>Feature sequence001 569 1423 gene locus_tag LOCUS_00010 569 1423 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971126.1 protein_id gnl|my_center|LOCUS_00010 1472 2239 gene locus_tag LOCUS_00020 1472 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2331 3443 gene locus_tag LOCUS_00030 2331 3443 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385032.1 protein_id gnl|my_center|LOCUS_00030 3546 4127 gene locus_tag LOCUS_00040 gene gfa 3546 4127 CDS product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337580.1 protein_id gnl|my_center|LOCUS_00040 4261 4043 gene locus_tag LOCUS_00050 4261 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4297 6702 gene locus_tag LOCUS_00060 4297 6702 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038570.1 protein_id gnl|my_center|LOCUS_00060 8667 6733 gene locus_tag LOCUS_00070 8667 6733 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275257.1 protein_id gnl|my_center|LOCUS_00070 9039 9404 gene locus_tag LOCUS_00080 9039 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9520 10464 gene locus_tag LOCUS_00090 9520 10464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246274.1 protein_id gnl|my_center|LOCUS_00090 10498 11058 gene locus_tag LOCUS_00100 10498 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00100 11591 12019 gene locus_tag LOCUS_00110 11591 12019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12016 13689 gene locus_tag LOCUS_00120 12016 13689 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035924.1 protein_id gnl|my_center|LOCUS_00120 14620 13823 gene locus_tag LOCUS_00130 14620 13823 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_00130 15270 16961 gene locus_tag LOCUS_00140 gene gspE 15270 16961 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 protein_id gnl|my_center|LOCUS_00140 16942 17124 gene locus_tag LOCUS_00150 16942 17124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17121 18338 gene locus_tag LOCUS_00160 17121 18338 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_00160 18441 18881 gene locus_tag LOCUS_00170 gene gspG 18441 18881 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317918.1 protein_id gnl|my_center|LOCUS_00170 18878 19471 gene locus_tag LOCUS_00180 18878 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19468 19896 gene locus_tag LOCUS_00190 19468 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19893 20564 gene locus_tag LOCUS_00200 19893 20564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20561 21433 gene locus_tag LOCUS_00210 20561 21433 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 protein_id gnl|my_center|LOCUS_00210 21430 22599 gene locus_tag LOCUS_00220 21430 22599 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035907.1 protein_id gnl|my_center|LOCUS_00220 22596 23237 gene locus_tag LOCUS_00230 gene gspM 22596 23237 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343405.1 protein_id gnl|my_center|LOCUS_00230 23234 23926 gene locus_tag LOCUS_00240 23234 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23942 26566 gene locus_tag LOCUS_00250 gene gspD 23942 26566 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463321.1 protein_id gnl|my_center|LOCUS_00250 26627 29149 gene locus_tag LOCUS_00260 gene hrpB 26627 29149 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275159.1 protein_id gnl|my_center|LOCUS_00260 29295 29570 gene locus_tag LOCUS_00270 29295 29570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 31008 29620 gene locus_tag LOCUS_00280 31008 29620 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_00280 32331 31189 gene locus_tag LOCUS_00290 32331 31189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35349 33187 gene locus_tag LOCUS_00300 35349 33187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36117 37361 gene locus_tag LOCUS_00310 36117 37361 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037245.1 protein_id gnl|my_center|LOCUS_00310 38228 37467 gene locus_tag LOCUS_00320 38228 37467 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_00320 39652 38273 gene locus_tag LOCUS_00330 gene dbpA 39652 38273 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 protein_id gnl|my_center|LOCUS_00330 39752 40111 gene locus_tag LOCUS_00340 gene folB 39752 40111 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_00340 40111 40599 gene locus_tag LOCUS_00350 gene folK 40111 40599 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038531.1 protein_id gnl|my_center|LOCUS_00350 40710 41537 gene locus_tag LOCUS_00360 40710 41537 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_00360 42384 41638 gene locus_tag LOCUS_00370 42384 41638 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_00370 43250 42462 gene locus_tag LOCUS_00380 43250 42462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 43657 45843 gene locus_tag LOCUS_00390 43657 45843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 46018 47211 gene locus_tag LOCUS_00400 46018 47211 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508984.1 protein_id gnl|my_center|LOCUS_00400 48470 47223 gene locus_tag LOCUS_00410 48470 47223 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_00410 48780 50696 gene locus_tag LOCUS_00420 48780 50696 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819968.1 protein_id gnl|my_center|LOCUS_00420 52747 50693 gene locus_tag LOCUS_00430 52747 50693 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993987.1 protein_id gnl|my_center|LOCUS_00430 53054 54619 gene locus_tag LOCUS_00440 53054 54619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54934 54518 gene locus_tag LOCUS_00450 54934 54518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 55749 54931 gene locus_tag LOCUS_00460 55749 54931 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038499.1 protein_id gnl|my_center|LOCUS_00460 56525 55875 gene locus_tag LOCUS_00470 gene dsbA 56525 55875 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_00470 57473 56586 gene locus_tag LOCUS_00480 57473 56586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58244 57540 gene locus_tag LOCUS_00490 58244 57540 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_00490 58417 59076 gene locus_tag LOCUS_00500 gene yihA 58417 59076 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038495.1 protein_id gnl|my_center|LOCUS_00500 59617 59126 gene locus_tag LOCUS_00510 59617 59126 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 protein_id gnl|my_center|LOCUS_00510 59798 59646 gene locus_tag LOCUS_00520 59798 59646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59749 60432 gene locus_tag LOCUS_00530 gene bioD 59749 60432 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035832.1 protein_id gnl|my_center|LOCUS_00530 60487 60834 gene locus_tag LOCUS_00540 60487 60834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60979 63195 gene locus_tag LOCUS_00550 gene dcp 60979 63195 CDS product peptidyl-dipeptidase Dcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275152.1 protein_id gnl|my_center|LOCUS_00550 63410 65233 gene locus_tag LOCUS_00560 gene kefB 63410 65233 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112454.1 protein_id gnl|my_center|LOCUS_00560 65364 66440 gene locus_tag LOCUS_00570 65364 66440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 69954 66451 gene locus_tag LOCUS_00580 69954 66451 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039067.1 protein_id gnl|my_center|LOCUS_00580 70260 69967 gene locus_tag LOCUS_00590 70260 69967 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_00590 73627 70472 gene locus_tag LOCUS_00600 gene putA 73627 70472 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_00600 73714 74319 gene locus_tag LOCUS_00610 73714 74319 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506314.1 protein_id gnl|my_center|LOCUS_00610 74366 75304 gene locus_tag LOCUS_00620 74366 75304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 75442 76983 gene locus_tag LOCUS_00630 gene ctaD 75442 76983 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038912.1 protein_id gnl|my_center|LOCUS_00630 77044 77175 gene locus_tag LOCUS_00640 77044 77175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 77230 78180 gene locus_tag LOCUS_00650 77230 78180 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_00650 78434 79204 gene locus_tag LOCUS_00660 78434 79204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 79395 80795 gene locus_tag LOCUS_00670 79395 80795 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_00670 81550 83934 gene locus_tag LOCUS_00680 81550 83934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 84650 83961 gene locus_tag LOCUS_00690 84650 83961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 84900 85742 gene locus_tag LOCUS_00700 84900 85742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 86003 86842 gene locus_tag LOCUS_00710 86003 86842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 86845 87699 gene locus_tag LOCUS_00720 86845 87699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 87944 95194 gene locus_tag LOCUS_00730 87944 95194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 95224 101688 gene locus_tag LOCUS_00740 95224 101688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 101832 102905 gene locus_tag LOCUS_00750 101832 102905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 102893 104149 gene locus_tag LOCUS_00760 102893 104149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 104146 105705 gene locus_tag LOCUS_00770 104146 105705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 105702 107084 gene locus_tag LOCUS_00780 105702 107084 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_00780 107081 108202 gene locus_tag LOCUS_00790 107081 108202 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_00790 108199 109347 gene locus_tag LOCUS_00800 108199 109347 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_00800 111469 109373 gene locus_tag LOCUS_00810 111469 109373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 112742 111495 gene locus_tag LOCUS_00820 112742 111495 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787334.1 protein_id gnl|my_center|LOCUS_00820 113023 113655 gene locus_tag LOCUS_00830 113023 113655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 113753 114961 gene locus_tag LOCUS_00840 113753 114961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 114965 115732 gene locus_tag LOCUS_00850 114965 115732 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031644.1 protein_id gnl|my_center|LOCUS_00850 117612 115789 gene locus_tag LOCUS_00860 117612 115789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 118601 117609 gene locus_tag LOCUS_00870 gene galE 118601 117609 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_00870 119434 118598 gene locus_tag LOCUS_00880 119434 118598 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121324.1 protein_id gnl|my_center|LOCUS_00880 120207 119431 gene locus_tag LOCUS_00890 120207 119431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 121514 120204 gene locus_tag LOCUS_00900 121514 120204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 122354 121569 gene locus_tag LOCUS_00910 122354 121569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 123901 122351 gene locus_tag LOCUS_00920 123901 122351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 124547 123927 gene locus_tag LOCUS_00930 124547 123927 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_00930 124753 126030 gene locus_tag LOCUS_00940 gene tviB 124753 126030 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 protein_id gnl|my_center|LOCUS_00940 126087 127097 gene locus_tag LOCUS_00950 126087 127097 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532735.1 protein_id gnl|my_center|LOCUS_00950 127384 127151 gene locus_tag LOCUS_00960 127384 127151 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200193.1 protein_id gnl|my_center|LOCUS_00960 127459 128157 gene locus_tag LOCUS_00970 127459 128157 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946158.1 protein_id gnl|my_center|LOCUS_00970 128217 128765 gene locus_tag LOCUS_00980 128217 128765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 protein_id gnl|my_center|LOCUS_00980 128765 129928 gene locus_tag LOCUS_00990 128765 129928 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038905.1 protein_id gnl|my_center|LOCUS_00990 129925 130869 gene locus_tag LOCUS_01000 gene cyoE 129925 130869 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506322.1 protein_id gnl|my_center|LOCUS_01000 130909 131574 gene locus_tag LOCUS_01010 130909 131574 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140285.1 protein_id gnl|my_center|LOCUS_01010 131558 132976 gene locus_tag LOCUS_01020 131558 132976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 133054 134091 gene locus_tag LOCUS_01030 133054 134091 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494086.1 protein_id gnl|my_center|LOCUS_01030 134093 137155 gene locus_tag LOCUS_01040 134093 137155 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_01040 137191 137475 gene locus_tag LOCUS_01050 137191 137475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 137472 138749 gene locus_tag LOCUS_01060 137472 138749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 139129 139365 gene locus_tag LOCUS_01070 139129 139365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 139512 142169 gene locus_tag LOCUS_01080 gene mgtA 139512 142169 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112338.1 protein_id gnl|my_center|LOCUS_01080 144058 143078 gene locus_tag LOCUS_01090 144058 143078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 144844 144098 gene locus_tag LOCUS_01100 144844 144098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 145644 144844 gene locus_tag LOCUS_01110 145644 144844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 148087 147035 gene locus_tag LOCUS_01120 148087 147035 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275525.1 protein_id gnl|my_center|LOCUS_01120 149596 148595 gene locus_tag LOCUS_01130 149596 148595 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_01130 150224 149604 gene locus_tag LOCUS_01140 150224 149604 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395055.1 protein_id gnl|my_center|LOCUS_01140 152142 150355 gene locus_tag LOCUS_01150 gene dnaG 152142 150355 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_01150 152692 152243 gene locus_tag LOCUS_01160 152692 152243 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_01160 153115 152900 gene locus_tag LOCUS_01170 gene rpsU 153115 152900 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808376.1 protein_id gnl|my_center|LOCUS_01170 153208 154245 gene locus_tag LOCUS_01180 gene tsaD 153208 154245 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038897.1 protein_id gnl|my_center|LOCUS_01180 155064 154345 gene locus_tag LOCUS_01190 155064 154345 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037770.1 protein_id gnl|my_center|LOCUS_01190 155924 155148 gene locus_tag LOCUS_01200 155924 155148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994124.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence002 885 2852 gene locus_tag LOCUS_01210 885 2852 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035950.1 protein_id gnl|my_center|LOCUS_01210 2852 3205 gene locus_tag LOCUS_01220 2852 3205 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_01220 3332 4747 gene locus_tag LOCUS_01230 3332 4747 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_01230 4747 5349 gene locus_tag LOCUS_01240 4747 5349 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_01240 5472 6743 gene locus_tag LOCUS_01250 5472 6743 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116082.1 protein_id gnl|my_center|LOCUS_01250 6771 7928 gene locus_tag LOCUS_01260 gene dusB 6771 7928 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 protein_id gnl|my_center|LOCUS_01260 7921 9273 gene locus_tag LOCUS_01270 7921 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 9413 10609 gene locus_tag LOCUS_01280 gene metK 9413 10609 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035997.1 protein_id gnl|my_center|LOCUS_01280 11327 10704 gene locus_tag LOCUS_01290 11327 10704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_01290 12471 11407 gene locus_tag LOCUS_01300 12471 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 12764 14647 gene locus_tag LOCUS_01310 12764 14647 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_01310 15022 14783 gene locus_tag LOCUS_01320 15022 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975287.1 protein_id gnl|my_center|LOCUS_01320 15842 15222 gene locus_tag LOCUS_01330 15842 15222 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930554.1 protein_id gnl|my_center|LOCUS_01330 18624 15919 gene locus_tag LOCUS_01340 gene ppc 18624 15919 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035990.1 protein_id gnl|my_center|LOCUS_01340 18903 20345 gene locus_tag LOCUS_01350 gene ahcY 18903 20345 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_01350 20753 21811 gene locus_tag LOCUS_01360 20753 21811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 21808 23523 gene locus_tag LOCUS_01370 gene ilvB 21808 23523 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393741.1 protein_id gnl|my_center|LOCUS_01370 23619 24815 gene locus_tag LOCUS_01380 23619 24815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 25085 25909 gene locus_tag LOCUS_01390 gene metF 25085 25909 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035975.1 protein_id gnl|my_center|LOCUS_01390 25935 26549 gene locus_tag LOCUS_01400 25935 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 26592 27509 gene locus_tag LOCUS_01410 26592 27509 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_01410 28885 27608 gene locus_tag LOCUS_01420 28885 27608 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 protein_id gnl|my_center|LOCUS_01420 29555 28869 gene locus_tag LOCUS_01430 29555 28869 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_01430 29442 29807 gene locus_tag LOCUS_01440 29442 29807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 31559 29865 gene locus_tag LOCUS_01450 31559 29865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 31933 31559 gene locus_tag LOCUS_01460 31933 31559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 32525 32049 gene locus_tag LOCUS_01470 32525 32049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 33572 32691 gene locus_tag LOCUS_01480 gene rimK 33572 32691 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038222.1 protein_id gnl|my_center|LOCUS_01480 34050 33583 gene locus_tag LOCUS_01490 34050 33583 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660269.1 protein_id gnl|my_center|LOCUS_01490 34162 34089 gene locus_tag LOCUS_t00010 34162 34089 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34460 36571 gene locus_tag LOCUS_01500 34460 36571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536019.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01500 36654 37358 gene locus_tag LOCUS_01510 gene trmB 36654 37358 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038258.1 protein_id gnl|my_center|LOCUS_01510 37497 39338 gene locus_tag LOCUS_01520 37497 39338 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_01520 39793 39428 gene locus_tag LOCUS_01530 39793 39428 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038260.1 protein_id gnl|my_center|LOCUS_01530 39871 40143 gene locus_tag LOCUS_01540 39871 40143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 40302 41219 gene locus_tag LOCUS_01550 gene yedA 40302 41219 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_01550 41272 41958 gene locus_tag LOCUS_01560 41272 41958 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_01560 42101 42511 gene locus_tag LOCUS_01570 gene mscL 42101 42511 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_01570 45757 42665 gene locus_tag LOCUS_01580 45757 42665 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942256.1 protein_id gnl|my_center|LOCUS_01580 46888 45767 gene locus_tag LOCUS_01590 46888 45767 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_01590 47537 47073 gene locus_tag LOCUS_01600 47537 47073 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_01600 47604 48125 gene locus_tag LOCUS_01610 47604 48125 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038291.1 protein_id gnl|my_center|LOCUS_01610 49817 48129 gene locus_tag LOCUS_01620 49817 48129 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_01620 51730 49817 gene locus_tag LOCUS_01630 51730 49817 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038326.1 protein_id gnl|my_center|LOCUS_01630 52713 51727 gene locus_tag LOCUS_01640 52713 51727 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263515.1 protein_id gnl|my_center|LOCUS_01640 53227 52706 gene locus_tag LOCUS_01650 53227 52706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 54144 53224 gene locus_tag LOCUS_01660 54144 53224 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275283.1 protein_id gnl|my_center|LOCUS_01660 55154 54159 gene locus_tag LOCUS_01670 55154 54159 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_01670 57545 55338 gene locus_tag LOCUS_01680 57545 55338 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038331.1 protein_id gnl|my_center|LOCUS_01680 58170 57628 gene locus_tag LOCUS_01690 58170 57628 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_01690 58823 58167 gene locus_tag LOCUS_01700 58823 58167 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_01700 59572 58820 gene locus_tag LOCUS_01710 59572 58820 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038334.1 protein_id gnl|my_center|LOCUS_01710 60630 59572 gene locus_tag LOCUS_01720 60630 59572 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_01720 60882 63410 gene locus_tag LOCUS_01730 60882 63410 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522231.1 protein_id gnl|my_center|LOCUS_01730 63447 64148 gene locus_tag LOCUS_01740 63447 64148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 protein_id gnl|my_center|LOCUS_01740 65534 64239 gene locus_tag LOCUS_01750 65534 64239 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038338.1 protein_id gnl|my_center|LOCUS_01750 66067 65813 gene locus_tag LOCUS_01760 66067 65813 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_01760 67109 66174 gene locus_tag LOCUS_01770 67109 66174 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 protein_id gnl|my_center|LOCUS_01770 69276 67201 gene locus_tag LOCUS_01780 gene recG 69276 67201 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_01780 69809 69426 gene locus_tag LOCUS_01790 69809 69426 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_01790 72070 69896 gene locus_tag LOCUS_01800 72070 69896 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038350.1 protein_id gnl|my_center|LOCUS_01800 72487 72197 gene locus_tag LOCUS_01810 gene rpoZ 72487 72197 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812428.1 protein_id gnl|my_center|LOCUS_01810 72729 73511 gene locus_tag LOCUS_01820 72729 73511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 73872 73570 gene locus_tag LOCUS_01830 73872 73570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 74549 73869 gene locus_tag LOCUS_01840 74549 73869 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039271.1 protein_id gnl|my_center|LOCUS_01840 75449 74598 gene locus_tag LOCUS_01850 75449 74598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 76278 75502 gene locus_tag LOCUS_01860 gene mlaE 76278 75502 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946578.1 protein_id gnl|my_center|LOCUS_01860 77111 76275 gene locus_tag LOCUS_01870 77111 76275 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_01870 77842 77192 gene locus_tag LOCUS_01880 gene gmk 77842 77192 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094883.1 protein_id gnl|my_center|LOCUS_01880 78699 77839 gene locus_tag LOCUS_01890 78699 77839 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 protein_id gnl|my_center|LOCUS_01890 78806 79537 gene locus_tag LOCUS_01900 gene rph 78806 79537 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_01900 79542 80141 gene locus_tag LOCUS_01910 gene rdgB 79542 80141 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877719.1 protein_id gnl|my_center|LOCUS_01910 80138 81304 gene locus_tag LOCUS_01920 gene hemW 80138 81304 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_01920 81735 82097 gene locus_tag LOCUS_01930 81735 82097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 82222 84543 gene locus_tag LOCUS_01940 82222 84543 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038357.1 protein_id gnl|my_center|LOCUS_01940 84543 84902 gene locus_tag LOCUS_01950 84543 84902 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038358.1 protein_id gnl|my_center|LOCUS_01950 85072 86391 gene locus_tag LOCUS_01960 gene pepQ 85072 86391 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038359.1 protein_id gnl|my_center|LOCUS_01960 86920 86396 gene locus_tag LOCUS_01970 86920 86396 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209677908.1 protein_id gnl|my_center|LOCUS_01970 87509 87093 gene locus_tag LOCUS_01980 87509 87093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 89140 87800 gene locus_tag LOCUS_01990 89140 87800 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_01990 89682 89137 gene locus_tag LOCUS_02000 89682 89137 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038362.1 protein_id gnl|my_center|LOCUS_02000 89810 90043 gene locus_tag LOCUS_02010 89810 90043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 90051 90359 gene locus_tag LOCUS_02020 90051 90359 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 protein_id gnl|my_center|LOCUS_02020 90711 91316 gene locus_tag LOCUS_02030 90711 91316 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038365.1 protein_id gnl|my_center|LOCUS_02030 91328 91780 gene locus_tag LOCUS_02040 91328 91780 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 protein_id gnl|my_center|LOCUS_02040 91813 92454 gene locus_tag LOCUS_02050 gene rpiA 91813 92454 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038367.1 protein_id gnl|my_center|LOCUS_02050 92618 92544 gene locus_tag LOCUS_t00020 92618 92544 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 2261 183 gene locus_tag LOCUS_02060 2261 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 2724 5162 gene locus_tag LOCUS_02070 2724 5162 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229634.1 protein_id gnl|my_center|LOCUS_02070 6244 5186 gene locus_tag LOCUS_02080 6244 5186 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 protein_id gnl|my_center|LOCUS_02080 6285 7010 gene locus_tag LOCUS_02090 6285 7010 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036197.1 protein_id gnl|my_center|LOCUS_02090 7007 7765 gene locus_tag LOCUS_02100 7007 7765 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 protein_id gnl|my_center|LOCUS_02100 8088 8177 gene locus_tag LOCUS_t00030 8088 8177 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8551 8234 gene locus_tag LOCUS_02110 8551 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 8438 10093 gene locus_tag LOCUS_02120 8438 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 10117 10416 gene locus_tag LOCUS_02130 10117 10416 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036205.1 protein_id gnl|my_center|LOCUS_02130 10524 11126 gene locus_tag LOCUS_02140 gene recR 10524 11126 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036206.1 protein_id gnl|my_center|LOCUS_02140 11147 11491 gene locus_tag LOCUS_02150 11147 11491 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_02150 12137 11547 gene locus_tag LOCUS_02160 12137 11547 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_02160 14158 12185 gene locus_tag LOCUS_02170 14158 12185 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 protein_id gnl|my_center|LOCUS_02170 15108 14155 gene locus_tag LOCUS_02180 15108 14155 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_02180 16049 15108 gene locus_tag LOCUS_02190 16049 15108 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_02190 16718 16134 gene locus_tag LOCUS_02200 16718 16134 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036216.1 protein_id gnl|my_center|LOCUS_02200 17185 16730 gene locus_tag LOCUS_02210 17185 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 17370 17849 gene locus_tag LOCUS_02220 gene yceD 17370 17849 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072716.1 protein_id gnl|my_center|LOCUS_02220 17917 18111 gene locus_tag LOCUS_02230 gene rpmF 17917 18111 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010368401.1 protein_id gnl|my_center|LOCUS_02230 18271 19245 gene locus_tag LOCUS_02240 18271 19245 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_02240 19384 20331 gene locus_tag LOCUS_02250 gene fabD 19384 20331 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036219.1 protein_id gnl|my_center|LOCUS_02250 20384 21127 gene locus_tag LOCUS_02260 gene fabG 20384 21127 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 protein_id gnl|my_center|LOCUS_02260 21315 21563 gene locus_tag LOCUS_02270 gene acpP 21315 21563 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_02270 21832 23040 gene locus_tag LOCUS_02280 gene fabF 21832 23040 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036221.1 protein_id gnl|my_center|LOCUS_02280 23043 24389 gene locus_tag LOCUS_02290 23043 24389 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_02290 24389 25216 gene locus_tag LOCUS_02300 gene pabC 24389 25216 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_02300 25213 26256 gene locus_tag LOCUS_02310 gene mltG 25213 26256 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_02310 26253 26894 gene locus_tag LOCUS_02320 gene tmk 26253 26894 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267153.1 protein_id gnl|my_center|LOCUS_02320 26891 27826 gene locus_tag LOCUS_02330 26891 27826 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036224.1 protein_id gnl|my_center|LOCUS_02330 27823 28788 gene locus_tag LOCUS_02340 27823 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 29016 31850 gene locus_tag LOCUS_02350 29016 31850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 31957 32310 gene locus_tag LOCUS_02360 31957 32310 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_02360 32606 32935 gene locus_tag LOCUS_02370 32606 32935 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040258.1 protein_id gnl|my_center|LOCUS_02370 32926 33483 gene locus_tag LOCUS_02380 32926 33483 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944318.1 protein_id gnl|my_center|LOCUS_02380 33493 34221 gene locus_tag LOCUS_02390 33493 34221 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037657.1 protein_id gnl|my_center|LOCUS_02390 34224 35477 gene locus_tag LOCUS_02400 34224 35477 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037656.1 protein_id gnl|my_center|LOCUS_02400 35662 36189 gene locus_tag LOCUS_02410 gene nuoE 35662 36189 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_02410 36193 37521 gene locus_tag LOCUS_02420 gene nuoF 36193 37521 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037654.1 protein_id gnl|my_center|LOCUS_02420 37518 39842 gene locus_tag LOCUS_02430 gene nuoG 37518 39842 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131407368.1 protein_id gnl|my_center|LOCUS_02430 39846 40898 gene locus_tag LOCUS_02440 gene nuoH 39846 40898 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037652.1 protein_id gnl|my_center|LOCUS_02440 40902 41393 gene locus_tag LOCUS_02450 gene nuoI 40902 41393 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508211.1 protein_id gnl|my_center|LOCUS_02450 41402 42061 gene locus_tag LOCUS_02460 41402 42061 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944316.1 protein_id gnl|my_center|LOCUS_02460 42058 42363 gene locus_tag LOCUS_02470 gene nuoK 42058 42363 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914274.1 protein_id gnl|my_center|LOCUS_02470 42368 44437 gene locus_tag LOCUS_02480 gene nuoL 42368 44437 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037649.1 protein_id gnl|my_center|LOCUS_02480 44452 45960 gene locus_tag LOCUS_02490 44452 45960 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_02490 45972 47426 gene locus_tag LOCUS_02500 gene nuoN 45972 47426 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037647.1 protein_id gnl|my_center|LOCUS_02500 47546 47622 gene locus_tag LOCUS_t00040 47546 47622 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 47809 48363 gene locus_tag LOCUS_02510 gene rimP 47809 48363 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037646.1 protein_id gnl|my_center|LOCUS_02510 48412 49917 gene locus_tag LOCUS_02520 gene nusA 48412 49917 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 protein_id gnl|my_center|LOCUS_02520 50049 52892 gene locus_tag LOCUS_02530 gene infB 50049 52892 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275326.1 protein_id gnl|my_center|LOCUS_02530 53003 53386 gene locus_tag LOCUS_02540 gene rbfA 53003 53386 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216910.1 protein_id gnl|my_center|LOCUS_02540 53414 54340 gene locus_tag LOCUS_02550 gene truB 53414 54340 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037642.1 protein_id gnl|my_center|LOCUS_02550 54508 54777 gene locus_tag LOCUS_02560 gene rpsO 54508 54777 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059467.1 protein_id gnl|my_center|LOCUS_02560 54861 56975 gene locus_tag LOCUS_02570 gene pnp 54861 56975 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_02570 57099 58238 gene locus_tag LOCUS_02580 gene phaE 57099 58238 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037306.1 protein_id gnl|my_center|LOCUS_02580 58251 59318 gene locus_tag LOCUS_02590 58251 59318 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_02590 59347 59538 gene locus_tag LOCUS_02600 59347 59538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 59544 60596 gene locus_tag LOCUS_02610 gene mtnA 59544 60596 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036755.1 protein_id gnl|my_center|LOCUS_02610 60897 63485 gene locus_tag LOCUS_02620 gene gyrA 60897 63485 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036756.1 protein_id gnl|my_center|LOCUS_02620 64059 63646 gene locus_tag LOCUS_02630 64059 63646 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524075.1 protein_id gnl|my_center|LOCUS_02630 64652 64170 gene locus_tag LOCUS_02640 64652 64170 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036246.1 protein_id gnl|my_center|LOCUS_02640 64807 65259 gene locus_tag LOCUS_02650 64807 65259 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_02650 65354 66256 gene locus_tag LOCUS_02660 65354 66256 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_02660 66700 66335 gene locus_tag LOCUS_02670 gene pilH 66700 66335 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 protein_id gnl|my_center|LOCUS_02670 67768 66770 gene locus_tag LOCUS_02680 67768 66770 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909335.1 protein_id gnl|my_center|LOCUS_02680 68382 67786 gene locus_tag LOCUS_02690 68382 67786 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507326.1 protein_id gnl|my_center|LOCUS_02690 70028 68604 gene locus_tag LOCUS_02700 gene lpdA 70028 68604 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036671.1 protein_id gnl|my_center|LOCUS_02700 <71154 70196 gene locus_tag LOCUS_02710 <71154 70196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036672.1:dihydrolipoyllysine-residue succinyltransferase >Feature sequence004 137 625 gene locus_tag LOCUS_02720 137 625 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036024.1 protein_id gnl|my_center|LOCUS_02720 625 1071 gene locus_tag LOCUS_02730 625 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 1762 1139 gene locus_tag LOCUS_02740 gene coaE 1762 1139 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038217.1 protein_id gnl|my_center|LOCUS_02740 2616 1759 gene locus_tag LOCUS_02750 2616 1759 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038216.1 protein_id gnl|my_center|LOCUS_02750 4053 2779 gene locus_tag LOCUS_02760 4053 2779 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_02760 5912 4191 gene locus_tag LOCUS_02770 gene pilB 5912 4191 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 protein_id gnl|my_center|LOCUS_02770 6237 7091 gene locus_tag LOCUS_02780 6237 7091 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_02780 7319 8329 gene locus_tag LOCUS_02790 7319 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 8330 9256 gene locus_tag LOCUS_02800 8330 9256 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937860.1 protein_id gnl|my_center|LOCUS_02800 9226 10275 gene locus_tag LOCUS_02810 9226 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 11931 11551 gene locus_tag LOCUS_02820 11931 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 13850 12456 gene locus_tag LOCUS_02830 13850 12456 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202144.1 protein_id gnl|my_center|LOCUS_02830 14634 13963 gene locus_tag LOCUS_02840 14634 13963 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256835.1 protein_id gnl|my_center|LOCUS_02840 15815 14640 gene locus_tag LOCUS_02850 15815 14640 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_02850 18034 15929 gene locus_tag LOCUS_02860 18034 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 20238 18031 gene locus_tag LOCUS_02870 20238 18031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 20789 20358 gene locus_tag LOCUS_02880 20789 20358 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_02880 21620 21144 gene locus_tag LOCUS_02890 21620 21144 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_02890 23292 21877 gene locus_tag LOCUS_02900 23292 21877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 23421 25589 gene locus_tag LOCUS_02910 23421 25589 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_02910 27099 26131 gene locus_tag LOCUS_02920 27099 26131 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 protein_id gnl|my_center|LOCUS_02920 28435 27212 gene locus_tag LOCUS_02930 28435 27212 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037477.1 protein_id gnl|my_center|LOCUS_02930 29377 28532 gene locus_tag LOCUS_02940 29377 28532 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 protein_id gnl|my_center|LOCUS_02940 30024 29551 gene locus_tag LOCUS_02950 gene ybeY 30024 29551 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 protein_id gnl|my_center|LOCUS_02950 31001 30021 gene locus_tag LOCUS_02960 31001 30021 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 protein_id gnl|my_center|LOCUS_02960 31137 31799 gene locus_tag LOCUS_02970 31137 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 31815 32786 gene locus_tag LOCUS_02980 31815 32786 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704457.1 protein_id gnl|my_center|LOCUS_02980 32783 33751 gene locus_tag LOCUS_02990 32783 33751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704458.1 protein_id gnl|my_center|LOCUS_02990 33763 34857 gene locus_tag LOCUS_03000 33763 34857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704459.1 protein_id gnl|my_center|LOCUS_03000 35370 34876 gene locus_tag LOCUS_03010 35370 34876 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816757.1 protein_id gnl|my_center|LOCUS_03010 36749 35367 gene locus_tag LOCUS_03020 gene miaB 36749 35367 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_03020 37094 38179 gene locus_tag LOCUS_03030 37094 38179 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037468.1 protein_id gnl|my_center|LOCUS_03030 39429 38209 gene locus_tag LOCUS_03040 gene algW 39429 38209 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_03040 39656 40162 gene locus_tag LOCUS_03050 gene petA 39656 40162 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037467.1 protein_id gnl|my_center|LOCUS_03050 40162 41463 gene locus_tag LOCUS_03060 40162 41463 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037466.1 protein_id gnl|my_center|LOCUS_03060 41456 42205 gene locus_tag LOCUS_03070 41456 42205 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994029.1 protein_id gnl|my_center|LOCUS_03070 42280 42918 gene locus_tag LOCUS_03080 42280 42918 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037464.1 protein_id gnl|my_center|LOCUS_03080 42905 43351 gene locus_tag LOCUS_03090 42905 43351 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 protein_id gnl|my_center|LOCUS_03090 43792 43388 gene locus_tag LOCUS_03100 43792 43388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 44816 43944 gene locus_tag LOCUS_03110 gene nadC 44816 43944 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037638.1 protein_id gnl|my_center|LOCUS_03110 47131 44813 gene locus_tag LOCUS_03120 47131 44813 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103361.1 protein_id gnl|my_center|LOCUS_03120 47597 47256 gene locus_tag LOCUS_03130 47597 47256 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 protein_id gnl|my_center|LOCUS_03130 47662 48099 gene locus_tag LOCUS_03140 gene purE 47662 48099 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167785.1 protein_id gnl|my_center|LOCUS_03140 48096 49253 gene locus_tag LOCUS_03150 48096 49253 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037635.1 protein_id gnl|my_center|LOCUS_03150 49901 49323 gene locus_tag LOCUS_03160 gene sodB 49901 49323 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_03160 50013 50336 gene locus_tag LOCUS_03170 gene grxD 50013 50336 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037633.1 protein_id gnl|my_center|LOCUS_03170 50333 51103 gene locus_tag LOCUS_03180 50333 51103 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037632.1 protein_id gnl|my_center|LOCUS_03180 51144 51755 gene locus_tag LOCUS_03190 51144 51755 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450537.1 protein_id gnl|my_center|LOCUS_03190 51853 53586 gene locus_tag LOCUS_03200 51853 53586 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705506.1 protein_id gnl|my_center|LOCUS_03200 54012 56402 gene locus_tag LOCUS_03210 54012 56402 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771478.1 protein_id gnl|my_center|LOCUS_03210 56722 59955 gene locus_tag LOCUS_03220 56722 59955 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_03220 60239 61639 gene locus_tag LOCUS_03230 gene ppnN 60239 61639 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054702.1 protein_id gnl|my_center|LOCUS_03230 61709 61785 gene locus_tag LOCUS_t00050 61709 61785 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 62142 62471 gene locus_tag LOCUS_03240 62142 62471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 62468 62818 gene locus_tag LOCUS_03250 62468 62818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence005 681 415 gene locus_tag LOCUS_03260 681 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 989 792 gene locus_tag LOCUS_03270 989 792 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216955.1 protein_id gnl|my_center|LOCUS_03270 1355 1113 gene locus_tag LOCUS_03280 1355 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1293 1757 gene locus_tag LOCUS_03290 1293 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1754 3037 gene locus_tag LOCUS_03300 gene hemL 1754 3037 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038374.1 protein_id gnl|my_center|LOCUS_03300 3495 3076 gene locus_tag LOCUS_03310 3495 3076 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265697.1 protein_id gnl|my_center|LOCUS_03310 