15498 13255 gene locus_tag LOCUS_43550 <15498 13255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence118 236 616 gene locus_tag LOCUS_43560 236 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 1039 1773 gene locus_tag LOCUS_43570 1039 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 1920 2444 gene locus_tag LOCUS_43580 gene pgsA 1920 2444 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459962.1 protein_id gnl|my_center|LOCUS_43580 2705 3772 gene locus_tag LOCUS_43590 gene recA 2705 3772 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_43590 4157 5941 gene locus_tag LOCUS_43600 gene arc 4157 5941 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_43600 6112 7608 gene locus_tag LOCUS_43610 gene dop 6112 7608 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_43610 7751 7948 gene locus_tag LOCUS_43620 7751 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 7951 8745 gene locus_tag LOCUS_43630 gene prcB 7951 8745 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_43630 8874 9596 gene locus_tag LOCUS_43640 gene prcA 8874 9596 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_43640 9747 11105 gene locus_tag LOCUS_43650 gene pafA 9747 11105 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_43650 11264 13897 gene locus_tag LOCUS_43660 gene ppdK 11264 13897 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_43660 14208 14807 gene locus_tag LOCUS_43670 14208 14807 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_43670 >Feature sequence119 1 1131 gene locus_tag LOCUS_43680 1 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 1322 1741 gene locus_tag LOCUS_43690 1322 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 2089 1748 gene locus_tag LOCUS_43700 2089 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 2705 2346 gene locus_tag LOCUS_43710 2705 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 3273 2788 gene locus_tag LOCUS_43720 3273 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 5275 3425 gene locus_tag LOCUS_43730 5275 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 5851 5654 gene locus_tag LOCUS_43740 5851 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 6339 5917 gene locus_tag LOCUS_43750 6339 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 6729 6382 gene locus_tag LOCUS_43760 6729 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 6840 6939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7424 7116 gene locus_tag LOCUS_43770 7424 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 7623 7417 gene locus_tag LOCUS_43780 7623 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 7879 7628 gene locus_tag LOCUS_43790 7879 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 11625 7969 gene locus_tag LOCUS_43800 11625 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 12662 12853 gene locus_tag LOCUS_43810 12662 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 12996 14306 gene locus_tag LOCUS_43820 12996 14306 CDS product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723340.1 protein_id gnl|my_center|LOCUS_43820 14819 15031 gene locus_tag LOCUS_43830 14819 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 >Feature sequence120 917 51 gene locus_tag LOCUS_43840 917 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 1889 1071 gene locus_tag LOCUS_43850 1889 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 3312 1891 gene locus_tag LOCUS_43860 3312 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 6273 3337 gene locus_tag LOCUS_43870 6273 3337 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_43870 6392 6476 gene locus_tag LOCUS_t00150 6392 6476 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7622 6501 gene locus_tag LOCUS_43880 7622 6501 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255987.1 protein_id gnl|my_center|LOCUS_43880 8086 7706 gene locus_tag LOCUS_43890 8086 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 9054 8173 gene locus_tag LOCUS_43900 9054 8173 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_43900 9372 11327 gene locus_tag LOCUS_43910 gene ppiD 9372 11327 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 protein_id gnl|my_center|LOCUS_43910 12834 11389 gene locus_tag LOCUS_43920 12834 11389 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_43920 13941 12874 gene locus_tag LOCUS_43930 gene mqnC 13941 12874 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_43930 14612 14959 gene locus_tag LOCUS_43940 14612 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 >Feature sequence121 3901 2564 gene locus_tag LOCUS_43950 3901 2564 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_43950 4058 4258 gene locus_tag LOCUS_43960 4058 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 5677 4292 gene locus_tag LOCUS_43970 5677 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 7506 6070 gene locus_tag LOCUS_43980 7506 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 8009 7524 gene locus_tag LOCUS_43990 8009 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 9118 8006 gene locus_tag LOCUS_44000 9118 8006 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_44000 9751 9173 gene locus_tag LOCUS_44010 9751 9173 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926813.1 protein_id gnl|my_center|LOCUS_44010 9947 12127 gene locus_tag LOCUS_44020 9947 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 13337 12477 gene locus_tag LOCUS_44030 13337 12477 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 protein_id gnl|my_center|LOCUS_44030 14364 13366 gene locus_tag LOCUS_44040 14364 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 <14952 14431 gene locus_tag LOCUS_44050 <14952 14431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229618.1:tartrate dehydrogenase >Feature sequence122 505 1065 gene locus_tag LOCUS_44060 505 1065 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898818.1 protein_id gnl|my_center|LOCUS_44060 1131 1673 gene locus_tag LOCUS_44070 gene atpH 1131 1673 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816489.1 protein_id gnl|my_center|LOCUS_44070 1830 3353 gene locus_tag LOCUS_44080 gene atpA 1830 3353 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_44080 3421 4299 gene locus_tag LOCUS_44090 3421 4299 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_44090 4336 4809 gene locus_tag LOCUS_44100 4336 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 4825 5094 gene locus_tag LOCUS_44110 4825 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 5130 6539 gene locus_tag LOCUS_44120 gene atpD 5130 6539 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_44120 6642 7049 gene locus_tag LOCUS_44130 gene atpC 6642 7049 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405147.1 protein_id gnl|my_center|LOCUS_44130 7938 7057 gene locus_tag LOCUS_44140 7938 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 8064 9068 gene locus_tag LOCUS_44150 8064 9068 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967753.1 protein_id gnl|my_center|LOCUS_44150 10644 9286 gene locus_tag LOCUS_44160 10644 9286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 12225 10819 gene locus_tag LOCUS_44170 12225 10819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 12990 12307 gene locus_tag LOCUS_44180 12990 12307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 14026 13142 gene locus_tag LOCUS_44190 14026 13142 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_44190 14273 14016 gene locus_tag LOCUS_44200 14273 14016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 >Feature sequence123 730 35 gene locus_tag LOCUS_44210 730 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 1597 788 gene locus_tag LOCUS_44220 1597 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 2530 1661 gene locus_tag LOCUS_44230 2530 1661 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090295.1 protein_id gnl|my_center|LOCUS_44230 4098 2542 gene locus_tag LOCUS_44240 4098 2542 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_44240 