>Feature sequence001 <1 1576 gene locus_tag LOCUS_00010 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968324.1:hydantoinase/oxoprolinase family protein 1602 3194 gene locus_tag LOCUS_00020 1602 3194 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339387.1 protein_id gnl|my_center|LOCUS_00020 4847 3228 gene locus_tag LOCUS_00030 4847 3228 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895690.1 protein_id gnl|my_center|LOCUS_00030 4888 6075 gene locus_tag LOCUS_00040 gene aruH 4888 6075 CDS product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102073.1 protein_id gnl|my_center|LOCUS_00040 7521 6046 gene locus_tag LOCUS_00050 7521 6046 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036991.1 protein_id gnl|my_center|LOCUS_00050 9519 7594 gene locus_tag LOCUS_00060 9519 7594 CDS product protease pro-enzyme activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963944.1 protein_id gnl|my_center|LOCUS_00060 9997 9662 gene locus_tag LOCUS_00070 9997 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10187 11686 gene locus_tag LOCUS_00080 10187 11686 CDS product carnitine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242879.1 protein_id gnl|my_center|LOCUS_00080 11706 12353 gene locus_tag LOCUS_00090 11706 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 15598 12356 gene locus_tag LOCUS_00100 15598 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 16861 15698 gene locus_tag LOCUS_00110 16861 15698 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528296.1 protein_id gnl|my_center|LOCUS_00110 17690 16893 gene locus_tag LOCUS_00120 17690 16893 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976307.1 protein_id gnl|my_center|LOCUS_00120 19752 17698 gene locus_tag LOCUS_00130 19752 17698 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528297.1 protein_id gnl|my_center|LOCUS_00130 20234 19749 gene locus_tag LOCUS_00140 20234 19749 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 protein_id gnl|my_center|LOCUS_00140 21156 20257 gene locus_tag LOCUS_00150 21156 20257 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_00150 21269 21667 gene locus_tag LOCUS_00160 21269 21667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00160 21664 22692 gene locus_tag LOCUS_00170 21664 22692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00170 22692 23804 gene locus_tag LOCUS_00180 22692 23804 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037487.1 protein_id gnl|my_center|LOCUS_00180 24698 23868 gene locus_tag LOCUS_00190 24698 23868 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_00190 25595 24705 gene locus_tag LOCUS_00200 25595 24705 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 protein_id gnl|my_center|LOCUS_00200 26355 25660 gene locus_tag LOCUS_00210 26355 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27521 26352 gene locus_tag LOCUS_00220 27521 26352 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_00220 27647 28975 gene locus_tag LOCUS_00230 gene hemL 27647 28975 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_00230 28986 30578 gene locus_tag LOCUS_00240 28986 30578 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_00240 30575 32158 gene locus_tag LOCUS_00250 30575 32158 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_00250 32161 33372 gene locus_tag LOCUS_00260 32161 33372 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_00260 33389 34534 gene locus_tag LOCUS_00270 33389 34534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527095.1 protein_id gnl|my_center|LOCUS_00270 34569 37118 gene locus_tag LOCUS_00280 34569 37118 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_00280 37157 38797 gene locus_tag LOCUS_00290 gene murJ 37157 38797 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_00290 38904 39545 gene locus_tag LOCUS_00300 38904 39545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40376 39546 gene locus_tag LOCUS_00310 gene hutG 40376 39546 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918842.1 protein_id gnl|my_center|LOCUS_00310 40393 41784 gene locus_tag LOCUS_00320 40393 41784 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088984.1 protein_id gnl|my_center|LOCUS_00320 41885 42946 gene locus_tag LOCUS_00330 41885 42946 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_00330 42969 44633 gene locus_tag LOCUS_00340 42969 44633 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193449.1 protein_id gnl|my_center|LOCUS_00340 44630 45001 gene locus_tag LOCUS_00350 44630 45001 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_00350 45019 46146 gene locus_tag LOCUS_00360 45019 46146 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192765.1 protein_id gnl|my_center|LOCUS_00360 46257 47177 gene locus_tag LOCUS_00370 46257 47177 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_00370 47174 48100 gene locus_tag LOCUS_00380 47174 48100 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_00380 48109 49020 gene locus_tag LOCUS_00390 48109 49020 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191750.1 protein_id gnl|my_center|LOCUS_00390 49096 49674 gene locus_tag LOCUS_00400 49096 49674 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062684.1 protein_id gnl|my_center|LOCUS_00400 49749 50084 gene locus_tag LOCUS_00410 49749 50084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50151 51143 gene locus_tag LOCUS_00420 50151 51143 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 protein_id gnl|my_center|LOCUS_00420 51249 52421 gene locus_tag LOCUS_00430 51249 52421 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946303.1 protein_id gnl|my_center|LOCUS_00430 52890 52429 gene locus_tag LOCUS_00440 52890 52429 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626636.1 protein_id gnl|my_center|LOCUS_00440 53041 54147 gene locus_tag LOCUS_00450 gene ald 53041 54147 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 protein_id gnl|my_center|LOCUS_00450 54229 54807 gene locus_tag LOCUS_00460 54229 54807 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_00460 55926 54835 gene locus_tag LOCUS_00470 55926 54835 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_00470 >Feature sequence002 132 875 gene locus_tag LOCUS_00480 132 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 989 1435 gene locus_tag LOCUS_00490 gene aroQ 989 1435 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 protein_id gnl|my_center|LOCUS_00490 1477 1944 gene locus_tag LOCUS_00500 gene accB 1477 1944 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354613.1 protein_id gnl|my_center|LOCUS_00500 1953 3296 gene locus_tag LOCUS_00510 gene accC 1953 3296 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 protein_id gnl|my_center|LOCUS_00510 3293 4168 gene locus_tag LOCUS_00520 gene prmA 3293 4168 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145803.1 protein_id gnl|my_center|LOCUS_00520 4175 5374 gene locus_tag LOCUS_00530 4175 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5383 6372 gene locus_tag LOCUS_00540 gene dusB 5383 6372 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_00540 6448 6693 gene locus_tag LOCUS_00550 6448 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 6741 8324 gene locus_tag LOCUS_00560 gene purH 6741 8324 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210692.1 protein_id gnl|my_center|LOCUS_00560 8336 9628 gene locus_tag LOCUS_00570 gene purD 8336 9628 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035746.1 protein_id gnl|my_center|LOCUS_00570 9637 10068 gene locus_tag LOCUS_00580 9637 10068 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680077.1 protein_id gnl|my_center|LOCUS_00580 10918 10058 gene locus_tag LOCUS_00590 10918 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 12502 11057 gene locus_tag LOCUS_00600 gene rho 12502 11057 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_00600 12864 12499 gene locus_tag LOCUS_00610 gene trxA 12864 12499 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_00610 13199 14473 gene locus_tag LOCUS_00620 13199 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00620 14590 14814 gene locus_tag LOCUS_00630 14590 14814 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_00630 14814 16190 gene locus_tag LOCUS_00640 14814 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 16219 16644 gene locus_tag LOCUS_00650 gene arfB 16219 16644 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 protein_id gnl|my_center|LOCUS_00650 16659 17117 gene locus_tag LOCUS_00660 16659 17117 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112336.1 protein_id gnl|my_center|LOCUS_00660 17850 17122 gene locus_tag LOCUS_00670 17850 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 20430 18061 gene locus_tag LOCUS_00680 20430 18061 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_00680 21491 20427 gene locus_tag LOCUS_00690 21491 20427 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_00690 22857 21496 gene locus_tag LOCUS_00700 22857 21496 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 protein_id gnl|my_center|LOCUS_00700 25016 22905 gene locus_tag LOCUS_00710 25016 22905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 25256 26059 gene locus_tag LOCUS_00720 25256 26059 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_00720 26666 26079 gene locus_tag LOCUS_00730 26666 26079 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036725.1 protein_id gnl|my_center|LOCUS_00730 26666 30292 gene locus_tag LOCUS_00740 26666 30292 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265799.1 protein_id gnl|my_center|LOCUS_00740 31923 30289 gene locus_tag LOCUS_00750 31923 30289 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_00750 32199 32014 gene locus_tag LOCUS_00760 32199 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 33476 32199 gene locus_tag LOCUS_00770 33476 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 34024 33527 gene locus_tag LOCUS_00780 34024 33527 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_00780 34954 34028 gene locus_tag LOCUS_00790 34954 34028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 35609 34959 gene locus_tag LOCUS_00800 35609 34959 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 protein_id gnl|my_center|LOCUS_00800 35988 35785 gene locus_tag LOCUS_00810 35988 35785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 36094 36618 gene locus_tag LOCUS_00820 gene greB 36094 36618 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090951.1 protein_id gnl|my_center|LOCUS_00820 38017 36593 gene locus_tag LOCUS_00830 38017 36593 CDS product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090487.1 protein_id gnl|my_center|LOCUS_00830 38786 38127 gene locus_tag LOCUS_00840 38786 38127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 38852 39721 gene locus_tag LOCUS_00850 38852 39721 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190656.1 protein_id gnl|my_center|LOCUS_00850 39767 41746 gene locus_tag LOCUS_00860 gene speA 39767 41746 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_00860 42486 41749 gene locus_tag LOCUS_00870 42486 41749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 42592 42873 gene locus_tag LOCUS_00880 42592 42873 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_00880 42965 43816 gene locus_tag LOCUS_00890 42965 43816 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_00890 45917 43824 gene locus_tag LOCUS_00900 45917 43824 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974016.1 protein_id gnl|my_center|LOCUS_00900 45995 46534 gene locus_tag LOCUS_00910 45995 46534 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_00910 46623 46964 gene locus_tag LOCUS_00920 46623 46964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 47614 46961 gene locus_tag LOCUS_00930 47614 46961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 48251 47625 gene locus_tag LOCUS_00940 48251 47625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 48393 49763 gene locus_tag LOCUS_00950 48393 49763 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_00950 50470 49781 gene locus_tag LOCUS_00960 50470 49781 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_00960 50492 51145 gene locus_tag LOCUS_00970 50492 51145 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_00970 51159 53246 gene locus_tag LOCUS_00980 51159 53246 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_00980 53296 55176 gene locus_tag LOCUS_00990 53296 55176 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918932.