4761 3535 gene locus_tag LOCUS_03320 4761 3535 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038384.1 protein_id gnl|my_center|LOCUS_03320 5867 5049 gene locus_tag LOCUS_03330 5867 5049 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038387.1 protein_id gnl|my_center|LOCUS_03330 6513 5911 gene locus_tag LOCUS_03340 6513 5911 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 protein_id gnl|my_center|LOCUS_03340 7922 6564 gene locus_tag LOCUS_03350 gene mpl 7922 6564 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038392.1 protein_id gnl|my_center|LOCUS_03350 8497 7970 gene locus_tag LOCUS_03360 8497 7970 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_03360 8747 10024 gene locus_tag LOCUS_03370 8747 10024 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038394.1 protein_id gnl|my_center|LOCUS_03370 10120 11052 gene locus_tag LOCUS_03380 10120 11052 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899139.1 protein_id gnl|my_center|LOCUS_03380 11227 13278 gene locus_tag LOCUS_03390 11227 13278 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_03390 13431 15569 gene locus_tag LOCUS_03400 13431 15569 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_03400 15715 16467 gene locus_tag LOCUS_03410 15715 16467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 16582 17118 gene locus_tag LOCUS_03420 gene ppa 16582 17118 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804918.1 protein_id gnl|my_center|LOCUS_03420 17405 18421 gene locus_tag LOCUS_03430 17405 18421 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036148.1 protein_id gnl|my_center|LOCUS_03430 19537 18539 gene locus_tag LOCUS_03440 19537 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 20284 19685 gene locus_tag LOCUS_03450 20284 19685 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038433.1 protein_id gnl|my_center|LOCUS_03450 20610 21263 gene locus_tag LOCUS_03460 20610 21263 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_03460 21296 22645 gene locus_tag LOCUS_03470 21296 22645 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 protein_id gnl|my_center|LOCUS_03470 23956 22688 gene locus_tag LOCUS_03480 gene waaA 23956 22688 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 protein_id gnl|my_center|LOCUS_03480 24041 24967 gene locus_tag LOCUS_03490 24041 24967 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038437.1 protein_id gnl|my_center|LOCUS_03490 25843 25016 gene locus_tag LOCUS_03500 25843 25016 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_03500 27152 25791 gene locus_tag LOCUS_03510 27152 25791 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 protein_id gnl|my_center|LOCUS_03510 28342 27191 gene locus_tag LOCUS_03520 28342 27191 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038439.1 protein_id gnl|my_center|LOCUS_03520 28607 28398 gene locus_tag LOCUS_03530 28607 28398 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_03530 29336 28743 gene locus_tag LOCUS_03540 29336 28743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 29973 29380 gene locus_tag LOCUS_03550 29973 29380 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195469.1 protein_id gnl|my_center|LOCUS_03550 30117 31094 gene locus_tag LOCUS_03560 30117 31094 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 protein_id gnl|my_center|LOCUS_03560 34061 31074 gene locus_tag LOCUS_03570 34061 31074 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 protein_id gnl|my_center|LOCUS_03570 37126 34265 gene locus_tag LOCUS_03580 gene glnE 37126 34265 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038683.1 protein_id gnl|my_center|LOCUS_03580 37355 39199 gene locus_tag LOCUS_03590 37355 39199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 40964 39312 gene locus_tag LOCUS_03600 gene groL 40964 39312 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_03600 41390 41097 gene locus_tag LOCUS_03610 gene groES 41390 41097 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_03610 41622 41978 gene locus_tag LOCUS_03620 41622 41978 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_03620 42008 44182 gene locus_tag LOCUS_03630 42008 44182 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035768.1 protein_id gnl|my_center|LOCUS_03630 44182 44721 gene locus_tag LOCUS_03640 44182 44721 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814954.1 protein_id gnl|my_center|LOCUS_03640 44864 45325 gene locus_tag LOCUS_03650 gene aroQ 44864 45325 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_03650 45377 45835 gene locus_tag LOCUS_03660 gene accB 45377 45835 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354626.1 protein_id gnl|my_center|LOCUS_03660 45853 46233 gene locus_tag LOCUS_03670 45853 46233 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_03670 46286 47653 gene locus_tag LOCUS_03680 gene accC 46286 47653 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 protein_id gnl|my_center|LOCUS_03680 47777 48694 gene locus_tag LOCUS_03690 gene prmA 47777 48694 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035761.1 protein_id gnl|my_center|LOCUS_03690 48801 49655 gene locus_tag LOCUS_03700 48801 49655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 49892 50116 gene locus_tag LOCUS_03710 gene fis 49892 50116 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035757.1 protein_id gnl|my_center|LOCUS_03710 50184 51794 gene locus_tag LOCUS_03720 gene purH 50184 51794 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035747.1 protein_id gnl|my_center|LOCUS_03720 51851 52561 gene locus_tag LOCUS_03730 51851 52561 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920500.1 protein_id gnl|my_center|LOCUS_03730 53065 52586 gene locus_tag LOCUS_03740 53065 52586 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972923.1 protein_id gnl|my_center|LOCUS_03740 53623 53093 gene locus_tag LOCUS_03750 53623 53093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 53844 56582 gene locus_tag LOCUS_03760 gene polA 53844 56582 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039091.1 protein_id gnl|my_center|LOCUS_03760 56936 57142 gene locus_tag LOCUS_03770 56936 57142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 57195 59465 gene locus_tag LOCUS_03780 gene uvrD 57195 59465 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383404.1 protein_id gnl|my_center|LOCUS_03780 59610 59963 gene locus_tag LOCUS_03790 59610 59963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941417.1 protein_id gnl|my_center|LOCUS_03790 <60739 59986 gene locus_tag LOCUS_03800 <60739 59986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096390.1:heme biosynthesis protein HemY >Feature sequence006 492 938 gene locus_tag LOCUS_03810 gene mraZ 492 938 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005910933.1 protein_id gnl|my_center|LOCUS_03810 956 1957 gene locus_tag LOCUS_03820 gene rsmH 956 1957 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047697615.1 protein_id gnl|my_center|LOCUS_03820 1954 2223 gene locus_tag LOCUS_03830 1954 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2223 4040 gene locus_tag LOCUS_03840 2223 4040 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 protein_id gnl|my_center|LOCUS_03840 4037 5542 gene locus_tag LOCUS_03850 4037 5542 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_03850 5539 6921 gene locus_tag LOCUS_03860 gene murF 5539 6921 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035959.1 protein_id gnl|my_center|LOCUS_03860 6911 8011 gene locus_tag LOCUS_03870 gene mraY 6911 8011 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_03870 8011 9249 gene locus_tag LOCUS_03880 gene ftsW 8011 9249 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027080830.1 protein_id gnl|my_center|LOCUS_03880 9246 10319 gene locus_tag LOCUS_03890 gene murG 9246 10319 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035962.1 protein_id gnl|my_center|LOCUS_03890 10316 11755 gene locus_tag LOCUS_03900 gene murC 10316 11755 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035963.1 protein_id gnl|my_center|LOCUS_03900 11752 12705 gene locus_tag LOCUS_03910 11752 12705 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035964.1 protein_id gnl|my_center|LOCUS_03910 12714 13436 gene locus_tag LOCUS_03920 12714 13436 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035965.1 protein_id gnl|my_center|LOCUS_03920 13447 14679 gene locus_tag LOCUS_03930 gene ftsA 13447 14679 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003485272.1 protein_id gnl|my_center|LOCUS_03930 14822 16006 gene locus_tag LOCUS_03940 gene ftsZ 14822 16006 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035966.1 protein_id gnl|my_center|LOCUS_03940 16483 17397 gene locus_tag LOCUS_03950 gene lpxC 16483 17397 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_03950 18080 17637 gene locus_tag LOCUS_03960 18080 17637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 18196 19059 gene locus_tag LOCUS_03970 18196 19059 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 protein_id gnl|my_center|LOCUS_03970 19241 21976 gene locus_tag LOCUS_03980 gene secA 19241 21976 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035970.1 protein_id gnl|my_center|LOCUS_03980 22915 22064 gene locus_tag LOCUS_03990 22915 22064 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036025.1 protein_id gnl|my_center|LOCUS_03990 23362 22931 gene locus_tag LOCUS_04000 gene apaG 23362 22931 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036026.1 protein_id gnl|my_center|LOCUS_04000 24168 23359 gene locus_tag LOCUS_04010 gene rsmA 24168 23359 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 protein_id gnl|my_center|LOCUS_04010 25222 24227 gene locus_tag LOCUS_04020 gene pdxA 25222 24227 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 protein_id gnl|my_center|LOCUS_04020 26589 25228 gene locus_tag LOCUS_04030 26589 25228 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036029.1 protein_id gnl|my_center|LOCUS_04030 29053 26624 gene locus_tag LOCUS_04040 gene lptD 29053 26624 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036030.1 protein_id gnl|my_center|LOCUS_04040 30063 29230 gene locus_tag LOCUS_04050 30063 29230 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036031.1 protein_id gnl|my_center|LOCUS_04050 30731 30159 gene locus_tag LOCUS_04060 30731 30159 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_04060 31353 30745 gene locus_tag LOCUS_04070 31353 30745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_04070 31448 32665 gene locus_tag LOCUS_04080 gene ubiH 31448 32665 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036034.1 protein_id gnl|my_center|LOCUS_04080 32662 33873 gene locus_tag LOCUS_04090 32662 33873 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036035.1 protein_id gnl|my_center|LOCUS_04090 34010 34741 gene locus_tag LOCUS_04100 34010 34741 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690367.1 protein_id gnl|my_center|LOCUS_04100 36653 34767 gene locus_tag LOCUS_04110 36653 34767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 37929 36853 gene locus_tag LOCUS_04120 gene hemE 37929 36853 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524502.1 protein_id gnl|my_center|LOCUS_04120 38215 37955 gene locus_tag LOCUS_04130 38215 37955 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037968.1 protein_id gnl|my_center|LOCUS_04130 42037 38297 gene locus_tag LOCUS_04140 42037 38297 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039153.1 protein_id gnl|my_center|LOCUS_04140 43805 42078 gene locus_tag LOCUS_04150 43805 42078 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019238119.1 protein_id gnl|my_center|LOCUS_04150 46518 43963 gene locus_tag LOCUS_04160 gene ndvB 46518 43963 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_04160 47699 46761 gene locus_tag LOCUS_04170 47699 46761 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926857.1 protein_id gnl|my_center|LOCUS_04170 48390 49565 gene locus_tag LOCUS_04180 48390 49565 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135173384.1 protein_id gnl|my_center|LOCUS_04180 49562 50344 gene locus_tag LOCUS_04190 49562 50344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 50296 50889 gene locus_tag LOCUS_04200 50296 50889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 50918 52156 gene locus_tag LOCUS_04210 50918 52156 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_04210 52652 53593 gene locus_tag LOCUS_04220 52652 53593 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920660.1 protein_id gnl|my_center|LOCUS_04220 53855 54631 gene locus_tag LOCUS_04230 53855 54631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 54650 54874 gene locus_tag LOCUS_04240 54650 54874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 55034 55696 gene locus_tag LOCUS_04250 55034 55696 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919535.1 protein_id gnl|my_center|LOCUS_04250 55993 55775 gene locus_tag LOCUS_04260 55993 55775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence007 1569 358 gene locus_tag LOCUS_04270 gene tyrS 1569 358 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038916.1 protein_id gnl|my_center|LOCUS_04270 1729 3195 gene locus_tag LOCUS_04280 1729 3195 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038917.1 protein_id gnl|my_center|LOCUS_04280 3199 4332 gene locus_tag LOCUS_04290 3199 4332 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_04290 5717 4464 gene locus_tag LOCUS_04300 5717 4464 CDS product muropeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815250.1 protein_id gnl|my_center|LOCUS_04300 6477 5707 gene locus_tag LOCUS_04310 6477 5707 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 protein_id gnl|my_center|LOCUS_04310 6640 7287 gene locus_tag LOCUS_04320 gene pyrE 6640 7287 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_04320 7413 8066 gene locus_tag LOCUS_04330 7413 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 10485 8164 gene locus_tag LOCUS_04340 10485 8164 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275495.1 protein_id gnl|my_center|LOCUS_04340 11017 10547 gene locus_tag LOCUS_04350 gene dut 11017 10547 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 protein_id gnl|my_center|LOCUS_04350 12219 11014 gene locus_tag LOCUS_04360 gene coaBC 12219 11014 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038934.1 protein_id gnl|my_center|LOCUS_04360 12316 12987 gene locus_tag LOCUS_04370 gene radC 12316 12987 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038935.1 protein_id gnl|my_center|LOCUS_04370 13515 15191 gene locus_tag LOCUS_04380 gene argS 13515 15191 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 protein_id gnl|my_center|LOCUS_04380 15191 15895 gene locus_tag LOCUS_04390 15191 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 15927 16679 gene locus_tag LOCUS_04400 15927 16679 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038939.1 protein_id gnl|my_center|LOCUS_04400 18016 16802 gene locus_tag LOCUS_04410 18016 16802 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194462.1 protein_id gnl|my_center|LOCUS_04410 18776 18027 gene locus_tag LOCUS_04420 18776 18027 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194452.1 protein_id gnl|my_center|LOCUS_04420 19693 18893 gene locus_tag LOCUS_04430 19693 18893 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194455.1 protein_id gnl|my_center|LOCUS_04430 21668 19779 gene locus_tag LOCUS_04440 gene speA 21668 19779 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038943.1 protein_id gnl|my_center|LOCUS_04440 21937 22791 gene locus_tag LOCUS_04450 gene speE 21937 22791 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_04450 23078 22884 gene locus_tag LOCUS_04460 23078 22884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 23230 24261 gene locus_tag LOCUS_04470 23230 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 24339 24971 gene locus_tag LOCUS_04480 24339 24971 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_04480 25024 25497 gene locus_tag LOCUS_04490 25024 25497 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 protein_id gnl|my_center|LOCUS_04490 25606 27489 gene locus_tag LOCUS_04500 25606 27489 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035434.1 protein_id gnl|my_center|LOCUS_04500 28291 27740 gene locus_tag LOCUS_04510 28291 27740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 29594 28308 gene locus_tag LOCUS_04520 29594 28308 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 protein_id gnl|my_center|LOCUS_04520 29760 30899 gene locus_tag LOCUS_04530 29760 30899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 30986 33496 gene locus_tag LOCUS_04540 30986 33496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 34000 33527 gene locus_tag LOCUS_04550 34000 33527 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_04550 34285 42963 gene locus_tag LOCUS_04560 34285 42963 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_04560 43041 43706 gene locus_tag LOCUS_04570 43041 43706 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814020.1 protein_id gnl|my_center|LOCUS_04570 44931 43726 gene locus_tag LOCUS_04580 44931 43726 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_04580 45311 46720 gene locus_tag LOCUS_04590 gene zwf 45311 46720 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_04590 46717 47430 gene locus_tag LOCUS_04600 46717 47430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 47458 48558 gene locus_tag LOCUS_04610 47458 48558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 48558 50225 gene locus_tag LOCUS_04620 gene pgi 48558 50225 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_04620 50351 52003 gene locus_tag LOCUS_04630 gene pgm 50351 52003 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268077.1 protein_id gnl|my_center|LOCUS_04630 52076 52618 gene locus_tag LOCUS_04640 52076 52618 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190603.1 protein_id gnl|my_center|LOCUS_04640 52729 53385 gene locus_tag LOCUS_04650 52729 53385 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_04650 53484 55538 gene locus_tag LOCUS_04660 gene tkt 53484 55538 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence008 1555 194 gene locus_tag LOCUS_04670 1555 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 2084 1545 gene locus_tag LOCUS_04680 2084 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2326 2081 gene locus_tag LOCUS_04690 2326 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2953 2432 gene locus_tag LOCUS_04700 2953 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 4176 2947 gene locus_tag LOCUS_04710 4176 2947 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_04710 5406 4678 gene locus_tag LOCUS_04720 gene lpxH 5406 4678 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 protein_id gnl|my_center|LOCUS_04720 6131 5412 gene locus_tag LOCUS_04730 6131 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 7719 6202 gene locus_tag LOCUS_04740 gene ppx 7719 6202 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944807.1 protein_id gnl|my_center|LOCUS_04740 9895 7802 gene locus_tag LOCUS_04750 gene ppk1 9895 7802 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 protein_id gnl|my_center|LOCUS_04750 11217 9949 gene locus_tag LOCUS_04760 gene phoR 11217 9949 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506859.1 protein_id gnl|my_center|LOCUS_04760 11991 11302 gene locus_tag LOCUS_04770 gene phoB 11991 11302 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_04770 13758 12142 gene locus_tag LOCUS_04780 13758 12142 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036178.1 protein_id gnl|my_center|LOCUS_04780 13875 14138 gene locus_tag LOCUS_04790 gene grxC 13875 14138 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506861.1 protein_id gnl|my_center|LOCUS_04790 14135 14515 gene locus_tag LOCUS_04800 14135 14515 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_04800 14706 15719 gene locus_tag LOCUS_04810 14706 15719 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 protein_id gnl|my_center|LOCUS_04810 17039 15825 gene locus_tag LOCUS_04820 17039 15825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 17469 17074 gene locus_tag LOCUS_04830 17469 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 17846 17466 gene locus_tag LOCUS_04840 17846 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 18682 17846 gene locus_tag LOCUS_04850 18682 17846 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_04850 19671 18769 gene locus_tag LOCUS_04860 19671 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 20510 19749 gene locus_tag LOCUS_04870 20510 19749 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_04870 21637 20507 gene locus_tag LOCUS_04880 21637 20507 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265760.1 protein_id gnl|my_center|LOCUS_04880 23031 21637 gene locus_tag LOCUS_04890 23031 21637 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063680.1 protein_id gnl|my_center|LOCUS_04890 24660 23242 gene locus_tag LOCUS_04900 24660 23242 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812764.1 protein_id gnl|my_center|LOCUS_04900 25346 24657 gene locus_tag LOCUS_04910 25346 24657 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_04910 25300 25569 gene locus_tag LOCUS_04920 25300 25569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 26099 25560 gene locus_tag LOCUS_04930 26099 25560 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338683.1 protein_id gnl|my_center|LOCUS_04930 26578 26105 gene locus_tag LOCUS_04940 26578 26105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 26997 26668 gene locus_tag LOCUS_04950 26997 26668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 27214 28638 gene locus_tag LOCUS_04960 27214 28638 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_04960 28652 29359 gene locus_tag LOCUS_04970 28652 29359 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807283.1 protein_id gnl|my_center|LOCUS_04970 29592 30314 gene locus_tag LOCUS_04980 29592 30314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 30507 31157 gene locus_tag LOCUS_04990 30507 31157 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_04990 34098 31258 gene locus_tag LOCUS_05000 gene rapA 34098 31258 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704808.1 protein_id gnl|my_center|LOCUS_05000 38227 34232 gene locus_tag LOCUS_05010 38227 34232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 38951 38400 gene locus_tag LOCUS_05020 38951 38400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 40061 39018 gene locus_tag LOCUS_05030 40061 39018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 40635 40144 gene locus_tag LOCUS_05040 40635 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 41231 40635 gene locus_tag LOCUS_05050 41231 40635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 41701 41228 gene locus_tag LOCUS_05060 41701 41228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 42757 42077 gene locus_tag LOCUS_05070 42757 42077 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112849.1 protein_id gnl|my_center|LOCUS_05070 45122 42786 gene locus_tag LOCUS_05080 45122 42786 CDS product catecholate siderophore receptor Fiu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429998.1 protein_id gnl|my_center|LOCUS_05080 47639 45513 gene locus_tag LOCUS_05090 47639 45513 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037705.1 protein_id gnl|my_center|LOCUS_05090 48472 47813 gene locus_tag LOCUS_05100 48472 47813 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036539.1 protein_id gnl|my_center|LOCUS_05100 49117 48662 gene locus_tag LOCUS_05110 49117 48662 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_05110 50133 49258 gene locus_tag LOCUS_05120 gene trxA 50133 49258 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 protein_id gnl|my_center|LOCUS_05120 50270 50887 gene locus_tag LOCUS_05130 50270 50887 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428234.1 protein_id gnl|my_center|LOCUS_05130 50884 51522 gene locus_tag LOCUS_05140 50884 51522 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315385.1 protein_id gnl|my_center|LOCUS_05140 51515 53215 gene locus_tag LOCUS_05150 51515 53215 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766330.1 protein_id gnl|my_center|LOCUS_05150 53212 53826 gene locus_tag LOCUS_05160 53212 53826 CDS product PqiC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268174.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence009 430 735 gene locus_tag LOCUS_05170 430 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 787 2634 gene locus_tag LOCUS_05180 787 2634 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925657.1 protein_id gnl|my_center|LOCUS_05180 2764 4479 gene locus_tag LOCUS_05190 2764 4479 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_05190 7366 4607 gene locus_tag LOCUS_05200 7366 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 9498 7540 gene locus_tag LOCUS_05210 9498 7540 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_05210 11167 9704 gene locus_tag LOCUS_05220 11167 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 11424 12164 gene locus_tag LOCUS_05230 11424 12164 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640216.1 protein_id gnl|my_center|LOCUS_05230 12197 12964 gene locus_tag LOCUS_05240 gene ddaH 12197 12964 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_05240 14070 13024 gene locus_tag LOCUS_05250 14070 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 15191 14469 gene locus_tag LOCUS_05260 15191 14469 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266992.1 protein_id gnl|my_center|LOCUS_05260 15389 16249 gene locus_tag LOCUS_05270 15389 16249 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035628.1 protein_id gnl|my_center|LOCUS_05270 16686 16258 gene locus_tag LOCUS_05280 16686 16258 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507823.1 protein_id gnl|my_center|LOCUS_05280 17371 16760 gene locus_tag LOCUS_05290 17371 16760 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 protein_id gnl|my_center|LOCUS_05290 17933 17376 gene locus_tag LOCUS_05300 17933 17376 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037433.1 protein_id gnl|my_center|LOCUS_05300 18015 18893 gene locus_tag LOCUS_05310 18015 18893 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103962.1 protein_id gnl|my_center|LOCUS_05310 18983 20983 gene locus_tag LOCUS_05320 18983 20983 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_05320 21091 23715 gene locus_tag LOCUS_05330 gene mprF 21091 23715 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706484.1 protein_id gnl|my_center|LOCUS_05330 23712 24518 gene locus_tag LOCUS_05340 23712 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 24594 25664 gene locus_tag LOCUS_05350 24594 25664 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 protein_id gnl|my_center|LOCUS_05350 25661 26362 gene locus_tag LOCUS_05360 25661 26362 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_05360 26779 26429 gene locus_tag LOCUS_05370 26779 26429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 27408 26821 gene locus_tag LOCUS_05380 27408 26821 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_05380 27736 27557 gene locus_tag LOCUS_05390 27736 27557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 28109 28948 gene locus_tag LOCUS_05400 28109 28948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 29030 30589 gene locus_tag LOCUS_05410 29030 30589 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 protein_id gnl|my_center|LOCUS_05410 30715 30639 gene locus_tag LOCUS_t00060 30715 30639 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30888 32423 gene locus_tag LOCUS_05420 30888 32423 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 protein_id gnl|my_center|LOCUS_05420 32512 32814 gene locus_tag LOCUS_05430 32512 32814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 32825 33601 gene locus_tag LOCUS_05440 32825 33601 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_05440 33594 34373 gene locus_tag LOCUS_05450 33594 34373 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_05450 34385 35428 gene locus_tag LOCUS_05460 34385 35428 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036961.1 protein_id gnl|my_center|LOCUS_05460 35442 36488 gene locus_tag LOCUS_05470 gene murB 35442 36488 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036960.1 protein_id gnl|my_center|LOCUS_05470 37808 36558 gene locus_tag LOCUS_05480 37808 36558 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208584.1 protein_id gnl|my_center|LOCUS_05480 38101 40257 gene locus_tag LOCUS_05490 gene ppk1 38101 40257 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_05490 42159 40285 gene locus_tag LOCUS_05500 42159 40285 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_05500 42411 43931 gene locus_tag LOCUS_05510 42411 43931 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 protein_id gnl|my_center|LOCUS_05510 44187 45386 gene locus_tag LOCUS_05520 44187 45386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 45475 47154 gene locus_tag LOCUS_05530 45475 47154 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_05530 47198 48424 gene locus_tag LOCUS_05540 47198 48424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 48517 50730 gene locus_tag LOCUS_05550 48517 50730 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275121.1 protein_id gnl|my_center|LOCUS_05550 50753 51136 gene locus_tag LOCUS_05560 50753 51136 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_05560 51334 51173 gene locus_tag LOCUS_05570 51334 51173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 51347 51553 gene locus_tag LOCUS_05580 51347 51553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 51918 51843 gene locus_tag LOCUS_t00070 51918 51843 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 53096 51981 gene locus_tag LOCUS_05590 gene rnd 53096 51981 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037450.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence010 1806 271 gene locus_tag LOCUS_05600 1806 271 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038532.1 protein_id gnl|my_center|LOCUS_05600 2361 1915 gene locus_tag LOCUS_05610 2361 1915 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038533.1 protein_id gnl|my_center|LOCUS_05610 4179 2371 gene locus_tag LOCUS_05620 4179 2371 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038534.1 protein_id gnl|my_center|LOCUS_05620 6561 4270 gene locus_tag LOCUS_05630 6561 4270 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036281.1 protein_id gnl|my_center|LOCUS_05630 6932 6600 gene locus_tag LOCUS_05640 6932 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6903 7961 gene locus_tag LOCUS_05650 6903 7961 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507348.1 protein_id gnl|my_center|LOCUS_05650 7982 9289 gene locus_tag LOCUS_05660 gene fucP 7982 9289 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_05660 9332 10312 gene locus_tag LOCUS_05670 9332 10312 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 protein_id gnl|my_center|LOCUS_05670 10309 11538 gene locus_tag LOCUS_05680 10309 11538 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 protein_id gnl|my_center|LOCUS_05680 12330 11578 gene locus_tag LOCUS_05690 12330 11578 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275306.1 protein_id gnl|my_center|LOCUS_05690 12936 12388 gene locus_tag LOCUS_05700 12936 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 13888 12926 gene locus_tag LOCUS_05710 13888 12926 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_05710 15528 13885 gene locus_tag LOCUS_05720 15528 13885 CDS product glucosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097704.1 protein_id gnl|my_center|LOCUS_05720 16975 15641 gene locus_tag LOCUS_05730 16975 15641 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_05730 18683 17019 gene locus_tag LOCUS_05740 18683 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 18565 18954 gene locus_tag LOCUS_05750 18565 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 20480 19101 gene locus_tag LOCUS_05760 20480 19101 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085170.1 protein_id gnl|my_center|LOCUS_05760 21100 20471 gene locus_tag LOCUS_05770 21100 20471 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_05770 21957 21103 gene locus_tag LOCUS_05780 21957 21103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 23771 21954 gene locus_tag LOCUS_05790 23771 21954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_05790 25021 23768 gene locus_tag LOCUS_05800 25021 23768 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_05800 26334 25018 gene locus_tag LOCUS_05810 26334 25018 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 protein_id gnl|my_center|LOCUS_05810 27548 26331 gene locus_tag LOCUS_05820 27548 26331 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391470.1 protein_id gnl|my_center|LOCUS_05820 28336 27884 gene locus_tag LOCUS_05830 28336 27884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 29497 28400 gene locus_tag LOCUS_05840 29497 28400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 29582 29884 gene locus_tag LOCUS_05850 29582 29884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 29958 31088 gene locus_tag LOCUS_05860 29958 31088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 31294 33015 gene locus_tag LOCUS_05870 31294 33015 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193449.1 protein_id gnl|my_center|LOCUS_05870 33771 33271 gene locus_tag LOCUS_05880 33771 33271 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037865.1 protein_id gnl|my_center|LOCUS_05880 34653 33961 gene locus_tag LOCUS_05890 34653 33961 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035945.1 protein_id gnl|my_center|LOCUS_05890 37322 34650 gene locus_tag LOCUS_05900 37322 34650 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035944.1 protein_id gnl|my_center|LOCUS_05900 37987 37436 gene locus_tag LOCUS_05910 gene kdpC 37987 37436 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_05910 38900 38091 gene locus_tag LOCUS_05920 38900 38091 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206895.1 protein_id gnl|my_center|LOCUS_05920 39184 38969 gene locus_tag LOCUS_05930 39184 38969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 41317 39248 gene locus_tag LOCUS_05940 gene kdpB 41317 39248 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_05940 43129 41321 gene locus_tag LOCUS_05950 gene kdpA 43129 41321 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_05950 44462 43512 gene locus_tag LOCUS_05960 44462 43512 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190574.1 protein_id gnl|my_center|LOCUS_05960 45743 44547 gene locus_tag LOCUS_05970 45743 44547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_05970 45910 46914 gene locus_tag LOCUS_05980 45910 46914 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_05980 47021 47647 gene locus_tag LOCUS_05990 47021 47647 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037974.1 protein_id gnl|my_center|LOCUS_05990 47644 48225 gene locus_tag LOCUS_06000 47644 48225 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 protein_id gnl|my_center|LOCUS_06000 48222 48773 gene locus_tag LOCUS_06010 48222 48773 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 protein_id gnl|my_center|LOCUS_06010 48786 50153 gene locus_tag LOCUS_06020 48786 50153 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_06020 50500 50261 gene locus_tag LOCUS_06030 50500 50261 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 protein_id gnl|my_center|LOCUS_06030 50569 51951 gene locus_tag LOCUS_06040 50569 51951 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_06040 <52622 52100 gene locus_tag LOCUS_06050 <52622 52100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104946.1:L-lactate dehydrogenase LldA >Feature sequence011 416 1114 gene locus_tag LOCUS_06060 416 1114 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510899.1 protein_id gnl|my_center|LOCUS_06060 1212 2294 gene locus_tag LOCUS_06070 1212 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2291 3073 gene locus_tag LOCUS_06080 2291 3073 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_06080 3756 3112 gene locus_tag LOCUS_06090 3756 3112 CDS product DUF6348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114390.1 protein_id gnl|my_center|LOCUS_06090 4279 3749 gene locus_tag LOCUS_06100 4279 3749 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084971.1 protein_id gnl|my_center|LOCUS_06100 5745 4381 gene locus_tag LOCUS_06110 5745 4381 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112748.1 protein_id gnl|my_center|LOCUS_06110 6694 5777 gene locus_tag LOCUS_06120 gene rocF 6694 5777 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039000.1 protein_id gnl|my_center|LOCUS_06120 6827 7330 gene locus_tag LOCUS_06130 6827 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 7676 7290 gene locus_tag LOCUS_06140 7676 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 8041 8487 gene locus_tag LOCUS_06150 gene azu 8041 8487 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813974.1 protein_id gnl|my_center|LOCUS_06150 11190 9862 gene locus_tag LOCUS_06160 11190 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 12501 11890 gene locus_tag LOCUS_06170 12501 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 12776 12701 gene locus_tag LOCUS_t00080 12776 12701 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13575 12907 gene locus_tag LOCUS_06180 13575 12907 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_06180 14372 13608 gene locus_tag LOCUS_06190 14372 13608 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039010.1 protein_id gnl|my_center|LOCUS_06190 15409 14369 gene locus_tag LOCUS_06200 gene birA 15409 14369 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_06200 15574 15915 gene locus_tag LOCUS_06210 15574 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 15928 16716 gene locus_tag LOCUS_06220 15928 16716 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039012.1 protein_id gnl|my_center|LOCUS_06220 18126 16744 gene locus_tag LOCUS_06230 18126 16744 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_06230 18820 18128 gene locus_tag LOCUS_06240 18820 18128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_06240 19145 18822 gene locus_tag LOCUS_06250 19145 18822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 20163 19228 gene locus_tag LOCUS_06260 gene dusA 20163 19228 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039017.1 protein_id gnl|my_center|LOCUS_06260 20682 21458 gene locus_tag LOCUS_06270 20682 21458 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 protein_id gnl|my_center|LOCUS_06270 21493 22050 gene locus_tag LOCUS_06280 21493 22050 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_06280 22740 22072 gene locus_tag LOCUS_06290 22740 22072 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 protein_id gnl|my_center|LOCUS_06290 23093 24505 gene locus_tag LOCUS_06300 23093 24505 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275186.1 protein_id gnl|my_center|LOCUS_06300 24521 25915 gene locus_tag LOCUS_06310 gene cls 24521 25915 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191365.1 protein_id gnl|my_center|LOCUS_06310 26426 25995 gene locus_tag LOCUS_06320 26426 25995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 26506 27144 gene locus_tag LOCUS_06330 gene pncA 26506 27144 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_06330 27640 27164 gene locus_tag LOCUS_06340 27640 27164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 28849 27923 gene locus_tag LOCUS_06350 28849 27923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 29953 28991 gene locus_tag LOCUS_06360 29953 28991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 30399 32345 gene locus_tag LOCUS_06370 30399 32345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 32425 32703 gene locus_tag LOCUS_06380 32425 32703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 33445 32729 gene locus_tag LOCUS_06390 33445 32729 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038877.1 protein_id gnl|my_center|LOCUS_06390 34039 33509 gene locus_tag LOCUS_06400 34039 33509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038740.1 protein_id gnl|my_center|LOCUS_06400 34232 34780 gene locus_tag LOCUS_06410 gene tsaA 34232 34780 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943048.1 protein_id gnl|my_center|LOCUS_06410 35167 36093 gene locus_tag LOCUS_06420 35167 36093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 36676 36155 gene locus_tag LOCUS_06430 36676 36155 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921241.1 protein_id gnl|my_center|LOCUS_06430 36952 37287 gene locus_tag LOCUS_06440 36952 37287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 37482 38345 gene locus_tag LOCUS_06450 37482 38345 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_06450 40010 38364 gene locus_tag LOCUS_06460 40010 38364 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_06460 40841 40257 gene locus_tag LOCUS_06470 40841 40257 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814300.1 protein_id gnl|my_center|LOCUS_06470 42199 41261 gene locus_tag LOCUS_06480 42199 41261 CDS product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 protein_id gnl|my_center|LOCUS_06480 42587 42366 gene locus_tag LOCUS_06490 42587 42366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 42771 43181 gene locus_tag LOCUS_06500 42771 43181 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_06500 43931 43215 gene locus_tag LOCUS_06510 43931 43215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929357.1 protein_id gnl|my_center|LOCUS_06510 44290 44604 gene locus_tag LOCUS_06520 44290 44604 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217002.1 protein_id gnl|my_center|LOCUS_06520 45102 44707 gene locus_tag LOCUS_06530 45102 44707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 48135 45253 gene locus_tag LOCUS_06540 48135 45253 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 protein_id gnl|my_center|LOCUS_06540 48408 48611 gene locus_tag LOCUS_06550 48408 48611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 48648 49115 gene locus_tag LOCUS_06560 48648 49115 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105425.1 protein_id gnl|my_center|LOCUS_06560 49884 49186 gene locus_tag LOCUS_06570 49884 49186 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640365.1 protein_id gnl|my_center|LOCUS_06570 50675 49881 gene locus_tag LOCUS_06580 gene trpC 50675 49881 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_06580 51847 50765 gene locus_tag LOCUS_06590 gene trpD 51847 50765 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_06590 52443 51844 gene locus_tag LOCUS_06600 52443 51844 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence012 858 22 gene locus_tag LOCUS_06610 858 22 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266848.1 protein_id gnl|my_center|LOCUS_06610 1205 873 gene locus_tag LOCUS_06620 1205 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1258 1593 gene locus_tag LOCUS_06630 1258 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1618 2946 gene locus_tag LOCUS_06640 1618 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3522 3773 gene locus_tag LOCUS_06650 3522 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3979 4446 gene locus_tag LOCUS_06660 3979 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5059 4658 gene locus_tag LOCUS_06670 5059 4658 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 protein_id gnl|my_center|LOCUS_06670 5358 5062 gene locus_tag LOCUS_06680 5358 5062 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809515.1 protein_id gnl|my_center|LOCUS_06680 5606 6613 gene locus_tag LOCUS_06690 5606 6613 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509462.1 protein_id gnl|my_center|LOCUS_06690 6623 8014 gene locus_tag LOCUS_06700 gene ntrC 6623 8014 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035445.1 protein_id gnl|my_center|LOCUS_06700 8243 9562 gene locus_tag LOCUS_06710 8243 9562 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528141.1 protein_id gnl|my_center|LOCUS_06710 9559 11085 gene locus_tag LOCUS_06720 9559 11085 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528142.1 protein_id gnl|my_center|LOCUS_06720 11171 12076 gene locus_tag LOCUS_06730 gene gnd 11171 12076 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 protein_id gnl|my_center|LOCUS_06730 12679 12278 gene locus_tag LOCUS_06740 12679 12278 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707472.1 protein_id gnl|my_center|LOCUS_06740 13246 12791 gene locus_tag LOCUS_06750 gene rnk 13246 12791 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_06750 13632 13297 gene locus_tag LOCUS_06760 13632 13297 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_06760 14128 13688 gene locus_tag LOCUS_06770 14128 13688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074250.1 protein_id gnl|my_center|LOCUS_06770 14918 14214 gene locus_tag LOCUS_06780 14918 14214 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_06780 16003 14918 gene locus_tag LOCUS_06790 16003 14918 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038605.1 protein_id gnl|my_center|LOCUS_06790 16671 16000 gene locus_tag LOCUS_06800 16671 16000 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509047.1 protein_id gnl|my_center|LOCUS_06800 18991 16832 gene locus_tag LOCUS_06810 18991 16832 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143261.1 protein_id gnl|my_center|LOCUS_06810 19136 21553 gene locus_tag LOCUS_06820 19136 21553 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994129.1 protein_id gnl|my_center|LOCUS_06820 21642 22346 gene locus_tag LOCUS_06830 21642 22346 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_06830 23012 22362 gene locus_tag LOCUS_06840 23012 22362 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243294.1 protein_id gnl|my_center|LOCUS_06840 24961 23144 gene locus_tag LOCUS_06850 gene edd 24961 23144 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327377.1 protein_id gnl|my_center|LOCUS_06850 25772 25059 gene locus_tag LOCUS_06860 gene pgl 25772 25059 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327379.1 protein_id gnl|my_center|LOCUS_06860 27346 25886 gene locus_tag LOCUS_06870 gene zwf 27346 25886 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971003.1 protein_id gnl|my_center|LOCUS_06870 27519 28319 gene locus_tag LOCUS_06880 27519 28319 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918333.1 protein_id gnl|my_center|LOCUS_06880 28429 29568 gene locus_tag LOCUS_06890 gene nagA 28429 29568 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038508.1 protein_id gnl|my_center|LOCUS_06890 30656 29586 gene locus_tag LOCUS_06900 30656 29586 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038510.1 protein_id gnl|my_center|LOCUS_06900 32079 30793 gene locus_tag LOCUS_06910 32079 30793 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_06910 32517 33632 gene locus_tag LOCUS_06920 32517 33632 CDS product glucokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038011.1 protein_id gnl|my_center|LOCUS_06920 33792 36701 gene locus_tag LOCUS_06930 33792 36701 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038506.1 protein_id gnl|my_center|LOCUS_06930 36846 39161 gene locus_tag LOCUS_06940 36846 39161 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054358.1 protein_id gnl|my_center|LOCUS_06940 39158 40231 gene locus_tag LOCUS_06950 39158 40231 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_06950 40319 41350 gene locus_tag LOCUS_06960 40319 41350 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038509.1 protein_id gnl|my_center|LOCUS_06960 41844 43787 gene locus_tag LOCUS_06970 gene btuB 41844 43787 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_06970 43885 47049 gene locus_tag LOCUS_06980 43885 47049 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038870.