5672 4176 gene locus_tag LOCUS_44250 5672 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 6985 6254 gene locus_tag LOCUS_44260 6985 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 7982 6966 gene locus_tag LOCUS_44270 7982 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 8686 7970 gene locus_tag LOCUS_44280 8686 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 9152 8748 gene locus_tag LOCUS_44290 9152 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 9853 9476 gene locus_tag LOCUS_44300 9853 9476 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730101.1 protein_id gnl|my_center|LOCUS_44300 11154 9958 gene locus_tag LOCUS_44310 11154 9958 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_44310 12234 11347 gene locus_tag LOCUS_44320 12234 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 13483 12278 gene locus_tag LOCUS_44330 13483 12278 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613585.1 protein_id gnl|my_center|LOCUS_44330 13731 13740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence124 1391 105 gene locus_tag LOCUS_44340 1391 105 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_44340 2366 1443 gene locus_tag LOCUS_44350 gene mltG 2366 1443 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_44350 2949 2503 gene locus_tag LOCUS_44360 gene ruvX 2949 2503 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_44360 3306 4169 gene locus_tag LOCUS_44370 3306 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 4525 5190 gene locus_tag LOCUS_44380 4525 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 5187 5945 gene locus_tag LOCUS_44390 5187 5945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_44390 6005 7642 gene locus_tag LOCUS_44400 6005 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 7779 8282 gene locus_tag LOCUS_44410 7779 8282 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 protein_id gnl|my_center|LOCUS_44410 8389 9429 gene locus_tag LOCUS_44420 8389 9429 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539819.1 protein_id gnl|my_center|LOCUS_44420 9478 9774 gene locus_tag LOCUS_44430 9478 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 9833 11176 gene locus_tag LOCUS_44440 9833 11176 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949164.1 protein_id gnl|my_center|LOCUS_44440 13019 11583 gene locus_tag LOCUS_44450 13019 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 13384 13115 gene locus_tag LOCUS_44460 13384 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 >Feature sequence125 1175 234 gene locus_tag LOCUS_44470 1175 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_44470 1541 2503 gene locus_tag LOCUS_44480 1541 2503 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089242.1 protein_id gnl|my_center|LOCUS_44480 3288 2575 gene locus_tag LOCUS_44490 3288 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 4221 3298 gene locus_tag LOCUS_44500 4221 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 4794 4225 gene locus_tag LOCUS_44510 4794 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 6029 4884 gene locus_tag LOCUS_44520 gene pseC 6029 4884 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_44520 6599 6147 gene locus_tag LOCUS_44530 gene aroQ 6599 6147 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_44530 6986 7321 gene locus_tag LOCUS_44540 6986 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 7719 9092 gene locus_tag LOCUS_44550 7719 9092 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_44550 10284 9430 gene locus_tag LOCUS_44560 10284 9430 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_44560 11303 10281 gene locus_tag LOCUS_44570 11303 10281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_44570 12278 11451 gene locus_tag LOCUS_44580 12278 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 12378 12950 gene locus_tag LOCUS_44590 12378 12950 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_44590 12962 13720 gene locus_tag LOCUS_44600 12962 13720 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_44600 13791 13800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence126 1637 381 gene locus_tag LOCUS_44610 1637 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 2344 1775 gene locus_tag LOCUS_44620 2344 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 5063 2403 gene locus_tag LOCUS_44630 5063 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 5317 5063 gene locus_tag LOCUS_44640 5317 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 7352 5415 gene locus_tag LOCUS_44650 7352 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 7687 8061 gene locus_tag LOCUS_44660 7687 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 9107 8055 gene locus_tag LOCUS_44670 9107 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 9981 9160 gene locus_tag LOCUS_44680 9981 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 10194 11114 gene locus_tag LOCUS_44690 10194 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 12297 11119 gene locus_tag LOCUS_44700 12297 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 12650 12441 gene locus_tag LOCUS_44710 12650 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 13668 12895 gene locus_tag LOCUS_44720 13668 12895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 >Feature sequence127 832 1692 gene locus_tag LOCUS_44730 832 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 1784 2428 gene locus_tag LOCUS_44740 1784 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 2441 3064 gene locus_tag LOCUS_44750 2441 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 3831 3061 gene locus_tag LOCUS_44760 3831 3061 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_44760 4120 3833 gene locus_tag LOCUS_44770 4120 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 5157 4138 gene locus_tag LOCUS_44780 5157 4138 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_44780 6177 5167 gene locus_tag LOCUS_44790 6177 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 7037 6303 gene locus_tag LOCUS_44800 7037 6303 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_44800 7575 7919 gene locus_tag LOCUS_44810 7575 7919 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_44810 7947 10676 gene locus_tag LOCUS_44820 7947 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 11315 10713 gene locus_tag LOCUS_44830 11315 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 11463 13061 gene locus_tag LOCUS_44840 11463 13061 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_44840 >Feature sequence128 632 1420 gene locus_tag LOCUS_44850 gene garL 632 1420 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039577.1 protein_id gnl|my_center|LOCUS_44850 2322 1591 gene locus_tag LOCUS_44860 2322 1591 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391476.1 protein_id gnl|my_center|LOCUS_44860 3366 2323 gene locus_tag LOCUS_44870 gene aph(9)-Ia 3366 2323 CDS product aminoglycoside O-phosphotransferase APH(9)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947221.1 protein_id gnl|my_center|LOCUS_44870 4183 3410 gene locus_tag LOCUS_44880 4183 3410 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546419.1 protein_id gnl|my_center|LOCUS_44880 5761 4187 gene locus_tag LOCUS_44890 5761 4187 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545223.1 protein_id gnl|my_center|LOCUS_44890 6291 5857 gene locus_tag LOCUS_44900 6291 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 6644 7639 gene locus_tag LOCUS_44910 6644 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 7890 7741 gene locus_tag LOCUS_44920 7890 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 8514 7891 gene locus_tag LOCUS_44930 8514 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 10529 9087 gene locus_tag LOCUS_44940 10529 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 11888 10548 gene locus_tag LOCUS_44950 11888 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 <13206 11945 gene locus_tag