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence003 <1 2676 gene locus_tag LOCUS_01000 <1 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039200.1:TonB-dependent receptor 2841 4295 gene locus_tag LOCUS_01010 2841 4295 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039202.1 protein_id gnl|my_center|LOCUS_01010 4304 5035 gene locus_tag LOCUS_01020 4304 5035 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267339.1 protein_id gnl|my_center|LOCUS_01020 5035 5304 gene locus_tag LOCUS_01030 5035 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 5368 6561 gene locus_tag LOCUS_01040 5368 6561 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01040 6689 7702 gene locus_tag LOCUS_01050 6689 7702 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039199.1 protein_id gnl|my_center|LOCUS_01050 7699 9084 gene locus_tag LOCUS_01060 7699 9084 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_01060 9167 10339 gene locus_tag LOCUS_01070 9167 10339 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_01070 10336 11214 gene locus_tag LOCUS_01080 10336 11214 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_01080 11211 12032 gene locus_tag LOCUS_01090 11211 12032 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_01090 13475 12033 gene locus_tag LOCUS_01100 13475 12033 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_01100 13535 14635 gene locus_tag LOCUS_01110 gene ugpC 13535 14635 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037286.1 protein_id gnl|my_center|LOCUS_01110 15006 14632 gene locus_tag LOCUS_01120 15006 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 15433 15014 gene locus_tag LOCUS_01130 15433 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 15886 15470 gene locus_tag LOCUS_01140 15886 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 16032 17501 gene locus_tag LOCUS_01150 gene ccoN 16032 17501 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477654.1 protein_id gnl|my_center|LOCUS_01150 17498 18103 gene locus_tag LOCUS_01160 gene ccoO 17498 18103 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212596.1 protein_id gnl|my_center|LOCUS_01160 18116 18265 gene locus_tag LOCUS_01170 18116 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 18265 19167 gene locus_tag LOCUS_01180 gene ccoP 18265 19167 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477628.1 protein_id gnl|my_center|LOCUS_01180 19174 19473 gene locus_tag LOCUS_01190 19174 19473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 19470 20873 gene locus_tag LOCUS_01200 gene ccoG 19470 20873 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_01200 20870 21028 gene locus_tag LOCUS_01210 20870 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 21037 23448 gene locus_tag LOCUS_01220 21037 23448 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_01220 23445 23624 gene locus_tag LOCUS_01230 23445 23624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 23617 24330 gene locus_tag LOCUS_01240 23617 24330 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_01240 25461 24340 gene locus_tag LOCUS_01250 25461 24340 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387905.1 protein_id gnl|my_center|LOCUS_01250 26194 25469 gene locus_tag LOCUS_01260 26194 25469 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970750.1 protein_id gnl|my_center|LOCUS_01260 26457 27602 gene locus_tag LOCUS_01270 26457 27602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 27599 27904 gene locus_tag LOCUS_01280 27599 27904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 28553 27864 gene locus_tag LOCUS_01290 28553 27864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 29191 28550 gene locus_tag LOCUS_01300 29191 28550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 29327 32689 gene locus_tag LOCUS_01310 29327 32689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 32710 33216 gene locus_tag LOCUS_01320 32710 33216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 33577 33254 gene locus_tag LOCUS_01330 33577 33254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 34955 33906 gene locus_tag LOCUS_01340 34955 33906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 36530 34995 gene locus_tag LOCUS_01350 36530 34995 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395758.1 protein_id gnl|my_center|LOCUS_01350 38947 36527 gene locus_tag LOCUS_01360 38947 36527 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528147.1 protein_id gnl|my_center|LOCUS_01360 39098 40303 gene locus_tag LOCUS_01370 39098 40303 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_01370 41735 40263 gene locus_tag LOCUS_01380 41735 40263 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_01380 43735 41732 gene locus_tag LOCUS_01390 43735 41732 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538142.1 protein_id gnl|my_center|LOCUS_01390 44249 43737 gene locus_tag LOCUS_01400 44249 43737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 46825 44336 gene locus_tag LOCUS_01410 46825 44336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 46936 48453 gene locus_tag LOCUS_01420 46936 48453 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_01420 48509 50428 gene locus_tag LOCUS_01430 48509 50428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 51277 50429 gene locus_tag LOCUS_01440 51277 50429 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_01440 52104 51274 gene locus_tag LOCUS_01450 52104 51274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 52261 52121 gene locus_tag LOCUS_01460 52261 52121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 >Feature sequence004 3 872 gene locus_tag LOCUS_01470 3 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 961 1680 gene locus_tag LOCUS_01480 961 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 5574 1681 gene locus_tag LOCUS_01490 gene purL 5574 1681 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_01490 5900 5589 gene locus_tag LOCUS_01500 5900 5589 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 protein_id gnl|my_center|LOCUS_01500 6059 7348 gene locus_tag LOCUS_01510 gene tagH 6059 7348 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967723.1 protein_id gnl|my_center|LOCUS_01510 7455 7363 gene locus_tag LOCUS_t00010 7455 7363 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7528 8943 gene locus_tag LOCUS_01520 gene mltF 7528 8943 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266923.1 protein_id gnl|my_center|LOCUS_01520 9401 8940 gene locus_tag LOCUS_01530 gene tadA 9401 8940 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_01530 10272 9394 gene locus_tag LOCUS_01540 10272 9394 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818638.1 protein_id gnl|my_center|LOCUS_01540 11636 10269 gene locus_tag LOCUS_01550 gene xseA 11636 10269 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_01550 11690 13156 gene locus_tag LOCUS_01560 gene guaB 11690 13156 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380633.1 protein_id gnl|my_center|LOCUS_01560 13171 14823 gene locus_tag LOCUS_01570 gene guaA 13171 14823 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 protein_id gnl|my_center|LOCUS_01570 14991 15233 gene locus_tag LOCUS_01580 14991 15233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 15772 15296 gene locus_tag LOCUS_01590 15772 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 16051 17130 gene locus_tag LOCUS_01600 16051 17130 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_01600 17285 17142 gene locus_tag LOCUS_01610 17285 17142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 17571 17326 gene locus_tag LOCUS_01620 17571 17326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 17665 18405 gene locus_tag LOCUS_01630 17665 18405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 18402 19439 gene locus_tag LOCUS_01640 18402 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 19581 20657 gene locus_tag LOCUS_01650 19581 20657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01650 22151 20688 gene locus_tag LOCUS_01660 22151 20688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 23630 22239 gene locus_tag LOCUS_01670 gene der 23630 22239 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208345.1 protein_id gnl|my_center|LOCUS_01670 24843 23671 gene locus_tag LOCUS_01680 gene bamB 24843 23671 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_01680 25545 24847 gene locus_tag LOCUS_01690 25545 24847 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_01690 26832 25546 gene locus_tag LOCUS_01700 gene hisS 26832 25546 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 protein_id gnl|my_center|LOCUS_01700 27651 26833 gene locus_tag LOCUS_01710 27651 26833 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_01710 28452 27658 gene locus_tag LOCUS_01720 gene pilW 28452 27658 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208338.1 protein_id gnl|my_center|LOCUS_01720 29588 28449 gene locus_tag LOCUS_01730 29588 28449 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_01730 30030 29602 gene locus_tag LOCUS_01740 gene ndk 30030 29602 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092811.1 protein_id gnl|my_center|LOCUS_01740 30481 30158 gene locus_tag LOCUS_01750 gene iscA 30481 30158 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_01750 31993 30503 gene locus_tag LOCUS_01760 31993 30503 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771029.1 protein_id gnl|my_center|LOCUS_01760 32730 31990 gene locus_tag LOCUS_01770 gene trmJ 32730 31990 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_01770 32805 33605 gene locus_tag LOCUS_01780 gene suhB 32805 33605 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence005 63 2078 gene locus_tag LOCUS_01790 63 2078 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_01790 2081 3922 gene locus_tag LOCUS_01800 2081 3922 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_01800 5053 3929 gene locus_tag LOCUS_01810 5053 3929 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_01810 6116 5253 gene locus_tag LOCUS_01820 6116 5253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_01820 6997 6113 gene locus_tag LOCUS_01830 6997 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 8115 6994 gene locus_tag LOCUS_01840 8115 6994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_01840 9167 8112 gene locus_tag LOCUS_01850 9167 8112 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_01850 9313 10245 gene locus_tag LOCUS_01860 9313 10245 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_01860 10242 11102 gene locus_tag LOCUS_01870 10242 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 11099 11887 gene locus_tag LOCUS_01880 gene hisN 11099 11887 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_01880 13064 11898 gene locus_tag LOCUS_01890 13064 11898 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_01890 14449 13061 gene locus_tag LOCUS_01900 14449 13061 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_01900 15816 14449 gene locus_tag LOCUS_01910 15816 14449 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_01910 16929 15832 gene locus_tag LOCUS_01920 16929 15832 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815495.1 protein_id gnl|my_center|LOCUS_01920 18257 16926 gene locus_tag LOCUS_01930 18257 16926 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948255.1 protein_id gnl|my_center|LOCUS_01930 19675 18245 gene locus_tag LOCUS_01940 gene phnY 19675 18245 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 protein_id gnl|my_center|LOCUS_01940 20885 19665 gene locus_tag LOCUS_01950 gene phnA 20885 19665 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194696.1 protein_id gnl|my_center|LOCUS_01950 22001 20898 gene locus_tag LOCUS_01960 gene phnW 22001 20898 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112368.1 protein_id gnl|my_center|LOCUS_01960 22063 23283 gene locus_tag LOCUS_01970 gene