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence013 459 1094 gene locus_tag LOCUS_06990 459 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1691 1113 gene locus_tag LOCUS_07000 1691 1113 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_07000 1836 4286 gene locus_tag LOCUS_07010 1836 4286 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963454.1 protein_id gnl|my_center|LOCUS_07010 4283 5131 gene locus_tag LOCUS_07020 4283 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07020 5956 5210 gene locus_tag LOCUS_07030 gene dsbG 5956 5210 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 protein_id gnl|my_center|LOCUS_07030 7336 6215 gene locus_tag LOCUS_07040 7336 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 7939 7499 gene locus_tag LOCUS_07050 7939 7499 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036378.1 protein_id gnl|my_center|LOCUS_07050 8883 8050 gene locus_tag LOCUS_07060 8883 8050 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035418.1 protein_id gnl|my_center|LOCUS_07060 9748 9053 gene locus_tag LOCUS_07070 9748 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9983 11389 gene locus_tag LOCUS_07080 9983 11389 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037505.1 protein_id gnl|my_center|LOCUS_07080 12226 11453 gene locus_tag LOCUS_07090 12226 11453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12407 13399 gene locus_tag LOCUS_07100 12407 13399 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966094.1 protein_id gnl|my_center|LOCUS_07100 13763 13413 gene locus_tag LOCUS_07110 13763 13413 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_07110 14277 13975 gene locus_tag LOCUS_07120 14277 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 15521 14454 gene locus_tag LOCUS_07130 15521 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 15847 17457 gene locus_tag LOCUS_07140 15847 17457 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_07140 17603 18304 gene locus_tag LOCUS_07150 17603 18304 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 protein_id gnl|my_center|LOCUS_07150 18424 19425 gene locus_tag LOCUS_07160 18424 19425 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196428.1 protein_id gnl|my_center|LOCUS_07160 19558 20637 gene locus_tag LOCUS_07170 gene ada 19558 20637 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089725526.1 protein_id gnl|my_center|LOCUS_07170 20687 21388 gene locus_tag LOCUS_07180 gene alkB 20687 21388 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104393.1 protein_id gnl|my_center|LOCUS_07180 21385 22365 gene locus_tag LOCUS_07190 21385 22365 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_07190 22812 22408 gene locus_tag LOCUS_07200 22812 22408 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197761.1 protein_id gnl|my_center|LOCUS_07200 25000 22901 gene locus_tag LOCUS_07210 25000 22901 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551535.1 protein_id gnl|my_center|LOCUS_07210 25397 28288 gene locus_tag LOCUS_07220 gene gcvP 25397 28288 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036312.1 protein_id gnl|my_center|LOCUS_07220 28437 29570 gene locus_tag LOCUS_07230 28437 29570 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730676.1 protein_id gnl|my_center|LOCUS_07230 29911 30339 gene locus_tag LOCUS_07240 29911 30339 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 protein_id gnl|my_center|LOCUS_07240 30469 30870 gene locus_tag LOCUS_07250 30469 30870 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_07250 31192 32745 gene locus_tag LOCUS_07260 31192 32745 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665774.1 protein_id gnl|my_center|LOCUS_07260 34102 32669 gene locus_tag LOCUS_07270 34102 32669 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_07270 36234 34198 gene locus_tag LOCUS_07280 36234 34198 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198752.1 protein_id gnl|my_center|LOCUS_07280 37170 36325 gene locus_tag LOCUS_07290 37170 36325 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_07290 38334 37237 gene locus_tag LOCUS_07300 38334 37237 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_07300 39737 38331 gene locus_tag LOCUS_07310 39737 38331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 40806 39739 gene locus_tag LOCUS_07320 40806 39739 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_07320 41822 40803 gene locus_tag LOCUS_07330 gene arsS 41822 40803 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_07330 44036 41841 gene locus_tag LOCUS_07340 44036 41841 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_07340 44521 44069 gene locus_tag LOCUS_07350 44521 44069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 45111 44602 gene locus_tag LOCUS_07360 45111 44602 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086804.1 protein_id gnl|my_center|LOCUS_07360 45744 45229 gene locus_tag LOCUS_07370 45744 45229 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706875.1 protein_id gnl|my_center|LOCUS_07370 46526 45741 gene locus_tag LOCUS_07380 46526 45741 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926120.1 protein_id gnl|my_center|LOCUS_07380 <47386 46501 gene locus_tag LOCUS_07390 <47386 46501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173508789.1:DUF692 domain-containing protein >Feature sequence014 550 2337 gene locus_tag LOCUS_07400 gene katG 550 2337 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_07400 3085 2678 gene locus_tag LOCUS_07410 gene hslR 3085 2678 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208910.1 protein_id gnl|my_center|LOCUS_07410 3765 3175 gene locus_tag LOCUS_07420 3765 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 4741 3839 gene locus_tag LOCUS_07430 4741 3839 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_07430 4870 6006 gene locus_tag LOCUS_07440 4870 6006 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035915.1 protein_id gnl|my_center|LOCUS_07440 6242 8419 gene locus_tag LOCUS_07450 6242 8419 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268635.1 protein_id gnl|my_center|LOCUS_07450 8421 9008 gene locus_tag LOCUS_07460 gene pnuC 8421 9008 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766257.1 protein_id gnl|my_center|LOCUS_07460 9135 9767 gene locus_tag LOCUS_07470 9135 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 11158 9830 gene locus_tag LOCUS_07480 11158 9830 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_07480 12854 11229 gene locus_tag LOCUS_07490 12854 11229 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_07490 13836 12922 gene locus_tag LOCUS_07500 13836 12922 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096546.1 protein_id gnl|my_center|LOCUS_07500 15172 13847 gene locus_tag LOCUS_07510 15172 13847 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_07510 16229 15204 gene locus_tag LOCUS_07520 16229 15204 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 protein_id gnl|my_center|LOCUS_07520 18311 16287 gene locus_tag LOCUS_07530 18311 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 20556 18346 gene locus_tag LOCUS_07540 20556 18346 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036376.1 protein_id gnl|my_center|LOCUS_07540 20497 20802 gene locus_tag LOCUS_07550 20497 20802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 20957 21526 gene locus_tag LOCUS_07560 20957 21526 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228982.1 protein_id gnl|my_center|LOCUS_07560 21586 22809 gene locus_tag LOCUS_07570 21586 22809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_07570 23045 22851 gene locus_tag LOCUS_07580 23045 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 23249 24985 gene locus_tag LOCUS_07590 23249 24985 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537669.1 protein_id gnl|my_center|LOCUS_07590 25209 26456 gene locus_tag LOCUS_07600 25209 26456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 28445 26577 gene locus_tag LOCUS_07610 gene htpG 28445 26577 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064608.1 protein_id gnl|my_center|LOCUS_07610 28736 29602 gene locus_tag LOCUS_07620 gene gluQRS 28736 29602 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037437.1 protein_id gnl|my_center|LOCUS_07620 29656 30447 gene locus_tag LOCUS_07630 29656 30447 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 protein_id gnl|my_center|LOCUS_07630 31325 30537 gene locus_tag LOCUS_07640 31325 30537 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036615.1 protein_id gnl|my_center|LOCUS_07640 31236 31865 gene locus_tag LOCUS_07650 31236 31865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 32790 31918 gene locus_tag LOCUS_07660 32790 31918 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_07660 33892 32822 gene locus_tag LOCUS_07670 33892 32822 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 protein_id gnl|my_center|LOCUS_07670 34374 34165 gene locus_tag LOCUS_07680 34374 34165 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_07680 34973 34518 gene locus_tag LOCUS_07690 34973 34518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 34915 35217 gene locus_tag LOCUS_07700 34915 35217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 36471 35248 gene locus_tag LOCUS_07710 36471 35248 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198466.1 protein_id gnl|my_center|LOCUS_07710 36693 37052 gene locus_tag LOCUS_07720 36693 37052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 37278 38357 gene locus_tag LOCUS_07730 37278 38357 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_07730 38904 38422 gene locus_tag LOCUS_07740 38904 38422 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_07740 39037 40548 gene locus_tag LOCUS_07750 gene dacB 39037 40548 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_07750 41052 40567 gene locus_tag LOCUS_07760 41052 40567 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 protein_id gnl|my_center|LOCUS_07760 42317 41133 gene locus_tag LOCUS_07770 gene pncB 42317 41133 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192078.1 protein_id gnl|my_center|LOCUS_07770 43775 42660 gene locus_tag LOCUS_07780 43775 42660 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_07780 44358 43888 gene locus_tag LOCUS_07790 44358 43888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence015 3340 3657 gene locus_tag LOCUS_07800 3340 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3722 4735 gene locus_tag LOCUS_07810 3722 4735 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 protein_id gnl|my_center|LOCUS_07810 4744 6099 gene locus_tag LOCUS_07820 4744 6099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383259.1 protein_id gnl|my_center|LOCUS_07820 6402 6980 gene locus_tag LOCUS_07830 6402 6980 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 protein_id gnl|my_center|LOCUS_07830 7823 6993 gene locus_tag LOCUS_07840 gene aroE 7823 6993 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039025.1 protein_id gnl|my_center|LOCUS_07840 7985 8251 gene locus_tag LOCUS_07850 7985 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9752 8262 gene locus_tag LOCUS_07860 9752 8262 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_07860 9824 10441 gene locus_tag LOCUS_07870 9824 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 11147 10458 gene locus_tag LOCUS_07880 11147 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 11259 11429 gene locus_tag LOCUS_07890 11259 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 11441 12301 gene locus_tag LOCUS_07900 gene dapF 11441 12301 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983200.1 protein_id gnl|my_center|LOCUS_07900 12384 13070 gene locus_tag LOCUS_07910 12384 13070 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944790.1 protein_id gnl|my_center|LOCUS_07910 13078 13965 gene locus_tag LOCUS_07920 gene xerC 13078 13965 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 protein_id gnl|my_center|LOCUS_07920 14090 14623 gene locus_tag LOCUS_07930 gene hslV 14090 14623 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_07930 14716 16062 gene locus_tag LOCUS_07940 gene hslU 14716 16062 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038587.1 protein_id gnl|my_center|LOCUS_07940 16099 16719 gene locus_tag LOCUS_07950 16099 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 16862 17788 gene locus_tag LOCUS_07960 gene rbsK 16862 17788 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132865.1 protein_id gnl|my_center|LOCUS_07960 19168 17822 gene locus_tag LOCUS_07970 gene mnmE 19168 17822 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244945.1 protein_id gnl|my_center|LOCUS_07970 20975 19251 gene locus_tag LOCUS_07980 gene yidC 20975 19251 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707925.1 protein_id gnl|my_center|LOCUS_07980 21341 21039 gene locus_tag LOCUS_07990 21341 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 21593 21459 gene locus_tag LOCUS_08000 gene rpmH 21593 21459 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044781.1 protein_id gnl|my_center|LOCUS_08000 21827 23110 gene locus_tag LOCUS_08010 gene dnaA 21827 23110 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035259.1 protein_id gnl|my_center|LOCUS_08010 23366 24466 gene locus_tag LOCUS_08020 gene dnaN 23366 24466 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035260.1 protein_id gnl|my_center|LOCUS_08020 24562 25641 gene locus_tag LOCUS_08030 gene recF 24562 25641 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035261.1 protein_id gnl|my_center|LOCUS_08030 25738 28170 gene locus_tag LOCUS_08040 gene gyrB 25738 28170 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035262.1 protein_id gnl|my_center|LOCUS_08040 28372 29658 gene locus_tag LOCUS_08050 28372 29658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 29879 30529 gene locus_tag LOCUS_08060 29879 30529 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033836101.1 protein_id gnl|my_center|LOCUS_08060 30708 31385 gene locus_tag LOCUS_08070 gene exbB 30708 31385 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035267.1 protein_id gnl|my_center|LOCUS_08070 31397 31819 gene locus_tag LOCUS_08080 31397 31819 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035268.1 protein_id gnl|my_center|LOCUS_08080 31856 32236 gene locus_tag LOCUS_08090 31856 32236 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035269.1 protein_id gnl|my_center|LOCUS_08090 33089 32346 gene locus_tag LOCUS_08100 33089 32346 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_08100 33818 33174 gene locus_tag LOCUS_08110 33818 33174 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057213.1 protein_id gnl|my_center|LOCUS_08110 33936 37415 gene locus_tag LOCUS_08120 33936 37415 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 protein_id gnl|my_center|LOCUS_08120 38895 37432 gene locus_tag LOCUS_08130 38895 37432 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_08130 43622 38919 gene locus_tag LOCUS_08140 43622 38919 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_08140 44456 43785 gene locus_tag LOCUS_08150 44456 43785 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence016 1081 191 gene locus_tag LOCUS_08160 1081 191 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_08160 2637 1078 gene locus_tag LOCUS_08170 2637 1078 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_08170 3437 2634 gene locus_tag LOCUS_08180 3437 2634 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_08180 3723 3442 gene locus_tag LOCUS_08190 3723 3442 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_08190 4459 3758 gene locus_tag LOCUS_08200 4459 3758 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_08200 4757 4449 gene locus_tag LOCUS_08210 4757 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 5088 4750 gene locus_tag LOCUS_08220 5088 4750 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_08220 5486 5085 gene locus_tag LOCUS_08230 5486 5085 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_08230 6915 5461 gene locus_tag LOCUS_08240 gene atpD 6915 5461 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065404.1 protein_id gnl|my_center|LOCUS_08240 8108 6912 gene locus_tag LOCUS_08250 8108 6912 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827568.1 protein_id gnl|my_center|LOCUS_08250 9538 8111 gene locus_tag LOCUS_08260 9538 8111 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389222.1 protein_id gnl|my_center|LOCUS_08260 11324 9552 gene locus_tag LOCUS_08270 11324 9552 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338825.1 protein_id gnl|my_center|LOCUS_08270 11776 12213 gene locus_tag LOCUS_08280 11776 12213 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_08280 13195 12362 gene locus_tag LOCUS_08290 13195 12362 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_08290 14273 13641 gene locus_tag LOCUS_08300 14273 13641 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 protein_id gnl|my_center|LOCUS_08300 14762 16363 gene locus_tag LOCUS_08310 gene appC 14762 16363 CDS product cytochrome bd-II oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263572.1 protein_id gnl|my_center|LOCUS_08310 16367 17500 gene locus_tag LOCUS_08320 gene cydB 16367 17500 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707369.1 protein_id gnl|my_center|LOCUS_08320 17510 17731 gene locus_tag LOCUS_08330 17510 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 17799 19538 gene locus_tag LOCUS_08340 gene cydD 17799 19538 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 protein_id gnl|my_center|LOCUS_08340 19535 21352 gene locus_tag LOCUS_08350 gene cydC 19535 21352 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941873.1 protein_id gnl|my_center|LOCUS_08350 22480 21362 gene locus_tag LOCUS_08360 22480 21362 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087319.1 protein_id gnl|my_center|LOCUS_08360 22868 23419 gene locus_tag LOCUS_08370 22868 23419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 23817 24548 gene locus_tag LOCUS_08380 23817 24548 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067323.1 protein_id gnl|my_center|LOCUS_08380 24797 24991 gene locus_tag LOCUS_08390 24797 24991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 25460 25074 gene locus_tag LOCUS_08400 25460 25074 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 protein_id gnl|my_center|LOCUS_08400 25645 26925 gene locus_tag LOCUS_08410 25645 26925 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_08410 26953 27159 gene locus_tag LOCUS_08420 26953 27159 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_08420 27189 28286 gene locus_tag LOCUS_08430 27189 28286 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072998.1 protein_id gnl|my_center|LOCUS_08430 28279 31545 gene locus_tag LOCUS_08440 28279 31545 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_08440 32668 31625 gene locus_tag LOCUS_08450 gene pyrC 32668 31625 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_08450 33660 32860 gene locus_tag LOCUS_08460 33660 32860 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_08460 33932 34369 gene locus_tag LOCUS_08470 33932 34369 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 protein_id gnl|my_center|LOCUS_08470 34366 36660 gene locus_tag LOCUS_08480 34366 36660 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445450.1 protein_id gnl|my_center|LOCUS_08480 35434 35500 gene locus_tag LOCUS_t00090 35434 35500 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 36772 37548 gene locus_tag LOCUS_08490 gene fnr 36772 37548 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077129.1 protein_id gnl|my_center|LOCUS_08490 37725 37649 gene locus_tag LOCUS_t00100 37725 37649 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37898 39286 gene locus_tag LOCUS_08500 gene hisS 37898 39286 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence017 2173 3051 gene locus_tag LOCUS_08510 2173 3051 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815269.1 protein_id gnl|my_center|LOCUS_08510 4477 3101 gene locus_tag LOCUS_08520 4477 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5205 4474 gene locus_tag LOCUS_08530 5205 4474 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_08530 5389 7224 gene locus_tag LOCUS_08540 5389 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7481 7155 gene locus_tag LOCUS_08550 7481 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7619 10606 gene locus_tag LOCUS_08560 7619 10606 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210763276.1 protein_id gnl|my_center|LOCUS_08560 10721 12127 gene locus_tag LOCUS_08570 10721 12127 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201008.1 protein_id gnl|my_center|LOCUS_08570 12677 15790 gene locus_tag LOCUS_08580 12677 15790 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_08580 16032 17108 gene locus_tag LOCUS_08590 16032 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 17156 18556 gene locus_tag LOCUS_08600 17156 18556 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201008.1 protein_id gnl|my_center|LOCUS_08600 19762 18971 gene locus_tag LOCUS_08610 19762 18971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 20021 22267 gene locus_tag LOCUS_08620 20021 22267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 22264 23460 gene locus_tag LOCUS_08630 22264 23460 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952782.1 protein_id gnl|my_center|LOCUS_08630 23457 24527 gene locus_tag LOCUS_08640 23457 24527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 24524 26038 gene locus_tag LOCUS_08650 24524 26038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 26048 28183 gene locus_tag LOCUS_08660 26048 28183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 28570 29811 gene locus_tag LOCUS_08670 28570 29811 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_08670 29808 30875 gene locus_tag LOCUS_08680 29808 30875 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267493.1 protein_id gnl|my_center|LOCUS_08680 30872 33937 gene locus_tag LOCUS_08690 30872 33937 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_08690 33937 35013 gene locus_tag LOCUS_08700 33937 35013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 36156 35038 gene locus_tag LOCUS_08710 36156 35038 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816841.1 protein_id gnl|my_center|LOCUS_08710 36584 39412 gene locus_tag LOCUS_08720 36584 39412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919622.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence018 <1 2934 gene locus_tag LOCUS_08730 <1 2934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105302.1:nitrate reductase subunit alpha 2934 4478 gene locus_tag LOCUS_08740 gene narH 2934 4478 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 protein_id gnl|my_center|LOCUS_08740 4475 5158 gene locus_tag LOCUS_08750 gene narJ 4475 5158 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571684.1 protein_id gnl|my_center|LOCUS_08750 5155 5859 gene locus_tag LOCUS_08760 gene narI 5155 5859 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 protein_id gnl|my_center|LOCUS_08760 5862 6773 gene locus_tag LOCUS_08770 5862 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 6856 8169 gene locus_tag LOCUS_08780 6856 8169 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_08780 8264 8665 gene locus_tag LOCUS_08790 8264 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 8987 8667 gene locus_tag LOCUS_08800 8987 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 9279 9127 gene locus_tag LOCUS_08810 9279 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 10495 9509 gene locus_tag LOCUS_08820 gene lipA 10495 9509 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946482.1 protein_id gnl|my_center|LOCUS_08820 10663 12171 gene locus_tag LOCUS_08830 gene glpK 10663 12171 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035612.1 protein_id gnl|my_center|LOCUS_08830 13161 12226 gene locus_tag LOCUS_08840 13161 12226 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_08840 13438 14484 gene locus_tag LOCUS_08850 13438 14484 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003482734.1 protein_id gnl|my_center|LOCUS_08850 14700 15665 gene locus_tag LOCUS_08860 gene mreC 14700 15665 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08860 15662 16147 gene locus_tag LOCUS_08870 gene mreD 15662 16147 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038565.1 protein_id gnl|my_center|LOCUS_08870 16149 18149 gene locus_tag LOCUS_08880 gene mrdA 16149 18149 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038564.1 protein_id gnl|my_center|LOCUS_08880 18146 19261 gene locus_tag LOCUS_08890 gene rodA 18146 19261 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 protein_id gnl|my_center|LOCUS_08890 19359 20369 gene locus_tag LOCUS_08900 gene mltB 19359 20369 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_08900 20366 21286 gene locus_tag LOCUS_08910 20366 21286 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947237.1 protein_id gnl|my_center|LOCUS_08910 21373 22614 gene locus_tag LOCUS_08920 21373 22614 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038554.1 protein_id gnl|my_center|LOCUS_08920 22622 22915 gene locus_tag LOCUS_08930 22622 22915 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038551.1 protein_id gnl|my_center|LOCUS_08930 23105 23710 gene locus_tag LOCUS_08940 gene lipB 23105 23710 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_08940 23720 24730 gene locus_tag LOCUS_08950 gene lipA 23720 24730 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038549.1 protein_id gnl|my_center|LOCUS_08950 24739 27006 gene locus_tag LOCUS_08960 24739 27006 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_08960 27316 29280 gene locus_tag LOCUS_08970 27316 29280 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838414.1 protein_id gnl|my_center|LOCUS_08970 29333 30811 gene locus_tag LOCUS_08980 gene ubiD 29333 30811 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 protein_id gnl|my_center|LOCUS_08980 31129 30797 gene locus_tag LOCUS_08990 31129 30797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 31260 32258 gene locus_tag LOCUS_09000 31260 32258 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093020.1 protein_id gnl|my_center|LOCUS_09000 32263 33171 gene locus_tag LOCUS_09010 32263 33171 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 protein_id gnl|my_center|LOCUS_09010 34492 33284 gene locus_tag LOCUS_09020 gene fabB 34492 33284 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035826.1 protein_id gnl|my_center|LOCUS_09020 35007 34492 gene locus_tag LOCUS_09030 gene fabA 35007 34492 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083591.1 protein_id gnl|my_center|LOCUS_09030 36579 35137 gene locus_tag LOCUS_09040 gene nadB 36579 35137 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804026.1 protein_id gnl|my_center|LOCUS_09040 37601 36576 gene locus_tag LOCUS_09050 gene nadA 37601 36576 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389188.1 protein_id gnl|my_center|LOCUS_09050 38503 37643 gene locus_tag LOCUS_09060 38503 37643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 38809 38552 gene locus_tag LOCUS_09070 38809 38552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 39711 38947 gene locus_tag LOCUS_09080 gene anr 39711 38947 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence019 <1 1297 gene locus_tag LOCUS_09090 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895499.1:chemotaxis protein CheA 1503 2009 gene locus_tag LOCUS_09100 1503 2009 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_09100 2023 3798 gene locus_tag LOCUS_09110 2023 3798 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535875.1 protein_id gnl|my_center|LOCUS_09110 3799 4695 gene locus_tag LOCUS_09120 3799 4695 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938886.1 protein_id gnl|my_center|LOCUS_09120 4692 5339 gene locus_tag LOCUS_09130 gene cheD 4692 5339 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102220.1 protein_id gnl|my_center|LOCUS_09130 5555 6583 gene locus_tag LOCUS_09140 5555 6583 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_09140 6600 7787 gene locus_tag LOCUS_09150 6600 7787 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_09150 7798 8097 gene locus_tag LOCUS_09160 gene hsbA 7798 8097 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_09160 8790 8428 gene locus_tag LOCUS_09170 8790 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 9310 8957 gene locus_tag LOCUS_09180 9310 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 9971 9393 gene locus_tag LOCUS_09190 9971 9393 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_09190 10929 10015 gene locus_tag LOCUS_09200 10929 10015 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_09200 11516 10917 gene locus_tag LOCUS_09210 11516 10917 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036076.1 protein_id gnl|my_center|LOCUS_09210 13027 11519 gene locus_tag LOCUS_09220 13027 11519 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_09220 13594 13178 gene locus_tag LOCUS_09230 13594 13178 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187960.1 protein_id gnl|my_center|LOCUS_09230 13733 14833 gene locus_tag LOCUS_09240 13733 14833 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 protein_id gnl|my_center|LOCUS_09240 15537 14923 gene locus_tag LOCUS_09250 15537 14923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 15948 15541 gene locus_tag LOCUS_09260 15948 15541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 16589 15945 gene locus_tag LOCUS_09270 16589 15945 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506786.1 protein_id gnl|my_center|LOCUS_09270 16683 16988 gene locus_tag LOCUS_09280 16683 16988 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_09280 16988 18466 gene locus_tag LOCUS_09290 16988 18466 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_09290 18920 18492 gene locus_tag LOCUS_09300 18920 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 19147 19704 gene locus_tag LOCUS_09310 gene sufT 19147 19704 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_09310 20202 22343 gene locus_tag LOCUS_09320 20202 22343 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704796.1 protein_id gnl|my_center|LOCUS_09320 22941 22450 gene locus_tag LOCUS_09330 22941 22450 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_09330 24793 23153 gene locus_tag LOCUS_09340 24793 23153 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193195.1 protein_id gnl|my_center|LOCUS_09340 25181 24837 gene locus_tag LOCUS_09350 25181 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 25780 25178 gene locus_tag LOCUS_09360 gene wrbA 25780 25178 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036095.1 protein_id gnl|my_center|LOCUS_09360 25883 27160 gene locus_tag LOCUS_09370 25883 27160 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036096.1 protein_id gnl|my_center|LOCUS_09370 27157 27639 gene locus_tag LOCUS_09380 27157 27639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 27636 27905 gene locus_tag LOCUS_09390 27636 27905 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036098.1 protein_id gnl|my_center|LOCUS_09390 28673 27909 gene locus_tag LOCUS_09400 gene ppk2 28673 27909 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036100.1 protein_id gnl|my_center|LOCUS_09400 29815 28736 gene locus_tag LOCUS_09410 gene prfA 29815 28736 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036103.1 protein_id gnl|my_center|LOCUS_09410 31151 29880 gene locus_tag LOCUS_09420 gene hemA 31151 29880 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036104.1 protein_id gnl|my_center|LOCUS_09420 31262 33001 gene locus_tag LOCUS_09430 31262 33001 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036105.1 protein_id gnl|my_center|LOCUS_09430 33022 33609 gene locus_tag LOCUS_09440 gene lolB 33022 33609 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036106.1 protein_id gnl|my_center|LOCUS_09440 33689 35068 gene locus_tag LOCUS_09450 33689 35068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 35107 35183 gene locus_tag LOCUS_t00110 35107 35183 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 35236 36177 gene locus_tag LOCUS_09460 35236 36177 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036108.1 protein_id gnl|my_center|LOCUS_09460 36275 36931 gene locus_tag LOCUS_09470 36275 36931 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036109.1 protein_id gnl|my_center|LOCUS_09470 36986 37570 gene locus_tag LOCUS_09480 gene pth 36986 37570 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036110.1 protein_id gnl|my_center|LOCUS_09480 37655 38743 gene locus_tag LOCUS_09490 gene ychF 37655 38743 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036111.1 protein_id gnl|my_center|LOCUS_09490 38758 39246 gene locus_tag LOCUS_09500 38758 39246 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037723.1 protein_id gnl|my_center|LOCUS_09500 39536 39621 gene locus_tag LOCUS_t00120 39536 39621 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 39737 39810 gene locus_tag LOCUS_t00130 39737 39810 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 39834 39909 gene locus_tag LOCUS_t00140 39834 39909 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 430 1098 gene locus_tag LOCUS_09510 gene can 430 1098 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_09510 1095 1523 gene locus_tag LOCUS_09520 1095 1523 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_09520 2420 1602 gene locus_tag LOCUS_09530 gene hutG 2420 1602 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524693.1 protein_id gnl|my_center|LOCUS_09530 2564 3979 gene locus_tag LOCUS_09540 2564 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4113 4616 gene locus_tag LOCUS_09550 4113 4616 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037713.1 protein_id gnl|my_center|LOCUS_09550 5223 4714 gene locus_tag LOCUS_09560 5223 4714 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037712.1 protein_id gnl|my_center|LOCUS_09560 5558 6853 gene locus_tag LOCUS_09570 5558 6853 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035834.1 protein_id gnl|my_center|LOCUS_09570 7480 6926 gene locus_tag LOCUS_09580 gene rimJ 7480 6926 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704794.1 protein_id gnl|my_center|LOCUS_09580 8325 7477 gene locus_tag LOCUS_09590 gene fghA 8325 7477 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144409.1 protein_id gnl|my_center|LOCUS_09590 8484 10367 gene locus_tag LOCUS_09600 8484 10367 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_09600 10442 12064 gene locus_tag LOCUS_09610 10442 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 12245 13063 gene locus_tag LOCUS_09620 12245 13063 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_09620 13449 13048 gene locus_tag LOCUS_09630 13449 13048 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035473.1 protein_id gnl|my_center|LOCUS_09630 14365 13505 gene locus_tag LOCUS_09640 14365 13505 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399938.1 protein_id gnl|my_center|LOCUS_09640 14485 14877 gene locus_tag LOCUS_09650 14485 14877 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083819.1 protein_id gnl|my_center|LOCUS_09650 16458 14878 gene locus_tag LOCUS_09660 16458 14878 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390497.1 protein_id gnl|my_center|LOCUS_09660 16638 17486 gene locus_tag LOCUS_09670 16638 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 18090 17518 gene locus_tag LOCUS_09680 18090 17518 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037740.1 protein_id gnl|my_center|LOCUS_09680 19964 18192 gene locus_tag LOCUS_09690 gene ggt 19964 18192 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976285.1 protein_id gnl|my_center|LOCUS_09690 20302 21531 gene locus_tag LOCUS_09700 gene kch 20302 21531 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011378679.1 protein_id gnl|my_center|LOCUS_09700 23850 21565 gene locus_tag LOCUS_09710 23850 21565 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705493.1 protein_id gnl|my_center|LOCUS_09710 24426 23977 gene locus_tag LOCUS_09720 24426 23977 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 protein_id gnl|my_center|LOCUS_09720 24978 24508 gene locus_tag LOCUS_09730 gene rlmH 24978 24508 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037743.1 protein_id gnl|my_center|LOCUS_09730 25461 25075 gene locus_tag LOCUS_09740 gene rsfS 25461 25075 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 protein_id gnl|my_center|LOCUS_09740 26606 25527 gene locus_tag LOCUS_09750 26606 25527 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551047.1 protein_id gnl|my_center|LOCUS_09750 27061 26753 gene locus_tag LOCUS_09760 27061 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 27823 27191 gene locus_tag LOCUS_09770 27823 27191 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_09770 29095 28001 gene locus_tag LOCUS_09780 29095 28001 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038671.1 protein_id gnl|my_center|LOCUS_09780 29403 30326 gene locus_tag LOCUS_09790 29403 30326 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038755.1 protein_id gnl|my_center|LOCUS_09790 30427 32298 gene locus_tag LOCUS_09800 30427 32298 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_09800 32362 32835 gene locus_tag LOCUS_09810 gene msrB 32362 32835 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 protein_id gnl|my_center|LOCUS_09810 33048 33827 gene locus_tag LOCUS_09820 33048 33827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 33917 34552 gene locus_tag LOCUS_09830 33917 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 35624 34992 gene locus_tag LOCUS_09840 gene nadD 35624 34992 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_09840 36631 35621 gene locus_tag LOCUS_09850 gene holA 36631 35621 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037747.1 protein_id gnl|my_center|LOCUS_09850 37179 36631 gene locus_tag LOCUS_09860 37179 36631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 <39485 37185 gene locus_tag LOCUS_09870 <39485 37185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076057355.1:leucine--tRNA ligase >Feature sequence021 <1 1792 gene locus_tag LOCUS_09880 <1 1792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204977.1:exodeoxyribonuclease V subunit beta 1789 3678 gene locus_tag LOCUS_09890 gene recD 1789 3678 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_09890 4226 3765 gene locus_tag LOCUS_09900 gene pilE 4226 3765 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_09900 7648 4385 gene locus_tag LOCUS_09910 7648 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 8463 7810 gene locus_tag LOCUS_09920 8463 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 9448 8465 gene locus_tag LOCUS_09930 9448 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 10140 9544 gene locus_tag LOCUS_09940 10140 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10658 10137 gene locus_tag LOCUS_09950 10658 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 11190 11115 gene locus_tag LOCUS_t00150 11190 11115 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12201 11239 gene locus_tag LOCUS_09960 gene ispH 12201 11239 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_09960 12818 12318 gene locus_tag LOCUS_09970 gene lspA 12818 12318 