LOCUS_44960 <13206 11945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence129 1013 279 gene locus_tag LOCUS_44970 1013 279 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 protein_id gnl|my_center|LOCUS_44970 2037 1072 gene locus_tag LOCUS_44980 2037 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 3766 2141 gene locus_tag LOCUS_44990 3766 2141 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_44990 4501 3785 gene locus_tag LOCUS_45000 4501 3785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_45000 5481 4543 gene locus_tag LOCUS_45010 5481 4543 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_45010 5770 7125 gene locus_tag LOCUS_45020 5770 7125 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_45020 7518 7180 gene locus_tag LOCUS_45030 7518 7180 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_45030 9094 7679 gene locus_tag LOCUS_45040 gene glnA 9094 7679 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_45040 10180 9560 gene locus_tag LOCUS_45050 gene dcd 10180 9560 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_45050 11049 10291 gene locus_tag LOCUS_45060 11049 10291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 11892 11062 gene locus_tag LOCUS_45070 11892 11062 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336895.1 protein_id gnl|my_center|LOCUS_45070 <13148 12184 gene locus_tag LOCUS_45080 <13148 12184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258001.1:heterodisulfide reductase-related iron-sulfur binding cluster >Feature sequence130 2647 23 gene locus_tag LOCUS_45090 2647 23 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_45090 3391 4911 gene locus_tag LOCUS_45100 3391 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 5809 5036 gene locus_tag LOCUS_45110 5809 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 6056 7354 gene locus_tag LOCUS_45120 6056 7354 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_45120 7373 7960 gene locus_tag LOCUS_45130 7373 7960 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_45130 7960 8187 gene locus_tag LOCUS_45140 7960 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 8181 8954 gene locus_tag LOCUS_45150 8181 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 8970 10079 gene locus_tag LOCUS_45160 8970 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668735.1 protein_id gnl|my_center|LOCUS_45160 11804 10149 gene locus_tag LOCUS_45170 11804 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence131 <1 1449 gene locus_tag LOCUS_45180 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979130.1:CoA-acylating methylmalonate-semialdehyde dehydrogenase 1644 2105 gene locus_tag LOCUS_45190 1644 2105 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_45190 2107 2580 gene locus_tag LOCUS_45200 2107 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 4490 2595 gene locus_tag LOCUS_45210 4490 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_45210 5118 5588 gene locus_tag LOCUS_45220 5118 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 5621 7087 gene locus_tag LOCUS_45230 5621 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 7865 7278 gene locus_tag LOCUS_45240 7865 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 8083 8886 gene locus_tag LOCUS_45250 8083 8886 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_45250 8867 9454 gene locus_tag LOCUS_45260 8867 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 9532 10425 gene locus_tag LOCUS_45270 9532 10425 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_45270 10461 11486 gene locus_tag LOCUS_45280 gene iolG 10461 11486 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_45280 <12201 11504 gene locus_tag LOCUS_45290 <12201 11504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083143.1:ABC transporter ATP-binding protein >Feature sequence132 2012 72 gene locus_tag LOCUS_45300 gene selB 2012 72 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_45300 2812 2045 gene locus_tag LOCUS_45310 gene lepB 2812 2045 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941922.1 protein_id gnl|my_center|LOCUS_45310 4706 2901 gene locus_tag LOCUS_45320 gene lepA 4706 2901 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_45320 5476 4868 gene locus_tag LOCUS_45330 5476 4868 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_45330 6460 5501 gene locus_tag LOCUS_45340 6460 5501 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_45340 7853 6744 gene locus_tag LOCUS_45350 gene phnA 7853 6744 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533039.1 protein_id gnl|my_center|LOCUS_45350 8037 8690 gene locus_tag LOCUS_45360 8037 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 9521 10915 gene locus_tag LOCUS_45370 gene glmM 9521 10915 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_45370 >Feature sequence133 392 523 gene locus_tag LOCUS_45380 392 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 743 1978 gene locus_tag LOCUS_45390 743 1978 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402980.1 protein_id gnl|my_center|LOCUS_45390 2162 2779 gene locus_tag LOCUS_45400 2162 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 2883 4496 gene locus_tag LOCUS_45410 2883 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 4512 7091 gene locus_tag LOCUS_45420 4512 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 7105 8259 gene locus_tag LOCUS_45430 7105 8259 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_45430 8410 10143 gene locus_tag LOCUS_45440 8410 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 10467 11471 gene locus_tag LOCUS_45450 10467 11471 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_45450 >Feature sequence134 3229 92 gene locus_tag LOCUS_45460 3229 92 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583655.1 protein_id gnl|my_center|LOCUS_45460 3576 3229 gene locus_tag LOCUS_45470 3576 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 3877 3560 gene locus_tag LOCUS_45480 3877 3560 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_45480 6511 5201 gene locus_tag LOCUS_45490 6511 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108245.1 protein_id gnl|my_center|LOCUS_45490 8049 6514 gene locus_tag LOCUS_45500 8049 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 11307 8191 gene locus_tag LOCUS_45510 11307 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 >Feature sequence135 1159 1365 gene locus_tag LOCUS_45520 1159 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 1362 1637 gene locus_tag LOCUS_45530 1362 1637 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_45530 3137 1986 gene locus_tag LOCUS_45540 3137 1986 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_45540 4949 3441 gene locus_tag LOCUS_45550 4949 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 6209 7507 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattcccttctaacgggaaagtg 8400 7981 gene locus_tag LOCUS_45560 8400 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 8704 8348 gene locus_tag LOCUS_45570 8704 8348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 9349 10980 gene locus_tag LOCUS_45580 9349 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 >Feature sequence136 155 1456 gene locus_tag LOCUS_45590 155 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 1643 4087 gene locus_tag LOCUS_45600 1643 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 4967 4131 gene locus_tag LOCUS_45610 4967 4131 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_45610 8365 4970 gene locus_tag LOCUS_45620 8365 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_45620 9326 8355 gene locus_tag LOCUS_45630 9326 8355 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_45630 9471 10664 gene locus_tag LOCUS_45640 9471 10664 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_45640 >Feature sequence137 81 1166 gene locus_tag LOCUS_45650 81 1166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_45650 2167 1169 gene locus_tag LOCUS_45660 