phnA 22063 23283 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199121.1 protein_id gnl|my_center|LOCUS_01970 23273 24706 gene locus_tag LOCUS_01980 gene phnY 23273 24706 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 protein_id gnl|my_center|LOCUS_01980 24700 25914 gene locus_tag LOCUS_01990 24700 25914 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_01990 25923 26225 gene locus_tag LOCUS_02000 25923 26225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 26271 26355 gene locus_tag LOCUS_t00020 26271 26355 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27318 26311 gene locus_tag LOCUS_02010 27318 26311 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941859.1 protein_id gnl|my_center|LOCUS_02010 27927 27328 gene locus_tag LOCUS_02020 gene petA 27927 27328 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_02020 28541 27924 gene locus_tag LOCUS_02030 28541 27924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 28659 29651 gene locus_tag LOCUS_02040 28659 29651 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence006 2265 775 gene locus_tag LOCUS_02050 2265 775 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437413.1 protein_id gnl|my_center|LOCUS_02050 3505 2330 gene locus_tag LOCUS_02060 3505 2330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275547.1 protein_id gnl|my_center|LOCUS_02060 4236 3502 gene locus_tag LOCUS_02070 4236 3502 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_02070 5819 4233 gene locus_tag LOCUS_02080 5819 4233 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039042.1 protein_id gnl|my_center|LOCUS_02080 6346 5891 gene locus_tag LOCUS_02090 6346 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7256 6594 gene locus_tag LOCUS_02100 7256 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 7458 7802 gene locus_tag LOCUS_02110 7458 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 7831 8124 gene locus_tag LOCUS_02120 7831 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 8167 9333 gene locus_tag LOCUS_02130 8167 9333 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_02130 9368 10597 gene locus_tag LOCUS_02140 9368 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 11615 10626 gene locus_tag LOCUS_02150 11615 10626 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_02150 11676 13625 gene locus_tag LOCUS_02160 11676 13625 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227897.1 protein_id gnl|my_center|LOCUS_02160 14052 13648 gene locus_tag LOCUS_02170 14052 13648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 14015 15928 gene locus_tag LOCUS_02180 14015 15928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 18121 15941 gene locus_tag LOCUS_02190 18121 15941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 21322 18299 gene locus_tag LOCUS_02200 21322 18299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 21857 22489 gene locus_tag LOCUS_02210 21857 22489 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974147.1 protein_id gnl|my_center|LOCUS_02210 22762 24744 gene locus_tag LOCUS_02220 22762 24744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02220 24889 25542 gene locus_tag LOCUS_02230 24889 25542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02230 25574 27457 gene locus_tag LOCUS_02240 25574 27457 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146465.1 protein_id gnl|my_center|LOCUS_02240 27454 27831 gene locus_tag LOCUS_02250 27454 27831 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_02250 28270 27857 gene locus_tag LOCUS_02260 28270 27857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 29787 28267 gene locus_tag LOCUS_02270 29787 28267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 29880 30770 gene locus_tag LOCUS_02280 29880 30770 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087810.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence007 428 1165 gene locus_tag LOCUS_02290 428 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1205 2533 gene locus_tag LOCUS_02300 1205 2533 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_02300 2530 3786 gene locus_tag LOCUS_02310 2530 3786 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983670.1 protein_id gnl|my_center|LOCUS_02310 3787 4920 gene locus_tag LOCUS_02320 3787 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5362 4886 gene locus_tag LOCUS_02330 5362 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 5468 5944 gene locus_tag LOCUS_02340 5468 5944 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813149.1 protein_id gnl|my_center|LOCUS_02340 5941 7386 gene locus_tag LOCUS_02350 5941 7386 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 protein_id gnl|my_center|LOCUS_02350 7402 8604 gene locus_tag LOCUS_02360 7402 8604 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_02360 9085 8618 gene locus_tag LOCUS_02370 9085 8618 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 protein_id gnl|my_center|LOCUS_02370 9197 9448 gene locus_tag LOCUS_02380 9197 9448 CDS product DUF6356 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639959.1 protein_id gnl|my_center|LOCUS_02380 9451 10551 gene locus_tag LOCUS_02390 9451 10551 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388363.1 protein_id gnl|my_center|LOCUS_02390 10615 11220 gene locus_tag LOCUS_02400 gene folE 10615 11220 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945065.1 protein_id gnl|my_center|LOCUS_02400 11479 11285 gene locus_tag LOCUS_02410 11479 11285 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 protein_id gnl|my_center|LOCUS_02410 13420 11594 gene locus_tag LOCUS_02420 gene typA 13420 11594 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 protein_id gnl|my_center|LOCUS_02420 13940 13518 gene locus_tag LOCUS_02430 13940 13518 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_02430 14038 15702 gene locus_tag LOCUS_02440 14038 15702 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_02440 15714 16406 gene locus_tag LOCUS_02450 15714 16406 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114535.1 protein_id gnl|my_center|LOCUS_02450 16428 18290 gene locus_tag LOCUS_02460 16428 18290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_02460 20190 18304 gene locus_tag LOCUS_02470 gene glgB 20190 18304 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_02470 22771 20237 gene locus_tag LOCUS_02480 22771 20237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 22930 23232 gene locus_tag LOCUS_02490 22930 23232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 24630 23365 gene locus_tag LOCUS_02500 gene gabT 24630 23365 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706800.1 protein_id gnl|my_center|LOCUS_02500 25162 24701 gene locus_tag LOCUS_02510 25162 24701 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_02510 25263 26318 gene locus_tag LOCUS_02520 25263 26318 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088624.1 protein_id gnl|my_center|LOCUS_02520 26324 27175 gene locus_tag LOCUS_02530 gene tesB 26324 27175 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_02530 28111 27197 gene locus_tag LOCUS_02540 28111 27197 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_02540 29532 28123 gene locus_tag LOCUS_02550 29532 28123 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_02550 30436 29552 gene locus_tag LOCUS_02560 gene htpX 30436 29552 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence008 1061 156 gene locus_tag LOCUS_02570 1061 156 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 protein_id gnl|my_center|LOCUS_02570 1112 1543 gene locus_tag LOCUS_02580 1112 1543 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770885.1 protein_id gnl|my_center|LOCUS_02580 1709 2611 gene locus_tag LOCUS_02590 1709 2611 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257191.1 protein_id gnl|my_center|LOCUS_02590 2614 2976 gene locus_tag LOCUS_02600 gene rsbS 2614 2976 CDS product RsbT antagonist protein RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225190.1 protein_id gnl|my_center|LOCUS_02600 2986 3390 gene locus_tag LOCUS_02610 gene rsbT 2986 3390 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 protein_id gnl|my_center|LOCUS_02610 3387 3998 gene locus_tag LOCUS_02620 3387 3998 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256364.1 protein_id gnl|my_center|LOCUS_02620 4011 4934 gene locus_tag LOCUS_02630 4011 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 4941 5570 gene locus_tag LOCUS_02640 4941 5570 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_02640 5677 6420 gene locus_tag LOCUS_02650 5677 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 8712 6424 gene locus_tag LOCUS_02660 8712 6424 CDS product transferrin receptor-like dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928760.1 protein_id gnl|my_center|LOCUS_02660 8839 10398 gene locus_tag LOCUS_02670 8839 10398 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188750.1 protein_id gnl|my_center|LOCUS_02670 10587 11105 gene locus_tag LOCUS_02680 10587 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 11325 11834 gene locus_tag LOCUS_02690 11325 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 11841 12566 gene locus_tag LOCUS_02700 11841 12566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12630 14945 gene locus_tag LOCUS_02710 12630 14945 CDS product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543968.1 protein_id gnl|my_center|LOCUS_02710 14942 15433 gene locus_tag LOCUS_02720 14942 15433 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216613.1 protein_id gnl|my_center|LOCUS_02720 15450 15944 gene locus_tag LOCUS_02730 15450 15944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02730 16330 15941 gene locus_tag LOCUS_02740 16330 15941 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_02740 17339 16305 gene locus_tag LOCUS_02750 17339 16305 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112101.1 protein_id gnl|my_center|LOCUS_02750 18625 17345 gene locus_tag LOCUS_02760 18625 17345 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964195.1 protein_id gnl|my_center|LOCUS_02760 19574 18708 gene locus_tag LOCUS_02770 19574 18708 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 protein_id gnl|my_center|LOCUS_02770 20348 19584 gene locus_tag LOCUS_02780 20348 19584 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_02780 20472 21626 gene locus_tag LOCUS_02790 20472 21626 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_02790 21690 22598 gene locus_tag LOCUS_02800 21690 22598 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_02800 23214 23627 gene locus_tag LOCUS_02810 23214 23627 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819827.1 protein_id gnl|my_center|LOCUS_02810 24407 23664 gene locus_tag LOCUS_02820 24407 23664 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_02820 25126 24404 gene locus_tag LOCUS_02830 25126 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 25388 25185 gene locus_tag LOCUS_02840 25388 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 26074 25562 gene locus_tag LOCUS_02850 26074 25562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 26421 26074 gene locus_tag LOCUS_02860 26421 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 27316 26423 gene locus_tag LOCUS_02870 27316 26423 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085800.1 protein_id gnl|my_center|LOCUS_02870 28201 27425 gene locus_tag LOCUS_02880 28201 27425 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085797.1 protein_id gnl|my_center|LOCUS_02880 28733 28188 gene locus_tag LOCUS_02890 28733 28188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 29732 28836 gene locus_tag LOCUS_02900 gene folD 29732 28836 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816853.1 protein_id gnl|my_center|LOCUS_02900 <30635 29732 gene locus_tag LOCUS_02910 <30635 29732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942520.1:adenosylhomocysteinase >Feature sequence009 <1 843 gene locus_tag LOCUS_02920 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_186447661.1:cytochrome c biogenesis protein DipZ 856 1434 gene locus_tag LOCUS_02930 856 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1460 2158 gene