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036354.1 protein_id gnl|my_center|LOCUS_09970 15817 12956 gene locus_tag LOCUS_09980 gene ileS 15817 12956 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036353.1 protein_id gnl|my_center|LOCUS_09980 16863 15910 gene locus_tag LOCUS_09990 16863 15910 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036352.1 protein_id gnl|my_center|LOCUS_09990 18516 16924 gene locus_tag LOCUS_10000 gene murJ 18516 16924 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036351.1 protein_id gnl|my_center|LOCUS_10000 18759 19022 gene locus_tag LOCUS_10010 gene rpsT 18759 19022 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002807888.1 protein_id gnl|my_center|LOCUS_10010 19488 19180 gene locus_tag LOCUS_10020 19488 19180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 21320 19485 gene locus_tag LOCUS_10030 21320 19485 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_10030 21562 21317 gene locus_tag LOCUS_10040 21562 21317 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037004.1 protein_id gnl|my_center|LOCUS_10040 21684 22478 gene locus_tag LOCUS_10050 21684 22478 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 protein_id gnl|my_center|LOCUS_10050 22547 24535 gene locus_tag LOCUS_10060 22547 24535 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_10060 24660 25562 gene locus_tag LOCUS_10070 24660 25562 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 protein_id gnl|my_center|LOCUS_10070 25592 26080 gene locus_tag LOCUS_10080 25592 26080 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_10080 26268 26858 gene locus_tag LOCUS_10090 26268 26858 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929042.1 protein_id gnl|my_center|LOCUS_10090 27554 26931 gene locus_tag LOCUS_10100 27554 26931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 27695 28462 gene locus_tag LOCUS_10110 27695 28462 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037001.1 protein_id gnl|my_center|LOCUS_10110 28572 29135 gene locus_tag LOCUS_10120 gene yeiP 28572 29135 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037000.1 protein_id gnl|my_center|LOCUS_10120 29318 31402 gene locus_tag LOCUS_10130 29318 31402 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036738.1 protein_id gnl|my_center|LOCUS_10130 31383 32498 gene locus_tag LOCUS_10140 31383 32498 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085528.1 protein_id gnl|my_center|LOCUS_10140 32508 33032 gene locus_tag LOCUS_10150 32508 33032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 33130 34422 gene locus_tag LOCUS_10160 gene kynU 33130 34422 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 protein_id gnl|my_center|LOCUS_10160 35459 34464 gene locus_tag LOCUS_10170 35459 34464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 36479 35679 gene locus_tag LOCUS_10180 36479 35679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 37849 36584 gene locus_tag LOCUS_10190 37849 36584 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037382.1 protein_id gnl|my_center|LOCUS_10190 <38959 37846 gene locus_tag LOCUS_10200 <38959 37846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042599274.1:glutamate 5-kinase >Feature sequence022 453 1463 gene locus_tag LOCUS_10210 gene ilvC 453 1463 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038422.1 protein_id gnl|my_center|LOCUS_10210 1543 3399 gene locus_tag LOCUS_10220 gene ilvB 1543 3399 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149674780.1 protein_id gnl|my_center|LOCUS_10220 3403 3732 gene locus_tag LOCUS_10230 3403 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 3729 5309 gene locus_tag LOCUS_10240 gene ilvA 3729 5309 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 protein_id gnl|my_center|LOCUS_10240 6404 5325 gene locus_tag LOCUS_10250 6404 5325 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_10250 6562 7587 gene locus_tag LOCUS_10260 gene ubiA 6562 7587 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401244.1 protein_id gnl|my_center|LOCUS_10260 8412 7690 gene locus_tag LOCUS_10270 8412 7690 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_10270 8625 8419 gene locus_tag LOCUS_10280 8625 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140805.1 protein_id gnl|my_center|LOCUS_10280 8774 9832 gene locus_tag LOCUS_10290 gene bioB 8774 9832 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_10290 9810 11003 gene locus_tag LOCUS_10300 gene bioF 9810 11003 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_10300 11046 11822 gene locus_tag LOCUS_10310 11046 11822 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185449.1 protein_id gnl|my_center|LOCUS_10310 11819 12604 gene locus_tag LOCUS_10320 gene bioH 11819 12604 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035639.1 protein_id gnl|my_center|LOCUS_10320 12614 13492 gene locus_tag LOCUS_10330 gene bioC 12614 13492 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_10330 13928 13647 gene locus_tag LOCUS_10340 13928 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 18302 15045 gene locus_tag LOCUS_10350 18302 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10350 19300 18473 gene locus_tag LOCUS_10360 19300 18473 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044954.1 protein_id gnl|my_center|LOCUS_10360 20199 19375 gene locus_tag LOCUS_10370 20199 19375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 21823 20528 gene locus_tag LOCUS_10380 21823 20528 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970031.1 protein_id gnl|my_center|LOCUS_10380 21947 22435 gene locus_tag LOCUS_10390 21947 22435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 22456 23187 gene locus_tag LOCUS_10400 22456 23187 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967077.1 protein_id gnl|my_center|LOCUS_10400 25434 23254 gene locus_tag LOCUS_10410 25434 23254 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275293.1 protein_id gnl|my_center|LOCUS_10410 25553 25750 gene locus_tag LOCUS_10420 25553 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 25948 29145 gene locus_tag LOCUS_10430 25948 29145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10430 30673 29372 gene locus_tag LOCUS_10440 30673 29372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 31671 30703 gene locus_tag LOCUS_10450 31671 30703 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_10450 31928 32446 gene locus_tag LOCUS_10460 31928 32446 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206292.1 protein_id gnl|my_center|LOCUS_10460 32452 33603 gene locus_tag LOCUS_10470 32452 33603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 33745 36408 gene locus_tag LOCUS_10480 33745 36408 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_10480 36508 38283 gene locus_tag LOCUS_10490 gene ggt 36508 38283 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976285.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence023 982 2553 gene locus_tag LOCUS_10500 982 2553 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543739.1 protein_id gnl|my_center|LOCUS_10500 3113 2646 gene locus_tag LOCUS_10510 3113 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5672 3279 gene locus_tag LOCUS_10520 gene bglX 5672 3279 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_10520 6406 5786 gene locus_tag LOCUS_10530 6406 5786 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812028.1 protein_id gnl|my_center|LOCUS_10530 7063 6524 gene locus_tag LOCUS_10540 7063 6524 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919545.1 protein_id gnl|my_center|LOCUS_10540 7236 9188 gene locus_tag LOCUS_10550 7236 9188 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438954.1 protein_id gnl|my_center|LOCUS_10550 10142 9300 gene locus_tag LOCUS_10560 10142 9300 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038631.1 protein_id gnl|my_center|LOCUS_10560 11432 10266 gene locus_tag LOCUS_10570 11432 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 12858 11776 gene locus_tag LOCUS_10580 12858 11776 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705632.1 protein_id gnl|my_center|LOCUS_10580 13039 13446 gene locus_tag LOCUS_10590 13039 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 14619 13486 gene locus_tag LOCUS_10600 14619 13486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 14761 15876 gene locus_tag LOCUS_10610 14761 15876 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036663.1 protein_id gnl|my_center|LOCUS_10610 16059 16265 gene locus_tag LOCUS_10620 16059 16265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 16775 16308 gene locus_tag LOCUS_10630 16775 16308 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 protein_id gnl|my_center|LOCUS_10630 20151 16831 gene locus_tag LOCUS_10640 20151 16831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 22571 20355 gene locus_tag LOCUS_10650 22571 20355 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_10650 22806 24398 gene locus_tag LOCUS_10660 22806 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 24460 24885 gene locus_tag LOCUS_10670 gene cadR 24460 24885 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812014.1 protein_id gnl|my_center|LOCUS_10670 24882 27221 gene locus_tag LOCUS_10680 24882 27221 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_10680 27328 28620 gene locus_tag LOCUS_10690 gene folC 27328 28620 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_10690 28735 29754 gene locus_tag LOCUS_10700 28735 29754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 29808 30473 gene locus_tag LOCUS_10710 29808 30473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 30653 32125 gene locus_tag LOCUS_10720 gene purF 30653 32125 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036167.1 protein_id gnl|my_center|LOCUS_10720 32229 33059 gene locus_tag LOCUS_10730 32229 33059 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_10730 34490 33087 gene locus_tag LOCUS_10740 34490 33087 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_10740 35290 34487 gene locus_tag LOCUS_10750 35290 34487 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_10750 36936 35404 gene locus_tag LOCUS_10760 36936 35404 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169161074.1 protein_id gnl|my_center|LOCUS_10760 37919 37023 gene locus_tag LOCUS_10770 37919 37023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 38527 37949 gene locus_tag LOCUS_10780 38527 37949 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096934.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence024 2305 1805 gene locus_tag LOCUS_10790 gene dtd 2305 1805 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_10790 2385 3278 gene locus_tag LOCUS_10800 2385 3278 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_10800 3612 3250 gene locus_tag LOCUS_10810 3612 3250 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120685.1 protein_id gnl|my_center|LOCUS_10810 5353 3626 gene locus_tag LOCUS_10820 5353 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 6439 5408 gene locus_tag LOCUS_10830 6439 5408 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_10830 7410 6592 gene locus_tag LOCUS_10840 7410 6592 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_10840 7617 8606 gene locus_tag LOCUS_10850 7617 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 8603 9550 gene locus_tag LOCUS_10860 8603 9550 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_10860 10415 9489 gene locus_tag LOCUS_10870 10415 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 11656 10427 gene locus_tag LOCUS_10880 11656 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 13537 11816 gene locus_tag LOCUS_10890 13537 11816 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038828.1 protein_id gnl|my_center|LOCUS_10890 14955 13642 gene locus_tag LOCUS_10900 gene rsmB 14955 13642 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704264.1 protein_id gnl|my_center|LOCUS_10900 15893 14952 gene locus_tag LOCUS_10910 gene fmt 15893 14952 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 protein_id gnl|my_center|LOCUS_10910 16399 15890 gene locus_tag LOCUS_10920 gene def 16399 15890 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_10920 16587 17714 gene locus_tag LOCUS_10930 16587 17714 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038832.1 protein_id gnl|my_center|LOCUS_10930 17805 18995 gene locus_tag LOCUS_10940 gene dprA 17805 18995 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038833.1 protein_id gnl|my_center|LOCUS_10940 19124 21652 gene locus_tag LOCUS_10950 19124 21652 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 protein_id gnl|my_center|LOCUS_10950 21653 22225 gene locus_tag LOCUS_10960 21653 22225 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 protein_id gnl|my_center|LOCUS_10960 22265 23647 gene locus_tag LOCUS_10970 gene xanA2 22265 23647 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_10970 23755 25005 gene locus_tag LOCUS_10980 gene purD 23755 25005 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035746.1 protein_id gnl|my_center|LOCUS_10980 25490 25278 gene locus_tag LOCUS_10990 25490 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 25372 26070 gene locus_tag LOCUS_11000 25372 26070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 28033 26180 gene locus_tag LOCUS_11010 28033 26180 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 protein_id gnl|my_center|LOCUS_11010 30468 28153 gene locus_tag LOCUS_11020 30468 28153 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037300.1 protein_id gnl|my_center|LOCUS_11020 31384 30593 gene locus_tag LOCUS_11030 31384 30593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 33376 31457 gene locus_tag LOCUS_11040 gene mnmG 33376 31457 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035631.1 protein_id gnl|my_center|LOCUS_11040 33936 34112 gene locus_tag LOCUS_11050 33936 34112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 36848 34197 gene locus_tag LOCUS_11060 gene pepN 36848 34197 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_11060 36914 37930 gene locus_tag LOCUS_11070 36914 37930 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973550.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence025 <1 1874 gene locus_tag LOCUS_11080 <1 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206818979.1:maltodextrin glucosidase 2098 3198 gene locus_tag LOCUS_11090 2098 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3920 3237 gene locus_tag LOCUS_11100 3920 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3899 4132 gene locus_tag LOCUS_11110 3899 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4117 5013 gene locus_tag LOCUS_11120 4117 5013 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_11120 8032 5042 gene locus_tag LOCUS_11130 8032 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 9724 8162 gene locus_tag LOCUS_11140 9724 8162 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_11140 9873 12290 gene locus_tag LOCUS_11150 9873 12290 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_11150 12530 14377 gene locus_tag LOCUS_11160 12530 14377 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531013.1 protein_id gnl|my_center|LOCUS_11160 16906 14402 gene locus_tag LOCUS_11170 16906 14402 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036948.1 protein_id gnl|my_center|LOCUS_11170 18098 17085 gene locus_tag LOCUS_11180 18098 17085 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920175.1 protein_id gnl|my_center|LOCUS_11180 18403 20592 gene locus_tag LOCUS_11190 18403 20592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037604.1 protein_id gnl|my_center|LOCUS_11190 20589 22055 gene locus_tag LOCUS_11200 20589 22055 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 protein_id gnl|my_center|LOCUS_11200 23139 22117 gene locus_tag LOCUS_11210 23139 22117 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508157.1 protein_id gnl|my_center|LOCUS_11210 24667 23291 gene locus_tag LOCUS_11220 24667 23291 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133829731.1 protein_id gnl|my_center|LOCUS_11220 26794 24968 gene locus_tag LOCUS_11230 gene recQ 26794 24968 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_11230 27930 26896 gene locus_tag LOCUS_11240 gene ltaE 27930 26896 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065118.1 protein_id gnl|my_center|LOCUS_11240 28237 28500 gene locus_tag LOCUS_11250 28237 28500 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389676.1 protein_id gnl|my_center|LOCUS_11250 28556 30082 gene locus_tag LOCUS_11260 28556 30082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 30408 32237 gene locus_tag LOCUS_11270 gene asnB 30408 32237 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_11270 32544 32257 gene locus_tag LOCUS_11280 32544 32257 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_11280 33751 32627 gene locus_tag LOCUS_11290 gene lptG 33751 32627 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035892.1 protein_id gnl|my_center|LOCUS_11290 34908 33748 gene locus_tag LOCUS_11300 gene lptF 34908 33748 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 protein_id gnl|my_center|LOCUS_11300 34954 36444 gene locus_tag LOCUS_11310 34954 36444 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035890.1 protein_id gnl|my_center|LOCUS_11310 36549 36971 gene locus_tag LOCUS_11320 36549 36971 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995970.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence026 1298 519 gene locus_tag LOCUS_11330 1298 519 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533161.1 protein_id gnl|my_center|LOCUS_11330 2806 1355 gene locus_tag LOCUS_11340 gene nirK 2806 1355 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528780.1 protein_id gnl|my_center|LOCUS_11340 3413 4561 gene locus_tag LOCUS_11350 3413 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 5315 4644 gene locus_tag LOCUS_11360 5315 4644 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266695.1 protein_id gnl|my_center|LOCUS_11360 5941 5312 gene locus_tag LOCUS_11370 5941 5312 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103394.1 protein_id gnl|my_center|LOCUS_11370 6090 7052 gene locus_tag LOCUS_11380 6090 7052 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_11380 7055 8344 gene locus_tag LOCUS_11390 7055 8344 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_11390 8341 9123 gene locus_tag LOCUS_11400 8341 9123 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_11400 9120 10412 gene locus_tag LOCUS_11410 9120 10412 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_11410 10409 10942 gene locus_tag LOCUS_11420 10409 10942 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942967.1 protein_id gnl|my_center|LOCUS_11420 10939 11736 gene locus_tag LOCUS_11430 10939 11736 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_11430 11733 12842 gene locus_tag LOCUS_11440 11733 12842 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_11440 12839 13417 gene locus_tag LOCUS_11450 12839 13417 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_11450 13533 14051 gene locus_tag LOCUS_11460 13533 14051 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_11460 15075 14335 gene locus_tag LOCUS_11470 15075 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_11470 15814 15173 gene locus_tag LOCUS_11480 15814 15173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 19157 15873 gene locus_tag LOCUS_11490 19157 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 19506 20897 gene locus_tag LOCUS_11500 19506 20897 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038973.1 protein_id gnl|my_center|LOCUS_11500 21274 22455 gene locus_tag LOCUS_11510 21274 22455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 22468 23169 gene locus_tag LOCUS_11520 22468 23169 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_11520 23351 24730 gene locus_tag LOCUS_11530 23351 24730 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 protein_id gnl|my_center|LOCUS_11530 25368 28241 gene locus_tag LOCUS_11540 25368 28241 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275339.1 protein_id gnl|my_center|LOCUS_11540 28347 30194 gene locus_tag LOCUS_11550 28347 30194 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_11550 30340 31662 gene locus_tag LOCUS_11560 30340 31662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 32554 31769 gene locus_tag LOCUS_11570 32554 31769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11570 32856 32590 gene locus_tag LOCUS_11580 32856 32590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11580 33388 32921 gene locus_tag LOCUS_11590 33388 32921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 33803 33594 gene locus_tag LOCUS_11600 33803 33594 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266187.1 protein_id gnl|my_center|LOCUS_11600 35737 33830 gene locus_tag LOCUS_11610 35737 33830 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266186.1 protein_id gnl|my_center|LOCUS_11610 37046 35715 gene locus_tag LOCUS_11620 37046 35715 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015415380.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence027 1938 1330 gene locus_tag LOCUS_11630 1938 1330 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_11630 4012 1988 gene locus_tag LOCUS_11640 4012 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4088 4813 gene locus_tag LOCUS_11650 4088 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5613 4888 gene locus_tag LOCUS_11660 gene recO 5613 4888 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036469.1 protein_id gnl|my_center|LOCUS_11660 6635 5703 gene locus_tag LOCUS_11670 gene era 6635 5703 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 protein_id gnl|my_center|LOCUS_11670 7409 6750 gene locus_tag LOCUS_11680 gene rnc 7409 6750 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036467.1 protein_id gnl|my_center|LOCUS_11680 7796 7413 gene locus_tag LOCUS_11690 7796 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 8857 7946 gene locus_tag LOCUS_11700 gene lepB 8857 7946 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036465.1 protein_id gnl|my_center|LOCUS_11700 10693 8900 gene locus_tag LOCUS_11710 gene lepA 10693 8900 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275537.1 protein_id gnl|my_center|LOCUS_11710 12361 10892 gene locus_tag LOCUS_11720 12361 10892 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036463.1 protein_id gnl|my_center|LOCUS_11720 13218 12535 gene locus_tag LOCUS_11730 13218 12535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 13838 13221 gene locus_tag LOCUS_11740 gene rpoE 13838 13221 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_11740 16570 13997 gene locus_tag LOCUS_11750 16570 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 17066 16584 gene locus_tag LOCUS_11760 17066 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 17368 19425 gene locus_tag LOCUS_11770 17368 19425 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036460.1 protein_id gnl|my_center|LOCUS_11770 20084 19497 gene locus_tag LOCUS_11780 20084 19497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 20360 20136 gene locus_tag LOCUS_11790 20360 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 21700 20357 gene locus_tag LOCUS_11800 21700 20357 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_11800 22610 21846 gene locus_tag LOCUS_11810 gene mip 22610 21846 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_11810 24557 22776 gene locus_tag LOCUS_11820 24557 22776 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099684.1 protein_id gnl|my_center|LOCUS_11820 24711 24786 gene locus_tag LOCUS_t00160 24711 24786 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 24797 24872 gene locus_tag LOCUS_t00170 24797 24872 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 24899 24975 gene locus_tag LOCUS_t00180 24899 24975 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 25498 25037 gene locus_tag LOCUS_11830 25498 25037 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 protein_id gnl|my_center|LOCUS_11830 26342 25527 gene locus_tag LOCUS_11840 26342 25527 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037311.1 protein_id gnl|my_center|LOCUS_11840 26467 28944 gene locus_tag LOCUS_11850 gene ppsA 26467 28944 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037312.1 protein_id gnl|my_center|LOCUS_11850 29241 30032 gene locus_tag LOCUS_11860 29241 30032 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192771.1 protein_id gnl|my_center|LOCUS_11860 30148 31542 gene locus_tag LOCUS_11870 30148 31542 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123403.1 protein_id gnl|my_center|LOCUS_11870 31918 34023 gene locus_tag LOCUS_11880 31918 34023 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113558.1 protein_id gnl|my_center|LOCUS_11880 34342 35592 gene locus_tag LOCUS_11890 34342 35592 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_11890 35669 36052 gene locus_tag LOCUS_11900 35669 36052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 36049 36231 gene locus_tag LOCUS_11910 36049 36231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence028 1507 881 gene locus_tag LOCUS_11920 1507 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2514 1507 gene locus_tag LOCUS_11930 gene fliG 2514 1507 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 protein_id gnl|my_center|LOCUS_11930 4222 2507 gene locus_tag LOCUS_11940 gene fliF 4222 2507 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_11940 4613 4278 gene locus_tag LOCUS_11950 gene fliE 4613 4278 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234824.1 protein_id gnl|my_center|LOCUS_11950 6161 4740 gene locus_tag LOCUS_11960 6161 4740 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037099.1 protein_id gnl|my_center|LOCUS_11960 7126 6572 gene locus_tag LOCUS_11970 7126 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7568 7263 gene locus_tag LOCUS_11980 7568 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 7996 7565 gene locus_tag LOCUS_11990 7996 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9311 8013 gene locus_tag LOCUS_12000 gene fliD 9311 8013 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530401.1 protein_id gnl|my_center|LOCUS_12000 9205 9651 gene locus_tag LOCUS_12010 9205 9651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11172 9676 gene locus_tag LOCUS_12020 gene fliC 11172 9676 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079690.1 protein_id gnl|my_center|LOCUS_12020 12639 11413 gene locus_tag LOCUS_12030 gene flgL 12639 11413 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706634.1 protein_id gnl|my_center|LOCUS_12030 14557 12677 gene locus_tag LOCUS_12040 gene flgK 14557 12677 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_12040 15541 14576 gene locus_tag LOCUS_12050 gene flgJ 15541 14576 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_12050 16821 15541 gene locus_tag LOCUS_12060 16821 15541 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037110.1 protein_id gnl|my_center|LOCUS_12060 17513 16821 gene locus_tag LOCUS_12070 gene flgH 17513 16821 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037111.1 protein_id gnl|my_center|LOCUS_12070 18301 17516 gene locus_tag LOCUS_12080 gene flgG 18301 17516 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197257.1 protein_id gnl|my_center|LOCUS_12080 19076 18336 gene locus_tag LOCUS_12090 19076 18336 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011192165.1 protein_id gnl|my_center|LOCUS_12090 20303 19086 gene locus_tag LOCUS_12100 gene flgE 20303 19086 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_12100 20997 20344 gene locus_tag LOCUS_12110 20997 20344 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037114.1 protein_id gnl|my_center|LOCUS_12110 21455 21015 gene locus_tag LOCUS_12120 gene flgC 21455 21015 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082150.1 protein_id gnl|my_center|LOCUS_12120 21871 21455 gene locus_tag LOCUS_12130 gene flgB 21871 21455 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097783.1 protein_id gnl|my_center|LOCUS_12130 22967 22014 gene locus_tag LOCUS_12140 22967 22014 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_12140 23164 24468 gene locus_tag LOCUS_12150 23164 24468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 24465 25199 gene locus_tag LOCUS_12160 24465 25199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 25324 25647 gene locus_tag LOCUS_12170 25324 25647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 25644 26090 gene locus_tag LOCUS_12180 25644 26090 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817170.1 protein_id gnl|my_center|LOCUS_12180 26190 27467 gene locus_tag LOCUS_12190 26190 27467 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_12190 28533 27499 gene locus_tag LOCUS_12200 28533 27499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 30347 28599 gene locus_tag LOCUS_12210 gene ggt 30347 28599 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_12210 30604 30344 gene locus_tag LOCUS_12220 30604 30344 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_12220 31213 30713 gene locus_tag LOCUS_12230 31213 30713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508077.1 protein_id gnl|my_center|LOCUS_12230 31745 31206 gene locus_tag LOCUS_12240 gene coaD 31745 31206 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037533.1 protein_id gnl|my_center|LOCUS_12240 32372 31791 gene locus_tag LOCUS_12250 gene rsmD 32372 31791 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037534.1 protein_id gnl|my_center|LOCUS_12250 32447 33571 gene locus_tag LOCUS_12260 32447 33571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12260 33595 34653 gene locus_tag LOCUS_12270 33595 34653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 34650 35702 gene locus_tag LOCUS_12280 gene mutY 34650 35702 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037560.1 protein_id gnl|my_center|LOCUS_12280 35752 36030 gene locus_tag LOCUS_12290 35752 36030 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence029 2509 506 gene locus_tag LOCUS_12300 2509 506 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536127.1 protein_id gnl|my_center|LOCUS_12300 2848 3105 gene locus_tag LOCUS_12310 2848 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6077 3315 gene locus_tag LOCUS_12320 6077 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 6127 6426 gene locus_tag LOCUS_12330 6127 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 7217 6450 gene locus_tag LOCUS_12340 7217 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 7960 7214 gene locus_tag LOCUS_12350 7960 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 8853 7960 gene locus_tag LOCUS_12360 8853 7960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_12360 9301 8894 gene locus_tag LOCUS_12370 9301 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 9579 9271 gene locus_tag LOCUS_12380 9579 9271 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921019.1 protein_id gnl|my_center|LOCUS_12380 11112 10018 gene locus_tag LOCUS_12390 11112 10018 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028948.1 protein_id gnl|my_center|LOCUS_12390 11363 11109 gene locus_tag LOCUS_12400 11363 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 11299 12360 gene locus_tag LOCUS_12410 11299 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 12417 13112 gene locus_tag LOCUS_12420 12417 13112 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036958.1 protein_id gnl|my_center|LOCUS_12420 14292 13198 gene locus_tag LOCUS_12430 14292 13198 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040656.1 protein_id gnl|my_center|LOCUS_12430 14814 14389 gene locus_tag LOCUS_12440 14814 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 16290 14875 gene locus_tag LOCUS_12450 16290 14875 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 protein_id gnl|my_center|LOCUS_12450 16582 17976 gene locus_tag LOCUS_12460 gene pssA 16582 17976 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275564.1 protein_id gnl|my_center|LOCUS_12460 18655 18047 gene locus_tag LOCUS_12470 18655 18047 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 protein_id gnl|my_center|LOCUS_12470 18866 18660 gene locus_tag LOCUS_12480 18866 18660 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_12480 18946 19851 gene locus_tag LOCUS_12490 gene ttcA 18946 19851 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039168.1 protein_id gnl|my_center|LOCUS_12490 19915 21093 gene locus_tag LOCUS_12500 19915 21093 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035355.1 protein_id gnl|my_center|LOCUS_12500 21224 22141 gene locus_tag LOCUS_12510 21224 22141 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039167.1 protein_id gnl|my_center|LOCUS_12510 22234 23040 gene locus_tag LOCUS_12520 22234 23040 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275488.1 protein_id gnl|my_center|LOCUS_12520 23801 23199 gene locus_tag LOCUS_12530 23801 23199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 24932 23943 gene locus_tag LOCUS_12540 24932 23943 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206062.1 protein_id gnl|my_center|LOCUS_12540 26813 24957 gene locus_tag LOCUS_12550 26813 24957 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_12550 27906 26953 gene locus_tag LOCUS_12560 gene pip 27906 26953 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_12560 29635 27932 gene locus_tag LOCUS_12570 29635 27932 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205295.1 protein_id gnl|my_center|LOCUS_12570 31214 29652 gene locus_tag LOCUS_12580 31214 29652 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_12580 32735 31227 gene locus_tag LOCUS_12590 32735 31227 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_12590 32947 33867 gene locus_tag LOCUS_12600 32947 33867 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_12600 33889 34587 gene locus_tag LOCUS_12610 33889 34587 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 protein_id gnl|my_center|LOCUS_12610 35262 34597 gene locus_tag LOCUS_12620 35262 34597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 <35934 35323 gene locus_tag LOCUS_12630 <35934 35323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014509029.1:bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE >Feature sequence030 37 372 gene locus_tag LOCUS_12640 gene rplV 37 372 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_12640 388 1140 gene locus_tag LOCUS_12650 gene rpsC 388 1140 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_12650 1152 1565 gene locus_tag LOCUS_12660 gene rplP 1152 1565 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036127.1 protein_id gnl|my_center|LOCUS_12660 1565 1750 gene locus_tag LOCUS_12670 gene rpmC 1565 1750 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771530.1 protein_id gnl|my_center|LOCUS_12670 1763 2038 gene locus_tag LOCUS_12680 gene rpsQ 1763 2038 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036129.1 protein_id gnl|my_center|LOCUS_12680 2053 2421 gene locus_tag LOCUS_12690 gene rplN 2053 2421 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486699.1 protein_id gnl|my_center|LOCUS_12690 2437 2751 gene locus_tag LOCUS_12700 gene rplX 2437 2751 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571669.1 protein_id gnl|my_center|LOCUS_12700 2763 3302 gene locus_tag LOCUS_12710 gene rplE 2763 3302 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371090.1 protein_id gnl|my_center|LOCUS_12710 3315 3620 gene locus_tag LOCUS_12720 gene rpsN 3315 3620 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005917137.1 protein_id gnl|my_center|LOCUS_12720 3843 4238 gene locus_tag LOCUS_12730 gene rpsH 3843 4238 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371096.1 protein_id gnl|my_center|LOCUS_12730 4250 4777 gene locus_tag LOCUS_12740 gene rplF 4250 4777 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036130.1 protein_id gnl|my_center|LOCUS_12740 4874 5227 gene locus_tag LOCUS_12750 gene rplR 4874 5227 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993383.1 protein_id gnl|my_center|LOCUS_12750 5338 5859 gene locus_tag LOCUS_12760 gene rpsE 5338 5859 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486682.1 protein_id gnl|my_center|LOCUS_12760 5852 6052 gene locus_tag LOCUS_12770 gene rpmD 5852 6052 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450646.1 protein_id gnl|my_center|LOCUS_12770 6058 6489 gene locus_tag LOCUS_12780 gene rplO 6058 6489 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439114.1 protein_id gnl|my_center|LOCUS_12780 6495 7817 gene locus_tag LOCUS_12790 gene secY 6495 7817 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036132.1 protein_id gnl|my_center|LOCUS_12790 7943 8299 gene locus_tag LOCUS_12800 gene rpsM 7943 8299 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036133.1 protein_id gnl|my_center|LOCUS_12800 8384 8770 gene locus_tag LOCUS_12810 gene rpsK 8384 8770 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486671.1 protein_id gnl|my_center|LOCUS_12810 8850 9476 gene locus_tag LOCUS_12820 gene rpsD 8850 9476 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811641.1 protein_id gnl|my_center|LOCUS_12820 9492 10490 gene locus_tag LOCUS_12830 gene rpoA 9492 10490 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811635.1 protein_id gnl|my_center|LOCUS_12830 10701 11084 gene locus_tag LOCUS_12840 gene rplQ 10701 11084 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 protein_id gnl|my_center|LOCUS_12840 11267 11779 gene locus_tag LOCUS_12850 11267 11779 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_12850 11766 13154 gene locus_tag LOCUS_12860 11766 13154 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_12860 13202 13975 gene locus_tag LOCUS_12870 13202 13975 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556719.1 protein_id gnl|my_center|LOCUS_12870 13972 15261 gene locus_tag LOCUS_12880 13972 15261 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266474.1 protein_id gnl|my_center|LOCUS_12880 15796 15284 gene locus_tag LOCUS_12890 15796 15284 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966411.1 protein_id gnl|my_center|LOCUS_12890 16499 15777 gene locus_tag LOCUS_12900 16499 15777 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_12900 17923 16496 gene locus_tag LOCUS_12910 17923 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 18602 17937 gene locus_tag LOCUS_12920 gene mprA 18602 17937 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_12920 18729 20207 gene locus_tag LOCUS_12930 gene rng 18729 20207 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 protein_id gnl|my_center|LOCUS_12930 20274 24164 gene locus_tag LOCUS_12940 20274 24164 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_12940 24283 25722 gene locus_tag LOCUS_12950 gene tldD 24283 25722 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_12950 25854 26225 gene locus_tag LOCUS_12960 25854 26225 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 protein_id gnl|my_center|LOCUS_12960 26212 27540 gene locus_tag LOCUS_12970 26212 27540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 28255 27668 gene locus_tag LOCUS_12980 28255 27668 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_12980 29611 28274 gene locus_tag LOCUS_12990 29611 28274 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_12990 31216 29675 gene locus_tag LOCUS_13000 31216 29675 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071496.1 protein_id gnl|my_center|LOCUS_13000 31560 31931 gene locus_tag LOCUS_13010 31560 31931 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036018.1 protein_id gnl|my_center|LOCUS_13010 32016 32636 gene locus_tag LOCUS_13020 32016 32636 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 protein_id gnl|my_center|LOCUS_13020 32636 33526 gene locus_tag LOCUS_13030 32636 33526 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275437.1 protein_id gnl|my_center|LOCUS_13030 33526 34029 gene locus_tag LOCUS_13040 33526 34029 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_13040 34139 35032 gene locus_tag LOCUS_13050 gene lgt 34139 35032 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036022.1 protein_id gnl|my_center|LOCUS_13050 35036 35830 gene locus_tag LOCUS_13060 35036 35830 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036023.