2167 1169 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_45660 3190 2213 gene locus_tag LOCUS_45670 3190 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 5220 3202 gene locus_tag LOCUS_45680 5220 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 7277 5364 gene locus_tag LOCUS_45690 7277 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 8808 7426 gene locus_tag LOCUS_45700 8808 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 9119 9778 gene locus_tag LOCUS_45710 gene rpoE 9119 9778 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_45710 10151 10238 gene locus_tag LOCUS_t00160 10151 10238 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10242 10326 gene locus_tag LOCUS_t00170 10242 10326 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence138 2591 6 gene locus_tag LOCUS_45720 2591 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 2911 2588 gene locus_tag LOCUS_45730 2911 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 3111 2911 gene locus_tag LOCUS_45740 3111 2911 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_45740 4879 3254 gene locus_tag LOCUS_45750 4879 3254 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964265.1 protein_id gnl|my_center|LOCUS_45750 5974 4910 gene locus_tag LOCUS_45760 5974 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 8136 5974 gene locus_tag LOCUS_45770 8136 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 9401 8139 gene locus_tag LOCUS_45780 9401 8139 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 protein_id gnl|my_center|LOCUS_45780 10053 9631 gene locus_tag LOCUS_45790 10053 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 >Feature sequence139 230 976 gene locus_tag LOCUS_45800 230 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 1039 1536 gene locus_tag LOCUS_45810 1039 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 3424 1694 gene locus_tag LOCUS_45820 3424 1694 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_45820 4431 3460 gene locus_tag LOCUS_45830 4431 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 5865 5101 gene locus_tag LOCUS_45840 5865 5101 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 protein_id gnl|my_center|LOCUS_45840 6221 5937 gene locus_tag LOCUS_45850 6221 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 6741 6268 gene locus_tag LOCUS_45860 6741 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 7677 6832 gene locus_tag LOCUS_45870 7677 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 7994 7692 gene locus_tag LOCUS_45880 7994 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 8916 8119 gene locus_tag LOCUS_45890 8916 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 9400 8927 gene locus_tag LOCUS_45900 9400 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 >Feature sequence140 1371 1664 gene locus_tag LOCUS_45910 1371 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 1724 3343 gene locus_tag LOCUS_45920 gene ggt 1724 3343 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_45920 3582 4028 gene locus_tag LOCUS_45930 3582 4028 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400443.1 protein_id gnl|my_center|LOCUS_45930 4255 5304 gene locus_tag LOCUS_45940 4255 5304 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944638.1 protein_id gnl|my_center|LOCUS_45940 6525 5584 gene locus_tag LOCUS_45950 6525 5584 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140857.1 protein_id gnl|my_center|LOCUS_45950 6650 7570 gene locus_tag LOCUS_45960 6650 7570 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_45960 7764 8729 gene locus_tag LOCUS_45970 gene murQ 7764 8729 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 protein_id gnl|my_center|LOCUS_45970 8791 9741 gene locus_tag LOCUS_45980 8791 9741 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_45980 >Feature sequence141 <1 784 gene locus_tag LOCUS_45990 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545135.1:4-hydroxy-tetrahydrodipicolinate synthase 2311 998 gene locus_tag LOCUS_46000 2311 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_46000 3395 2331 gene locus_tag LOCUS_46010 3395 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 4401 3478 gene locus_tag LOCUS_46020 4401 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 5590 4508 gene locus_tag LOCUS_46030 gene alr 5590 4508 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181633.1 protein_id gnl|my_center|LOCUS_46030 6594 5806 gene locus_tag LOCUS_46040 6594 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 7405 6680 gene locus_tag LOCUS_46050 gene potB 7405 6680 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715500.1 protein_id gnl|my_center|LOCUS_46050 8051 7521 gene locus_tag LOCUS_46060 8051 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_46060 9397 8051 gene locus_tag LOCUS_46070 9397 8051 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_46070 >Feature sequence142 375 947 gene locus_tag LOCUS_46080 375 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 996 2063 gene locus_tag LOCUS_46090 996 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 2498 2187 gene locus_tag LOCUS_46100 2498 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 3687 8180 gene locus_tag LOCUS_46110 gene gltB 3687 8180 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259099.1 protein_id gnl|my_center|LOCUS_46110 8753 8331 gene locus_tag LOCUS_46120 8753 8331 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_46120 9256 8807 gene locus_tag LOCUS_46130 9256 8807 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_46130 >Feature sequence143 358 942 gene locus_tag LOCUS_46140 358 942 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_46140 1121 2917 gene locus_tag LOCUS_46150 1121 2917 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_46150 3170 3457 gene locus_tag LOCUS_46160 3170 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 3454 3786 gene locus_tag LOCUS_46170 3454 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 3791 5092 gene locus_tag LOCUS_46180 3791 5092 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_46180 5099 5371 gene locus_tag LOCUS_46190 5099 5371 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_46190 5358 5597 gene locus_tag LOCUS_46200 5358 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 5670 7640 gene locus_tag LOCUS_46210 5670 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 7847 8905 gene locus_tag LOCUS_46220 7847 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 >Feature sequence144 920 120 gene locus_tag LOCUS_46230 gene trpA 920 120 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496709.1 protein_id gnl|my_center|LOCUS_46230 2487 985 gene locus_tag LOCUS_46240 2487 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 7211 2499 gene locus_tag LOCUS_46250 7211 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 8096 7545 gene locus_tag LOCUS_46260 8096 7545 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183217.1 protein_id gnl|my_center|LOCUS_46260 8656 8171 gene locus_tag LOCUS_46270 8656 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 8848 9426 gene locus_tag LOCUS_46280 8848 9426 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_46280 >Feature sequence145 645 160 gene locus_tag LOCUS_46290 645 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 893 642 gene locus_tag LOCUS_46300 893 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 1473 1183 gene locus_tag LOCUS_46310 1473 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 1927 2178 gene locus_tag LOCUS_46320 1927 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 2906 2547 gene locus_tag LOCUS_46330 2906 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 3691 2921 gene locus_tag LOCUS_46340 3691 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 4290 3919 gene locus_tag LOCUS_46350 4290 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 5091 4303 gene locus_tag LOCUS_46360 5091 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 