locus_tag LOCUS_02940 gene msrA 1460 2158 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_02940 3020 2163 gene locus_tag LOCUS_02950 gene kynA 3020 2163 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810516.1 protein_id gnl|my_center|LOCUS_02950 3099 3986 gene locus_tag LOCUS_02960 3099 3986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_02960 3986 4996 gene locus_tag LOCUS_02970 3986 4996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_02970 5031 6044 gene locus_tag LOCUS_02980 5031 6044 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_02980 7241 6063 gene locus_tag LOCUS_02990 7241 6063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_02990 8427 7264 gene locus_tag LOCUS_03000 8427 7264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_03000 9110 8424 gene locus_tag LOCUS_03010 9110 8424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_03010 10380 9133 gene locus_tag LOCUS_03020 10380 9133 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275499.1 protein_id gnl|my_center|LOCUS_03020 11251 10502 gene locus_tag LOCUS_03030 11251 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 11274 12095 gene locus_tag LOCUS_03040 11274 12095 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_03040 12199 13611 gene locus_tag LOCUS_03050 12199 13611 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_03050 14209 13613 gene locus_tag LOCUS_03060 14209 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 15528 14197 gene locus_tag LOCUS_03070 gene thrC 15528 14197 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036973.1 protein_id gnl|my_center|LOCUS_03070 16501 15560 gene locus_tag LOCUS_03080 16501 15560 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838316.1 protein_id gnl|my_center|LOCUS_03080 18981 16498 gene locus_tag LOCUS_03090 gene thrA 18981 16498 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403462.1 protein_id gnl|my_center|LOCUS_03090 19225 19707 gene locus_tag LOCUS_03100 19225 19707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 19707 20330 gene locus_tag LOCUS_03110 19707 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 20662 20342 gene locus_tag LOCUS_03120 20662 20342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 21645 20722 gene locus_tag LOCUS_03130 21645 20722 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531969.1 protein_id gnl|my_center|LOCUS_03130 22097 21642 gene locus_tag LOCUS_03140 22097 21642 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_03140 22241 23896 gene locus_tag LOCUS_03150 22241 23896 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_03150 23901 24359 gene locus_tag LOCUS_03160 23901 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 25327 24356 gene locus_tag LOCUS_03170 gene cysB 25327 24356 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_03170 25413 26837 gene locus_tag LOCUS_03180 gene cysG 25413 26837 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_03180 26834 27865 gene locus_tag LOCUS_03190 26834 27865 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_03190 27913 28608 gene locus_tag LOCUS_03200 gene modB 27913 28608 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_03200 28623 29735 gene locus_tag LOCUS_03210 gene modC 28623 29735 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_03210 <30450 29753 gene locus_tag LOCUS_03220 <30450 29753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976331.1:phenylacetic acid degradation bifunctional protein PaaZ >Feature sequence010 <1 924 gene locus_tag LOCUS_03230 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994121.1:MBL fold metallo-hydrolase 921 1910 gene locus_tag LOCUS_03240 921 1910 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869284.1 protein_id gnl|my_center|LOCUS_03240 1996 2883 gene locus_tag LOCUS_03250 gene prpB 1996 2883 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945814.1 protein_id gnl|my_center|LOCUS_03250 2880 4022 gene locus_tag LOCUS_03260 gene prpC 2880 4022 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187967.1 protein_id gnl|my_center|LOCUS_03260 4030 5487 gene locus_tag LOCUS_03270 4030 5487 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272709.1 protein_id gnl|my_center|LOCUS_03270 6998 5484 gene locus_tag LOCUS_03280 6998 5484 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_03280 7766 7125 gene locus_tag LOCUS_03290 7766 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7899 8345 gene locus_tag LOCUS_03300 gene dtd 7899 8345 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266358.1 protein_id gnl|my_center|LOCUS_03300 8468 8701 gene locus_tag LOCUS_03310 gene tatA 8468 8701 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648696.1 protein_id gnl|my_center|LOCUS_03310 8754 9134 gene locus_tag LOCUS_03320 8754 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 9118 9897 gene locus_tag LOCUS_03330 gene tatC 9118 9897 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_03330 9930 11393 gene locus_tag LOCUS_03340 9930 11393 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_03340 11766 11413 gene locus_tag LOCUS_03350 11766 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 11911 13887 gene locus_tag LOCUS_03360 11911 13887 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_03360 14281 13910 gene locus_tag LOCUS_03370 14281 13910 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640659.1 protein_id gnl|my_center|LOCUS_03370 14721 14278 gene locus_tag LOCUS_03380 14721 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 14794 15189 gene locus_tag LOCUS_03390 14794 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 15838 15197 gene locus_tag LOCUS_03400 15838 15197 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_03400 17170 15893 gene locus_tag LOCUS_03410 gene cptA 17170 15893 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_03410 19436 17187 gene locus_tag LOCUS_03420 19436 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 20770 19568 gene locus_tag LOCUS_03430 20770 19568 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_03430 20769 21191 gene locus_tag LOCUS_03440 20769 21191 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 protein_id gnl|my_center|LOCUS_03440 21198 21464 gene locus_tag LOCUS_03450 gene grxC 21198 21464 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948013.1 protein_id gnl|my_center|LOCUS_03450 21467 21952 gene locus_tag LOCUS_03460 gene secB 21467 21952 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704300.1 protein_id gnl|my_center|LOCUS_03460 21995 23011 gene locus_tag LOCUS_03470 gene gpsA 21995 23011 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815279.1 protein_id gnl|my_center|LOCUS_03470 23612 23049 gene locus_tag LOCUS_03480 23612 23049 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947216.1 protein_id gnl|my_center|LOCUS_03480 23928 23635 gene locus_tag LOCUS_03490 23928 23635 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267656.1 protein_id gnl|my_center|LOCUS_03490 24401 23982 gene locus_tag LOCUS_03500 24401 23982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 24709 24434 gene locus_tag LOCUS_03510 24709 24434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 25805 25404 gene locus_tag LOCUS_03520 25805 25404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 26327 25998 gene locus_tag LOCUS_03530 26327 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 26723 26358 gene locus_tag LOCUS_03540 26723 26358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 26947 26720 gene locus_tag LOCUS_03550 26947 26720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 27505 27206 gene locus_tag LOCUS_03560 27505 27206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence011 1111 59 gene locus_tag LOCUS_03570 gene hppD 1111 59 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197900.1 protein_id gnl|my_center|LOCUS_03570 1157 6019 gene locus_tag LOCUS_03580 1157 6019 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_03580 6120 6869 gene locus_tag LOCUS_03590 gene gpmA 6120 6869 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_03590 7279 6884 gene locus_tag LOCUS_03600 7279 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 8067 7276 gene locus_tag LOCUS_03610 8067 7276 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_03610 8389 8075 gene locus_tag LOCUS_03620 8389 8075 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034859020.1 protein_id gnl|my_center|LOCUS_03620 8731 8471 gene locus_tag LOCUS_03630 8731 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 8855 9757 gene locus_tag LOCUS_03640 8855 9757 CDS product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816618.1 protein_id gnl|my_center|LOCUS_03640 9766 10083 gene locus_tag LOCUS_03650 9766 10083 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809828.1 protein_id gnl|my_center|LOCUS_03650 11272 10097 gene locus_tag LOCUS_03660 11272 10097 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265690.1 protein_id gnl|my_center|LOCUS_03660 12493 11294 gene locus_tag LOCUS_03670 12493 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 13992 12490 gene locus_tag LOCUS_03680 13992 12490 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479935.1 protein_id gnl|my_center|LOCUS_03680 14074 14997 gene locus_tag LOCUS_03690 14074 14997 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_03690 14994 16532 gene locus_tag LOCUS_03700 gene glpD 14994 16532 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526148.1 protein_id gnl|my_center|LOCUS_03700 16611 17372 gene locus_tag LOCUS_03710 16611 17372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 17430 19100 gene locus_tag LOCUS_03720 17430 19100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 19156 20514 gene locus_tag LOCUS_03730 19156 20514 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164897.1 protein_id gnl|my_center|LOCUS_03730 21304 20525 gene locus_tag LOCUS_03740 21304 20525 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_03740 22597 21323 gene locus_tag LOCUS_03750 gene mdpA 22597 21323 CDS product metallopeptidase MdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_03750 22695 22769 gene locus_tag LOCUS_t00030 22695 22769 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23427 22849 gene locus_tag LOCUS_03760 23427 22849 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 protein_id gnl|my_center|LOCUS_03760 23618 24250 gene locus_tag LOCUS_03770 23618 24250 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_03770 24317 24790 gene locus_tag LOCUS_03780 24317 24790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 26187 24730 gene locus_tag LOCUS_03790 26187 24730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 26550 26714 gene locus_tag LOCUS_03800 26550 26714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 26757 27215 gene locus_tag LOCUS_03810 26757 27215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence012 1222 3381 gene locus_tag LOCUS_03820 1222 3381 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_03820 4019 3435 gene locus_tag LOCUS_03830 4019 3435 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807699.1 protein_id gnl|my_center|LOCUS_03830 4204 4599 gene locus_tag LOCUS_03840 4204 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4815 4630 gene locus_tag LOCUS_03850 4815 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4891 5583 gene locus_tag LOCUS_03860 4891 5583 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 protein_id gnl|my_center|LOCUS_03860 6246 5554 gene locus_tag LOCUS_03870 gene lepB 6246 5554 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072829.1 protein_id gnl|my_center|LOCUS_03870 6355 6807 gene locus_tag LOCUS_03880 gene trxC 6355 6807 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_03880 9593 6702 gene locus_tag LOCUS_03890 9593 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 9867 10448 gene locus_tag LOCUS_03900 9867 10448 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811316.1 protein_id gnl|my_center|LOCUS_03900 10495 10974 gene locus_tag LOCUS_03910 10495 10974 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173437.1 protein_id gnl|my_center|LOCUS_03910 10964 13180 gene locus_tag LOCUS_03920 10964 13180 