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence031 301 1098 gene locus_tag LOCUS_13070 gene surE 301 1098 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 protein_id gnl|my_center|LOCUS_13070 1102 1797 gene locus_tag LOCUS_13080 1102 1797 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 protein_id gnl|my_center|LOCUS_13080 1797 2402 gene locus_tag LOCUS_13090 1797 2402 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036885.1 protein_id gnl|my_center|LOCUS_13090 2428 3390 gene locus_tag LOCUS_13100 2428 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3801 3427 gene locus_tag LOCUS_13110 3801 3427 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036887.1 protein_id gnl|my_center|LOCUS_13110 4107 3811 gene locus_tag LOCUS_13120 gene yhbY 4107 3811 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650404.1 protein_id gnl|my_center|LOCUS_13120 4201 4851 gene locus_tag LOCUS_13130 gene rlmE 4201 4851 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438562.1 protein_id gnl|my_center|LOCUS_13130 4848 6809 gene locus_tag LOCUS_13140 gene ftsH 4848 6809 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941435.1 protein_id gnl|my_center|LOCUS_13140 7023 7099 gene locus_tag LOCUS_t00190 7023 7099 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7282 7358 gene locus_tag LOCUS_t00200 7282 7358 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7382 7458 gene locus_tag LOCUS_t00210 7382 7458 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7474 7550 gene locus_tag LOCUS_t00220 7474 7550 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7571 7646 gene locus_tag LOCUS_t00230 7571 7646 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7915 7999 gene locus_tag LOCUS_t00240 7915 7999 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8088 9380 gene locus_tag LOCUS_13150 gene tig 8088 9380 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036183.1 protein_id gnl|my_center|LOCUS_13150 9461 10090 gene locus_tag LOCUS_13160 gene clpP 9461 10090 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193408.1 protein_id gnl|my_center|LOCUS_13160 10198 11490 gene locus_tag LOCUS_13170 gene clpX 10198 11490 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036185.1 protein_id gnl|my_center|LOCUS_13170 12520 11957 gene locus_tag LOCUS_13180 12520 11957 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_13180 13649 12489 gene locus_tag LOCUS_13190 13649 12489 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 protein_id gnl|my_center|LOCUS_13190 14517 13777 gene locus_tag LOCUS_13200 14517 13777 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207941.1 protein_id gnl|my_center|LOCUS_13200 14630 16042 gene locus_tag LOCUS_13210 gene gltX 14630 16042 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037816.1 protein_id gnl|my_center|LOCUS_13210 16064 16384 gene locus_tag LOCUS_13220 16064 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 16443 16862 gene locus_tag LOCUS_13230 16443 16862 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 protein_id gnl|my_center|LOCUS_13230 16967 17395 gene locus_tag LOCUS_13240 16967 17395 CDS product MerC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 protein_id gnl|my_center|LOCUS_13240 17453 18442 gene locus_tag LOCUS_13250 17453 18442 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_13250 18508 18669 gene locus_tag LOCUS_13260 18508 18669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 18880 19218 gene locus_tag LOCUS_13270 18880 19218 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036977.1 protein_id gnl|my_center|LOCUS_13270 19215 20111 gene locus_tag LOCUS_13280 gene hisG 19215 20111 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036978.1 protein_id gnl|my_center|LOCUS_13280 20172 21488 gene locus_tag LOCUS_13290 gene hisD 20172 21488 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036979.1 protein_id gnl|my_center|LOCUS_13290 21485 22558 gene locus_tag LOCUS_13300 gene hisC 21485 22558 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036980.1 protein_id gnl|my_center|LOCUS_13300 22555 23619 gene locus_tag LOCUS_13310 gene hisB 22555 23619 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204632952.1 protein_id gnl|my_center|LOCUS_13310 23619 24209 gene locus_tag LOCUS_13320 gene hisH 23619 24209 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036982.1 protein_id gnl|my_center|LOCUS_13320 24251 24934 gene locus_tag LOCUS_13330 gene hisA 24251 24934 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036983.1 protein_id gnl|my_center|LOCUS_13330 24928 25698 gene locus_tag LOCUS_13340 gene hisF 24928 25698 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036984.1 protein_id gnl|my_center|LOCUS_13340 25800 26447 gene locus_tag LOCUS_13350 gene hisIE 25800 26447 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036985.1 protein_id gnl|my_center|LOCUS_13350 27489 26458 gene locus_tag LOCUS_13360 27489 26458 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275470.1 protein_id gnl|my_center|LOCUS_13360 28341 27505 gene locus_tag LOCUS_13370 gene mtnC 28341 27505 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204632947.1 protein_id gnl|my_center|LOCUS_13370 28942 28388 gene locus_tag LOCUS_13380 28942 28388 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_13380 29589 28939 gene locus_tag LOCUS_13390 29589 28939 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036990.1 protein_id gnl|my_center|LOCUS_13390 29755 30087 gene locus_tag LOCUS_13400 29755 30087 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197194.1 protein_id gnl|my_center|LOCUS_13400 32010 30550 gene locus_tag LOCUS_13410 32010 30550 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036991.1 protein_id gnl|my_center|LOCUS_13410 33605 32079 gene locus_tag LOCUS_13420 33605 32079 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036992.1 protein_id gnl|my_center|LOCUS_13420 33774 34322 gene locus_tag LOCUS_13430 33774 34322 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_13430 34914 34393 gene locus_tag LOCUS_13440 34914 34393 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence032 1443 601 gene locus_tag LOCUS_13450 gene mscS 1443 601 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_13450 1833 1531 gene locus_tag LOCUS_13460 1833 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2510 1920 gene locus_tag LOCUS_13470 2510 1920 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_13470 2944 2507 gene locus_tag LOCUS_13480 2944 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3824 3066 gene locus_tag LOCUS_13490 3824 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 4799 3948 gene locus_tag LOCUS_13500 4799 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5365 4925 gene locus_tag LOCUS_13510 5365 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 6069 5611 gene locus_tag LOCUS_13520 6069 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037360.1 protein_id gnl|my_center|LOCUS_13520 6366 6782 gene locus_tag LOCUS_13530 6366 6782 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095222.1 protein_id gnl|my_center|LOCUS_13530 6920 7747 gene locus_tag LOCUS_13540 6920 7747 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189857.1 protein_id gnl|my_center|LOCUS_13540 8224 7760 gene locus_tag LOCUS_13550 8224 7760 CDS product DUF6491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275334.1 protein_id gnl|my_center|LOCUS_13550 9031 8294 gene locus_tag LOCUS_13560 9031 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 9171 10433 gene locus_tag LOCUS_13570 9171 10433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_13570 10520 10852 gene locus_tag LOCUS_13580 10520 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 13682 10923 gene locus_tag LOCUS_13590 gene aceE 13682 10923 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038709.1 protein_id gnl|my_center|LOCUS_13590 16047 13759 gene locus_tag LOCUS_13600 16047 13759 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038443.1 protein_id gnl|my_center|LOCUS_13600 17445 16156 gene locus_tag LOCUS_13610 17445 16156 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_13610 17356 17631 gene locus_tag LOCUS_13620 17356 17631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 18741 17668 gene locus_tag LOCUS_13630 gene rsgA 18741 17668 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038460.1 protein_id gnl|my_center|LOCUS_13630 18887 20134 gene locus_tag LOCUS_13640 18887 20134 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 protein_id gnl|my_center|LOCUS_13640 20152 20772 gene locus_tag LOCUS_13650 20152 20772 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_13650 20874 21731 gene locus_tag LOCUS_13660 20874 21731 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077545.1 protein_id gnl|my_center|LOCUS_13660 21806 22729 gene locus_tag LOCUS_13670 gene grxD 21806 22729 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038466.1 protein_id gnl|my_center|LOCUS_13670 24115 22793 gene locus_tag LOCUS_13680 24115 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 24318 25892 gene locus_tag LOCUS_13690 24318 25892 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_13690 25969 27612 gene locus_tag LOCUS_13700 25969 27612 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_13700 29517 27697 gene locus_tag LOCUS_13710 29517 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 <32497 29591 gene locus_tag LOCUS_13720 <32497 29591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275339.1:TonB-dependent receptor >Feature sequence033 341 598 gene locus_tag LOCUS_13730 341 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 595 801 gene locus_tag LOCUS_13740 595 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 798 1010 gene locus_tag LOCUS_13750 798 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1007 1642 gene locus_tag LOCUS_13760 1007 1642 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113183.1 protein_id gnl|my_center|LOCUS_13760 1639 2067 gene locus_tag LOCUS_13770 1639 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2067 4064 gene locus_tag LOCUS_13780 2067 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4413 5117 gene locus_tag LOCUS_13790 4413 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 5133 5279 gene locus_tag LOCUS_13800 5133 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 5282 5863 gene locus_tag LOCUS_13810 5282 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5835 6590 gene locus_tag LOCUS_13820 5835 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6581 7306 gene locus_tag LOCUS_13830 6581 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 7473 7384 gene locus_tag LOCUS_t00250 7473 7384 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7585 8286 gene locus_tag LOCUS_13840 7585 8286 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_13840 9016 8306 gene locus_tag LOCUS_13850 gene dnaQ 9016 8306 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036193.1 protein_id gnl|my_center|LOCUS_13850 9459 9013 gene locus_tag LOCUS_13860 gene rnhA 9459 9013 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 protein_id gnl|my_center|LOCUS_13860 10167 9484 gene locus_tag LOCUS_13870 10167 9484 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404449.1 protein_id gnl|my_center|LOCUS_13870 10410 11174 gene locus_tag LOCUS_13880 gene gloB 10410 11174 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526568.1 protein_id gnl|my_center|LOCUS_13880 11171 12358 gene locus_tag LOCUS_13890 gene mltD 11171 12358 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228041.1 protein_id gnl|my_center|LOCUS_13890 14386 12548 gene locus_tag LOCUS_13900 14386 12548 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036187.1 protein_id gnl|my_center|LOCUS_13900 14690 14614 gene locus_tag LOCUS_t00260 14690 14614 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 14773 14699 gene locus_tag LOCUS_t00270 14773 14699 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15065 14793 gene locus_tag LOCUS_13910 15065 14793 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 protein_id gnl|my_center|LOCUS_13910 17886 15397 gene locus_tag LOCUS_13920 gene lon 17886 15397 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036186.1 protein_id gnl|my_center|LOCUS_13920 19087 18218 gene locus_tag LOCUS_13930 gene accD 19087 18218 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037670.1 protein_id gnl|my_center|LOCUS_13930 19935 19135 gene locus_tag LOCUS_13940 gene trpA 19935 19135 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037671.1 protein_id gnl|my_center|LOCUS_13940 20546 19932 gene locus_tag LOCUS_13950 20546 19932 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_13950 21754 20543 gene locus_tag LOCUS_13960 gene trpB 21754 20543 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037673.1 protein_id gnl|my_center|LOCUS_13960 21882 22781 gene locus_tag LOCUS_13970 gene trpI 21882 22781 CDS product trpBA operon transcriptional activator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114633.1 protein_id gnl|my_center|LOCUS_13970 23829 22795 gene locus_tag LOCUS_13980 23829 22795 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039037.1 protein_id gnl|my_center|LOCUS_13980 24461 23826 gene locus_tag LOCUS_13990 24461 23826 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_13990 25240 24458 gene locus_tag LOCUS_14000 gene truA 25240 24458 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037676.1 protein_id gnl|my_center|LOCUS_14000 27751 25400 gene locus_tag LOCUS_14010 27751 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 28231 27965 gene locus_tag LOCUS_14020 28231 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 29310 28279 gene locus_tag LOCUS_14030 29310 28279 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037679.1 protein_id gnl|my_center|LOCUS_14030 30345 29350 gene locus_tag LOCUS_14040 30345 29350 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037680.1 protein_id gnl|my_center|LOCUS_14040 31461 30373 gene locus_tag LOCUS_14050 gene aroC 31461 30373 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037681.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence034 <1 917 gene locus_tag LOCUS_14060 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879818.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 1207 2121 gene locus_tag LOCUS_14070 gene cysD 1207 2121 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038279.1 protein_id gnl|my_center|LOCUS_14070 2121 4016 gene locus_tag LOCUS_14080 gene cysN 2121 4016 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994000.1 protein_id gnl|my_center|LOCUS_14080 4094 5194 gene locus_tag LOCUS_14090 gene gcvT 4094 5194 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038002.1 protein_id gnl|my_center|LOCUS_14090 5279 5674 gene locus_tag LOCUS_14100 gene gcvH 5279 5674 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038001.1 protein_id gnl|my_center|LOCUS_14100 6421 6762 gene locus_tag LOCUS_14110 6421 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 7139 8179 gene locus_tag LOCUS_14120 7139 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 9546 8224 gene locus_tag LOCUS_14130 9546 8224 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994167.1 protein_id gnl|my_center|LOCUS_14130 9545 10189 gene locus_tag LOCUS_14140 9545 10189 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_14140 10243 12138 gene locus_tag LOCUS_14150 10243 12138 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_14150 13764 12187 gene locus_tag LOCUS_14160 13764 12187 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_14160 13898 15160 gene locus_tag LOCUS_14170 13898 15160 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_14170 15622 15194 gene locus_tag LOCUS_14180 15622 15194 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_14180 16462 15719 gene locus_tag LOCUS_14190 gene mtgA 16462 15719 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 protein_id gnl|my_center|LOCUS_14190 16560 17459 gene locus_tag LOCUS_14200 16560 17459 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037990.1 protein_id gnl|my_center|LOCUS_14200 20336 17490 gene locus_tag LOCUS_14210 20336 17490 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052103386.1 protein_id gnl|my_center|LOCUS_14210 20660 21568 gene locus_tag LOCUS_14220 20660 21568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037991.1 protein_id gnl|my_center|LOCUS_14220 22562 21660 gene locus_tag LOCUS_14230 22562 21660 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073605.1 protein_id gnl|my_center|LOCUS_14230 23025 22579 gene locus_tag LOCUS_14240 23025 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 23567 23022 gene locus_tag LOCUS_14250 23567 23022 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_14250 25489 23708 gene locus_tag LOCUS_14260 25489 23708 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_14260 26246 25623 gene locus_tag LOCUS_14270 26246 25623 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 protein_id gnl|my_center|LOCUS_14270 26322 27230 gene locus_tag LOCUS_14280 26322 27230 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275307.1 protein_id gnl|my_center|LOCUS_14280 27240 29717 gene locus_tag LOCUS_14290 27240 29717 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 protein_id gnl|my_center|LOCUS_14290 29714 30190 gene locus_tag LOCUS_14300 29714 30190 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_14300 31096 30197 gene locus_tag LOCUS_14310 31096 30197 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053621.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence035 589 1911 gene locus_tag LOCUS_14320 589 1911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_14320 1963 3219 gene locus_tag LOCUS_14330 1963 3219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_14330 3336 4637 gene locus_tag LOCUS_14340 3336 4637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_14340 4649 5866 gene locus_tag LOCUS_14350 4649 5866 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_14350 5923 7083 gene locus_tag LOCUS_14360 5923 7083 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898981.1 protein_id gnl|my_center|LOCUS_14360 7143 8471 gene locus_tag LOCUS_14370 7143 8471 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_14370 8535 9767 gene locus_tag LOCUS_14380 8535 9767 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 protein_id gnl|my_center|LOCUS_14380 9951 11294 gene locus_tag LOCUS_14390 9951 11294 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035809.1 protein_id gnl|my_center|LOCUS_14390 11511 12908 gene locus_tag LOCUS_14400 11511 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 13024 13965 gene locus_tag LOCUS_14410 13024 13965 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_14410 13981 14427 gene locus_tag LOCUS_14420 13981 14427 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038003.1 protein_id gnl|my_center|LOCUS_14420 14424 15701 gene locus_tag LOCUS_14430 14424 15701 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_14430 16147 15824 gene locus_tag LOCUS_14440 16147 15824 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 protein_id gnl|my_center|LOCUS_14440 18149 16416 gene locus_tag LOCUS_14450 18149 16416 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035881.1 protein_id gnl|my_center|LOCUS_14450 18642 18223 gene locus_tag LOCUS_14460 18642 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 18754 19536 gene locus_tag LOCUS_14470 gene pssA 18754 19536 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035883.1 protein_id gnl|my_center|LOCUS_14470 19533 20024 gene locus_tag LOCUS_14480 19533 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 20029 20502 gene locus_tag LOCUS_14490 gene rimI 20029 20502 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_14490 20836 20552 gene locus_tag LOCUS_14500 20836 20552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 20846 21538 gene locus_tag LOCUS_14510 gene tsaB 20846 21538 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 protein_id gnl|my_center|LOCUS_14510 21651 21968 gene locus_tag LOCUS_14520 21651 21968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 23054 22014 gene locus_tag LOCUS_14530 23054 22014 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356366.1 protein_id gnl|my_center|LOCUS_14530 23144 24019 gene locus_tag LOCUS_14540 gene gigC 23144 24019 CDS product LysR family transcriptional regulator GigC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120024.1 protein_id gnl|my_center|LOCUS_14540 24355 24140 gene locus_tag LOCUS_14550 24355 24140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 26246 24501 gene locus_tag LOCUS_14560 gene ptsP 26246 24501 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037935.1 protein_id gnl|my_center|LOCUS_14560 26640 26371 gene locus_tag LOCUS_14570 26640 26371 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 protein_id gnl|my_center|LOCUS_14570 27041 26649 gene locus_tag LOCUS_14580 27041 26649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_14580 27993 27085 gene locus_tag LOCUS_14590 gene rapZ 27993 27085 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508477.1 protein_id gnl|my_center|LOCUS_14590 28948 27998 gene locus_tag LOCUS_14600 gene hprK 28948 27998 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_14600 29410 29087 gene locus_tag LOCUS_14610 gene hpf 29410 29087 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_14610 31025 29556 gene locus_tag LOCUS_14620 31025 29556 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence036 1798 2976 gene locus_tag LOCUS_14630 1798 2976 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_14630 3105 3524 gene locus_tag LOCUS_14640 3105 3524 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_14640 3610 4950 gene locus_tag LOCUS_14650 3610 4950 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_14650 5097 5678 gene locus_tag LOCUS_14660 5097 5678 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_14660 5747 6346 gene locus_tag LOCUS_14670 5747 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 7292 6357 gene locus_tag LOCUS_14680 gene xerD 7292 6357 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035895.1 protein_id gnl|my_center|LOCUS_14680 7319 7828 gene locus_tag LOCUS_14690 7319 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 8008 9261 gene locus_tag LOCUS_14700 gene phaZ 8008 9261 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185678.1 protein_id gnl|my_center|LOCUS_14700 9649 9299 gene locus_tag LOCUS_14710 9649 9299 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037708.1 protein_id gnl|my_center|LOCUS_14710 9729 10133 gene locus_tag LOCUS_14720 9729 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 10254 11579 gene locus_tag LOCUS_14730 10254 11579 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036866.1 protein_id gnl|my_center|LOCUS_14730 12417 11650 gene locus_tag LOCUS_14740 12417 11650 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037420.1 protein_id gnl|my_center|LOCUS_14740 12595 13344 gene locus_tag LOCUS_14750 12595 13344 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 protein_id gnl|my_center|LOCUS_14750 14169 13462 gene locus_tag LOCUS_14760 gene hda 14169 13462 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037913.1 protein_id gnl|my_center|LOCUS_14760 15293 14166 gene locus_tag LOCUS_14770 15293 14166 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_14770 16297 15296 gene locus_tag LOCUS_14780 16297 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 16426 17490 gene locus_tag LOCUS_14790 gene purM 16426 17490 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628894.1 protein_id gnl|my_center|LOCUS_14790 17513 18187 gene locus_tag LOCUS_14800 gene purN 17513 18187 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037918.1 protein_id gnl|my_center|LOCUS_14800 18223 18933 gene locus_tag LOCUS_14810 18223 18933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 20344 19085 gene locus_tag LOCUS_14820 gene murA 20344 19085 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037922.1 protein_id gnl|my_center|LOCUS_14820 20627 20388 gene locus_tag LOCUS_14830 20627 20388 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_14830 20833 21843 gene locus_tag LOCUS_14840 20833 21843 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_14840 21921 22472 gene locus_tag LOCUS_14850 21921 22472 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037925.1 protein_id gnl|my_center|LOCUS_14850 22469 23149 gene locus_tag LOCUS_14860 22469 23149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 23163 23627 gene locus_tag LOCUS_14870 23163 23627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 23632 24351 gene locus_tag LOCUS_14880 gene lptB 23632 24351 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037928.1 protein_id gnl|my_center|LOCUS_14880 24439 25914 gene locus_tag LOCUS_14890 24439 25914 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_14890 26045 26368 gene locus_tag LOCUS_14900 gene hpf 26045 26368 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 protein_id gnl|my_center|LOCUS_14900 26494 27444 gene locus_tag LOCUS_14910 gene hprK 26494 27444 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_14910 27449 28336 gene locus_tag LOCUS_14920 gene rapZ 27449 28336 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508477.1 protein_id gnl|my_center|LOCUS_14920 28342 28734 gene locus_tag LOCUS_14930 28342 28734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_14930 28727 28996 gene locus_tag LOCUS_14940 28727 28996 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence037 234 584 gene locus_tag LOCUS_14950 234 584 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036517.1 protein_id gnl|my_center|LOCUS_14950 2733 634 gene locus_tag LOCUS_14960 2733 634 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070840.1 protein_id gnl|my_center|LOCUS_14960 3874 2774 gene locus_tag LOCUS_14970 gene aroB 3874 2774 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037967.1 protein_id gnl|my_center|LOCUS_14970 4437 3871 gene locus_tag LOCUS_14980 4437 3871 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037966.1 protein_id gnl|my_center|LOCUS_14980 4470 5318 gene locus_tag LOCUS_14990 4470 5318 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040207.1 protein_id gnl|my_center|LOCUS_14990 5375 5719 gene locus_tag LOCUS_15000 5375 5719 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_15000 6628 5798 gene locus_tag LOCUS_15010 6628 5798 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_15010 6823 7410 gene locus_tag LOCUS_15020 gene pdxH 6823 7410 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037965.1 protein_id gnl|my_center|LOCUS_15020 7454 8254 gene locus_tag LOCUS_15030 7454 8254 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_15030 8856 8281 gene locus_tag LOCUS_15040 8856 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 9677 8853 gene locus_tag LOCUS_15050 gene proC 9677 8853 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_15050 10057 11094 gene locus_tag LOCUS_15060 10057 11094 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_15060 11175 12344 gene locus_tag LOCUS_15070 11175 12344 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 protein_id gnl|my_center|LOCUS_15070 14230 12437 gene locus_tag LOCUS_15080 14230 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 15258 14332 gene locus_tag LOCUS_15090 15258 14332 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037876.1 protein_id gnl|my_center|LOCUS_15090 15739 15290 gene locus_tag LOCUS_15100 gene ruvX 15739 15290 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037877.1 protein_id gnl|my_center|LOCUS_15100 16305 15736 gene locus_tag LOCUS_15110 16305 15736 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_15110 17212 16343 gene locus_tag LOCUS_15120 17212 16343 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_15120 18186 17209 gene locus_tag LOCUS_15130 gene gshB 18186 17209 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038049.1 protein_id gnl|my_center|LOCUS_15130 18588 18953 gene locus_tag LOCUS_15140 gene pilG 18588 18953 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_15140 18981 19352 gene locus_tag LOCUS_15150 gene pilH 18981 19352 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_15150 19349 19888 gene locus_tag LOCUS_15160 19349 19888 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508568.1 protein_id gnl|my_center|LOCUS_15160 20034 22064 gene locus_tag LOCUS_15170 gene pilJ 20034 22064 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_15170 22181 28141 gene locus_tag LOCUS_15180 22181 28141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 28134 29837 gene locus_tag LOCUS_15190 28134 29837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence038 1872 943 gene locus_tag LOCUS_15200 1872 943 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036731.1 protein_id gnl|my_center|LOCUS_15200 2168 1869 gene locus_tag LOCUS_15210 2168 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3009 2248 gene locus_tag LOCUS_15220 3009 2248 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036730.1 protein_id gnl|my_center|LOCUS_15220 8111 3183 gene locus_tag LOCUS_15230 8111 3183 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037508.1 protein_id gnl|my_center|LOCUS_15230 8727 9908 gene locus_tag LOCUS_15240 8727 9908 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037510.1 protein_id gnl|my_center|LOCUS_15240 9922 13101 gene locus_tag LOCUS_15250 9922 13101 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037511.1 protein_id gnl|my_center|LOCUS_15250 14443 13196 gene locus_tag LOCUS_15260 14443 13196 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_15260 14611 15540 gene locus_tag LOCUS_15270 14611 15540 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_15270 15583 16668 gene locus_tag LOCUS_15280 15583 16668 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036698.1 protein_id gnl|my_center|LOCUS_15280 16670 19360 gene locus_tag LOCUS_15290 gene metH 16670 19360 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194931144.1 protein_id gnl|my_center|LOCUS_15290 19715 19374 gene locus_tag LOCUS_15300 19715 19374 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389676.1 protein_id gnl|my_center|LOCUS_15300 19835 19909 gene locus_tag LOCUS_t00280 19835 19909 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23942 20187 gene locus_tag LOCUS_15310 23942 20187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 24396 27857 gene locus_tag LOCUS_15320 gene recC 24396 27857 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703323.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence039 183 1106 gene locus_tag LOCUS_15330 183 1106 CDS product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 protein_id gnl|my_center|LOCUS_15330 2566 1196 gene locus_tag LOCUS_15340 gene glmU 2566 1196 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035805.1 protein_id gnl|my_center|LOCUS_15340 3087 3626 gene locus_tag LOCUS_15350 3087 3626 CDS product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 protein_id gnl|my_center|LOCUS_15350 4097 3672 gene locus_tag LOCUS_15360 4097 3672 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035802.1 protein_id gnl|my_center|LOCUS_15360 5610 4198 gene locus_tag LOCUS_15370 gene atpD 5610 4198 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035801.1 protein_id gnl|my_center|LOCUS_15370 6659 5742 gene locus_tag LOCUS_15380 gene atpG 6659 5742 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035800.1 protein_id gnl|my_center|LOCUS_15380 8329 6779 gene locus_tag LOCUS_15390 gene atpA 8329 6779 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035799.1 protein_id gnl|my_center|LOCUS_15390 8993 8460 gene locus_tag LOCUS_15400 8993 8460 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035798.1 protein_id gnl|my_center|LOCUS_15400 9467 8997 gene locus_tag LOCUS_15410 9467 8997 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035797.1 protein_id gnl|my_center|LOCUS_15410 9839 9561 gene locus_tag LOCUS_15420 gene atpE 9839 9561 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195828.1 protein_id gnl|my_center|LOCUS_15420 10722 9907 gene locus_tag LOCUS_15430 gene atpB 10722 9907 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443864.1 protein_id gnl|my_center|LOCUS_15430 11091 10726 gene locus_tag LOCUS_15440 11091 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 11748 11359 gene locus_tag LOCUS_15450 11748 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 12264 11902 gene locus_tag LOCUS_15460 gene queD 12264 11902 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_15460 12591 13211 gene locus_tag LOCUS_15470 12591 13211 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463347.1 protein_id gnl|my_center|LOCUS_15470 13236 13598 gene locus_tag LOCUS_15480 13236 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 14795 13806 gene locus_tag LOCUS_15490 14795 13806 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_15490 15208 15132 gene locus_tag LOCUS_t00290 15208 15132 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15362 15922 gene locus_tag LOCUS_15500 15362 15922 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035729.1 protein_id gnl|my_center|LOCUS_15500 16305 17027 gene locus_tag LOCUS_15510 16305 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 17014 17448 gene locus_tag LOCUS_15520 17014 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 17494 17862 gene locus_tag LOCUS_15530 gene erpA 17494 17862 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035737.1 protein_id gnl|my_center|LOCUS_15530 17872 18840 gene locus_tag LOCUS_15540 gene nudC 17872 18840 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_15540 18916 19785 gene locus_tag LOCUS_15550 18916 19785 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 protein_id gnl|my_center|LOCUS_15550 21673 19799 gene locus_tag LOCUS_15560 21673 19799 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035742.1 protein_id gnl|my_center|LOCUS_15560 22016 22588 gene locus_tag LOCUS_15570 22016 22588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 24812 22665 gene locus_tag LOCUS_15580 gene glyS 24812 22665 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039155.1 protein_id gnl|my_center|LOCUS_15580 25732 24809 gene locus_tag LOCUS_15590 gene glyQ 25732 24809 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039156.1 protein_id gnl|my_center|LOCUS_15590 25830 27668 gene locus_tag LOCUS_15600 25830 27668 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039157.1 protein_id gnl|my_center|LOCUS_15600 27684 28412 gene locus_tag LOCUS_15610 27684 28412 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_15610 29054 28422 gene locus_tag LOCUS_15620 29054 28422 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035276.1 protein_id gnl|my_center|LOCUS_15620 29197 29391 gene locus_tag LOCUS_15630 29197 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 29511 29406 gene locus_tag LOCUS_r00010 29511 29406 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence040 901 413 gene locus_tag LOCUS_15640 901 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1036 1734 gene locus_tag LOCUS_15650 1036 1734 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091491.1 protein_id gnl|my_center|LOCUS_15650 1731 3083 gene locus_tag LOCUS_15660 1731 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 3920 3546 gene locus_tag LOCUS_15670 3920 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4740 3964 gene locus_tag LOCUS_15680 4740 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 5813 5559 gene locus_tag LOCUS_15690 5813 5559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 5947 6288 gene locus_tag LOCUS_15700 5947 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 6941 6348 gene locus_tag LOCUS_15710 6941 6348 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324738.1 protein_id gnl|my_center|LOCUS_15710 7029 7829 gene locus_tag LOCUS_15720 gene dapB 7029 7829 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257160.1 protein_id gnl|my_center|LOCUS_15720 8313 7840 gene locus_tag LOCUS_15730 8313 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 8807 8310 gene locus_tag LOCUS_15740 8807 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 8694 8984 gene locus_tag LOCUS_15750 8694 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 8996 9322 gene locus_tag LOCUS_15760 8996 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 9425 10381 gene locus_tag LOCUS_15770 9425 10381 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_15770 10378 11694 gene locus_tag LOCUS_15780 10378 11694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_15780 12833 11772 gene locus_tag LOCUS_15790 gene dinB 12833 11772 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035828.1 protein_id gnl|my_center|LOCUS_15790 14201 12954 gene locus_tag LOCUS_15800 14201 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 14378 15709 gene locus_tag LOCUS_15810 14378 15709 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_15810 15768 17900 gene locus_tag LOCUS_15820 15768 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_15820 19021 18104 gene locus_tag LOCUS_15830 19021 18104 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038319.1 protein_id gnl|my_center|LOCUS_15830 19159 19926 gene locus_tag LOCUS_15840 19159 19926 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_15840 20107 21666 gene locus_tag LOCUS_15850 20107 21666 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_15850 21795 22424 gene locus_tag LOCUS_15860 gene lexA 21795 22424 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267741.1 protein_id gnl|my_center|LOCUS_15860 22424 23050 gene locus_tag LOCUS_15870 gene imuA 22424 23050 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024663571.1 protein_id gnl|my_center|LOCUS_15870 23063 24463 gene locus_tag LOCUS_15880 23063 24463 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036300.1 protein_id gnl|my_center|LOCUS_15880 24460 27537 gene locus_tag LOCUS_15890 gene dnaE2 24460 27537 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 protein_id gnl|my_center|LOCUS_15890 27599 28015 gene locus_tag LOCUS_15900 27599 28015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 28451 28044 gene locus_tag LOCUS_15910 28451 28044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 28918 28448 gene locus_tag LOCUS_15920 28918 28448 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035701.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence041 86 1135 gene locus_tag LOCUS_15930 gene ruvB 86 1135 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_15930 1128 1541 gene locus_tag LOCUS_15940 gene ybgC 1128 1541 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 protein_id gnl|my_center|LOCUS_15940 1576 2262 gene locus_tag LOCUS_15950 gene tolQ 1576 2262 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038137.1 protein_id gnl|my_center|LOCUS_15950 2277 2729 gene locus_tag LOCUS_15960 gene tolR 2277 2729 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038136.1 protein_id gnl|my_center|LOCUS_15960 2716 3660 gene locus_tag LOCUS_15970 2716 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3657 4982 gene locus_tag LOCUS_15980 gene tolB 3657 4982 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_15980 5233 5745 gene locus_tag LOCUS_15990 gene pal 5233 5745 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_15990 5745 6593 gene locus_tag LOCUS_16000 gene ybgF 5745 6593 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_16000 6604 7296 gene locus_tag LOCUS_16010 gene queE 6604 7296 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_16010 7446 8132 gene locus_tag LOCUS_16020 gene queC 7446 8132 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038130.1 protein_id gnl|my_center|LOCUS_16020 8195 8270 gene locus_tag LOCUS_t00300 8195 8270 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9055 8339 gene locus_tag LOCUS_16030 9055 8339 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968582.1 protein_id gnl|my_center|LOCUS_16030 9612 9052 gene locus_tag LOCUS_16040 9612 9052 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036053.1 protein_id gnl|my_center|LOCUS_16040 11324 9639 gene locus_tag LOCUS_16050 11324 9639 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036057.1 protein_id gnl|my_center|LOCUS_16050 11521 11799 gene locus_tag LOCUS_16060 11521 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 11820 12338 gene locus_tag LOCUS_16070 11820 12338 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037427.1 protein_id gnl|my_center|LOCUS_16070 12433 13203 gene locus_tag LOCUS_16080 12433 13203 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_16080 13295 17188 gene locus_tag LOCUS_16090 gene purL 13295 17188 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035897.1 protein_id gnl|my_center|LOCUS_16090 17218 17967 gene locus_tag LOCUS_16100 17218 17967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 18095 18946 gene locus_tag LOCUS_16110 18095 18946 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035916.1 protein_id gnl|my_center|LOCUS_16110 19036 19938 gene locus_tag LOCUS_16120 19036 19938 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868565.1 protein_id gnl|my_center|LOCUS_16120 20496 19996 gene locus_tag LOCUS_16130 20496 19996 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926869.1 protein_id gnl|my_center|LOCUS_16130 20801 20595 gene locus_tag LOCUS_16140 20801 20595 CDS product CstA-like transporter-associated (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037849.1 protein_id gnl|my_center|LOCUS_16140 22885 20813 gene locus_tag LOCUS_16150 22885 20813 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770185.1 protein_id gnl|my_center|LOCUS_16150 23050 23847 gene locus_tag LOCUS_16160 23050 23847 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_16160 24042 24578 gene locus_tag LOCUS_16170 gene def 24042 24578 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268642.1 protein_id gnl|my_center|LOCUS_16170 24742 24999 gene locus_tag LOCUS_16180 24742 24999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 25065 25361 gene locus_tag LOCUS_16190 25065 25361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 25441 25944 gene locus_tag LOCUS_16200 25441 25944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 26770 25928 gene locus_tag LOCUS_16210 gene pyrF 26770 25928 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_16210 <28229 26875 gene locus_tag LOCUS_16220 <28229 26875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035928.1:energy-dependent translational throttle protein EttA >Feature sequence042 115 2163 gene locus_tag LOCUS_16230 115 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2270 3709 gene locus_tag LOCUS_16240 2270 3709 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035289.1 protein_id gnl|my_center|LOCUS_16240 3778 5019 gene locus_tag LOCUS_16250 3778 5019 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929184.1 protein_id gnl|my_center|LOCUS_16250 5795 5025 gene locus_tag LOCUS_16260 5795 5025 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115017.1 protein_id gnl|my_center|LOCUS_16260 5877 6683 gene locus_tag LOCUS_16270 5877 6683 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522540.1 protein_id gnl|my_center|LOCUS_16270 6793 7698 gene locus_tag LOCUS_16280 6793 7698 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812450.1 protein_id gnl|my_center|LOCUS_16280 7689 8462 gene locus_tag LOCUS_16290 7689 8462 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035954.1 protein_id gnl|my_center|LOCUS_16290 8563 10254 gene locus_tag LOCUS_16300 gene ligB 8563 10254 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269232.1 protein_id gnl|my_center|LOCUS_16300 10719 10318 gene locus_tag LOCUS_16310 10719 10318 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810229.1 protein_id gnl|my_center|LOCUS_16310 11360 10764 gene locus_tag LOCUS_16320 11360 10764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_16320 11565 11368 gene locus_tag LOCUS_16330 11565 11368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12232 11654 gene locus_tag LOCUS_16340 12232 11654 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198721.1 protein_id gnl|my_center|LOCUS_16340 12842 12285 gene locus_tag LOCUS_16350 12842 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 14944 12839 gene locus_tag LOCUS_16360 gene dinG 14944 12839 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014159192.1 protein_id gnl|my_center|LOCUS_16360 15412 18324 gene locus_tag LOCUS_16370 15412 18324 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052103386.1 protein_id gnl|my_center|LOCUS_16370 18999 18343 gene locus_tag LOCUS_16380 18999 18343 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268731.1 protein_id gnl|my_center|LOCUS_16380 18974 19174 gene locus_tag LOCUS_16390 18974 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 19253 20716 gene locus_tag LOCUS_16400 19253 20716 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 protein_id gnl|my_center|LOCUS_16400 20703 21389 gene locus_tag LOCUS_16410 20703 21389 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039228.1 protein_id gnl|my_center|LOCUS_16410 21389 24763 gene locus_tag LOCUS_16420 21389 24763 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_16420 24750 25904 gene locus_tag LOCUS_16430 24750 25904 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_16430 27249 25948 gene locus_tag LOCUS_16440 27249 25948 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538165.