7789 6485 gene locus_tag LOCUS_46370 7789 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 8387 8650 gene locus_tag LOCUS_46380 8387 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 >Feature sequence146 274 4671 gene locus_tag LOCUS_46390 274 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 6054 5041 gene locus_tag LOCUS_46400 6054 5041 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46400 6246 6058 gene locus_tag LOCUS_46410 6246 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46410 8918 6249 gene locus_tag LOCUS_46420 8918 6249 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104585991.1 protein_id gnl|my_center|LOCUS_46420 >Feature sequence147 3582 289 gene locus_tag LOCUS_46430 3582 289 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_46430 3744 5978 gene locus_tag LOCUS_46440 3744 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 6001 6570 gene locus_tag LOCUS_46450 6001 6570 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_46450 6862 7644 gene locus_tag LOCUS_46460 6862 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 7541 8437 gene locus_tag LOCUS_46470 7541 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 8430 8942 gene locus_tag LOCUS_46480 8430 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 >Feature sequence148 <1 1356 gene locus_tag LOCUS_46490 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase 1685 4450 gene locus_tag LOCUS_46500 1685 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 4440 5921 gene locus_tag LOCUS_46510 4440 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021016.1 protein_id gnl|my_center|LOCUS_46510 6046 6456 gene locus_tag LOCUS_46520 6046 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 7340 6738 gene locus_tag LOCUS_46530 7340 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 9026 7419 gene locus_tag LOCUS_46540 9026 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 >Feature sequence149 3462 658 gene locus_tag LOCUS_46550 3462 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 7603 3509 gene locus_tag LOCUS_46560 7603 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 <9031 7866 gene locus_tag LOCUS_46570 <9031 7866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence150 870 2036 gene locus_tag LOCUS_46580 870 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 2400 3218 gene locus_tag LOCUS_46590 2400 3218 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113090.1 protein_id gnl|my_center|LOCUS_46590 3451 4539 gene locus_tag LOCUS_46600 gene mnmA 3451 4539 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_46600 4536 5456 gene locus_tag LOCUS_46610 gene miaA 4536 5456 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_46610 5568 7211 gene locus_tag LOCUS_46620 5568 7211 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_46620 8859 7219 gene locus_tag LOCUS_46630 8859 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence151 157 2631 gene locus_tag LOCUS_46640 157 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 2656 3153 gene locus_tag LOCUS_46650 2656 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 3150 4409 gene locus_tag LOCUS_46660 3150 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 4640 5347 gene locus_tag LOCUS_46670 4640 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 5741 5986 gene locus_tag LOCUS_46680 5741 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 5986 6363 gene locus_tag LOCUS_46690 5986 6363 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_46690 6823 7557 gene locus_tag LOCUS_46700 6823 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 7662 8396 gene locus_tag LOCUS_46710 7662 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 8440 8539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence152 312 25 gene locus_tag LOCUS_46720 312 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 576 388 gene locus_tag LOCUS_46730 576 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 2124 691 gene locus_tag LOCUS_46740 2124 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 2772 2161 gene locus_tag LOCUS_46750 2772 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 3545 3003 gene locus_tag LOCUS_46760 3545 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 3584 3796 gene locus_tag LOCUS_46770 3584 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 5264 3762 gene locus_tag LOCUS_46780 5264 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 8487 5425 gene locus_tag LOCUS_46790 8487 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 >Feature sequence153 237 2183 gene locus_tag LOCUS_46800 gene secD 237 2183 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_46800 2205 3401 gene locus_tag LOCUS_46810 2205 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 3526 4269 gene locus_tag LOCUS_46820 3526 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 4508 4930 gene locus_tag LOCUS_46830 4508 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 5038 5532 gene locus_tag LOCUS_46840 5038 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 5626 6318 gene locus_tag LOCUS_46850 5626 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 6353 7747 gene locus_tag LOCUS_46860 6353 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 >Feature sequence154 1430 1867 gene locus_tag LOCUS_46870 1430 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 1937 3424 gene locus_tag LOCUS_46880 1937 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 3425 4189 gene locus_tag LOCUS_46890 3425 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 5755 6282 gene locus_tag LOCUS_46900 5755 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 6290 7525 gene locus_tag LOCUS_46910 6290 7525 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_46910 >Feature sequence155 206 51 gene locus_tag LOCUS_46920 206 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 794 1594 gene locus_tag LOCUS_46930 794 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 1979 1824 gene locus_tag LOCUS_46940 1979 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 1968 3056 gene locus_tag LOCUS_46950 gene miaB 1968 3056 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_46950 3206 3988 gene locus_tag LOCUS_46960 gene map 3206 3988 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_46960 4016 4678 gene locus_tag LOCUS_46970 gene ccsA 4016 4678 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_46970 4678 5016 gene locus_tag LOCUS_46980 4678 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 5178 5627 gene locus_tag LOCUS_46990 5178 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 5814 6758 gene locus_tag LOCUS_47000 5814 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 >Feature sequence156 502 260 gene locus_tag LOCUS_47010 502 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 1659 505 gene locus_tag LOCUS_47020 1659 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 1958 1659 gene locus_tag LOCUS_47030 1958 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 2765 1986 gene locus_tag LOCUS_47040 2765 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 3574 2777 gene locus_tag LOCUS_47050 3574 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47050 4248 5075 gene locus_tag LOCUS_47060 4248 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 5643 6974 gene locus_tag LOCUS_47070 5643 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 >Feature sequence157 <1 1044 gene locus_tag LOCUS_47080 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258585.1:glycoside hydrolase family 32 protein 1056 1310 gene locus_tag LOCUS_47090 1056 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 1321 2124 gene locus_tag LOCUS_47100 1321 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 2160 3434 gene locus_tag LOCUS_47110 2160 3434 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256133.1 protein_id gnl|my_center|LOCUS_47110 3830 4639 gene locus_tag LOCUS_47120 3830 4639 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229391.1 