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_03920 13243 14454 gene locus_tag LOCUS_03930 13243 14454 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 protein_id gnl|my_center|LOCUS_03930 15169 14396 gene locus_tag LOCUS_03940 15169 14396 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_03940 15762 15184 gene locus_tag LOCUS_03950 15762 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 16529 15759 gene locus_tag LOCUS_03960 16529 15759 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533161.1 protein_id gnl|my_center|LOCUS_03960 17988 16531 gene locus_tag LOCUS_03970 gene nirK 17988 16531 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528780.1 protein_id gnl|my_center|LOCUS_03970 18474 18040 gene locus_tag LOCUS_03980 gene nsrR 18474 18040 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_03980 18928 18551 gene locus_tag LOCUS_03990 18928 18551 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_03990 18960 19862 gene locus_tag LOCUS_04000 18960 19862 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640156.1 protein_id gnl|my_center|LOCUS_04000 19935 20735 gene locus_tag LOCUS_04010 19935 20735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 20769 21302 gene locus_tag LOCUS_04020 20769 21302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 21626 21324 gene locus_tag LOCUS_04030 21626 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 21950 21627 gene locus_tag LOCUS_04040 21950 21627 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_04040 23036 22002 gene locus_tag LOCUS_04050 23036 22002 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 protein_id gnl|my_center|LOCUS_04050 24650 23124 gene locus_tag LOCUS_04060 24650 23124 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920649.1 protein_id gnl|my_center|LOCUS_04060 >Feature sequence013 441 1169 gene locus_tag LOCUS_04070 gene nth 441 1169 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185942.1 protein_id gnl|my_center|LOCUS_04070 1166 1621 gene locus_tag LOCUS_04080 1166 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1723 2097 gene locus_tag LOCUS_04090 1723 2097 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336246.1 protein_id gnl|my_center|LOCUS_04090 2097 3674 gene locus_tag LOCUS_04100 2097 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4479 3709 gene locus_tag LOCUS_04110 4479 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6329 4506 gene locus_tag LOCUS_04120 gene lpdA 6329 4506 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035792.1 protein_id gnl|my_center|LOCUS_04120 7777 6335 gene locus_tag LOCUS_04130 gene aceF 7777 6335 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_04130 10460 7791 gene locus_tag LOCUS_04140 gene aceE 10460 7791 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095425939.1 protein_id gnl|my_center|LOCUS_04140 10638 11672 gene locus_tag LOCUS_04150 gene pyrC 10638 11672 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_04150 11669 12391 gene locus_tag LOCUS_04160 gene rnt 11669 12391 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_04160 12715 12395 gene locus_tag LOCUS_04170 gene grxD 12715 12395 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037633.1 protein_id gnl|my_center|LOCUS_04170 12921 12718 gene locus_tag LOCUS_04180 12921 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 12866 13639 gene locus_tag LOCUS_04190 12866 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 13646 14503 gene locus_tag LOCUS_04200 gene nadC 13646 14503 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_04200 14632 16731 gene locus_tag LOCUS_04210 14632 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 17666 16728 gene locus_tag LOCUS_04220 17666 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 18142 17663 gene locus_tag LOCUS_04230 18142 17663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 18137 18724 gene locus_tag LOCUS_04240 18137 18724 CDS product DUF3455 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223796.1 protein_id gnl|my_center|LOCUS_04240 18676 19038 gene locus_tag LOCUS_04250 18676 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 20984 19152 gene locus_tag LOCUS_04260 20984 19152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 21981 21265 gene locus_tag LOCUS_04270 21981 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 24350 22011 gene locus_tag LOCUS_04280 24350 22011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence014 <1 1260 gene locus_tag LOCUS_04290 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105011.1:class II fumarate hydratase 1253 1960 gene locus_tag LOCUS_04300 1253 1960 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388120.1 protein_id gnl|my_center|LOCUS_04300 1957 2769 gene locus_tag LOCUS_04310 gene mazG 1957 2769 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_04310 2997 3143 gene locus_tag LOCUS_04320 2997 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3162 3848 gene locus_tag LOCUS_04330 3162 3848 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_04330 3867 5210 gene locus_tag LOCUS_04340 3867 5210 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_04340 6785 5247 gene locus_tag LOCUS_04350 6785 5247 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_04350 7954 6782 gene locus_tag LOCUS_04360 7954 6782 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213649.1 protein_id gnl|my_center|LOCUS_04360 8083 9453 gene locus_tag LOCUS_04370 8083 9453 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_04370 9470 10804 gene locus_tag LOCUS_04380 gene icd 9470 10804 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_04380 10791 11456 gene locus_tag LOCUS_04390 10791 11456 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_04390 11473 13287 gene locus_tag LOCUS_04400 gene uvrC 11473 13287 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_04400 13300 13854 gene locus_tag LOCUS_04410 gene pgsA 13300 13854 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268070.1 protein_id gnl|my_center|LOCUS_04410 13987 14062 gene locus_tag LOCUS_t00040 13987 14062 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15728 14088 gene locus_tag LOCUS_04420 15728 14088 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269292.1 protein_id gnl|my_center|LOCUS_04420 15932 16005 gene locus_tag LOCUS_t00050 15932 16005 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16129 17382 gene locus_tag LOCUS_04430 16129 17382 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_04430 18799 17609 gene locus_tag LOCUS_04440 18799 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 19103 19969 gene locus_tag LOCUS_04450 19103 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 20532 20230 gene locus_tag LOCUS_04460 20532 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 21086 20682 gene locus_tag LOCUS_04470 21086 20682 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095512524.1 protein_id gnl|my_center|LOCUS_04470 22191 21154 gene locus_tag LOCUS_04480 22191 21154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 22732 22184 gene locus_tag LOCUS_04490 22732 22184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence015 278 706 gene locus_tag LOCUS_04500 278 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 808 1767 gene locus_tag LOCUS_04510 808 1767 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943439.1 protein_id gnl|my_center|LOCUS_04510 1822 2388 gene locus_tag LOCUS_04520 1822 2388 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_04520 2692 2618 gene locus_tag LOCUS_t00060 2692 2618 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3972 2773 gene locus_tag LOCUS_04530 3972 2773 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945831.1 protein_id gnl|my_center|LOCUS_04530 4103 6127 gene locus_tag LOCUS_04540 gene uvrB 4103 6127 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_04540 6213 6287 gene locus_tag LOCUS_t00070 6213 6287 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6452 7804 gene locus_tag LOCUS_04550 6452 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 8760 7750 gene locus_tag LOCUS_04560 8760 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 11295 8851 gene locus_tag LOCUS_04570 11295 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 12427 11378 gene locus_tag LOCUS_04580 12427 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 13065 12424 gene locus_tag LOCUS_04590 13065 12424 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_04590 13379 13128 gene locus_tag LOCUS_04600 13379 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 13309 13728 gene locus_tag LOCUS_04610 13309 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 13755 13988 gene locus_tag LOCUS_04620 13755 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 13979 15343 gene locus_tag LOCUS_04630 13979 15343 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_04630 15348 16265 gene locus_tag LOCUS_04640 15348 16265 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 protein_id gnl|my_center|LOCUS_04640 16390 18318 gene locus_tag LOCUS_04650 gene thrS 16390 18318 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_04650 18382 18843 gene locus_tag LOCUS_04660 gene infC 18382 18843 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170846037.1 protein_id gnl|my_center|LOCUS_04660 18944 19147 gene locus_tag LOCUS_04670 gene rpmI 18944 19147 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 protein_id gnl|my_center|LOCUS_04670 19191 19553 gene locus_tag LOCUS_04680 gene rplT 19191 19553 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124858.1 protein_id gnl|my_center|LOCUS_04680 19570 20598 gene locus_tag LOCUS_04690 gene pheS 19570 20598 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382398.1 protein_id gnl|my_center|LOCUS_04690 20595 22988 gene locus_tag LOCUS_04700 gene pheT 20595 22988 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103972.1 protein_id gnl|my_center|LOCUS_04700 22993 23292 gene locus_tag LOCUS_04710 gene ihfA 22993 23292 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_04710 23273 23629 gene locus_tag LOCUS_04720 23273 23629 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence016 955 2532 gene locus_tag LOCUS_04730 955 2532 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_04730 2542 6744 gene locus_tag LOCUS_04740 2542 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6725 9205 gene locus_tag LOCUS_04750 6725 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 9220 9813 gene locus_tag LOCUS_04760 9220 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 10673 9825 gene locus_tag LOCUS_04770 10673 9825 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_04770 11389 10670 gene locus_tag LOCUS_04780 11389 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 12348 11386 gene locus_tag LOCUS_04790 12348 11386 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174491.1 protein_id gnl|my_center|LOCUS_04790 12408 14168 gene locus_tag LOCUS_04800 12408 14168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 14225 14584 gene locus_tag LOCUS_04810 14225 14584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 14669 16204 gene locus_tag LOCUS_04820 14669 16204 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969997.1 protein_id gnl|my_center|LOCUS_04820 16201 17007 gene locus_tag LOCUS_04830 16201 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 18031 17021 gene locus_tag LOCUS_04840 18031 17021 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201242.1 protein_id gnl|my_center|LOCUS_04840 18862 18122 gene locus_tag LOCUS_04850 18862 18122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390135.1 protein_id gnl|my_center|LOCUS_04850 19797 18865 gene locus_tag LOCUS_04860 19797 18865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975668.1 protein_id gnl|my_center|LOCUS_04860 20963 19794 gene locus_tag LOCUS_04870 20963 19794 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061568.1 protein_id gnl|my_center|LOCUS_04870 21874 20960 gene locus_tag LOCUS_04880 21874 20960 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550481.1 protein_id gnl|my_center|LOCUS_04880 21937 23202 gene locus_tag LOCUS_04890 21937 23202 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973657.1 protein_id gnl|my_center|LOCUS_04890 23214 23495 gene locus_tag LOCUS_04900 23214 23495 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531142.