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence043 67 1605 gene locus_tag LOCUS_16450 67 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2515 1754 gene locus_tag LOCUS_16460 gene phbB 2515 1754 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444788.1 protein_id gnl|my_center|LOCUS_16460 3128 2634 gene locus_tag LOCUS_16470 3128 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 4760 3207 gene locus_tag LOCUS_16480 4760 3207 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524545.1 protein_id gnl|my_center|LOCUS_16480 5977 4775 gene locus_tag LOCUS_16490 5977 4775 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_16490 7445 5964 gene locus_tag LOCUS_16500 7445 5964 CDS product MdtP family multidrug efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703365.1 protein_id gnl|my_center|LOCUS_16500 7981 7457 gene locus_tag LOCUS_16510 7981 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 8859 8050 gene locus_tag LOCUS_16520 8859 8050 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_16520 9024 9632 gene locus_tag LOCUS_16530 9024 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 9665 10147 gene locus_tag LOCUS_16540 9665 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10664 10230 gene locus_tag LOCUS_16550 10664 10230 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506828.1 protein_id gnl|my_center|LOCUS_16550 11927 11124 gene locus_tag LOCUS_16560 11927 11124 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 protein_id gnl|my_center|LOCUS_16560 12319 12714 gene locus_tag LOCUS_16570 gene sdhC 12319 12714 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037283.1 protein_id gnl|my_center|LOCUS_16570 12711 13115 gene locus_tag LOCUS_16580 gene sdhD 12711 13115 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_16580 13135 14922 gene locus_tag LOCUS_16590 gene sdhA 13135 14922 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037281.1 protein_id gnl|my_center|LOCUS_16590 15018 15800 gene locus_tag LOCUS_16600 15018 15800 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 protein_id gnl|my_center|LOCUS_16600 15883 16140 gene locus_tag LOCUS_16610 15883 16140 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420732.1 protein_id gnl|my_center|LOCUS_16610 16112 16549 gene locus_tag LOCUS_16620 16112 16549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 16656 17897 gene locus_tag LOCUS_16630 16656 17897 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 protein_id gnl|my_center|LOCUS_16630 17905 18603 gene locus_tag LOCUS_16640 gene lolD 17905 18603 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161961949.1 protein_id gnl|my_center|LOCUS_16640 18701 21013 gene locus_tag LOCUS_16650 18701 21013 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_16650 21117 21770 gene locus_tag LOCUS_16660 21117 21770 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_16660 21781 22212 gene locus_tag LOCUS_16670 21781 22212 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_16670 22209 23993 gene locus_tag LOCUS_16680 gene msbA 22209 23993 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211320.1 protein_id gnl|my_center|LOCUS_16680 24002 25003 gene locus_tag LOCUS_16690 gene lpxK 24002 25003 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037270.1 protein_id gnl|my_center|LOCUS_16690 26202 24940 gene locus_tag LOCUS_16700 gene hutI 26202 24940 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068174090.1 protein_id gnl|my_center|LOCUS_16700 <27377 26235 gene locus_tag LOCUS_16710 <27377 26235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037785.1:chloride channel protein >Feature sequence044 1014 2165 gene locus_tag LOCUS_16720 1014 2165 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 protein_id gnl|my_center|LOCUS_16720 2424 3146 gene locus_tag LOCUS_16730 2424 3146 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036151.1 protein_id gnl|my_center|LOCUS_16730 4397 3186 gene locus_tag LOCUS_16740 gene kbl 4397 3186 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036153.1 protein_id gnl|my_center|LOCUS_16740 8129 4497 gene locus_tag LOCUS_16750 8129 4497 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187804.1 protein_id gnl|my_center|LOCUS_16750 9303 8269 gene locus_tag LOCUS_16760 gene tdh 9303 8269 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666275.1 protein_id gnl|my_center|LOCUS_16760 9818 11911 gene locus_tag LOCUS_16770 9818 11911 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_16770 12001 12969 gene locus_tag LOCUS_16780 gene miaA 12001 12969 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036892.1 protein_id gnl|my_center|LOCUS_16780 13104 13391 gene locus_tag LOCUS_16790 13104 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 13482 14750 gene locus_tag LOCUS_16800 gene hflX 13482 14750 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036894.1 protein_id gnl|my_center|LOCUS_16800 14930 16006 gene locus_tag LOCUS_16810 gene hflK 14930 16006 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036250.1 protein_id gnl|my_center|LOCUS_16810 16003 16872 gene locus_tag LOCUS_16820 gene hflC 16003 16872 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003366315.1 protein_id gnl|my_center|LOCUS_16820 17009 16842 gene locus_tag LOCUS_16830 17009 16842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 17025 18317 gene locus_tag LOCUS_16840 17025 18317 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036253.1 protein_id gnl|my_center|LOCUS_16840 18895 18404 gene locus_tag LOCUS_16850 gene smpB 18895 18404 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036652.1 protein_id gnl|my_center|LOCUS_16850 18979 19410 gene locus_tag LOCUS_16860 18979 19410 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036653.1 protein_id gnl|my_center|LOCUS_16860 19403 19681 gene locus_tag LOCUS_16870 19403 19681 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210716.1 protein_id gnl|my_center|LOCUS_16870 20200 19742 gene locus_tag LOCUS_16880 20200 19742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 20279 20704 gene locus_tag LOCUS_16890 gene fur 20279 20704 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005988392.1 protein_id gnl|my_center|LOCUS_16890 22640 21063 gene locus_tag LOCUS_16900 gene uhpB 22640 21063 CDS product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096187.1 protein_id gnl|my_center|LOCUS_16900 22761 23396 gene locus_tag LOCUS_16910 22761 23396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_16910 25090 23417 gene locus_tag LOCUS_16920 gene recN 25090 23417 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036657.1 protein_id gnl|my_center|LOCUS_16920 25213 26274 gene locus_tag LOCUS_16930 gene hrcA 25213 26274 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_16930 26354 26887 gene locus_tag LOCUS_16940 gene grpE 26354 26887 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507314.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence045 1005 921 gene locus_tag LOCUS_t00310 1005 921 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1462 1019 gene locus_tag LOCUS_16950 1462 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2237 1470 gene locus_tag LOCUS_16960 gene tpiA 2237 1470 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_16960 2365 3174 gene locus_tag LOCUS_16970 2365 3174 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037662.1 protein_id gnl|my_center|LOCUS_16970 4143 3193 gene locus_tag LOCUS_16980 4143 3193 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_16980 5642 4245 gene locus_tag LOCUS_16990 gene glmM 5642 4245 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037669.1 protein_id gnl|my_center|LOCUS_16990 6590 5676 gene locus_tag LOCUS_17000 gene folP 6590 5676 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275372.1 protein_id gnl|my_center|LOCUS_17000 7191 6625 gene locus_tag LOCUS_17010 gene orn 7191 6625 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037314.1 protein_id gnl|my_center|LOCUS_17010 7378 8820 gene locus_tag LOCUS_17020 gene sbcB 7378 8820 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036735.1 protein_id gnl|my_center|LOCUS_17020 8891 9577 gene locus_tag LOCUS_17030 8891 9577 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 protein_id gnl|my_center|LOCUS_17030 10806 9574 gene locus_tag LOCUS_17040 10806 9574 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704390.1 protein_id gnl|my_center|LOCUS_17040 11162 11893 gene locus_tag LOCUS_17050 gene aqpZ 11162 11893 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298299.1 protein_id gnl|my_center|LOCUS_17050 12898 11939 gene locus_tag LOCUS_17060 gene epmA 12898 11939 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036753.1 protein_id gnl|my_center|LOCUS_17060 15294 12895 gene locus_tag LOCUS_17070 gene ligA 15294 12895 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036752.1 protein_id gnl|my_center|LOCUS_17070 15427 16053 gene locus_tag LOCUS_17080 15427 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 16200 17594 gene locus_tag LOCUS_17090 gene nhaD 16200 17594 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_17090 17634 18839 gene locus_tag LOCUS_17100 17634 18839 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_17100 19942 18959 gene locus_tag LOCUS_17110 19942 18959 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_17110 21203 20052 gene locus_tag LOCUS_17120 21203 20052 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_17120 21500 21757 gene locus_tag LOCUS_17130 21500 21757 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_17130 22349 21924 gene locus_tag LOCUS_17140 22349 21924 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521311.1 protein_id gnl|my_center|LOCUS_17140 22996 22487 gene locus_tag LOCUS_17150 22996 22487 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_17150 24976 23135 gene locus_tag LOCUS_17160 24976 23135 CDS product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532230.1 protein_id gnl|my_center|LOCUS_17160 25119 25778 gene locus_tag LOCUS_17170 25119 25778 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038447.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence046 3170 168 gene locus_tag LOCUS_17180 3170 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3561 4520 gene locus_tag LOCUS_17190 3561 4520 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_17190 6202 4562 gene locus_tag LOCUS_17200 6202 4562 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 protein_id gnl|my_center|LOCUS_17200 6496 7659 gene locus_tag LOCUS_17210 gene sucC 6496 7659 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038209.1 protein_id gnl|my_center|LOCUS_17210 7674 8546 gene locus_tag LOCUS_17220 gene sucD 7674 8546 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038208.1 protein_id gnl|my_center|LOCUS_17220 8649 10364 gene locus_tag LOCUS_17230 8649 10364 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054176.1 protein_id gnl|my_center|LOCUS_17230 11337 10483 gene locus_tag LOCUS_17240 11337 10483 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038204.1 protein_id gnl|my_center|LOCUS_17240 11420 12394 gene locus_tag LOCUS_17250 gene rluD 11420 12394 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 protein_id gnl|my_center|LOCUS_17250 12431 13213 gene locus_tag LOCUS_17260 gene pgeF 12431 13213 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038202.1 protein_id gnl|my_center|LOCUS_17260 13334 15931 gene locus_tag LOCUS_17270 gene clpB 13334 15931 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038185.1 protein_id gnl|my_center|LOCUS_17270 18527 16095 gene locus_tag LOCUS_17280 18527 16095 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038161.1 protein_id gnl|my_center|LOCUS_17280 18911 19240 gene locus_tag LOCUS_17290 18911 19240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 19388 21160 gene locus_tag LOCUS_17300 gene aspS 19388 21160 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038145.1 protein_id gnl|my_center|LOCUS_17300 21263 21913 gene locus_tag LOCUS_17310 21263 21913 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_17310 22006 22740 gene locus_tag LOCUS_17320 22006 22740 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038142.1 protein_id gnl|my_center|LOCUS_17320 22775 23296 gene locus_tag LOCUS_17330 gene ruvC 22775 23296 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038141.1 protein_id gnl|my_center|LOCUS_17330 23293 23886 gene locus_tag LOCUS_17340 gene ruvA 23293 23886 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450983.1 protein_id gnl|my_center|LOCUS_17340 23886 25799 gene locus_tag LOCUS_17350 23886 25799 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038140.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence047 516 1 gene locus_tag LOCUS_17360 516 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 710 2731 gene locus_tag LOCUS_17370 gene uvrB 710 2731 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037621.1 protein_id gnl|my_center|LOCUS_17370 2810 2884 gene locus_tag LOCUS_t00320 2810 2884 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3990 3034 gene locus_tag LOCUS_17380 3990 3034 CDS product aspartyl/asparaginyl beta-hydroxylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407254.1 protein_id gnl|my_center|LOCUS_17380 5548 4166 gene locus_tag LOCUS_17390 5548 4166 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036911.1 protein_id gnl|my_center|LOCUS_17390 6089 5628 gene locus_tag LOCUS_17400 6089 5628 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_17400 6913 6338 gene locus_tag LOCUS_17410 6913 6338 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_17410 7040 7936 gene locus_tag LOCUS_17420 gene dapA 7040 7936 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036915.1 protein_id gnl|my_center|LOCUS_17420 7970 8563 gene locus_tag LOCUS_17430 7970 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 8967 8644 gene locus_tag LOCUS_17440 8967 8644 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_17440 9189 9114 gene locus_tag LOCUS_t00330 9189 9114 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9383 10738 gene locus_tag LOCUS_17450 gene pcnB 9383 10738 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036939.1 protein_id gnl|my_center|LOCUS_17450 10735 11211 gene locus_tag LOCUS_17460 gene folK 10735 11211 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969486.1 protein_id gnl|my_center|LOCUS_17460 11266 12096 gene locus_tag LOCUS_17470 gene panB 11266 12096 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036941.1 protein_id gnl|my_center|LOCUS_17470 12115 12960 gene locus_tag LOCUS_17480 gene panC 12115 12960 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036942.1 protein_id gnl|my_center|LOCUS_17480 13062 13454 gene locus_tag LOCUS_17490 13062 13454 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 protein_id gnl|my_center|LOCUS_17490 14539 13451 gene locus_tag LOCUS_17500 gene queG 14539 13451 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_17500 14555 16078 gene locus_tag LOCUS_17510 14555 16078 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148264.1 protein_id gnl|my_center|LOCUS_17510 16071 16565 gene locus_tag LOCUS_17520 gene tsaE 16071 16565 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 protein_id gnl|my_center|LOCUS_17520 16767 18278 gene locus_tag LOCUS_17530 16767 18278 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198702760.1 protein_id gnl|my_center|LOCUS_17530 18325 20139 gene locus_tag LOCUS_17540 gene mutL 18325 20139 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_17540 20227 21081 gene locus_tag LOCUS_17550 20227 21081 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_17550 21889 21107 gene locus_tag LOCUS_17560 21889 21107 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 protein_id gnl|my_center|LOCUS_17560 22044 22784 gene locus_tag LOCUS_17570 22044 22784 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957701.1 protein_id gnl|my_center|LOCUS_17570 22812 23612 gene locus_tag LOCUS_17580 22812 23612 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036720.1 protein_id gnl|my_center|LOCUS_17580 23692 24543 gene locus_tag LOCUS_17590 23692 24543 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_17590 <25517 24649 gene locus_tag LOCUS_17600 <25517 24649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036346.1:enoyl-CoA hydratase/isomerase family protein >Feature sequence048 1830 937 gene locus_tag LOCUS_17610 1830 937 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494132.1 protein_id gnl|my_center|LOCUS_17610 1929 2822 gene locus_tag LOCUS_17620 1929 2822 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088921.1 protein_id gnl|my_center|LOCUS_17620 3560 2895 gene locus_tag LOCUS_17630 3560 2895 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035327.1 protein_id gnl|my_center|LOCUS_17630 3760 4119 gene locus_tag LOCUS_17640 3760 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 4168 4767 gene locus_tag LOCUS_17650 4168 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480904.1 protein_id gnl|my_center|LOCUS_17650 4922 5359 gene locus_tag LOCUS_17660 4922 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 5371 5916 gene locus_tag LOCUS_17670 5371 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5923 6885 gene locus_tag LOCUS_17680 5923 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 6888 7373 gene locus_tag LOCUS_17690 6888 7373 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_17690 7494 8606 gene locus_tag LOCUS_17700 7494 8606 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275472.1 protein_id gnl|my_center|LOCUS_17700 8955 11270 gene locus_tag LOCUS_17710 8955 11270 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036160.1 protein_id gnl|my_center|LOCUS_17710 11421 12098 gene locus_tag LOCUS_17720 11421 12098 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704333.1 protein_id gnl|my_center|LOCUS_17720 12095 13366 gene locus_tag LOCUS_17730 12095 13366 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_17730 13540 15009 gene locus_tag LOCUS_17740 13540 15009 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027457.1 protein_id gnl|my_center|LOCUS_17740 15229 17154 gene locus_tag LOCUS_17750 15229 17154 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438954.1 protein_id gnl|my_center|LOCUS_17750 17423 17499 gene locus_tag LOCUS_t00340 17423 17499 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17833 18996 gene locus_tag LOCUS_17760 17833 18996 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_17760 22758 19045 gene locus_tag LOCUS_17770 22758 19045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 23315 24712 gene locus_tag LOCUS_17780 gene hemN 23315 24712 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689506.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence049 814 1575 gene locus_tag LOCUS_17790 814 1575 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994123.1 protein_id gnl|my_center|LOCUS_17790 1848 2222 gene locus_tag LOCUS_17800 1848 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 2657 2367 gene locus_tag LOCUS_17810 2657 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2586 2822 gene locus_tag LOCUS_17820 2586 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3685 2753 gene locus_tag LOCUS_17830 3685 2753 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206552.1 protein_id gnl|my_center|LOCUS_17830 6579 3805 gene locus_tag LOCUS_17840 6579 3805 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161788737.1 protein_id gnl|my_center|LOCUS_17840 7322 6576 gene locus_tag LOCUS_17850 7322 6576 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 protein_id gnl|my_center|LOCUS_17850 7965 7417 gene locus_tag LOCUS_17860 7965 7417 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210846.1 protein_id gnl|my_center|LOCUS_17860 8695 8895 gene locus_tag LOCUS_17870 8695 8895 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_17870 8916 10475 gene locus_tag LOCUS_17880 8916 10475 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039042.1 protein_id gnl|my_center|LOCUS_17880 10472 11206 gene locus_tag LOCUS_17890 10472 11206 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_17890 11203 12402 gene locus_tag LOCUS_17900 11203 12402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275547.1 protein_id gnl|my_center|LOCUS_17900 12775 12530 gene locus_tag LOCUS_17910 12775 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 13461 12859 gene locus_tag LOCUS_17920 gene folE 13461 12859 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945065.1 protein_id gnl|my_center|LOCUS_17920 14106 13534 gene locus_tag LOCUS_17930 14106 13534 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198110.1 protein_id gnl|my_center|LOCUS_17930 15551 14103 gene locus_tag LOCUS_17940 gene rmuC 15551 14103 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039276.1 protein_id gnl|my_center|LOCUS_17940 15739 16977 gene locus_tag LOCUS_17950 gene alaC 15739 16977 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100170.1 protein_id gnl|my_center|LOCUS_17950 18162 16987 gene locus_tag LOCUS_17960 18162 16987 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_17960 18663 18226 gene locus_tag LOCUS_17970 18663 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 19722 18772 gene locus_tag LOCUS_17980 19722 18772 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_17980 20212 19772 gene locus_tag LOCUS_17990 20212 19772 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706462.1 protein_id gnl|my_center|LOCUS_17990 20267 21346 gene locus_tag LOCUS_18000 20267 21346 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_18000 21867 21424 gene locus_tag LOCUS_18010 21867 21424 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 protein_id gnl|my_center|LOCUS_18010 22416 21925 gene locus_tag LOCUS_18020 22416 21925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035457.1 protein_id gnl|my_center|LOCUS_18020 22899 22426 gene locus_tag LOCUS_18030 22899 22426 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437013.1 protein_id gnl|my_center|LOCUS_18030 22936 23760 gene locus_tag LOCUS_18040 22936 23760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 23815 24978 gene locus_tag LOCUS_18050 23815 24978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence050 1209 178 gene locus_tag LOCUS_18060 gene queA 1209 178 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037521.1 protein_id gnl|my_center|LOCUS_18060 1877 1275 gene locus_tag LOCUS_18070 1877 1275 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038983.1 protein_id gnl|my_center|LOCUS_18070 3082 1874 gene locus_tag LOCUS_18080 3082 1874 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050912608.1 protein_id gnl|my_center|LOCUS_18080 3916 3125 gene locus_tag LOCUS_18090 3916 3125 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919032.1 protein_id gnl|my_center|LOCUS_18090 4848 3919 gene locus_tag LOCUS_18100 4848 3919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919031.1 protein_id gnl|my_center|LOCUS_18100 5146 6642 gene locus_tag LOCUS_18110 5146 6642 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_18110 6792 7145 gene locus_tag LOCUS_18120 6792 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7263 7907 gene locus_tag LOCUS_18130 gene upp 7263 7907 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162121.1 protein_id gnl|my_center|LOCUS_18130 8985 8026 gene locus_tag LOCUS_18140 gene pip 8985 8026 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036072.1 protein_id gnl|my_center|LOCUS_18140 10437 9046 gene locus_tag LOCUS_18150 10437 9046 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036996.1 protein_id gnl|my_center|LOCUS_18150 10562 11794 gene locus_tag LOCUS_18160 gene serA 10562 11794 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036995.1 protein_id gnl|my_center|LOCUS_18160 11968 11892 gene locus_tag LOCUS_t00350 11968 11892 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12395 12039 gene locus_tag LOCUS_18170 12395 12039 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 protein_id gnl|my_center|LOCUS_18170 12675 12376 gene locus_tag LOCUS_18180 12675 12376 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811076.1 protein_id gnl|my_center|LOCUS_18180 15055 12677 gene locus_tag LOCUS_18190 gene pheT 15055 12677 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037596.1 protein_id gnl|my_center|LOCUS_18190 16149 15154 gene locus_tag LOCUS_18200 gene pheS 16149 15154 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037597.1 protein_id gnl|my_center|LOCUS_18200 16694 16335 gene locus_tag LOCUS_18210 gene rplT 16694 16335 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_18210 17019 16711 gene locus_tag LOCUS_18220 17019 16711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 17738 17166 gene locus_tag LOCUS_18230 gene infC 17738 17166 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690874.1 protein_id gnl|my_center|LOCUS_18230 19636 17735 gene locus_tag LOCUS_18240 gene thrS 19636 17735 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944299.1 protein_id gnl|my_center|LOCUS_18240 20393 19944 gene locus_tag LOCUS_18250 20393 19944 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036547.1 protein_id gnl|my_center|LOCUS_18250 23110 20462 gene locus_tag LOCUS_18260 23110 20462 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036575.1 protein_id gnl|my_center|LOCUS_18260 23972 23208 gene locus_tag LOCUS_18270 gene map 23972 23208 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036574.1 protein_id gnl|my_center|LOCUS_18270 24306 25169 gene locus_tag LOCUS_18280 gene rpsB 24306 25169 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence051 444 3500 gene locus_tag LOCUS_18290 444 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5017 4124 gene locus_tag LOCUS_18300 gene phhA 5017 4124 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 protein_id gnl|my_center|LOCUS_18300 5178 5654 gene locus_tag LOCUS_18310 5178 5654 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 protein_id gnl|my_center|LOCUS_18310 5733 6533 gene locus_tag LOCUS_18320 5733 6533 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035436.1 protein_id gnl|my_center|LOCUS_18320 6530 7549 gene locus_tag LOCUS_18330 6530 7549 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_18330 8173 7562 gene locus_tag LOCUS_18340 8173 7562 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032614391.1 protein_id gnl|my_center|LOCUS_18340 8691 8479 gene locus_tag LOCUS_18350 8691 8479 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810443.1 protein_id gnl|my_center|LOCUS_18350 9123 8701 gene locus_tag LOCUS_18360 9123 8701 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522995.1 protein_id gnl|my_center|LOCUS_18360 10731 9223 gene locus_tag LOCUS_18370 10731 9223 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228281.1 protein_id gnl|my_center|LOCUS_18370 13117 10931 gene locus_tag LOCUS_18380 13117 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 13726 14421 gene locus_tag LOCUS_18390 13726 14421 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531349.1 protein_id gnl|my_center|LOCUS_18390 14773 15192 gene locus_tag LOCUS_18400 14773 15192 CDS product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 protein_id gnl|my_center|LOCUS_18400 15408 16574 gene locus_tag LOCUS_18410 15408 16574 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_18410 16627 17076 gene locus_tag LOCUS_18420 16627 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18420 17086 17250 gene locus_tag LOCUS_18430 17086 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18430 17370 17525 gene locus_tag LOCUS_18440 17370 17525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 17580 17942 gene locus_tag LOCUS_18450 17580 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 17966 18445 gene locus_tag LOCUS_18460 17966 18445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 18442 18783 gene locus_tag LOCUS_18470 18442 18783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 18780 19925 gene locus_tag LOCUS_18480 18780 19925 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038977.1 protein_id gnl|my_center|LOCUS_18480 20730 19933 gene locus_tag LOCUS_18490 20730 19933 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035441.1 protein_id gnl|my_center|LOCUS_18490 21143 20784 gene locus_tag LOCUS_18500 21143 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 21064 21783 gene locus_tag LOCUS_18510 21064 21783 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930529.1 protein_id gnl|my_center|LOCUS_18510 21839 22177 gene locus_tag LOCUS_18520 21839 22177 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808480.1 protein_id gnl|my_center|LOCUS_18520 22200 23561 gene locus_tag LOCUS_18530 22200 23561 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275136.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence052 3521 927 gene locus_tag LOCUS_18540 gene acnD 3521 927 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 protein_id gnl|my_center|LOCUS_18540 3893 4570 gene locus_tag LOCUS_18550 3893 4570 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_18550 5762 4617 gene locus_tag LOCUS_18560 gene prpC 5762 4617 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_18560 6707 5892 gene locus_tag LOCUS_18570 gene prpB 6707 5892 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188143.1 protein_id gnl|my_center|LOCUS_18570 6942 8258 gene locus_tag LOCUS_18580 6942 8258 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_18580 8438 9001 gene locus_tag LOCUS_18590 gene ahpC 8438 9001 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389172.1 protein_id gnl|my_center|LOCUS_18590 9137 10732 gene locus_tag LOCUS_18600 gene ahpF 9137 10732 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036069.1 protein_id gnl|my_center|LOCUS_18600 12726 10831 gene locus_tag LOCUS_18610 gene prpE 12726 10831 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010284.1 protein_id gnl|my_center|LOCUS_18610 12879 13703 gene locus_tag LOCUS_18620 12879 13703 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035561.1 protein_id gnl|my_center|LOCUS_18620 14610 13738 gene locus_tag LOCUS_18630 gene bla 14610 13738 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974796.1 protein_id gnl|my_center|LOCUS_18630 15178 14824 gene locus_tag LOCUS_tm00010 15178 14824 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 15426 15749 gene locus_tag LOCUS_18640 15426 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 15768 16121 gene locus_tag LOCUS_18650 15768 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18650 16784 16176 gene locus_tag LOCUS_18660 16784 16176 CDS product NfuA family Fe-S biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037235.1 protein_id gnl|my_center|LOCUS_18660 16950 17291 gene locus_tag LOCUS_18670 16950 17291 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_18670 18191 17292 gene locus_tag LOCUS_18680 gene rluC 18191 17292 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 protein_id gnl|my_center|LOCUS_18680 18627 21644 gene locus_tag LOCUS_18690 gene rne 18627 21644 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037240.1 protein_id gnl|my_center|LOCUS_18690 22402 21746 gene locus_tag LOCUS_18700 22402 21746 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037241.1 protein_id gnl|my_center|LOCUS_18700 24123 22780 gene locus_tag LOCUS_18710 24123 22780 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039889.1 protein_id gnl|my_center|LOCUS_18710 24383 24120 gene locus_tag LOCUS_18720 24383 24120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence053 <1 583 gene locus_tag LOCUS_18730 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772336.1:alanine racemase 672 2057 gene locus_tag LOCUS_18740 gene radA 672 2057 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438953.1 protein_id gnl|my_center|LOCUS_18740 2682 2062 gene locus_tag LOCUS_18750 2682 2062 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388742.1 protein_id gnl|my_center|LOCUS_18750 3571 2705 gene locus_tag LOCUS_18760 gene purU 3571 2705 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088696.1 protein_id gnl|my_center|LOCUS_18760 4368 3571 gene locus_tag LOCUS_18770 gene ccsA 4368 3571 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036390.1 protein_id gnl|my_center|LOCUS_18770 4466 5845 gene locus_tag LOCUS_18780 gene ffh 4466 5845 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036391.1 protein_id gnl|my_center|LOCUS_18780 6037 6294 gene locus_tag LOCUS_18790 gene rpsP 6037 6294 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036396.1 protein_id gnl|my_center|LOCUS_18790 6324 6812 gene locus_tag LOCUS_18800 gene rimM 6324 6812 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036397.1 protein_id gnl|my_center|LOCUS_18800 6850 7638 gene locus_tag LOCUS_18810 gene trmD 6850 7638 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036398.1 protein_id gnl|my_center|LOCUS_18810 7688 8083 gene locus_tag LOCUS_18820 gene rplS 7688 8083 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036399.1 protein_id gnl|my_center|LOCUS_18820 10219 8180 gene locus_tag LOCUS_18830 10219 8180 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037435.1 protein_id gnl|my_center|LOCUS_18830 11290 10352 gene locus_tag LOCUS_18840 gene epmB 11290 10352 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_18840 11451 12029 gene locus_tag LOCUS_18850 gene efp 11451 12029 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037416.1 protein_id gnl|my_center|LOCUS_18850 12244 13575 gene locus_tag LOCUS_18860 12244 13575 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_18860 13588 13842 gene locus_tag LOCUS_18870 13588 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 13872 14615 gene locus_tag LOCUS_18880 13872 14615 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037413.1 protein_id gnl|my_center|LOCUS_18880 14612 15295 gene locus_tag LOCUS_18890 gene mupP 14612 15295 CDS product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895650.1 protein_id gnl|my_center|LOCUS_18890 15292 16146 gene locus_tag LOCUS_18900 15292 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 16256 17203 gene locus_tag LOCUS_18910 gene folE2 16256 17203 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 protein_id gnl|my_center|LOCUS_18910 17645 18862 gene locus_tag LOCUS_18920 17645 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 19495 19058 gene locus_tag LOCUS_18930 19495 19058 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_18930 20950 19580 gene locus_tag LOCUS_18940 gene cysS 20950 19580 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275351.1 protein_id gnl|my_center|LOCUS_18940 21135 21662 gene locus_tag LOCUS_18950 21135 21662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 22043 23050 gene locus_tag LOCUS_18960 22043 23050 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 protein_id gnl|my_center|LOCUS_18960 23057 23680 gene locus_tag LOCUS_18970 23057 23680 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521852.1 protein_id gnl|my_center|LOCUS_18970 23677 24168 gene locus_tag LOCUS_18980 23677 24168 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037392.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence054 41 208 gene locus_tag LOCUS_18990 gene rpmG 41 208 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895937.1 protein_id gnl|my_center|LOCUS_18990 1737 544 gene locus_tag LOCUS_19000 1737 544 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035419.1 protein_id gnl|my_center|LOCUS_19000 1914 2672 gene locus_tag LOCUS_19010 1914 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2669 3424 gene locus_tag LOCUS_19020 2669 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 3424 4779 gene locus_tag LOCUS_19030 3424 4779 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_19030 4783 5280 gene locus_tag LOCUS_19040 4783 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 5297 6124 gene locus_tag LOCUS_19050 gene mutM 5297 6124 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_19050 6914 6147 gene locus_tag LOCUS_19060 6914 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7569 6937 gene locus_tag LOCUS_19070 7569 6937 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039212.1 protein_id gnl|my_center|LOCUS_19070 7748 9733 gene locus_tag LOCUS_19080 7748 9733 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039208.1 protein_id gnl|my_center|LOCUS_19080 12880 9977 gene locus_tag LOCUS_19090 12880 9977 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265669.1 protein_id gnl|my_center|LOCUS_19090 15571 13538 gene locus_tag LOCUS_19100 15571 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 16214 15768 gene locus_tag LOCUS_19110 16214 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 17330 16299 gene locus_tag LOCUS_19120 17330 16299 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419507.1 protein_id gnl|my_center|LOCUS_19120 17462 18364 gene locus_tag LOCUS_19130 17462 18364 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039204.1 protein_id gnl|my_center|LOCUS_19130 18441 19625 gene locus_tag LOCUS_19140 18441 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 19651 22317 gene locus_tag LOCUS_19150 gene plsB 19651 22317 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039197.1 protein_id gnl|my_center|LOCUS_19150 22351 23727 gene locus_tag LOCUS_19160 22351 23727 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence055 2208 802 gene locus_tag LOCUS_19170 gene narK2 2208 802 CDS product nitrate/nitrite transporter NarK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105301.1 protein_id gnl|my_center|LOCUS_19170 3336 2542 gene locus_tag LOCUS_19180 3336 2542 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818535.1 protein_id gnl|my_center|LOCUS_19180 3771 3421 gene locus_tag LOCUS_19190 3771 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055333.1 protein_id gnl|my_center|LOCUS_19190 5033 3768 gene locus_tag LOCUS_19200 5033 3768 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037163.1 protein_id gnl|my_center|LOCUS_19200 6645 5065 gene locus_tag LOCUS_19210 6645 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 6884 6642 gene locus_tag LOCUS_19220 6884 6642 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 protein_id gnl|my_center|LOCUS_19220 7474 6881 gene locus_tag LOCUS_19230 7474 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19230 7971 7471 gene locus_tag LOCUS_19240 gene moaC 7971 7471 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_19240 9057 8002 gene locus_tag LOCUS_19250 gene moaA 9057 8002 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275431.1 protein_id gnl|my_center|LOCUS_19250 10261 9059 gene locus_tag LOCUS_19260 10261 9059 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_19260 10924 11859 gene locus_tag LOCUS_19270 10924 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 11915 12703 gene locus_tag LOCUS_19280 11915 12703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903162.1 protein_id gnl|my_center|LOCUS_19280 12705 13709 gene locus_tag LOCUS_19290 12705 13709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228140.1 protein_id gnl|my_center|LOCUS_19290 13970 13755 gene locus_tag LOCUS_19300 13970 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 14449 15243 gene locus_tag LOCUS_19310 gene anr 14449 15243 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_19310 15333 16574 gene locus_tag LOCUS_19320 gene ubiM 15333 16574 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 protein_id gnl|my_center|LOCUS_19320 16724 19039 gene locus_tag LOCUS_19330 16724 19039 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266410.1 protein_id gnl|my_center|LOCUS_19330 19205 19492 gene locus_tag LOCUS_19340 19205 19492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 19473 20729 gene locus_tag LOCUS_19350 19473 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970961.1 protein_id gnl|my_center|LOCUS_19350 20726 21124 gene locus_tag LOCUS_19360 gene anvM 20726 21124 CDS product anaerobic/virulence modulator AnvM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092971.1 protein_id gnl|my_center|LOCUS_19360 21270 21629 gene locus_tag LOCUS_19370 21270 21629 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368791.1 protein_id gnl|my_center|LOCUS_19370 21634 21975 gene locus_tag LOCUS_19380 21634 21975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 22712 21999 gene locus_tag LOCUS_19390 22712 21999 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence056 2611 1400 gene locus_tag LOCUS_19400 2611 1400 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038868.1 protein_id gnl|my_center|LOCUS_19400 3066 3599 gene locus_tag LOCUS_19410 3066 3599 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035509.1 protein_id gnl|my_center|LOCUS_19410 4232 3639 gene locus_tag LOCUS_19420 4232 3639 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768620.1 protein_id gnl|my_center|LOCUS_19420 4293 4982 gene locus_tag LOCUS_19430 4293 4982 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 protein_id gnl|my_center|LOCUS_19430 5084 6112 gene locus_tag LOCUS_19440 gene zapE 5084 6112 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035516.1 protein_id gnl|my_center|LOCUS_19440 6694 6152 gene locus_tag LOCUS_19450 6694 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039241.1 protein_id gnl|my_center|LOCUS_19450 7555 6812 gene locus_tag LOCUS_19460 gene gpmA 7555 6812 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198007.1 protein_id gnl|my_center|LOCUS_19460 7616 8359 gene locus_tag LOCUS_19470 7616 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 9356 8451 gene locus_tag LOCUS_19480 gene hemF 9356 8451 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039090.1 protein_id gnl|my_center|LOCUS_19480 10196 9441 gene locus_tag LOCUS_19490 10196 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 10309 11514 gene locus_tag LOCUS_19500 10309 11514 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_19500 11511 12326 gene locus_tag LOCUS_19510 11511 12326 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_19510 12323 13075 gene locus_tag LOCUS_19520 12323 13075 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039071.1 protein_id gnl|my_center|LOCUS_19520 13227 13427 gene locus_tag LOCUS_19530 13227 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537779.1 protein_id gnl|my_center|LOCUS_19530 14764 13523 gene locus_tag LOCUS_19540 14764 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 16408 14777 gene locus_tag LOCUS_19550 16408 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 19444 16589 gene locus_tag LOCUS_19560 19444 16589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 19723 20361 gene locus_tag LOCUS_19570 19723 20361 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704956.1 protein_id gnl|my_center|LOCUS_19570 21589 20852 gene locus_tag LOCUS_19580 gene fabG 21589 20852 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_19580 22043 21609 gene locus_tag LOCUS_19590 22043 21609 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_19590 <23733 22027 gene locus_tag LOCUS_19600 <23733 22027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039076.1:MMPL family transporter >Feature sequence057 218 1399 gene locus_tag LOCUS_19610 gene purT 218 1399 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_19610 1471 2997 gene locus_tag LOCUS_19620 1471 2997 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_19620 3721 3011 gene locus_tag LOCUS_19630 3721 3011 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275418.1 protein_id gnl|my_center|LOCUS_19630 4162 3770 gene locus_tag LOCUS_19640 4162 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 5046 4180 gene locus_tag LOCUS_19650 gene tesB 5046 4180 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_19650 5736 5170 gene locus_tag LOCUS_19660 5736 5170 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036723.1 protein_id gnl|my_center|LOCUS_19660 5825 6352 gene locus_tag LOCUS_19670 5825 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 6349 8550 gene locus_tag LOCUS_19680 gene rlmKL 6349 8550 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036729.1 protein_id gnl|my_center|LOCUS_19680 8612 9028 gene locus_tag LOCUS_19690 8612 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 9294 10514 gene locus_tag LOCUS_19700 gene egtB 9294 10514 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275134.1 protein_id gnl|my_center|LOCUS_19700 10511 11500 gene locus_tag LOCUS_19710 gene egtD 10511 11500 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_19710 13066 11561 gene locus_tag LOCUS_19720 13066 11561 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036870.1 protein_id gnl|my_center|LOCUS_19720 13675 13175 gene locus_tag LOCUS_19730 gene trxC 13675 13175 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_19730 14327 13725 gene locus_tag LOCUS_19740 14327 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 16158 14437 gene locus_tag LOCUS_19750 16158 14437 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040121148.1 protein_id gnl|my_center|LOCUS_19750 16302 16970 gene locus_tag LOCUS_19760 16302 16970 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975390.1 protein_id gnl|my_center|LOCUS_19760 16957 17628 gene locus_tag LOCUS_19770 16957 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 18224 17742 gene locus_tag LOCUS_19780 18224 17742 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809252.1 protein_id gnl|my_center|LOCUS_19780 18337 19509 gene locus_tag LOCUS_19790 18337 19509 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_19790 19609 20040 gene locus_tag LOCUS_19800 19609 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 20134 21024 gene locus_tag LOCUS_19810 20134 21024 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035563.1 protein_id gnl|my_center|LOCUS_19810 21976 21092 gene locus_tag LOCUS_19820 21976 21092 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037873.1 protein_id gnl|my_center|LOCUS_19820 22226 22831 gene locus_tag LOCUS_19830 22226 22831 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_19830 >Feature sequence058 1639 521 gene locus_tag LOCUS_19840 1639 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3348 1636 gene locus_tag LOCUS_19850 3348 1636 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_19850 3844 3503 gene locus_tag LOCUS_19860 3844 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3998 4912 gene locus_tag LOCUS_19870 gene rlmJ 3998 4912 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037826.1 protein_id gnl|my_center|LOCUS_19870 4950 5465 gene locus_tag LOCUS_19880 4950 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5533 6444 gene locus_tag LOCUS_19890 5533 6444 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_19890 6943 8379 gene locus_tag LOCUS_19900 6943 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 8843 8382 gene locus_tag LOCUS_19910 8843 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 9139 9672 gene locus_tag LOCUS_19920 9139 9672 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035985.1 protein_id gnl|my_center|LOCUS_19920 9778 10389 gene locus_tag LOCUS_19930 9778 10389 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195598.1 protein_id gnl|my_center|LOCUS_19930 10466 11623 gene locus_tag LOCUS_19940 10466 11623 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_19940 11702 12736 gene locus_tag LOCUS_19950 11702 12736 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 protein_id gnl|my_center|LOCUS_19950 12777 13454 gene locus_tag LOCUS_19960 12777 13454 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 protein_id gnl|my_center|LOCUS_19960 13766 14371 gene locus_tag LOCUS_19970 13766 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 14480 17956 gene locus_tag LOCUS_19980 gene mfd 14480 17956 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123086488.1 protein_id gnl|my_center|LOCUS_19980 18384 20078 gene locus_tag LOCUS_19990 18384 20078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 22382 20106 gene locus_tag LOCUS_20000 22382 20106 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_20000 22372 22581 gene locus_tag LOCUS_20010 22372 22581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence059 <1 740 gene locus_tag LOCUS_20020 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036704.