protein_id gnl|my_center|LOCUS_47120 4755 6146 gene locus_tag LOCUS_47130 4755 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198142920.1 protein_id gnl|my_center|LOCUS_47130 6175 6978 gene locus_tag LOCUS_47140 6175 6978 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_47140 >Feature sequence158 1424 216 gene locus_tag LOCUS_47150 1424 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 4069 1439 gene locus_tag LOCUS_47160 4069 1439 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_47160 5023 4364 gene locus_tag LOCUS_47170 5023 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 5448 6587 gene locus_tag LOCUS_47180 5448 6587 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_47180 >Feature sequence159 119 1867 gene locus_tag LOCUS_47190 119 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 1898 2137 gene locus_tag LOCUS_47200 1898 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 2833 3414 gene locus_tag LOCUS_47210 2833 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 3691 3984 gene locus_tag LOCUS_47220 3691 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 4003 5349 gene locus_tag LOCUS_47230 4003 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 5342 6859 gene locus_tag LOCUS_47240 5342 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 >Feature sequence160 2288 1647 gene locus_tag LOCUS_47250 2288 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 3363 4799 gene locus_tag LOCUS_47260 3363 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 4856 6733 gene locus_tag LOCUS_47270 4856 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 >Feature sequence161 6 956 gene locus_tag LOCUS_47280 6 956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_47280 1259 1459 gene locus_tag LOCUS_47290 1259 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 2354 1449 gene locus_tag LOCUS_47300 2354 1449 CDS product IS982 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140154.1 protein_id gnl|my_center|LOCUS_47300 2720 5443 gene locus_tag LOCUS_47310 2720 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 <6748 5609 gene locus_tag LOCUS_47320 <6748 5609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897970.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence162 2345 1110 gene locus_tag LOCUS_47330 2345 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 3268 5958 gene locus_tag LOCUS_47340 3268 5958 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_47340 6042 6518 gene locus_tag LOCUS_47350 6042 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence163 1283 336 gene locus_tag LOCUS_47360 1283 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 2188 1280 gene locus_tag LOCUS_47370 2188 1280 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_47370 3885 2191 gene locus_tag LOCUS_47380 3885 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 4181 3882 gene locus_tag LOCUS_47390 4181 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 5405 4182 gene locus_tag LOCUS_47400 5405 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 5776 5486 gene locus_tag LOCUS_47410 5776 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 >Feature sequence164 207 866 gene locus_tag LOCUS_47420 207 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 863 1741 gene locus_tag LOCUS_47430 863 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 1919 2332 gene locus_tag LOCUS_47440 1919 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 2518 2790 gene locus_tag LOCUS_47450 2518 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 3059 4612 gene locus_tag LOCUS_47460 3059 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 4620 5855 gene locus_tag LOCUS_47470 4620 5855 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_47470 >Feature sequence165 511 882 gene locus_tag LOCUS_47480 511 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 1034 1231 gene locus_tag LOCUS_47490 1034 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 1985 2161 gene locus_tag LOCUS_47500 1985 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 2586 2371 gene locus_tag LOCUS_47510 2586 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 4417 2570 gene locus_tag LOCUS_47520 4417 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 4652 5314 gene locus_tag LOCUS_47530 4652 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 5298 5795 gene locus_tag LOCUS_47540 5298 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 >Feature sequence166 2498 162 gene locus_tag LOCUS_47550 2498 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 2719 3798 gene locus_tag LOCUS_47560 2719 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 4845 4033 gene locus_tag LOCUS_47570 4845 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 5848 4907 gene locus_tag LOCUS_47580 5848 4907 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681076.1 protein_id gnl|my_center|LOCUS_47580 >Feature sequence167 2634 886 gene locus_tag LOCUS_47590 2634 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 2998 3222 gene locus_tag LOCUS_47600 2998 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 3279 5906 gene locus_tag LOCUS_47610 3279 5906 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_47610 >Feature sequence168 2787 160 gene locus_tag LOCUS_47620 2787 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 3077 2862 gene locus_tag LOCUS_47630 3077 2862 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_47630 4726 3302 gene locus_tag LOCUS_47640 4726 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47640 <5939 5047 gene locus_tag LOCUS_47650 <5939 5047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000963206.1:nucleotide-binding protein >Feature sequence169 592 1692 gene locus_tag LOCUS_47660 592 1692 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_47660 4425 1786 gene locus_tag LOCUS_47670 4425 1786 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_47670 5422 4601 gene locus_tag LOCUS_47680 5422 4601 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_47680 >Feature sequence170 1490 384 gene locus_tag LOCUS_47690 1490 384 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223493.1 protein_id gnl|my_center|LOCUS_47690 2222 1851 gene locus_tag LOCUS_47700 2222 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 2614 2219 gene locus_tag LOCUS_47710 2614 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 3154 2657 gene locus_tag LOCUS_47720 3154 2657 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_47720 4547 3129 gene locus_tag LOCUS_47730 4547 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 4935 4654 gene locus_tag LOCUS_47740 4935 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 >Feature sequence171 74 3622 gene locus_tag LOCUS_47750 74 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 4459 5616 gene locus_tag LOCUS_47760 4459 5616 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314820.1 protein_id gnl|my_center|LOCUS_47760 >Feature sequence172 108 3221 gene locus_tag LOCUS_47770 108 3221 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_47770 3853 4152 gene locus_tag LOCUS_47780 3853 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 4139 4333 gene locus_tag LOCUS_47790 4139 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 >Feature sequence173 1555 3564 gene locus_tag LOCUS_47800 1555 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 4795 3569 gene locus_tag LOCUS_47810 4795 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 >Feature sequence174 428 198 gene locus_tag LOCUS_47820 428 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 1999 440 gene locus_tag LOCUS_47830 1999 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47830 3482 2031 gene locus_tag LOCUS_47840 3482 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 4796 3702 gene locus_tag LOCUS_47850 4796 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 >Feature sequence175 766 1689 gene locus_tag LOCUS_47860 766 