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence017 <1 1443 gene locus_tag LOCUS_04910 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930037.1:NADH-quinone oxidoreductase subunit L 1512 2963 gene locus_tag LOCUS_04920 1512 2963 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_04920 2960 4390 gene locus_tag LOCUS_04930 gene nuoN 2960 4390 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_04930 4455 5489 gene locus_tag LOCUS_04940 4455 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5501 6958 gene locus_tag LOCUS_04950 5501 6958 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444920.1 protein_id gnl|my_center|LOCUS_04950 7528 6989 gene locus_tag LOCUS_04960 7528 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7631 9052 gene locus_tag LOCUS_04970 gene hmgA 7631 9052 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194851.1 protein_id gnl|my_center|LOCUS_04970 9045 10388 gene locus_tag LOCUS_04980 gene fahA 9045 10388 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808480.1 protein_id gnl|my_center|LOCUS_04980 10385 11077 gene locus_tag LOCUS_04990 10385 11077 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_04990 11495 11154 gene locus_tag LOCUS_05000 11495 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 11625 12617 gene locus_tag LOCUS_05010 11625 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444587.1 protein_id gnl|my_center|LOCUS_05010 12855 13757 gene locus_tag LOCUS_05020 12855 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15118 13841 gene locus_tag LOCUS_05030 15118 13841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 15276 15932 gene locus_tag LOCUS_05040 15276 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 15929 16420 gene locus_tag LOCUS_05050 15929 16420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 17307 16468 gene locus_tag LOCUS_05060 17307 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 17622 18548 gene locus_tag LOCUS_05070 gene cysD 17622 18548 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038279.1 protein_id gnl|my_center|LOCUS_05070 18548 20455 gene locus_tag LOCUS_05080 gene cysN 18548 20455 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_05080 20452 21258 gene locus_tag LOCUS_05090 gene cysQ 20452 21258 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_05090 21690 21268 gene locus_tag LOCUS_05100 21690 21268 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061303.1 protein_id gnl|my_center|LOCUS_05100 21870 22943 gene locus_tag LOCUS_05110 21870 22943 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence018 130 3240 gene locus_tag LOCUS_05120 130 3240 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204974.1 protein_id gnl|my_center|LOCUS_05120 3251 6553 gene locus_tag LOCUS_05130 3251 6553 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521877.1 protein_id gnl|my_center|LOCUS_05130 6556 8082 gene locus_tag LOCUS_05140 6556 8082 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196794.1 protein_id gnl|my_center|LOCUS_05140 9404 8079 gene locus_tag LOCUS_05150 9404 8079 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401361.1 protein_id gnl|my_center|LOCUS_05150 11157 9427 gene locus_tag LOCUS_05160 11157 9427 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192556.1 protein_id gnl|my_center|LOCUS_05160 11250 11642 gene locus_tag LOCUS_05170 11250 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11666 12703 gene locus_tag LOCUS_05180 11666 12703 CDS product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 protein_id gnl|my_center|LOCUS_05180 12708 13463 gene locus_tag LOCUS_05190 12708 13463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 13543 13848 gene locus_tag LOCUS_05200 gene xanC 13543 13848 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_05200 13895 15181 gene locus_tag LOCUS_05210 gene xanA2 13895 15181 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_05210 15178 16476 gene locus_tag LOCUS_05220 15178 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 16473 17060 gene locus_tag LOCUS_05230 16473 17060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 17057 19435 gene locus_tag LOCUS_05240 17057 19435 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_05240 19432 20088 gene locus_tag LOCUS_05250 19432 20088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 20150 20908 gene locus_tag LOCUS_05260 20150 20908 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038465.1 protein_id gnl|my_center|LOCUS_05260 20905 21618 gene locus_tag LOCUS_05270 20905 21618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 21615 22808 gene locus_tag LOCUS_05280 21615 22808 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence019 <1 2648 gene locus_tag LOCUS_05290 <1 2648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532909.1:sarcosine oxidase subunit alpha 2635 3225 gene locus_tag LOCUS_05300 2635 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3222 5636 gene locus_tag LOCUS_05310 3222 5636 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_05310 5639 6844 gene locus_tag LOCUS_05320 5639 6844 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038761.1 protein_id gnl|my_center|LOCUS_05320 7009 11034 gene locus_tag LOCUS_05330 7009 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 11031 11675 gene locus_tag LOCUS_05340 11031 11675 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_05340 11822 12370 gene locus_tag LOCUS_05350 11822 12370 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037832.1 protein_id gnl|my_center|LOCUS_05350 12375 13343 gene locus_tag LOCUS_05360 12375 13343 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 protein_id gnl|my_center|LOCUS_05360 13362 13736 gene locus_tag LOCUS_05370 13362 13736 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004880039.1 protein_id gnl|my_center|LOCUS_05370 13745 14068 gene locus_tag LOCUS_05380 13745 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 14065 16056 gene locus_tag LOCUS_05390 14065 16056 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275321.1 protein_id gnl|my_center|LOCUS_05390 16078 18009 gene locus_tag LOCUS_05400 16078 18009 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704964.1 protein_id gnl|my_center|LOCUS_05400 18070 18903 gene locus_tag LOCUS_05410 18070 18903 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770000.1 protein_id gnl|my_center|LOCUS_05410 18900 19976 gene locus_tag LOCUS_05420 18900 19976 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437834.1 protein_id gnl|my_center|LOCUS_05420 20071 21177 gene locus_tag LOCUS_05430 20071 21177 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_05430 22585 21185 gene locus_tag LOCUS_05440 22585 21185 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523873.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence020 646 3453 gene locus_tag LOCUS_05450 646 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4711 3515 gene locus_tag LOCUS_05460 4711 3515 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_05460 6066 4735 gene locus_tag LOCUS_05470 6066 4735 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640670.1 protein_id gnl|my_center|LOCUS_05470 7400 6063 gene locus_tag LOCUS_05480 7400 6063 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_05480 8215 7424 gene locus_tag LOCUS_05490 8215 7424 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035619.1 protein_id gnl|my_center|LOCUS_05490 9066 8212 gene locus_tag LOCUS_05500 9066 8212 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_05500 10634 9066 gene locus_tag LOCUS_05510 gene pruA 10634 9066 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228781.1 protein_id gnl|my_center|LOCUS_05510 11995 10631 gene locus_tag LOCUS_05520 11995 10631 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112315.1 protein_id gnl|my_center|LOCUS_05520 12067 14598 gene locus_tag LOCUS_05530 12067 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 16620 14614 gene locus_tag LOCUS_05540 16620 14614 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_05540 16727 18721 gene locus_tag LOCUS_05550 16727 18721 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_05550 18849 21311 gene locus_tag LOCUS_05560 18849 21311 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence021 3530 621 gene locus_tag LOCUS_05570 3530 621 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942486.1 protein_id gnl|my_center|LOCUS_05570 5286 3640 gene locus_tag LOCUS_05580 gene pgi 5286 3640 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_05580 6480 5314 gene locus_tag LOCUS_05590 6480 5314 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_05590 7548 6535 gene locus_tag LOCUS_05600 7548 6535 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_05600 8822 7545 gene locus_tag LOCUS_05610 gene tviB 8822 7545 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172607932.1 protein_id gnl|my_center|LOCUS_05610 9593 8841 gene locus_tag LOCUS_05620 gene dnaQ 9593 8841 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_05620 10048 9605 gene locus_tag LOCUS_05630 gene rnhA 10048 9605 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_05630 10797 10048 gene locus_tag LOCUS_05640 10797 10048 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072515.1 protein_id gnl|my_center|LOCUS_05640 11123 10914 gene locus_tag LOCUS_05650 11123 10914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 11206 12669 gene locus_tag LOCUS_05660 11206 12669 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264066.1 protein_id gnl|my_center|LOCUS_05660 12742 13542 gene locus_tag LOCUS_05670 gene fabI 12742 13542 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087936.1 protein_id gnl|my_center|LOCUS_05670 15464 13539 gene locus_tag LOCUS_05680 gene ppiD 15464 13539 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_05680 15571 15495 gene locus_tag LOCUS_t00080 15571 15495 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15767 16246 gene locus_tag LOCUS_05690 15767 16246 CDS product DUF2844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198643.1 protein_id gnl|my_center|LOCUS_05690 16271 17515 gene locus_tag LOCUS_05700 16271 17515 CDS product DUF3443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524401.1 protein_id gnl|my_center|LOCUS_05700 17633 19483 gene locus_tag LOCUS_05710 17633 19483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 19480 20262 gene locus_tag LOCUS_05720 gene ygiD 19480 20262 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_05720 20441 20366 gene locus_tag LOCUS_t00090 20441 20366 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <21955 20562 gene locus_tag LOCUS_05730 <21955 20562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071918.1:endopeptidase La >Feature sequence022 <1 822 gene locus_tag LOCUS_05740 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404942.1:N-acetyl-gamma-glutamyl-phosphate reductase 840 2057 gene locus_tag LOCUS_05750 840 2057 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_05750 2054 3052 gene locus_tag LOCUS_05760 2054 3052 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404944.1 protein_id gnl|my_center|LOCUS_05760 3068 4003 gene locus_tag LOCUS_05770 gene argB 3068 4003 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_05770 4000 5184 gene locus_tag LOCUS_05780 gene argH 4000 5184 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404947.1 protein_id gnl|my_center|LOCUS_05780 5189 5743 gene locus_tag LOCUS_05790 5189 5743 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066626.1 protein_id gnl|my_center|LOCUS_05790 6381 5740 gene locus_tag LOCUS_05800 gene maiA 6381 5740 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_05800 7079 6393 gene locus_tag LOCUS_05810 7079 6393 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199325.1 protein_id gnl|my_center|LOCUS_05810 7122 7553 gene locus_tag LOCUS_05820 7122 7553 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_05820 7564 8001 gene locus_tag LOCUS_05830 7564 8001 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_05830 