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 737 1006 gene locus_tag LOCUS_20030 737 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1834 1103 gene locus_tag LOCUS_20040 gene phoU 1834 1103 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036708.1 protein_id gnl|my_center|LOCUS_20040 2713 1907 gene locus_tag LOCUS_20050 gene pstB 2713 1907 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036709.1 protein_id gnl|my_center|LOCUS_20050 3578 2706 gene locus_tag LOCUS_20060 gene pstA 3578 2706 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005618859.1 protein_id gnl|my_center|LOCUS_20060 4549 3578 gene locus_tag LOCUS_20070 gene pstC 4549 3578 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770815.1 protein_id gnl|my_center|LOCUS_20070 5692 4658 gene locus_tag LOCUS_20080 gene pstS 5692 4658 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036712.1 protein_id gnl|my_center|LOCUS_20080 6515 5844 gene locus_tag LOCUS_20090 gene rnt 6515 5844 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_20090 6766 8085 gene locus_tag LOCUS_20100 6766 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 8921 8280 gene locus_tag LOCUS_20110 gene hflD 8921 8280 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262317.1 protein_id gnl|my_center|LOCUS_20110 10062 8914 gene locus_tag LOCUS_20120 gene mnmA 10062 8914 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037128.1 protein_id gnl|my_center|LOCUS_20120 10544 10059 gene locus_tag LOCUS_20130 10544 10059 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 protein_id gnl|my_center|LOCUS_20130 10663 10989 gene locus_tag LOCUS_20140 gene clpS 10663 10989 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_20140 11056 13329 gene locus_tag LOCUS_20150 gene clpA 11056 13329 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_20150 13680 13462 gene locus_tag LOCUS_20160 gene infA 13680 13462 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037132.1 protein_id gnl|my_center|LOCUS_20160 14047 13772 gene locus_tag LOCUS_20170 14047 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 14336 14142 gene locus_tag LOCUS_20180 14336 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 14238 14915 gene locus_tag LOCUS_20190 14238 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 15006 16082 gene locus_tag LOCUS_20200 gene serC 15006 16082 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036771.1 protein_id gnl|my_center|LOCUS_20200 16157 17245 gene locus_tag LOCUS_20210 gene pheA 16157 17245 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275386.1 protein_id gnl|my_center|LOCUS_20210 17286 18593 gene locus_tag LOCUS_20220 gene aroA 17286 18593 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036773.1 protein_id gnl|my_center|LOCUS_20220 18655 19434 gene locus_tag LOCUS_20230 gene kdsB 18655 19434 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672371.1 protein_id gnl|my_center|LOCUS_20230 19481 21322 gene locus_tag LOCUS_20240 gene uvrC 19481 21322 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037266.1 protein_id gnl|my_center|LOCUS_20240 21323 22009 gene locus_tag LOCUS_20250 gene pgsA 21323 22009 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 protein_id gnl|my_center|LOCUS_20250 22081 22156 gene locus_tag LOCUS_t00360 22081 22156 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22317 22392 gene locus_tag LOCUS_t00370 22317 22392 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22475 22548 gene locus_tag LOCUS_t00380 22475 22548 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence060 1873 1508 gene locus_tag LOCUS_20260 1873 1508 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021993.1 protein_id gnl|my_center|LOCUS_20260 3698 1941 gene locus_tag LOCUS_20270 gene recJ 3698 1941 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027068825.1 protein_id gnl|my_center|LOCUS_20270 4618 3695 gene locus_tag LOCUS_20280 4618 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_20280 6558 4627 gene locus_tag LOCUS_20290 6558 4627 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038157.1 protein_id gnl|my_center|LOCUS_20290 6763 7125 gene locus_tag LOCUS_20300 6763 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 7265 8353 gene locus_tag LOCUS_20310 7265 8353 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275355.1 protein_id gnl|my_center|LOCUS_20310 8417 9307 gene locus_tag LOCUS_20320 8417 9307 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 protein_id gnl|my_center|LOCUS_20320 9386 10621 gene locus_tag LOCUS_20330 9386 10621 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_20330 11468 12451 gene locus_tag LOCUS_20340 gene cas1f 11468 12451 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_20340 12448 15822 gene locus_tag LOCUS_20350 gene cas3f 12448 15822 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_20350 16208 15834 gene locus_tag LOCUS_20360 16208 15834 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074358.1 protein_id gnl|my_center|LOCUS_20360 16495 16205 gene locus_tag LOCUS_20370 16495 16205 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011809180.1 protein_id gnl|my_center|LOCUS_20370 16699 18045 gene locus_tag LOCUS_20380 gene csy1 16699 18045 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_20380 18042 19046 gene locus_tag LOCUS_20390 gene csy2 18042 19046 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_20390 19064 20092 gene locus_tag LOCUS_20400 gene csy3 19064 20092 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029749.1 protein_id gnl|my_center|LOCUS_20400 20097 20657 gene locus_tag LOCUS_20410 gene cas6f 20097 20657 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_20410 20787 21294 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcgtaggcagctcagaaa >Feature sequence061 <1 2261 gene locus_tag LOCUS_20420 <1 2261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229330.1:exo 1,3/1,4-beta-D-glucan glucohydrolase 2295 3869 gene locus_tag LOCUS_20430 2295 3869 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_20430 4480 7002 gene locus_tag LOCUS_20440 4480 7002 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_20440 7008 8054 gene locus_tag LOCUS_20450 gene rhuM 7008 8054 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_20450 8058 10238 gene locus_tag LOCUS_20460 8058 10238 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_20460 10288 11001 gene locus_tag LOCUS_20470 10288 11001 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933923.1 protein_id gnl|my_center|LOCUS_20470 13183 11087 gene locus_tag LOCUS_20480 13183 11087 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 protein_id gnl|my_center|LOCUS_20480 14574 13189 gene locus_tag LOCUS_20490 14574 13189 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640670.1 protein_id gnl|my_center|LOCUS_20490 15628 14561 gene locus_tag LOCUS_20500 15628 14561 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929288.1 protein_id gnl|my_center|LOCUS_20500 15906 16187 gene locus_tag LOCUS_20510 15906 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 17612 16242 gene locus_tag LOCUS_20520 17612 16242 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191662.1 protein_id gnl|my_center|LOCUS_20520 20063 17658 gene locus_tag LOCUS_20530 20063 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence062 3128 288 gene locus_tag LOCUS_20540 3128 288 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994072.1 protein_id gnl|my_center|LOCUS_20540 4361 3438 gene locus_tag LOCUS_20550 4361 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5584 4388 gene locus_tag LOCUS_20560 5584 4388 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036675.1 protein_id gnl|my_center|LOCUS_20560 6350 5619 gene locus_tag LOCUS_20570 6350 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 6321 6509 gene locus_tag LOCUS_20580 6321 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 6531 8348 gene locus_tag LOCUS_20590 6531 8348 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038280.1 protein_id gnl|my_center|LOCUS_20590 8363 10042 gene locus_tag LOCUS_20600 gene cysI 8363 10042 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038281.1 protein_id gnl|my_center|LOCUS_20600 10039 10761 gene locus_tag LOCUS_20610 10039 10761 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038282.1 protein_id gnl|my_center|LOCUS_20610 11000 11887 gene locus_tag LOCUS_20620 11000 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 13627 11915 gene locus_tag LOCUS_20630 13627 11915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 14156 13638 gene locus_tag LOCUS_20640 14156 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 14854 14261 gene locus_tag LOCUS_20650 14854 14261 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522352.1 protein_id gnl|my_center|LOCUS_20650 15886 14927 gene locus_tag LOCUS_20660 15886 14927 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_20660 16349 15897 gene locus_tag LOCUS_20670 16349 15897 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707313.1 protein_id gnl|my_center|LOCUS_20670 16838 19651 gene locus_tag LOCUS_20680 16838 19651 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_20680 >Feature sequence063 301 1062 gene locus_tag LOCUS_20690 301 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1896 1108 gene locus_tag LOCUS_20700 1896 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2695 1973 gene locus_tag LOCUS_20710 2695 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2800 3573 gene locus_tag LOCUS_20720 2800 3573 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081153.1 protein_id gnl|my_center|LOCUS_20720 4581 3583 gene locus_tag LOCUS_20730 4581 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4804 5253 gene locus_tag LOCUS_20740 4804 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 5594 7831 gene locus_tag LOCUS_20750 gene parC 5594 7831 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036587.1 protein_id gnl|my_center|LOCUS_20750 7947 8402 gene locus_tag LOCUS_20760 7947 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 8936 8448 gene locus_tag LOCUS_20770 8936 8448 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_20770 8935 9864 gene locus_tag LOCUS_20780 8935 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 9927 12299 gene locus_tag LOCUS_20790 9927 12299 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_20790 13401 12322 gene locus_tag LOCUS_20800 13401 12322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 14622 13474 gene locus_tag LOCUS_20810 gene dapE 14622 13474 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941552.1 protein_id gnl|my_center|LOCUS_20810 15040 14681 gene locus_tag LOCUS_20820 15040 14681 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036578.1 protein_id gnl|my_center|LOCUS_20820 15944 15120 gene locus_tag LOCUS_20830 15944 15120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20830 16205 16495 gene locus_tag LOCUS_20840 16205 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507946.1 protein_id gnl|my_center|LOCUS_20840 17387 16509 gene locus_tag LOCUS_20850 17387 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 18450 17380 gene locus_tag LOCUS_20860 18450 17380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 18519 18791 gene locus_tag LOCUS_20870 18519 18791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence064 1119 1 gene locus_tag LOCUS_20880 1119 1 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267314.1 protein_id gnl|my_center|LOCUS_20880 2039 1167 gene locus_tag LOCUS_20890 2039 1167 CDS product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275299.1 protein_id gnl|my_center|LOCUS_20890 2858 2097 gene locus_tag LOCUS_20900 2858 2097 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038742.1 protein_id gnl|my_center|LOCUS_20900 3781 2855 gene locus_tag LOCUS_20910 3781 2855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 protein_id gnl|my_center|LOCUS_20910 4120 5334 gene locus_tag LOCUS_20920 4120 5334 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_20920 5378 6628 gene locus_tag LOCUS_20930 5378 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 6991 6647 gene locus_tag LOCUS_20940 6991 6647 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036505.1 protein_id gnl|my_center|LOCUS_20940 7860 7120 gene locus_tag LOCUS_20950 7860 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 8356 7976 gene locus_tag LOCUS_20960 8356 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 8803 9216 gene locus_tag LOCUS_20970 8803 9216 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112456.1 protein_id gnl|my_center|LOCUS_20970 9484 9248 gene locus_tag LOCUS_20980 9484 9248 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036497.1 protein_id gnl|my_center|LOCUS_20980 10111 9602 gene locus_tag LOCUS_20990 gene msrA 10111 9602 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530793.1 protein_id gnl|my_center|LOCUS_20990 10447 11574 gene locus_tag LOCUS_21000 10447 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 11571 12737 gene locus_tag LOCUS_21010 11571 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 15631 12707 gene locus_tag LOCUS_21020 15631 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 17187 15736 gene locus_tag LOCUS_21030 gene cycA 17187 15736 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038625.1 protein_id gnl|my_center|LOCUS_21030 17328 18257 gene locus_tag LOCUS_21040 17328 18257 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_21040 18254 19327 gene locus_tag LOCUS_21050 18254 19327 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence065 <1 900 gene locus_tag LOCUS_21060 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036954.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase 1626 910 gene locus_tag LOCUS_21070 gene aat 1626 910 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816030.1 protein_id gnl|my_center|LOCUS_21070 2768 1623 gene locus_tag LOCUS_21080 2768 1623 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 protein_id gnl|my_center|LOCUS_21080 3834 2872 gene locus_tag LOCUS_21090 gene trxB 3834 2872 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037135.1 protein_id gnl|my_center|LOCUS_21090 4070 6376 gene locus_tag LOCUS_21100 4070 6376 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_21100 6533 7198 gene locus_tag LOCUS_21110 gene lolA 6533 7198 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 protein_id gnl|my_center|LOCUS_21110 7754 7236 gene locus_tag LOCUS_21120 7754 7236 CDS product hydrogenase/oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528368.1 protein_id gnl|my_center|LOCUS_21120 9305 7761 gene locus_tag LOCUS_21130 9305 7761 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_21130 10772 9318 gene locus_tag LOCUS_21140 10772 9318 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_21140 11439 10774 gene locus_tag LOCUS_21150 11439 10774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_21150 12391 11444 gene locus_tag LOCUS_21160 12391 11444 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_21160 14409 12388 gene locus_tag LOCUS_21170 gene hyfB 14409 12388 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_21170 14528 14752 gene locus_tag LOCUS_21180 14528 14752 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528379.1 protein_id gnl|my_center|LOCUS_21180 17792 14802 gene locus_tag LOCUS_21190 17792 14802 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_21190 18047 19384 gene locus_tag LOCUS_21200 18047 19384 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037140.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence066 879 10 gene locus_tag LOCUS_21210 879 10 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_21210 2074 956 gene locus_tag LOCUS_21220 gene cfa 2074 956 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258479.1 protein_id gnl|my_center|LOCUS_21220 2460 2122 gene locus_tag LOCUS_21230 2460 2122 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554203.1 protein_id gnl|my_center|LOCUS_21230 2830 2474 gene locus_tag LOCUS_21240 gene crcB 2830 2474 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_21240 3174 4382 gene locus_tag LOCUS_21250 3174 4382 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_21250 5550 4399 gene locus_tag LOCUS_21260 5550 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6153 5656 gene locus_tag LOCUS_21270 6153 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275420.1 protein_id gnl|my_center|LOCUS_21270 6539 6255 gene locus_tag LOCUS_21280 gene minE 6539 6255 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036323.1 protein_id gnl|my_center|LOCUS_21280 7360 6545 gene locus_tag LOCUS_21290 gene minD 7360 6545 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036324.1 protein_id gnl|my_center|LOCUS_21290 8168 7398 gene locus_tag LOCUS_21300 gene minC 8168 7398 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036325.1 protein_id gnl|my_center|LOCUS_21300 8812 8165 gene locus_tag LOCUS_21310 8812 8165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036326.1 protein_id gnl|my_center|LOCUS_21310 9041 10264 gene locus_tag LOCUS_21320 9041 10264 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_21320 10409 10993 gene locus_tag LOCUS_21330 10409 10993 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_21330 11193 12551 gene locus_tag LOCUS_21340 11193 12551 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036329.1 protein_id gnl|my_center|LOCUS_21340 12743 13696 gene locus_tag LOCUS_21350 12743 13696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_21350 13693 14427 gene locus_tag LOCUS_21360 13693 14427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_21360 14431 16341 gene locus_tag LOCUS_21370 14431 16341 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_21370 16394 17323 gene locus_tag LOCUS_21380 16394 17323 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814205.1 protein_id gnl|my_center|LOCUS_21380 17810 17337 gene locus_tag LOCUS_21390 17810 17337 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192175.1 protein_id gnl|my_center|LOCUS_21390 18421 17807 gene locus_tag LOCUS_21400 18421 17807 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203008.1 protein_id gnl|my_center|LOCUS_21400 18568 18885 gene locus_tag LOCUS_21410 18568 18885 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_21410 18953 19327 gene locus_tag LOCUS_21420 18953 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence067 <1 951 gene locus_tag LOCUS_21430 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038870.1:efflux RND transporter permease subunit 1689 1069 gene locus_tag LOCUS_21440 1689 1069 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038077.1 protein_id gnl|my_center|LOCUS_21440 1795 2688 gene locus_tag LOCUS_21450 1795 2688 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038078.1 protein_id gnl|my_center|LOCUS_21450 4496 3204 gene locus_tag LOCUS_21460 4496 3204 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346353.1 protein_id gnl|my_center|LOCUS_21460 5483 4599 gene locus_tag LOCUS_21470 5483 4599 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528797.1 protein_id gnl|my_center|LOCUS_21470 6138 5548 gene locus_tag LOCUS_21480 6138 5548 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389378.1 protein_id gnl|my_center|LOCUS_21480 6296 7687 gene locus_tag LOCUS_21490 6296 7687 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_21490 7684 9174 gene locus_tag LOCUS_21500 7684 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21500 9342 9872 gene locus_tag LOCUS_21510 9342 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 11426 9897 gene locus_tag LOCUS_21520 11426 9897 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036592.1 protein_id gnl|my_center|LOCUS_21520 12718 11525 gene locus_tag LOCUS_21530 12718 11525 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_21530 14181 12727 gene locus_tag LOCUS_21540 14181 12727 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112617.1 protein_id gnl|my_center|LOCUS_21540 14701 14213 gene locus_tag LOCUS_21550 14701 14213 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036589.1 protein_id gnl|my_center|LOCUS_21550 14901 15767 gene locus_tag LOCUS_21560 14901 15767 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_21560 15807 16229 gene locus_tag LOCUS_21570 15807 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 16292 17068 gene locus_tag LOCUS_21580 16292 17068 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence068 748 110 gene locus_tag LOCUS_21590 748 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1235 1606 gene locus_tag LOCUS_21600 1235 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1815 2093 gene locus_tag LOCUS_21610 1815 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2160 2501 gene locus_tag LOCUS_21620 2160 2501 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640254.1 protein_id gnl|my_center|LOCUS_21620 2498 2977 gene locus_tag LOCUS_21630 2498 2977 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_21630 2985 3494 gene locus_tag LOCUS_21640 2985 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 3484 4539 gene locus_tag LOCUS_21650 gene arsB 3484 4539 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_21650 4842 5237 gene locus_tag LOCUS_21660 4842 5237 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247822.1 protein_id gnl|my_center|LOCUS_21660 7133 5391 gene locus_tag LOCUS_21670 7133 5391 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 protein_id gnl|my_center|LOCUS_21670 7449 10400 gene locus_tag LOCUS_21680 7449 10400 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_21680 10505 12094 gene locus_tag LOCUS_21690 10505 12094 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 protein_id gnl|my_center|LOCUS_21690 12732 12163 gene locus_tag LOCUS_21700 12732 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 14413 12911 gene locus_tag LOCUS_21710 14413 12911 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198157253.1 protein_id gnl|my_center|LOCUS_21710 14775 16358 gene locus_tag LOCUS_21720 14775 16358 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_21720 16385 18766 gene locus_tag LOCUS_21730 16385 18766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence069 967 11 gene locus_tag LOCUS_21740 967 11 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036549.1 protein_id gnl|my_center|LOCUS_21740 1126 1506 gene locus_tag LOCUS_21750 1126 1506 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_21750 5154 1606 gene locus_tag LOCUS_21760 gene dnaE 5154 1606 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036550.1 protein_id gnl|my_center|LOCUS_21760 5911 5318 gene locus_tag LOCUS_21770 5911 5318 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036551.1 protein_id gnl|my_center|LOCUS_21770 7151 5940 gene locus_tag LOCUS_21780 gene lpxB 7151 5940 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629001.1 protein_id gnl|my_center|LOCUS_21780 7969 7196 gene locus_tag LOCUS_21790 gene lpxA 7969 7196 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036553.1 protein_id gnl|my_center|LOCUS_21790 8439 7966 gene locus_tag LOCUS_21800 gene fabZ 8439 7966 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036554.1 protein_id gnl|my_center|LOCUS_21800 9460 8432 gene locus_tag LOCUS_21810 gene lpxD 9460 8432 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036555.1 protein_id gnl|my_center|LOCUS_21810 12011 9597 gene locus_tag LOCUS_21820 gene bamA 12011 9597 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237827.1 protein_id gnl|my_center|LOCUS_21820 13555 12209 gene locus_tag LOCUS_21830 gene rseP 13555 12209 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036558.1 protein_id gnl|my_center|LOCUS_21830 14767 13592 gene locus_tag LOCUS_21840 14767 13592 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036559.1 protein_id gnl|my_center|LOCUS_21840 15588 14770 gene locus_tag LOCUS_21850 15588 14770 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036560.1 protein_id gnl|my_center|LOCUS_21850 16337 15597 gene locus_tag LOCUS_21860 gene uppS 16337 15597 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921694.1 protein_id gnl|my_center|LOCUS_21860 16913 16356 gene locus_tag LOCUS_21870 gene frr 16913 16356 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036562.1 protein_id gnl|my_center|LOCUS_21870 17708 16986 gene locus_tag LOCUS_21880 gene pyrH 17708 16986 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_21880 18766 17885 gene locus_tag LOCUS_21890 gene tsf 18766 17885 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036566.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence070 541 1098 gene locus_tag LOCUS_21900 gene nudE 541 1098 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216848.1 protein_id gnl|my_center|LOCUS_21900 1095 1919 gene locus_tag LOCUS_21910 gene cysQ 1095 1919 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_21910 2005 2805 gene locus_tag LOCUS_21920 gene mazG 2005 2805 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_21920 3385 2864 gene locus_tag LOCUS_21930 3385 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3528 4298 gene locus_tag LOCUS_21940 3528 4298 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036683.1 protein_id gnl|my_center|LOCUS_21940 5511 4369 gene locus_tag LOCUS_21950 5511 4369 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815915.1 protein_id gnl|my_center|LOCUS_21950 6172 5543 gene locus_tag LOCUS_21960 6172 5543 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_21960 8704 6221 gene locus_tag LOCUS_21970 8704 6221 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813269.1 protein_id gnl|my_center|LOCUS_21970 9396 8701 gene locus_tag LOCUS_21980 9396 8701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_21980 9419 10027 gene locus_tag LOCUS_21990 9419 10027 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994095.1 protein_id gnl|my_center|LOCUS_21990 10127 10858 gene locus_tag LOCUS_22000 10127 10858 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506728.1 protein_id gnl|my_center|LOCUS_22000 10887 11906 gene locus_tag LOCUS_22010 10887 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 13372 11993 gene locus_tag LOCUS_22020 13372 11993 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479724.1 protein_id gnl|my_center|LOCUS_22020 14006 13452 gene locus_tag LOCUS_22030 gene yjgA 14006 13452 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037735.1 protein_id gnl|my_center|LOCUS_22030 14289 14053 gene locus_tag LOCUS_22040 14289 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 14416 15798 gene locus_tag LOCUS_22050 gene pmbA 14416 15798 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_22050 15924 16325 gene locus_tag LOCUS_22060 15924 16325 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_22060 17302 16403 gene locus_tag LOCUS_22070 17302 16403 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037730.1 protein_id gnl|my_center|LOCUS_22070 17543 17286 gene locus_tag LOCUS_22080 17543 17286 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037729.1 protein_id gnl|my_center|LOCUS_22080 <18507 17577 gene locus_tag LOCUS_22090 <18507 17577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994173.1:tRNA lysidine(34) synthetase TilS >Feature sequence071 2059 341 gene locus_tag LOCUS_22100 gene ilvD 2059 341 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 protein_id gnl|my_center|LOCUS_22100 3337 2240 gene locus_tag LOCUS_22110 gene leuB 3337 2240 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_22110 3921 3334 gene locus_tag LOCUS_22120 gene leuD 3921 3334 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_22120 5467 4058 gene locus_tag LOCUS_22130 gene leuC 5467 4058 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_22130 6426 5464 gene locus_tag LOCUS_22140 6426 5464 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_22140 8038 6443 gene locus_tag LOCUS_22150 8038 6443 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038426.1 protein_id gnl|my_center|LOCUS_22150 9807 8470 gene locus_tag LOCUS_22160 gene thrC 9807 8470 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036973.1 protein_id gnl|my_center|LOCUS_22160 10826 9804 gene locus_tag LOCUS_22170 10826 9804 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036971.1 protein_id gnl|my_center|LOCUS_22170 11974 10823 gene locus_tag LOCUS_22180 11974 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 12510 13565 gene locus_tag LOCUS_22190 12510 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 13562 14101 gene locus_tag LOCUS_22200 13562 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 <18445 14182 gene locus_tag LOCUS_22210 <18445 14182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046237820.1:autotransporter domain-containing protein >Feature sequence072 822 1739 gene locus_tag LOCUS_22220 gene hemC 822 1739 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038603.1 protein_id gnl|my_center|LOCUS_22220 2649 1837 gene locus_tag LOCUS_22230 2649 1837 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 protein_id gnl|my_center|LOCUS_22230 2823 3800 gene locus_tag LOCUS_22240 2823 3800 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_22240 5586 3814 gene locus_tag LOCUS_22250 5586 3814 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_22250 5801 6748 gene locus_tag LOCUS_22260 5801 6748 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064705.1 protein_id gnl|my_center|LOCUS_22260 7130 6762 gene locus_tag LOCUS_22270 7130 6762 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_22270 7923 7207 gene locus_tag LOCUS_22280 7923 7207 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_22280 8929 8060 gene locus_tag LOCUS_22290 8929 8060 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038925.1 protein_id gnl|my_center|LOCUS_22290 9811 8933 gene locus_tag LOCUS_22300 9811 8933 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_22300 10979 9888 gene locus_tag LOCUS_22310 gene ugpC 10979 9888 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037286.1 protein_id gnl|my_center|LOCUS_22310 11109 12470 gene locus_tag LOCUS_22320 11109 12470 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_22320 13215 12586 gene locus_tag LOCUS_22330 gene rsmG 13215 12586 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 protein_id gnl|my_center|LOCUS_22330 13776 13327 gene locus_tag LOCUS_22340 13776 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 14465 15472 gene locus_tag LOCUS_22350 14465 15472 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence073 1538 1194 gene locus_tag LOCUS_22360 1538 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2133 1627 gene locus_tag LOCUS_22370 2133 1627 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192577.1 protein_id gnl|my_center|LOCUS_22370 3098 2130 gene locus_tag LOCUS_22380 3098 2130 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275487.1 protein_id gnl|my_center|LOCUS_22380 4161 3025 gene locus_tag LOCUS_22390 gene hemH 4161 3025 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_22390 4258 4947 gene locus_tag LOCUS_22400 4258 4947 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275486.1 protein_id gnl|my_center|LOCUS_22400 5011 5271 gene locus_tag LOCUS_22410 5011 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 5296 5721 gene locus_tag LOCUS_22420 5296 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 5708 6490 gene locus_tag LOCUS_22430 gene tatC 5708 6490 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266364.1 protein_id gnl|my_center|LOCUS_22430 8680 6506 gene locus_tag LOCUS_22440 8680 6506 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038847.1 protein_id gnl|my_center|LOCUS_22440 10271 9075 gene locus_tag LOCUS_22450 10271 9075 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018972380.1 protein_id gnl|my_center|LOCUS_22450 10378 11778 gene locus_tag LOCUS_22460 10378 11778 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038844.1 protein_id gnl|my_center|LOCUS_22460 11821 13707 gene locus_tag LOCUS_22470 gene sppA 11821 13707 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038843.1 protein_id gnl|my_center|LOCUS_22470 14016 13813 gene locus_tag LOCUS_22480 14016 13813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 14160 14942 gene locus_tag LOCUS_22490 14160 14942 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_22490 15926 14982 gene locus_tag LOCUS_22500 15926 14982 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038480.1 protein_id gnl|my_center|LOCUS_22500 16122 16913 gene locus_tag LOCUS_22510 16122 16913 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence074 744 394 gene locus_tag LOCUS_22520 744 394 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 protein_id gnl|my_center|LOCUS_22520 1113 802 gene locus_tag LOCUS_22530 1113 802 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_22530 1424 1110 gene locus_tag LOCUS_22540 1424 1110 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 protein_id gnl|my_center|LOCUS_22540 3158 1488 gene locus_tag LOCUS_22550 gene hutU 3158 1488 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895695.1 protein_id gnl|my_center|LOCUS_22550 3383 4861 gene locus_tag LOCUS_22560 3383 4861 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 protein_id gnl|my_center|LOCUS_22560 4921 5433 gene locus_tag LOCUS_22570 4921 5433 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_22570 6453 5440 gene locus_tag LOCUS_22580 6453 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 6745 8046 gene locus_tag LOCUS_22590 6745 8046 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640195.1 protein_id gnl|my_center|LOCUS_22590 9411 8140 gene locus_tag LOCUS_22600 9411 8140 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_22600 12660 9598 gene locus_tag LOCUS_22610 12660 9598 CDS product DUF6067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202412.1 protein_id gnl|my_center|LOCUS_22610 13741 12755 gene locus_tag LOCUS_22620 13741 12755 CDS product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232772.1 protein_id gnl|my_center|LOCUS_22620 15225 13855 gene locus_tag LOCUS_22630 15225 13855 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_22630 15331 16896 gene locus_tag LOCUS_22640 15331 16896 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence075 599 928 gene locus_tag LOCUS_22650 599 928 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_22650 925 1230 gene locus_tag LOCUS_22660 925 1230 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_22660 1427 2008 gene locus_tag LOCUS_22670 1427 2008 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086729.1 protein_id gnl|my_center|LOCUS_22670 2151 2987 gene locus_tag LOCUS_22680 2151 2987 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528434.1 protein_id gnl|my_center|LOCUS_22680 2984 3985 gene locus_tag LOCUS_22690 2984 3985 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_22690 4386 6923 gene locus_tag LOCUS_22700 4386 6923 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 protein_id gnl|my_center|LOCUS_22700 7892 6999 gene locus_tag LOCUS_22710 7892 6999 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088296.1 protein_id gnl|my_center|LOCUS_22710 8090 9073 gene locus_tag LOCUS_22720 8090 9073 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_22720 9153 9854 gene locus_tag LOCUS_22730 9153 9854 CDS product DUF3348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275455.1 protein_id gnl|my_center|LOCUS_22730 9865 11961 gene locus_tag LOCUS_22740 9865 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 11958 12599 gene locus_tag LOCUS_22750 11958 12599 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038795.1 protein_id gnl|my_center|LOCUS_22750 12596 13126 gene locus_tag LOCUS_22760 12596 13126 CDS product DUF2894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064408.1 protein_id gnl|my_center|LOCUS_22760 15713 13158 gene locus_tag LOCUS_22770 gene thrA 15713 13158 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036970.1 protein_id gnl|my_center|LOCUS_22770 <17250 15883 gene locus_tag LOCUS_22780 <17250 15883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188420.1:acetyl-CoA hydrolase/transferase family protein >Feature sequence076 1157 369 gene locus_tag LOCUS_22790 gene surE 1157 369 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 protein_id gnl|my_center|LOCUS_22790 1290 1835 gene locus_tag LOCUS_22800 1290 1835 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 protein_id gnl|my_center|LOCUS_22800 2847 1825 gene locus_tag LOCUS_22810 gene truD 2847 1825 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_22810 3461 2988 gene locus_tag LOCUS_22820 gene ispF 3461 2988 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036880.1 protein_id gnl|my_center|LOCUS_22820 4157 3462 gene locus_tag LOCUS_22830 gene ispD 4157 3462 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036879.1 protein_id gnl|my_center|LOCUS_22830 4480 4154 gene locus_tag LOCUS_22840 4480 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 5798 4500 gene locus_tag LOCUS_22850 gene eno 5798 4500 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036877.1 protein_id gnl|my_center|LOCUS_22850 6740 5907 gene locus_tag LOCUS_22860 gene kdsA 6740 5907 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_22860 8407 6737 gene locus_tag LOCUS_22870 8407 6737 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036874.1 protein_id gnl|my_center|LOCUS_22870 8552 10351 gene locus_tag LOCUS_22880 8552 10351 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065133.1 protein_id gnl|my_center|LOCUS_22880 12577 10439 gene locus_tag LOCUS_22890 12577 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 14038 13262 gene locus_tag LOCUS_22900 14038 13262 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106577.1 protein_id gnl|my_center|LOCUS_22900 15506 14829 gene locus_tag LOCUS_22910 15506 14829 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_22910 15726 16181 gene locus_tag LOCUS_22920 15726 16181 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_22920 16829 16209 gene locus_tag LOCUS_22930 16829 16209 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919514.