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 1686 3683 gene locus_tag LOCUS_47870 1686 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 3683 4621 gene locus_tag LOCUS_47880 3683 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 >Feature sequence176 1615 77 gene locus_tag LOCUS_47890 1615 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 2367 1612 gene locus_tag LOCUS_47900 2367 1612 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_47900 4907 2367 gene locus_tag LOCUS_47910 gene zorA 4907 2367 CDS product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_47910 >Feature sequence177 4838 2055 gene locus_tag LOCUS_47920 4838 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 >Feature sequence178 184 771 gene locus_tag LOCUS_47930 184 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 1761 1318 gene locus_tag LOCUS_47940 1761 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 2745 2050 gene locus_tag LOCUS_47950 2745 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 3671 3507 gene locus_tag LOCUS_47960 3671 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 4507 3668 gene locus_tag LOCUS_47970 4507 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47970 >Feature sequence179 941 63 gene locus_tag LOCUS_47980 gene ispE 941 63 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_47980 1898 954 gene locus_tag LOCUS_47990 1898 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 3089 1899 gene locus_tag LOCUS_48000 3089 1899 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_48000 3419 3598 gene locus_tag LOCUS_48010 3419 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 4533 3691 gene locus_tag LOCUS_48020 4533 3691 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140081.1 protein_id gnl|my_center|LOCUS_48020 >Feature sequence180 1142 2416 gene locus_tag LOCUS_48030 1142 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 3371 2601 gene locus_tag LOCUS_48040 3371 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 4420 3368 gene locus_tag LOCUS_48050 gene rfaE1 4420 3368 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583086.1 protein_id gnl|my_center|LOCUS_48050 >Feature sequence181 735 184 gene locus_tag LOCUS_48060 735 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 2809 758 gene locus_tag LOCUS_48070 2809 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 3842 2817 gene locus_tag LOCUS_48080 3842 2817 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815218.1 protein_id gnl|my_center|LOCUS_48080 >Feature sequence182 768 34 gene locus_tag LOCUS_48090 768 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 2826 835 gene locus_tag LOCUS_48100 2826 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 >Feature sequence183 2520 163 gene locus_tag LOCUS_48110 2520 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 2969 2676 gene locus_tag LOCUS_48120 2969 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48120 3372 3025 gene locus_tag LOCUS_48130 3372 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 3935 3597 gene locus_tag LOCUS_48140 3935 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 >Feature sequence184 335 589 gene locus_tag LOCUS_48150 335 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 709 1719 gene locus_tag LOCUS_48160 709 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 1931 2182 gene locus_tag LOCUS_48170 1931 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 2345 3361 gene locus_tag LOCUS_48180 2345 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 >Feature sequence185 857 186 gene locus_tag LOCUS_48190 857 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 1878 859 gene locus_tag LOCUS_48200 1878 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 3462 2140 gene locus_tag LOCUS_48210 3462 2140 CDS product ISL3-like element ISEc53 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343766.1 protein_id gnl|my_center|LOCUS_48210 >Feature sequence186 2717 1797 gene locus_tag LOCUS_48220 2717 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48220 <4039 2737 gene locus_tag LOCUS_48230 <4039 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966548.1:leucine-rich repeat domain-containing protein 2740 2839 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence187 312 818 gene locus_tag LOCUS_48240 312 818 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_48240 811 1359 gene locus_tag LOCUS_48250 811 1359 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_48250 1492 2688 gene locus_tag LOCUS_48260 gene nuoD 1492 2688 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_48260 2702 3061 gene locus_tag LOCUS_48270 2702 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 >Feature sequence188 1841 1428 gene locus_tag LOCUS_48280 1841 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 2123 2926 gene locus_tag LOCUS_48290 2123 2926 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970738.1 protein_id gnl|my_center|LOCUS_48290 3349 2930 gene locus_tag LOCUS_48300 3349 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 >Feature sequence189 2050 1583 gene locus_tag LOCUS_48310 2050 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 2561 2100 gene locus_tag LOCUS_48320 2561 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 3430 2657 gene locus_tag LOCUS_48330 3430 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 3909 3520 gene locus_tag LOCUS_48340 3909 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 >Feature sequence190 850 1983 gene locus_tag LOCUS_48350 850 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 2005 2313 gene locus_tag LOCUS_48360 2005 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 2579 3667 gene locus_tag LOCUS_48370 2579 3667 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_48370 >Feature sequence191 275 682 gene locus_tag LOCUS_48380 275 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 1093 800 gene locus_tag LOCUS_48390 1093 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 1569 1222 gene locus_tag LOCUS_48400 1569 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 2487 1765 gene locus_tag LOCUS_48410 2487 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 3160 2498 gene locus_tag LOCUS_48420 3160 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 3249 3485 gene locus_tag LOCUS_48430 3249 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 3575 3426 gene locus_tag LOCUS_48440 3575 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 >Feature sequence192 957 1268 gene locus_tag LOCUS_48450 957 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 1509 2411 gene locus_tag LOCUS_48460 1509 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 2511 3344 gene locus_tag LOCUS_48470 2511 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 >Feature sequence193 101 1273 gene locus_tag LOCUS_48480 101 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 1263 1757 gene locus_tag LOCUS_48490 1263 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 2417 1779 gene locus_tag LOCUS_48500 2417 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 2469 3518 gene locus_tag LOCUS_48510 2469 3518 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_48510 >Feature sequence194 34 1773 gene locus_tag LOCUS_48520 34 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 >Feature sequence195 1431 2735 gene locus_tag LOCUS_48530 1431 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 >Feature sequence196 306 151 gene locus_tag LOCUS_48540 306 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 2242 458 gene locus_tag LOCUS_48550 2242 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 >Feature sequence197 253 3015 gene locus_tag LOCUS_48560 253 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 >Feature sequence198 1262 1005 gene locus_tag LOCUS_48570 1262 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 1485 1234 gene locus_tag LOCUS_48580 1485 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 1749 1985 gene locus_tag LOCUS_48590 