8021 8452 gene locus_tag LOCUS_05840 8021 8452 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199903.1 protein_id gnl|my_center|LOCUS_05840 8449 8679 gene locus_tag LOCUS_05850 8449 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 8914 9471 gene locus_tag LOCUS_05860 8914 9471 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_05860 9604 9885 gene locus_tag LOCUS_05870 9604 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 9873 10166 gene locus_tag LOCUS_05880 9873 10166 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038207.1 protein_id gnl|my_center|LOCUS_05880 11470 10196 gene locus_tag LOCUS_05890 11470 10196 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967274.1 protein_id gnl|my_center|LOCUS_05890 12874 11492 gene locus_tag LOCUS_05900 12874 11492 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_05900 13003 15780 gene locus_tag LOCUS_05910 gene polA 13003 15780 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190446.1 protein_id gnl|my_center|LOCUS_05910 15878 16429 gene locus_tag LOCUS_05920 15878 16429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 16518 17102 gene locus_tag LOCUS_05930 16518 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 17898 17317 gene locus_tag LOCUS_05940 gene yihA 17898 17317 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958433.1 protein_id gnl|my_center|LOCUS_05940 18027 18683 gene locus_tag LOCUS_05950 18027 18683 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_05950 18707 19609 gene locus_tag LOCUS_05960 18707 19609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 19691 19615 gene locus_tag LOCUS_t00100 19691 19615 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19837 20361 gene locus_tag LOCUS_05970 19837 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 <21411 20362 gene locus_tag LOCUS_05980 <21411 20362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039592.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence023 233 856 gene locus_tag LOCUS_05990 gene lexA 233 856 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704201.1 protein_id gnl|my_center|LOCUS_05990 870 1508 gene locus_tag LOCUS_06000 gene imuA 870 1508 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_06000 1512 2939 gene locus_tag LOCUS_06010 1512 2939 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_06010 2943 6035 gene locus_tag LOCUS_06020 gene dnaE2 2943 6035 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 protein_id gnl|my_center|LOCUS_06020 6274 8091 gene locus_tag LOCUS_06030 6274 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 8105 12694 gene locus_tag LOCUS_06040 8105 12694 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838180.1 protein_id gnl|my_center|LOCUS_06040 12739 14445 gene locus_tag LOCUS_06050 12739 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 14737 14465 gene locus_tag LOCUS_06060 14737 14465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 16058 14844 gene locus_tag LOCUS_06070 gene gspF 16058 14844 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_06070 17607 16096 gene locus_tag LOCUS_06080 gene xcpR 17607 16096 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_06080 19693 17618 gene locus_tag LOCUS_06090 gene gspD 19693 17618 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498847.1 protein_id gnl|my_center|LOCUS_06090 20766 19726 gene locus_tag LOCUS_06100 20766 19726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence024 1403 522 gene locus_tag LOCUS_06110 1403 522 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027236.1 protein_id gnl|my_center|LOCUS_06110 4141 1415 gene locus_tag LOCUS_06120 gene ligD 4141 1415 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104572.1 protein_id gnl|my_center|LOCUS_06120 1967 2050 gene locus_tag LOCUS_t00110 1967 2050 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4835 4158 gene locus_tag LOCUS_06130 4835 4158 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_06130 5553 4858 gene locus_tag LOCUS_06140 5553 4858 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 protein_id gnl|my_center|LOCUS_06140 8648 5565 gene locus_tag LOCUS_06150 8648 5565 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921619.1 protein_id gnl|my_center|LOCUS_06150 9807 8659 gene locus_tag LOCUS_06160 9807 8659 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171251.1 protein_id gnl|my_center|LOCUS_06160 11261 9804 gene locus_tag LOCUS_06170 11261 9804 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_06170 11860 11285 gene locus_tag LOCUS_06180 11860 11285 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 protein_id gnl|my_center|LOCUS_06180 14681 12009 gene locus_tag LOCUS_06190 14681 12009 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921413.1 protein_id gnl|my_center|LOCUS_06190 14842 15621 gene locus_tag LOCUS_06200 14842 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 15618 16085 gene locus_tag LOCUS_06210 15618 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 16206 16358 gene locus_tag LOCUS_06220 16206 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 17732 16404 gene locus_tag LOCUS_06230 17732 16404 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704253.1 protein_id gnl|my_center|LOCUS_06230 17839 18387 gene locus_tag LOCUS_06240 17839 18387 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970549.1 protein_id gnl|my_center|LOCUS_06240 18403 19902 gene locus_tag LOCUS_06250 18403 19902 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388051.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence025 <1 701 gene locus_tag LOCUS_06260 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112938.1:gamma-glutamyl-gamma-aminobutyrate hydrolase family protein 713 2053 gene locus_tag LOCUS_06270 713 2053 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529984.1 protein_id gnl|my_center|LOCUS_06270 2139 3263 gene locus_tag LOCUS_06280 2139 3263 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037487.1 protein_id gnl|my_center|LOCUS_06280 3271 4416 gene locus_tag LOCUS_06290 3271 4416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_06290 4425 5318 gene locus_tag LOCUS_06300 4425 5318 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813258.1 protein_id gnl|my_center|LOCUS_06300 5315 6163 gene locus_tag LOCUS_06310 5315 6163 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_06310 6171 6920 gene locus_tag LOCUS_06320 6171 6920 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284355.1 protein_id gnl|my_center|LOCUS_06320 7042 8211 gene locus_tag LOCUS_06330 7042 8211 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771011.1 protein_id gnl|my_center|LOCUS_06330 8208 8993 gene locus_tag LOCUS_06340 8208 8993 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_06340 9003 10175 gene locus_tag LOCUS_06350 9003 10175 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_06350 10196 12307 gene locus_tag LOCUS_06360 10196 12307 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_06360 12395 13072 gene locus_tag LOCUS_06370 12395 13072 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208083.1 protein_id gnl|my_center|LOCUS_06370 14822 13119 gene locus_tag LOCUS_06380 gene aceK 14822 13119 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038861.1 protein_id gnl|my_center|LOCUS_06380 15473 14841 gene locus_tag LOCUS_06390 15473 14841 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_06390 16818 15511 gene locus_tag LOCUS_06400 16818 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 17030 16851 gene locus_tag LOCUS_06410 17030 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 17011 18435 gene locus_tag LOCUS_06420 17011 18435 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036991.1 protein_id gnl|my_center|LOCUS_06420 18432 19553 gene locus_tag LOCUS_06430 gene aguA 18432 19553 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704695.1 protein_id gnl|my_center|LOCUS_06430 20315 19581 gene locus_tag LOCUS_06440 20315 19581 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036548.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence026 2996 2157 gene locus_tag LOCUS_06450 2996 2157 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_06450 3226 3498 gene locus_tag LOCUS_06460 3226 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 4799 3570 gene locus_tag LOCUS_06470 4799 3570 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_06470 4936 6744 gene locus_tag LOCUS_06480 4936 6744 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_06480 6741 8267 gene locus_tag LOCUS_06490 6741 8267 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530987.1 protein_id gnl|my_center|LOCUS_06490 9304 8264 gene locus_tag LOCUS_06500 9304 8264 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084319.1 protein_id gnl|my_center|LOCUS_06500 9972 9421 gene locus_tag LOCUS_06510 9972 9421 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_06510 10017 10442 gene locus_tag LOCUS_06520 10017 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 10406 10609 gene locus_tag LOCUS_06530 10406 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 10709 12358 gene locus_tag LOCUS_06540 10709 12358 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_06540 13217 12486 gene locus_tag LOCUS_06550 13217 12486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 protein_id gnl|my_center|LOCUS_06550 14176 13214 gene locus_tag LOCUS_06560 14176 13214 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438698.1 protein_id gnl|my_center|LOCUS_06560 14214 15311 gene locus_tag LOCUS_06570 14214 15311 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_06570 15362 16786 gene locus_tag LOCUS_06580 15362 16786 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 protein_id gnl|my_center|LOCUS_06580 16783 17541 gene locus_tag LOCUS_06590 16783 17541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 18331 17570 gene locus_tag LOCUS_06600 18331 17570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038742.1 protein_id gnl|my_center|LOCUS_06600 19257 18328 gene locus_tag LOCUS_06610 19257 18328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence027 1263 367 gene locus_tag LOCUS_06620 1263 367 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920982.1 protein_id gnl|my_center|LOCUS_06620 1467 2033 gene locus_tag LOCUS_06630 1467 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2030 2653 gene locus_tag LOCUS_06640 2030 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2650 3423 gene locus_tag LOCUS_06650 2650 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3423 4073 gene locus_tag LOCUS_06660 3423 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4074 8564 gene locus_tag LOCUS_06670 4074 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 8577 9062 gene locus_tag LOCUS_06680 8577 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 9412 9837 gene locus_tag LOCUS_06690 9412 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 10343 9882 gene locus_tag LOCUS_06700 10343 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 10418 11212 gene locus_tag LOCUS_06710 10418 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 11227 13278 gene locus_tag LOCUS_06720 11227 13278 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036460.1 protein_id gnl|my_center|LOCUS_06720 13389 14510 gene locus_tag LOCUS_06730 13389 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 14908 14516 gene locus_tag LOCUS_06740 14908 14516 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_06740 15889 14918 gene locus_tag LOCUS_06750 15889 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 16527 15901 gene locus_tag LOCUS_06760 gene tmk 16527 15901 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267153.1 protein_id gnl|my_center|LOCUS_06760 17603 16524 gene locus_tag LOCUS_06770 gene mltG 17603 16524 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_06770 18462 17596 gene locus_tag LOCUS_06780 gene pabC 18462 17596 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_06780 <19661 18452 gene locus_tag LOCUS_06790 <19661 18452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036222.1:aminodeoxychorismate synthase component I >Feature sequence028 <1 657 gene locus_tag LOCUS_06800 