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence077 <1 606 gene locus_tag LOCUS_22940 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004201735.1:NADP-dependent oxidoreductase 1182 1937 gene locus_tag LOCUS_22950 1182 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3642 2050 gene locus_tag LOCUS_22960 3642 2050 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196212.1 protein_id gnl|my_center|LOCUS_22960 3836 4300 gene locus_tag LOCUS_22970 3836 4300 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_22970 4490 5761 gene locus_tag LOCUS_22980 4490 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 6186 7682 gene locus_tag LOCUS_22990 6186 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 7701 10895 gene locus_tag LOCUS_23000 7701 10895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 10912 11373 gene locus_tag LOCUS_23010 10912 11373 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_23010 11391 12569 gene locus_tag LOCUS_23020 11391 12569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 12473 13810 gene locus_tag LOCUS_23030 12473 13810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence078 426 1388 gene locus_tag LOCUS_23040 426 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3206 5470 gene locus_tag LOCUS_23050 3206 5470 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994187.1 protein_id gnl|my_center|LOCUS_23050 5789 5649 gene locus_tag LOCUS_23060 5789 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 7696 5903 gene locus_tag LOCUS_23070 7696 5903 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265771.1 protein_id gnl|my_center|LOCUS_23070 8069 8452 gene locus_tag LOCUS_23080 8069 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 8496 9533 gene locus_tag LOCUS_23090 8496 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 9530 10273 gene locus_tag LOCUS_23100 9530 10273 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_23100 10357 11502 gene locus_tag LOCUS_23110 10357 11502 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038940.1 protein_id gnl|my_center|LOCUS_23110 11574 13631 gene locus_tag LOCUS_23120 gene prlC 11574 13631 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_23120 13954 13745 gene locus_tag LOCUS_23130 13954 13745 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115568.1 protein_id gnl|my_center|LOCUS_23130 14292 15086 gene locus_tag LOCUS_23140 gene xth 14292 15086 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence079 2127 1270 gene locus_tag LOCUS_23150 2127 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2523 4562 gene locus_tag LOCUS_23160 gene fusA 2523 4562 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_23160 5155 4676 gene locus_tag LOCUS_23170 5155 4676 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944109.1 protein_id gnl|my_center|LOCUS_23170 5266 5748 gene locus_tag LOCUS_23180 5266 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5788 7578 gene locus_tag LOCUS_23190 5788 7578 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037573.1 protein_id gnl|my_center|LOCUS_23190 8189 7950 gene locus_tag LOCUS_23200 8189 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 9717 8278 gene locus_tag LOCUS_23210 9717 8278 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223097.1 protein_id gnl|my_center|LOCUS_23210 9876 10349 gene locus_tag LOCUS_23220 9876 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 11187 10408 gene locus_tag LOCUS_23230 11187 10408 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_23230 11431 12030 gene locus_tag LOCUS_23240 11431 12030 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_23240 12181 14073 gene locus_tag LOCUS_23250 gene dxs 12181 14073 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037575.1 protein_id gnl|my_center|LOCUS_23250 <15470 14144 gene locus_tag LOCUS_23260 <15470 14144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224340.1:glycoside hydrolase family 18 protein >Feature sequence080 1390 836 gene locus_tag LOCUS_23270 1390 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2424 1468 gene locus_tag LOCUS_23280 2424 1468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_23280 3278 2421 gene locus_tag LOCUS_23290 3278 2421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_23290 3649 3275 gene locus_tag LOCUS_23300 3649 3275 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_23300 3994 3653 gene locus_tag LOCUS_23310 3994 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 6000 4330 gene locus_tag LOCUS_23320 6000 4330 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_23320 6714 6124 gene locus_tag LOCUS_23330 6714 6124 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969187.1 protein_id gnl|my_center|LOCUS_23330 6827 7801 gene locus_tag LOCUS_23340 6827 7801 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_23340 7863 9005 gene locus_tag LOCUS_23350 7863 9005 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 protein_id gnl|my_center|LOCUS_23350 9017 9808 gene locus_tag LOCUS_23360 9017 9808 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 protein_id gnl|my_center|LOCUS_23360 10139 9879 gene locus_tag LOCUS_23370 10139 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23370 11793 10255 gene locus_tag LOCUS_23380 11793 10255 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037359.1 protein_id gnl|my_center|LOCUS_23380 12653 11790 gene locus_tag LOCUS_23390 12653 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 13591 12689 gene locus_tag LOCUS_23400 13591 12689 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_23400 14658 14335 gene locus_tag LOCUS_23410 14658 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 14594 14965 gene locus_tag LOCUS_23420 14594 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence081 166 1362 gene locus_tag LOCUS_23430 166 1362 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968156.1 protein_id gnl|my_center|LOCUS_23430 1398 1631 gene locus_tag LOCUS_23440 1398 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2218 3855 gene locus_tag LOCUS_23450 2218 3855 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036788256.1 protein_id gnl|my_center|LOCUS_23450 4490 5551 gene locus_tag LOCUS_23460 4490 5551 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_23460 5885 6373 gene locus_tag LOCUS_23470 5885 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 7866 6412 gene locus_tag LOCUS_23480 7866 6412 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930897.1 protein_id gnl|my_center|LOCUS_23480 9095 7938 gene locus_tag LOCUS_23490 gene prpC 9095 7938 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 protein_id gnl|my_center|LOCUS_23490 9994 9116 gene locus_tag LOCUS_23500 gene prpB 9994 9116 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040192.1 protein_id gnl|my_center|LOCUS_23500 10190 12118 gene locus_tag LOCUS_23510 gene prpR 10190 12118 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533757.1 protein_id gnl|my_center|LOCUS_23510 12160 13374 gene locus_tag LOCUS_23520 12160 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 13371 13985 gene locus_tag LOCUS_23530 13371 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence082 <1 676 gene locus_tag LOCUS_23540 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035460.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase 783 3800 gene locus_tag LOCUS_23550 783 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 4193 3852 gene locus_tag LOCUS_23560 4193 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 5008 4325 gene locus_tag LOCUS_23570 5008 4325 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976241.1 protein_id gnl|my_center|LOCUS_23570 6098 5082 gene locus_tag LOCUS_23580 gene glk 6098 5082 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037288.1 protein_id gnl|my_center|LOCUS_23580 7870 6311 gene locus_tag LOCUS_23590 7870 6311 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144591055.1 protein_id gnl|my_center|LOCUS_23590 8024 9049 gene locus_tag LOCUS_23600 gene hemB 8024 9049 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_23600 9062 9742 gene locus_tag LOCUS_23610 9062 9742 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186914724.1 protein_id gnl|my_center|LOCUS_23610 9732 11165 gene locus_tag LOCUS_23620 9732 11165 CDS product heavy metal sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943578.1 protein_id gnl|my_center|LOCUS_23620 11852 11352 gene locus_tag LOCUS_23630 11852 11352 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345473.1 protein_id gnl|my_center|LOCUS_23630 12124 11849 gene locus_tag LOCUS_23640 12124 11849 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801912.1 protein_id gnl|my_center|LOCUS_23640 12571 13572 gene locus_tag LOCUS_23650 12571 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence083 1 420 gene locus_tag LOCUS_23660 1 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 1182 442 gene locus_tag LOCUS_23670 1182 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 2125 1277 gene locus_tag LOCUS_23680 2125 1277 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530212.1 protein_id gnl|my_center|LOCUS_23680 2456 2130 gene locus_tag LOCUS_23690 2456 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3654 2572 gene locus_tag LOCUS_23700 gene obgE 3654 2572 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036350.1 protein_id gnl|my_center|LOCUS_23700 4144 3887 gene locus_tag LOCUS_23710 gene rpmA 4144 3887 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036349.1 protein_id gnl|my_center|LOCUS_23710 4478 4164 gene locus_tag LOCUS_23720 gene rplU 4478 4164 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271409.1 protein_id gnl|my_center|LOCUS_23720 4795 4574 gene locus_tag LOCUS_23730 4795 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4807 7734 gene locus_tag LOCUS_23740 gene uvrA 4807 7734 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036348.1 protein_id gnl|my_center|LOCUS_23740 7731 8198 gene locus_tag LOCUS_23750 7731 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 8305 9777 gene locus_tag LOCUS_23760 8305 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 9798 10553 gene locus_tag LOCUS_23770 9798 10553 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_23770 11513 10665 gene locus_tag LOCUS_23780 11513 10665 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036721.1 protein_id gnl|my_center|LOCUS_23780 12100 11510 gene locus_tag LOCUS_23790 12100 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23790 12291 12100 gene locus_tag LOCUS_23800 12291 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23800 13043 12318 gene locus_tag LOCUS_23810 13043 12318 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957701.1 protein_id gnl|my_center|LOCUS_23810 >Feature sequence084 967 41 gene locus_tag LOCUS_23820 gene prmB 967 41 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037683.1 protein_id gnl|my_center|LOCUS_23820 1114 1950 gene locus_tag LOCUS_23830 gene asd 1114 1950 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037685.1 protein_id gnl|my_center|LOCUS_23830 2095 2541 gene locus_tag LOCUS_23840 2095 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3957 2590 gene locus_tag LOCUS_23850 3957 2590 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275325.1 protein_id gnl|my_center|LOCUS_23850 4203 5534 gene locus_tag LOCUS_23860 4203 5534 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037688.1 protein_id gnl|my_center|LOCUS_23860 5777 6277 gene locus_tag LOCUS_23870 gene greB 5777 6277 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037693.1 protein_id gnl|my_center|LOCUS_23870 6321 7211 gene locus_tag LOCUS_23880 6321 7211 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 protein_id gnl|my_center|LOCUS_23880 7498 9516 gene locus_tag LOCUS_23890 7498 9516 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_23890 9616 12138 gene locus_tag LOCUS_23900 9616 12138 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_23900 13103 12297 gene locus_tag LOCUS_23910 13103 12297 CDS product DUF3025 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527732.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence085 <1 2908 gene locus_tag LOCUS_23920 <1 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275461.1:efflux RND transporter permease subunit 3048 6191 gene locus_tag LOCUS_23930 3048 6191 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038870.1 protein_id gnl|my_center|LOCUS_23930 6540 6175 gene locus_tag LOCUS_23940 6540 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 6835 9060 gene locus_tag LOCUS_23950 6835 9060 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 protein_id gnl|my_center|LOCUS_23950 9195 10229 gene locus_tag LOCUS_23960 9195 10229 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275525.1 protein_id gnl|my_center|LOCUS_23960 11285 10341 gene locus_tag LOCUS_23970 11285 10341 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence086 411 818 gene locus_tag LOCUS_23980 411 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1354 854 gene locus_tag LOCUS_23990 gene tpx 1354 854 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_23990 2888 1470 gene locus_tag LOCUS_24000 gene hemN 2888 1470 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037247.1 protein_id gnl|my_center|LOCUS_24000 3953 2967 gene locus_tag LOCUS_24010 3953 2967 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 protein_id gnl|my_center|LOCUS_24010 5290 3983 gene locus_tag LOCUS_24020 gene hmgA 5290 3983 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035691.1 protein_id gnl|my_center|LOCUS_24020 6397 5303 gene locus_tag LOCUS_24030 gene hppD 6397 5303 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689502.1 protein_id gnl|my_center|LOCUS_24030 6512 7006 gene locus_tag LOCUS_24040 6512 7006 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_24040 8199 7066 gene locus_tag LOCUS_24050 8199 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 9947 8433 gene locus_tag LOCUS_24060 9947 8433 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_24060 11517 10033 gene locus_tag LOCUS_24070 11517 10033 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_24070 12425 11580 gene locus_tag LOCUS_24080 12425 11580 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence087 2731 4200 gene locus_tag LOCUS_24090 2731 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 5157 4234 gene locus_tag LOCUS_24100 5157 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 5635 8463 gene locus_tag LOCUS_24110 5635 8463 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035888.1 protein_id gnl|my_center|LOCUS_24110 10463 8469 gene locus_tag LOCUS_24120 10463 8469 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_24120 10595 10966 gene locus_tag LOCUS_24130 10595 10966 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037778.1 protein_id gnl|my_center|LOCUS_24130 11525 10989 gene locus_tag LOCUS_24140 11525 10989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 13048 11528 gene locus_tag LOCUS_24150 13048 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence088 453 61 gene locus_tag LOCUS_24160 gene rpsI 453 61 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 protein_id gnl|my_center|LOCUS_24160 891 463 gene locus_tag LOCUS_24170 gene rplM 891 463 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483082.1 protein_id gnl|my_center|LOCUS_24170 1021 2235 gene locus_tag LOCUS_24180 gene glcF 1021 2235 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_24180 2266 2907 gene locus_tag LOCUS_24190 gene coq7 2266 2907 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035727.1 protein_id gnl|my_center|LOCUS_24190 3801 3019 gene locus_tag LOCUS_24200 gene speD 3801 3019 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990692.1 protein_id gnl|my_center|LOCUS_24200 4090 4788 gene locus_tag LOCUS_24210 gene crp 4090 4788 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035725.1 protein_id gnl|my_center|LOCUS_24210 4923 5573 gene locus_tag LOCUS_24220 4923 5573 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 protein_id gnl|my_center|LOCUS_24220 5570 7216 gene locus_tag LOCUS_24230 gene ubiB 5570 7216 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035479.1 protein_id gnl|my_center|LOCUS_24230 7362 8051 gene locus_tag LOCUS_24240 7362 8051 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275145.1 protein_id gnl|my_center|LOCUS_24240 8147 8569 gene locus_tag LOCUS_24250 gene arfB 8147 8569 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_24250 8566 9162 gene locus_tag LOCUS_24260 8566 9162 CDS product lysophosphatidylcholine acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035483.1 protein_id gnl|my_center|LOCUS_24260 10286 9246 gene locus_tag LOCUS_24270 10286 9246 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_24270 10410 12005 gene locus_tag LOCUS_24280 gene aceB 10410 12005 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035492.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence089 271 360 gene locus_tag LOCUS_t00390 271 360 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 509 1243 gene locus_tag LOCUS_24290 509 1243 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929763.1 protein_id gnl|my_center|LOCUS_24290 1448 1858 gene locus_tag LOCUS_24300 1448 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2165 6109 gene locus_tag LOCUS_24310 2165 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 6955 6143 gene locus_tag LOCUS_24320 6955 6143 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640329.1 protein_id gnl|my_center|LOCUS_24320 7359 6952 gene locus_tag LOCUS_24330 gene cyoD 7359 6952 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809276.1 protein_id gnl|my_center|LOCUS_24330 7982 7356 gene locus_tag LOCUS_24340 gene cyoC 7982 7356 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819722.1 protein_id gnl|my_center|LOCUS_24340 9991 7979 gene locus_tag LOCUS_24350 gene cyoB 9991 7979 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531505.1 protein_id gnl|my_center|LOCUS_24350 10959 10015 gene locus_tag LOCUS_24360 gene cyoA 10959 10015 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392423.1 protein_id gnl|my_center|LOCUS_24360 11233 12567 gene locus_tag LOCUS_24370 11233 12567 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976133.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence090 1584 181 gene locus_tag LOCUS_24380 1584 181 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 protein_id gnl|my_center|LOCUS_24380 2728 1817 gene locus_tag LOCUS_24390 2728 1817 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_24390 3851 2817 gene locus_tag LOCUS_24400 3851 2817 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035354.1 protein_id gnl|my_center|LOCUS_24400 3992 4597 gene locus_tag LOCUS_24410 3992 4597 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262589.1 protein_id gnl|my_center|LOCUS_24410 4599 4802 gene locus_tag LOCUS_24420 4599 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 4799 5437 gene locus_tag LOCUS_24430 4799 5437 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090583.1 protein_id gnl|my_center|LOCUS_24430 5507 6211 gene locus_tag LOCUS_24440 5507 6211 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_24440 6270 6884 gene locus_tag LOCUS_24450 6270 6884 CDS product ParB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193730.1 protein_id gnl|my_center|LOCUS_24450 6881 8542 gene locus_tag LOCUS_24460 6881 8542 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526878.1 protein_id gnl|my_center|LOCUS_24460 8542 10329 gene locus_tag LOCUS_24470 8542 10329 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 protein_id gnl|my_center|LOCUS_24470 10407 10817 gene locus_tag LOCUS_24480 10407 10817 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 protein_id gnl|my_center|LOCUS_24480 10988 11689 gene locus_tag LOCUS_24490 10988 11689 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533388.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence091 2006 1164 gene locus_tag LOCUS_24500 2006 1164 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035700.1 protein_id gnl|my_center|LOCUS_24500 3771 2014 gene locus_tag LOCUS_24510 3771 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 5911 3788 gene locus_tag LOCUS_24520 5911 3788 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275520.1 protein_id gnl|my_center|LOCUS_24520 6060 6533 gene locus_tag LOCUS_24530 6060 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038064.1 protein_id gnl|my_center|LOCUS_24530 10679 6540 gene locus_tag LOCUS_24540 gene hrpA 10679 6540 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038068.1 protein_id gnl|my_center|LOCUS_24540 10816 11283 gene locus_tag LOCUS_24550 gene dpsA 10816 11283 CDS product non-specific DNA-binding protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_24550 <12206 11373 gene locus_tag LOCUS_24560 <12206 11373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941596.1:pitrilysin family protein >Feature sequence092 26 925 gene locus_tag LOCUS_24570 26 925 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_24570 1077 3134 gene locus_tag LOCUS_24580 1077 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3277 4668 gene locus_tag LOCUS_24590 gene yjjJ 3277 4668 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_24590 4850 5095 gene locus_tag LOCUS_24600 4850 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 6796 5105 gene locus_tag LOCUS_24610 6796 5105 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_24610 8320 6926 gene locus_tag LOCUS_24620 8320 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 8989 8411 gene locus_tag LOCUS_24630 8989 8411 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940055.1 protein_id gnl|my_center|LOCUS_24630 9266 11206 gene locus_tag LOCUS_24640 gene acs 9266 11206 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039129.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence093 603 130 gene locus_tag LOCUS_24650 603 130 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626636.1 protein_id gnl|my_center|LOCUS_24650 767 1885 gene locus_tag LOCUS_24660 gene ald 767 1885 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 protein_id gnl|my_center|LOCUS_24660 2123 3190 gene locus_tag LOCUS_24670 2123 3190 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038454.1 protein_id gnl|my_center|LOCUS_24670 3491 5974 gene locus_tag LOCUS_24680 3491 5974 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 protein_id gnl|my_center|LOCUS_24680 5971 7902 gene locus_tag LOCUS_24690 5971 7902 CDS product amylosucrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038457.1 protein_id gnl|my_center|LOCUS_24690 7902 8876 gene locus_tag LOCUS_24700 7902 8876 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_24700 8873 10213 gene locus_tag LOCUS_24710 8873 10213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_24710 10329 10877 gene locus_tag LOCUS_24720 10329 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence094 <1 1476 gene locus_tag LOCUS_24730 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039202.1:tryptophan 7-halogenase 1549 3021 gene locus_tag LOCUS_24740 1549 3021 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_24740 3048 4310 gene locus_tag LOCUS_24750 3048 4310 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_24750 4307 5185 gene locus_tag LOCUS_24760 4307 5185 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_24760 5182 6003 gene locus_tag LOCUS_24770 5182 6003 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_24770 6972 6046 gene locus_tag LOCUS_24780 6972 6046 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533364.1 protein_id gnl|my_center|LOCUS_24780 8025 6976 gene locus_tag LOCUS_24790 8025 6976 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 protein_id gnl|my_center|LOCUS_24790 8972 8139 gene locus_tag LOCUS_24800 8972 8139 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_24800 9855 9181 gene locus_tag LOCUS_24810 9855 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 10660 9860 gene locus_tag LOCUS_24820 gene xth 10660 9860 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence095 450 797 gene locus_tag LOCUS_24830 450 797 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036517.1 protein_id gnl|my_center|LOCUS_24830 1356 907 gene locus_tag LOCUS_24840 1356 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2787 1495 gene locus_tag LOCUS_24850 2787 1495 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113311.1 protein_id gnl|my_center|LOCUS_24850 3190 3936 gene locus_tag LOCUS_24860 3190 3936 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 protein_id gnl|my_center|LOCUS_24860 3933 5009 gene locus_tag LOCUS_24870 3933 5009 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 protein_id gnl|my_center|LOCUS_24870 6411 5251 gene locus_tag LOCUS_24880 6411 5251 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_24880 7012 6647 gene locus_tag LOCUS_24890 7012 6647 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_24890 9458 7113 gene locus_tag LOCUS_24900 9458 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 9707 10249 gene locus_tag LOCUS_24910 9707 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence096 945 1 gene locus_tag LOCUS_24920 945 1 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_24920 1460 1065 gene locus_tag LOCUS_24930 1460 1065 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036811.1 protein_id gnl|my_center|LOCUS_24930 1762 1457 gene locus_tag LOCUS_24940 1762 1457 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804328.1 protein_id gnl|my_center|LOCUS_24940 2675 1929 gene locus_tag LOCUS_24950 2675 1929 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 protein_id gnl|my_center|LOCUS_24950 4851 2791 gene locus_tag LOCUS_24960 4851 2791 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146311717.1 protein_id gnl|my_center|LOCUS_24960 7085 4902 gene locus_tag LOCUS_24970 7085 4902 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275305.1 protein_id gnl|my_center|LOCUS_24970 7733 7440 gene locus_tag LOCUS_24980 7733 7440 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_24980 8079 7726 gene locus_tag LOCUS_24990 8079 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 10020 8419 gene locus_tag LOCUS_25000 10020 8419 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence097 1 228 gene locus_tag LOCUS_25010 1 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 960 352 gene locus_tag LOCUS_25020 960 352 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275402.1 protein_id gnl|my_center|LOCUS_25020 1276 2847 gene locus_tag LOCUS_25030 1276 2847 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039014.1 protein_id gnl|my_center|LOCUS_25030 2895 4097 gene locus_tag LOCUS_25040 2895 4097 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039013.1 protein_id gnl|my_center|LOCUS_25040 4189 4836 gene locus_tag LOCUS_25050 4189 4836 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971475.1 protein_id gnl|my_center|LOCUS_25050 5754 4852 gene locus_tag LOCUS_25060 5754 4852 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 protein_id gnl|my_center|LOCUS_25060 6131 5754 gene locus_tag LOCUS_25070 6131 5754 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944172.1 protein_id gnl|my_center|LOCUS_25070 7941 6466 gene locus_tag LOCUS_25080 7941 6466 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_25080 9245 8454 gene locus_tag LOCUS_25090 9245 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence098 1625 849 gene locus_tag LOCUS_25100 1625 849 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_25100 3084 1684 gene locus_tag LOCUS_25110 3084 1684 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113277.1 protein_id gnl|my_center|LOCUS_25110 5073 3232 gene locus_tag LOCUS_25120 5073 3232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037763.1 protein_id gnl|my_center|LOCUS_25120 5178 5687 gene locus_tag LOCUS_25130 5178 5687 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337239.1 protein_id gnl|my_center|LOCUS_25130 5764 8181 gene locus_tag LOCUS_25140 5764 8181 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112423.1 protein_id gnl|my_center|LOCUS_25140 8284 8721 gene locus_tag LOCUS_25150 8284 8721 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808385.1 protein_id gnl|my_center|LOCUS_25150 <10248 8864 gene locus_tag LOCUS_25160 <10248 8864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_139328020.1:alpha/beta hydrolase-fold protein >Feature sequence099 2080 1292 gene locus_tag LOCUS_25170 2080 1292 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_25170 2462 2148 gene locus_tag LOCUS_25180 2462 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 3274 2459 gene locus_tag LOCUS_25190 3274 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 4689 3289 gene locus_tag LOCUS_25200 gene asnS 4689 3289 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036745.1 protein_id gnl|my_center|LOCUS_25200 4849 5175 gene locus_tag LOCUS_25210 gene iscA 4849 5175 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072278.1 protein_id gnl|my_center|LOCUS_25210 5370 5801 gene locus_tag LOCUS_25220 gene rpsF 5370 5801 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036747.1 protein_id gnl|my_center|LOCUS_25220 5817 6047 gene locus_tag LOCUS_25230 gene rpsR 5817 6047 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005991243.1 protein_id gnl|my_center|LOCUS_25230 6210 6659 gene locus_tag LOCUS_25240 gene rplI 6210 6659 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005991240.1 protein_id gnl|my_center|LOCUS_25240 6901 8295 gene locus_tag LOCUS_25250 6901 8295 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036624.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence100 <1 752 gene locus_tag LOCUS_25260 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035633.1:pyridoxal-phosphate dependent enzyme 1880 765 gene locus_tag LOCUS_25270 1880 765 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524705.1 protein_id gnl|my_center|LOCUS_25270 2027 2608 gene locus_tag LOCUS_25280 2027 2608 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_25280 3542 2616 gene locus_tag LOCUS_25290 3542 2616 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529105.1 protein_id gnl|my_center|LOCUS_25290 3681 4913 gene locus_tag LOCUS_25300 3681 4913 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190545.1 protein_id gnl|my_center|LOCUS_25300 4910 5977 gene locus_tag LOCUS_25310 4910 5977 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540386.1 protein_id gnl|my_center|LOCUS_25310 5980 6669 gene locus_tag LOCUS_25320 5980 6669 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190271.1 protein_id gnl|my_center|LOCUS_25320 6702 7472 gene locus_tag LOCUS_25330 6702 7472 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190784.1 protein_id gnl|my_center|LOCUS_25330 7500 8288 gene locus_tag LOCUS_25340 7500 8288 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552055.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence101 2173 1022 gene locus_tag LOCUS_25350 2173 1022 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527920.1 protein_id gnl|my_center|LOCUS_25350 2781 2173 gene locus_tag LOCUS_25360 gene slmA 2781 2173 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 protein_id gnl|my_center|LOCUS_25360 3163 4185 gene locus_tag LOCUS_25370 3163 4185 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766198.1 protein_id gnl|my_center|LOCUS_25370 4341 4496 gene locus_tag LOCUS_25380 4341 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 4520 5944 gene locus_tag LOCUS_25390 4520 5944 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_25390 6919 5972 gene locus_tag LOCUS_25400 6919 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 7377 7649 gene locus_tag LOCUS_25410 7377 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 7721 8341 gene locus_tag LOCUS_25420 7721 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082256002.1 protein_id gnl|my_center|LOCUS_25420 8392 8778 gene locus_tag LOCUS_25430 8392 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence102 1407 568 gene locus_tag LOCUS_25440 1407 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 2456 1431 gene locus_tag LOCUS_25450 2456 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3515 2544 gene locus_tag LOCUS_25460 3515 2544 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_25460 4174 3803 gene locus_tag LOCUS_25470 4174 3803 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_25470 4973 4359 gene locus_tag LOCUS_25480 4973 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_25480 5255 4986 gene locus_tag LOCUS_25490 5255 4986 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 protein_id gnl|my_center|LOCUS_25490 5698 5375 gene locus_tag LOCUS_25500 5698 5375 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_25500 7048 5795 gene locus_tag LOCUS_25510 7048 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 8303 7056 gene locus_tag LOCUS_25520 8303 7056 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191950.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence103 1200 73 gene locus_tag LOCUS_25530 1200 73 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037373.1 protein_id gnl|my_center|LOCUS_25530 2249 1200 gene locus_tag LOCUS_25540 2249 1200 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275352.1 protein_id gnl|my_center|LOCUS_25540 2701 2252 gene locus_tag LOCUS_25550 2701 2252 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036834.1 protein_id gnl|my_center|LOCUS_25550 3240 2698 gene locus_tag LOCUS_25560 3240 2698 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036835.1 protein_id gnl|my_center|LOCUS_25560 5210 3237 gene locus_tag LOCUS_25570 5210 3237 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036836.1 protein_id gnl|my_center|LOCUS_25570 5683 5207 gene locus_tag LOCUS_25580 gene ccmE 5683 5207 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036837.1 protein_id gnl|my_center|LOCUS_25580 5908 5702 gene locus_tag LOCUS_25590 5908 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 6663 5905 gene locus_tag LOCUS_25600 gene ccmC 6663 5905 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036839.1 protein_id gnl|my_center|LOCUS_25600 7357 6671 gene locus_tag LOCUS_25610 gene ccmB 7357 6671 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037365.1 protein_id gnl|my_center|LOCUS_25610 <7928 7354 gene locus_tag LOCUS_25620 <7928 7354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037364.1:heme ABC exporter ATP-binding protein CcmA >Feature sequence104 858 130 gene locus_tag LOCUS_25630 858 130 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 protein_id gnl|my_center|LOCUS_25630 1789 860 gene locus_tag LOCUS_25640 gene fleN 1789 860 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083064.1 protein_id gnl|my_center|LOCUS_25640 3138 1804 gene locus_tag LOCUS_25650 gene flhF 3138 1804 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_25650 6049 3317 gene locus_tag LOCUS_25660 6049 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 7204 6062 gene locus_tag LOCUS_25670 gene flhB 7204 6062 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_25670 <7754 7209 gene locus_tag LOCUS_25680 <7754 7209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114278.1:flagellar biosynthetic protein FliR >Feature sequence105 1360 1881 gene locus_tag LOCUS_25690 1360 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2158 1820 gene locus_tag LOCUS_25700 gene glnK 2158 1820 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_25700 2190 2609 gene locus_tag LOCUS_25710 2190 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2762 4255 gene locus_tag LOCUS_25720 2762 4255 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_25720 4335 5174 gene locus_tag LOCUS_25730 4335 5174 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071665.1 protein_id gnl|my_center|LOCUS_25730 5451 5753 gene locus_tag LOCUS_25740 5451 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 5867 7615 gene locus_tag LOCUS_25750 5867 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence106 2153 3298 gene locus_tag LOCUS_25760 2153 3298 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064290.1 protein_id gnl|my_center|LOCUS_25760 3466 3846 gene locus_tag LOCUS_25770 3466 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3846 4160 gene locus_tag LOCUS_25780 3846 4160 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871048.1 protein_id gnl|my_center|LOCUS_25780 4334 4621 gene locus_tag LOCUS_25790 4334 4621 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804826.1 protein_id gnl|my_center|LOCUS_25790 4785 6041 gene locus_tag LOCUS_25800 4785 6041 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085441.1 protein_id gnl|my_center|LOCUS_25800 6141 6683 gene locus_tag LOCUS_25810 6141 6683 CDS product AmiS/UreI family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064292.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence107 1582 842 gene locus_tag LOCUS_25820 1582 842 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 protein_id gnl|my_center|LOCUS_25820 3437 1587 gene locus_tag LOCUS_25830 3437 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 4092 3451 gene locus_tag LOCUS_25840 4092 3451 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268434.1 protein_id gnl|my_center|LOCUS_25840 4496 4089 gene locus_tag LOCUS_25850 gene cheY 4496 4089 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_25850 5287 4559 gene locus_tag LOCUS_25860 gene fliA 5287 4559 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378731.1 protein_id gnl|my_center|LOCUS_25860 6224 5289 gene locus_tag LOCUS_25870 gene fleN 6224 5289 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412391.1 protein_id gnl|my_center|LOCUS_25870 <7317 6239 gene locus_tag LOCUS_25880 <7317 6239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705286.1:flagellar biosynthesis protein FlhF >Feature sequence108 431 4591 gene locus_tag LOCUS_25890 gene rpoB 431 4591 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115576597.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence109 777 391 gene locus_tag LOCUS_25900 777 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1053 826 gene locus_tag LOCUS_25910 1053 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 1213 2751 gene locus_tag LOCUS_25920 1213 2751 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930905.1 protein_id gnl|my_center|LOCUS_25920 3184 2774 gene locus_tag LOCUS_25930 gene merR 3184 2774 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_25930 3256 3606 gene locus_tag LOCUS_25940 3256 3606 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_25940 3618 3896 gene locus_tag LOCUS_25950 gene merP 3618 3896 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732275.1 protein_id gnl|my_center|LOCUS_25950 3896 5296 gene locus_tag LOCUS_25960 gene merA 3896 5296 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_25960 6213 5353 gene locus_tag LOCUS_25970 6213 5353 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence110 693 1499 gene locus_tag LOCUS_25980 693 1499 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813952.1 protein_id gnl|my_center|LOCUS_25980 1496 2335 gene locus_tag LOCUS_25990 1496 2335 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037768.1 protein_id gnl|my_center|LOCUS_25990 2387 2818 gene locus_tag LOCUS_26000 2387 2818 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037423.1 protein_id gnl|my_center|LOCUS_26000 2815 3258 gene locus_tag LOCUS_26010 2815 3258 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 protein_id gnl|my_center|LOCUS_26010 3310 3534 gene locus_tag LOCUS_26020 3310 3534 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 protein_id gnl|my_center|LOCUS_26020 3694 4407 gene locus_tag LOCUS_26030 gene msrA 3694 4407 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence111 159 305 gene locus_tag LOCUS_26040 159 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 302 829 gene locus_tag LOCUS_26050 302 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 905 1396 gene locus_tag LOCUS_26060 905 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1578 1486 gene locus_tag LOCUS_t00400 1578 1486 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1855 1649 gene locus_tag LOCUS_26070 gene csrA 1855 1649 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305164.1 protein_id gnl|my_center|LOCUS_26070 4753 2126 gene locus_tag LOCUS_26080 gene alaS 4753 2126 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036901.1 protein_id gnl|my_center|LOCUS_26080 5338 4838 gene locus_tag LOCUS_26090 gene recX 5338 4838 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036900.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence112 2125 2562 gene locus_tag LOCUS_26100 2125 2562 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926507.1 protein_id gnl|my_center|LOCUS_26100 2675 3088 gene locus_tag LOCUS_26110 2675 3088 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_26110 3139 4413 gene locus_tag LOCUS_26120 3139 4413 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_26120 4481 4837 gene locus_tag LOCUS_26130 4481 4837 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529095.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence113 63 3047 gene locus_tag LOCUS_26140 63 3047 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_26140 3044 4369 gene locus_tag LOCUS_26150 3044 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5157 4363 gene locus_tag LOCUS_26160 5157 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence114 276 351 gene locus_tag LOCUS_t00410 276 351 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 432 827 gene locus_tag LOCUS_26170 432 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 829 1398 gene locus_tag LOCUS_26180 gene nusG 829 1398 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036113.1 protein_id gnl|my_center|LOCUS_26180 1610 2038 gene locus_tag LOCUS_26190 gene rplK 1610 2038 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036114.1 protein_id gnl|my_center|LOCUS_26190 2042 2749 gene locus_tag LOCUS_26200 gene rplA 2042 2749 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036115.1 protein_id gnl|my_center|LOCUS_26200 3104 3637 gene locus_tag LOCUS_26210 gene rplJ 3104 3637 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036116.1 protein_id gnl|my_center|LOCUS_26210 3682 4050 gene locus_tag LOCUS_26220 gene rplL 3682 4050 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036117.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence115 <1 848 gene locus_tag LOCUS_26230 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190513.1:GntP family permease 1096 2922 gene locus_tag LOCUS_26240 gene typA 1096 2922 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036140.1 protein_id gnl|my_center|LOCUS_26240 3985 3059 gene locus_tag LOCUS_26250 3985 3059 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958251.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence116 <3874 2737 gene locus_tag LOCUS_26260 <3874 2737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994010.1:ATP-binding protein >Feature sequence117 520 1197 gene locus_tag LOCUS_26270 gene ftsE 520 1197 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003484499.1 protein_id gnl|my_center|LOCUS_26270 1200 2177 gene locus_tag LOCUS_26280 gene ftsX 1200 2177 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038856.1 protein_id gnl|my_center|LOCUS_26280 2317 3162 gene locus_tag LOCUS_26290 2317 3162 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506371.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence118 129 398 gene locus_tag LOCUS_26300 gene xanC 129 398 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_26300 499 1224 gene locus_tag LOCUS_26310 499 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 1221 1517 gene locus_tag LOCUS_26320 1221 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039080.1 protein_id gnl|my_center|LOCUS_26320 1514 2470 gene locus_tag LOCUS_26330 1514 2470 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_26330 2397 3053 gene locus_tag LOCUS_26340 2397 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence119 1772 2098 gene locus_tag LOCUS_26350 gene trxA 1772 2098 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247584.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence120 164 249 gene locus_tag LOCUS_t00420 164 249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 441 1331 gene locus_tag LOCUS_26360 441 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 <2831 1484 gene locus_tag LOCUS_26370 <2831 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275348.1:formylglycine-generating enzyme family protein >Feature sequence121 2082 703 gene locus_tag LOCUS_26380 2082 703 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence122 <1 556 gene locus_tag LOCUS_26390 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_100097357.1:peptide chain release factor 2 600 953 gene locus_tag LOCUS_26400 600 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1059 2576 gene locus_tag LOCUS_26410 gene lysS 1059 2576 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037023.1 protein_id gnl|my_center|LOCUS_26410 >Feature sequence123 2 343 gene locus_tag LOCUS_26420 2 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 450 1730 gene locus_tag LOCUS_26430 gene serS 450 1730 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036776.1 protein_id gnl|my_center|LOCUS_26430 1727 2110 gene locus_tag LOCUS_26440 1727 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence124 <1 1874 gene locus_tag LOCUS_26450 <1 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206818979.1:maltodextrin glucosidase >Feature sequence125 723 1592 gene locus_tag LOCUS_26460 723 1592 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence126 656 333 gene locus_tag LOCUS_26470 656 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 820 1554 gene locus_tag LOCUS_26480 820 1554 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence127 <1 681 gene locus_tag LOCUS_26490 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035790.1:dihydrolipoyllysine-residue acetyltransferase >Feature sequence128 1273 764 gene locus_tag LOCUS_26500 1273 764 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_26500