1749 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 1990 2226 gene locus_tag LOCUS_48600 1990 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 2584 2976 gene locus_tag LOCUS_48610 2584 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 >Feature sequence199 958 35 gene locus_tag LOCUS_48620 958 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 1049 1792 gene locus_tag LOCUS_48630 1049 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48630 1812 2975 gene locus_tag LOCUS_48640 1812 2975 CDS product SAVED domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331497.1 protein_id gnl|my_center|LOCUS_48640 >Feature sequence200 >Feature sequence201 912 76 gene locus_tag LOCUS_48650 912 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071996.1 protein_id gnl|my_center|LOCUS_48650 <3193 1163 gene locus_tag LOCUS_48660 <3193 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939452.1:DEAD/DEAH box helicase family protein >Feature sequence202 <3186 198 gene locus_tag LOCUS_48670 <3186 198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016371.1:DEAD/DEAH box helicase >Feature sequence203 2234 660 gene locus_tag LOCUS_48680 2234 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 <3183 2552 gene locus_tag LOCUS_48690 <3183 2552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964265.1:site-specific DNA-methyltransferase >Feature sequence204 424 846 gene locus_tag LOCUS_48700 424 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 848 1792 gene locus_tag LOCUS_48710 848 1792 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 protein_id gnl|my_center|LOCUS_48710 2703 1789 gene locus_tag LOCUS_48720 2703 1789 CDS product HindIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995236.1 protein_id gnl|my_center|LOCUS_48720 >Feature sequence205 1615 1394 gene locus_tag LOCUS_48730 1615 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 2431 1814 gene locus_tag LOCUS_48740 2431 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 >Feature sequence206 >Feature sequence207 1259 111 gene locus_tag LOCUS_48750 1259 111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_48750 1886 1320 gene locus_tag LOCUS_48760 1886 1320 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_48760 2821 1922 gene locus_tag LOCUS_48770 2821 1922 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 protein_id gnl|my_center|LOCUS_48770 >Feature sequence208 703 1020 gene locus_tag LOCUS_48780 703 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 1498 1737 gene locus_tag LOCUS_48790 1498 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 1845 2813 gene locus_tag LOCUS_48800 1845 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 >Feature sequence209 1609 302 gene locus_tag LOCUS_48810 1609 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 >Feature sequence210 279 914 gene locus_tag LOCUS_48820 279 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 2351 1023 gene locus_tag LOCUS_48830 2351 1023 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_48830 2665 2453 gene locus_tag LOCUS_48840 2665 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 >Feature sequence211 1739 129 gene locus_tag LOCUS_48850 1739 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 2074 1832 gene locus_tag LOCUS_48860 2074 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 2668 2369 gene locus_tag LOCUS_48870 2668 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 >Feature sequence212 56 1249 gene locus_tag LOCUS_48880 56 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 1353 1452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1575 2537 gene locus_tag LOCUS_48890 1575 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 >Feature sequence213 1865 810 gene locus_tag LOCUS_48900 1865 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 >Feature sequence214 716 1732 gene locus_tag LOCUS_48910 716 1732 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_48910 1732 2235 gene locus_tag LOCUS_48920 1732 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 >Feature sequence215 339 1061 gene locus_tag LOCUS_48930 339 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 1255 2496 gene locus_tag LOCUS_48940 1255 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 >Feature sequence216 383 1267 gene locus_tag LOCUS_48950 383 1267 CDS product DUF2806 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279526.1 protein_id gnl|my_center|LOCUS_48950 1967 1410 gene locus_tag LOCUS_48960 1967 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 >Feature sequence217 1058 1423 gene locus_tag LOCUS_48970 1058 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 1520 1996 gene locus_tag LOCUS_48980 1520 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 2054 2431 gene locus_tag LOCUS_48990 2054 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 >Feature sequence218 705 580 gene locus_tag LOCUS_49000 705 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 1583 705 gene locus_tag LOCUS_49010 1583 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49010 2145 1894 gene locus_tag LOCUS_49020 2145 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence219 636 962 gene locus_tag LOCUS_49030 636 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 >Feature sequence220 438 31 gene locus_tag LOCUS_49040 438 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 1625 894 gene locus_tag LOCUS_49050 1625 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280507.1 protein_id gnl|my_center|LOCUS_49050 >Feature sequence221 >Feature sequence222 1114 65 gene locus_tag LOCUS_49060 1114 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 >Feature sequence223 909 421 gene locus_tag LOCUS_49070 gene dfrA 909 421 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637198.1 protein_id gnl|my_center|LOCUS_49070 1414 911 gene locus_tag LOCUS_49080 1414 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 2174 1479 gene locus_tag LOCUS_49090 2174 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 >Feature sequence224 392 87 gene locus_tag LOCUS_49100 392 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 916 554 gene locus_tag LOCUS_49110 916 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 <2271 1681 gene locus_tag LOCUS_49120 <2271 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529345.1:IS1595 family transposase >Feature sequence225 >Feature sequence226 446 721 gene locus_tag LOCUS_49130 446 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 826 1509 gene locus_tag LOCUS_49140 826 1509 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_49140 >Feature sequence227 110 487 gene locus_tag LOCUS_49150 110 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 492 848 gene locus_tag LOCUS_49160 492 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 853 1443 gene locus_tag LOCUS_49170 853 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 1453 2016 gene locus_tag LOCUS_49180 1453 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 >Feature sequence228 363 1106 gene locus_tag LOCUS_49190 363 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 1498 1205 gene locus_tag LOCUS_49200 1498 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 >Feature sequence229 541 1311 gene locus_tag LOCUS_49210 541 1311 CDS product viperin family antiviral radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 protein_id gnl|my_center|LOCUS_49210 1301 1906 gene locus_tag LOCUS_49220 1301 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 >Feature sequence230 261 46 gene locus_tag LOCUS_49230 261 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 <2051 341 gene locus_tag LOCUS_49240 <2051 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964263.1:DEAD/DEAH box helicase family protein >Feature sequence231 1713 133 gene locus_tag LOCUS_49250 1713 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 >Feature sequence232 1587 409 gene locus_tag LOCUS_49260 1587 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260