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392647.1:glycosyltransferase family 4 protein 674 1660 gene locus_tag LOCUS_06810 674 1660 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_06810 2038 1667 gene locus_tag LOCUS_06820 2038 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2155 2871 gene locus_tag LOCUS_06830 2155 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3291 4280 gene locus_tag LOCUS_06840 3291 4280 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_06840 4284 4613 gene locus_tag LOCUS_06850 4284 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 5238 4630 gene locus_tag LOCUS_06860 5238 4630 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533660.1 protein_id gnl|my_center|LOCUS_06860 7081 5231 gene locus_tag LOCUS_06870 7081 5231 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408474.1 protein_id gnl|my_center|LOCUS_06870 8552 8172 gene locus_tag LOCUS_06880 8552 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 9209 8649 gene locus_tag LOCUS_06890 9209 8649 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106016.1 protein_id gnl|my_center|LOCUS_06890 9432 13889 gene locus_tag LOCUS_06900 gene gltB 9432 13889 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_06900 13911 15323 gene locus_tag LOCUS_06910 13911 15323 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621194.1 protein_id gnl|my_center|LOCUS_06910 18010 15380 gene locus_tag LOCUS_06920 18010 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 18095 18664 gene locus_tag LOCUS_06930 18095 18664 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence029 565 1998 gene locus_tag LOCUS_06940 565 1998 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_06940 2050 2370 gene locus_tag LOCUS_06950 gene hpf 2050 2370 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162480.1 protein_id gnl|my_center|LOCUS_06950 2422 3318 gene locus_tag LOCUS_06960 gene rapZ 2422 3318 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_06960 4605 3427 gene locus_tag LOCUS_06970 4605 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5827 4625 gene locus_tag LOCUS_06980 5827 4625 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_06980 8341 5936 gene locus_tag LOCUS_06990 8341 5936 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535630.1 protein_id gnl|my_center|LOCUS_06990 9804 8365 gene locus_tag LOCUS_07000 gene pyk 9804 8365 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958436.1 protein_id gnl|my_center|LOCUS_07000 10999 9821 gene locus_tag LOCUS_07010 10999 9821 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939799.1 protein_id gnl|my_center|LOCUS_07010 12009 10996 gene locus_tag LOCUS_07020 gene gap 12009 10996 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809444.1 protein_id gnl|my_center|LOCUS_07020 14006 12009 gene locus_tag LOCUS_07030 gene tkt 14006 12009 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098688.1 protein_id gnl|my_center|LOCUS_07030 14282 15079 gene locus_tag LOCUS_07040 gene cpdA 14282 15079 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266482.1 protein_id gnl|my_center|LOCUS_07040 15025 15894 gene locus_tag LOCUS_07050 15025 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 16821 15931 gene locus_tag LOCUS_07060 16821 15931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 17900 16836 gene locus_tag LOCUS_07070 17900 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence030 274 615 gene locus_tag LOCUS_07080 274 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 628 1974 gene locus_tag LOCUS_07090 628 1974 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038930.1 protein_id gnl|my_center|LOCUS_07090 2909 2055 gene locus_tag LOCUS_07100 2909 2055 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246513.1 protein_id gnl|my_center|LOCUS_07100 2979 3737 gene locus_tag LOCUS_07110 2979 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3741 4463 gene locus_tag LOCUS_07120 gene rph 3741 4463 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_07120 4460 5071 gene locus_tag LOCUS_07130 4460 5071 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174736.1 protein_id gnl|my_center|LOCUS_07130 5068 5688 gene locus_tag LOCUS_07140 gene gmk 5068 5688 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_07140 5789 6067 gene locus_tag LOCUS_07150 5789 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 6083 8293 gene locus_tag LOCUS_07160 gene spoT 6083 8293 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 protein_id gnl|my_center|LOCUS_07160 8367 8750 gene locus_tag LOCUS_07170 8367 8750 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217718.1 protein_id gnl|my_center|LOCUS_07170 8729 10858 gene locus_tag LOCUS_07180 gene recG 8729 10858 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_07180 10872 11822 gene locus_tag LOCUS_07190 gene ubiA 10872 11822 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772835.1 protein_id gnl|my_center|LOCUS_07190 11833 12201 gene locus_tag LOCUS_07200 11833 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 12282 13343 gene locus_tag LOCUS_07210 gene bioB 12282 13343 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103330.1 protein_id gnl|my_center|LOCUS_07210 13318 14517 gene locus_tag LOCUS_07220 gene bioF 13318 14517 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_07220 14760 14664 gene locus_tag LOCUS_t00120 14760 14664 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15295 16194 gene locus_tag LOCUS_07230 gene bioC 15295 16194 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_07230 16191 16877 gene locus_tag LOCUS_07240 gene bioD 16191 16877 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_07240 16970 17449 gene locus_tag LOCUS_07250 16970 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 17539 18411 gene locus_tag LOCUS_07260 17539 18411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence031 <1 1431 gene locus_tag LOCUS_07270 <1 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002554661.1:aspartate--tRNA ligase 1461 2075 gene locus_tag LOCUS_07280 1461 2075 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_07280 4640 2079 gene locus_tag LOCUS_07290 gene mutS 4640 2079 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095574877.1 protein_id gnl|my_center|LOCUS_07290 4725 5234 gene locus_tag LOCUS_07300 gene pncC 4725 5234 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005019686.1 protein_id gnl|my_center|LOCUS_07300 5231 5809 gene locus_tag LOCUS_07310 gene thpR 5231 5809 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_07310 5913 6950 gene locus_tag LOCUS_07320 gene recA 5913 6950 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_07320 7338 6973 gene locus_tag LOCUS_07330 7338 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 7412 7903 gene locus_tag LOCUS_07340 gene recX 7412 7903 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 protein_id gnl|my_center|LOCUS_07340 7910 10534 gene locus_tag LOCUS_07350 gene alaS 7910 10534 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073284.1 protein_id gnl|my_center|LOCUS_07350 10651 10741 gene locus_tag LOCUS_t00130 10651 10741 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12190 10859 gene locus_tag LOCUS_07360 12190 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 12566 12180 gene locus_tag LOCUS_07370 12566 12180 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038312.1 protein_id gnl|my_center|LOCUS_07370 12898 13821 gene locus_tag LOCUS_07380 12898 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 15928 13952 gene locus_tag LOCUS_07390 15928 13952 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_07390 16289 15987 gene locus_tag LOCUS_07400 16289 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 16592 16380 gene locus_tag LOCUS_07410 16592 16380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 17307 16762 gene locus_tag LOCUS_07420 17307 16762 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085277.1 protein_id gnl|my_center|LOCUS_07420 17919 17326 gene locus_tag LOCUS_07430 17919 17326 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_07430 17922 18515 gene locus_tag LOCUS_07440 17922 18515 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556057.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence032 169 1329 gene locus_tag LOCUS_07450 169 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1369 1896 gene locus_tag LOCUS_07460 1369 1896 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_07460 1939 4170 gene locus_tag LOCUS_07470 1939 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4184 4546 gene locus_tag LOCUS_07480 4184 4546 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_07480 4546 5025 gene locus_tag LOCUS_07490 4546 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5036 5890 gene locus_tag LOCUS_07500 5036 5890 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_07500 5892 6551 gene locus_tag LOCUS_07510 gene cheD 5892 6551 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_07510 6587 7726 gene locus_tag LOCUS_07520 6587 7726 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_07520 8740 7730 gene locus_tag LOCUS_07530 8740 7730 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922219.1 protein_id gnl|my_center|LOCUS_07530 9756 8749 gene locus_tag LOCUS_07540 gene fliG 9756 8749 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890098.1 protein_id gnl|my_center|LOCUS_07540 11434 9749 gene locus_tag LOCUS_07550 gene fliF 11434 9749 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037092.1 protein_id gnl|my_center|LOCUS_07550 11782 11456 gene locus_tag LOCUS_07560 gene fliE 11782 11456 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344011.1 protein_id gnl|my_center|LOCUS_07560 12812 11799 gene locus_tag LOCUS_07570 12812 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 14086 12935 gene locus_tag LOCUS_07580 14086 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 14948 14352 gene locus_tag LOCUS_07590 14948 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 15378 14965 gene locus_tag LOCUS_07600 15378 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 16636 15530 gene locus_tag LOCUS_07610 16636 15530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_07610 17272 17659 gene locus_tag LOCUS_tm00010 17272 17659 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 17585 17659 gene locus_tag LOCUS_t00140 17585 17659 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 3776 1557 gene locus_tag LOCUS_07620 3776 1557 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038847.1 protein_id gnl|my_center|LOCUS_07620 3887 4477 gene locus_tag LOCUS_07630 3887 4477 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_07630 4474 4875 gene locus_tag LOCUS_07640 4474 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 4875 5162 gene locus_tag LOCUS_07650 4875 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 5179 5742 gene locus_tag LOCUS_07660 5179 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6680 5739 gene locus_tag LOCUS_07670 6680 5739 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_07670 7024 6677 gene locus_tag LOCUS_07680 7024 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 8825 7035 gene locus_tag LOCUS_07690 8825 7035 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444518.1 protein_id gnl|my_center|LOCUS_07690 10279 8891 gene locus_tag LOCUS_07700 10279 8891 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_07700 10575 10279 gene locus_tag LOCUS_07710 10575 10279 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_07710 11665 10586 gene locus_tag LOCUS_07720 11665 10586 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_07720 11828 12502 gene locus_tag LOCUS_07730 11828 12502 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_07730 12796 13686 gene locus_tag LOCUS_07740 12796 13686 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_07740 13810 16020 gene locus_tag LOCUS_07750 gene acs 13810 16020 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_07750 16048 16716 gene locus_tag LOCUS_07760 16048 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 <17876 16718 gene locus_tag LOCUS_07770 <17876 16718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266268.1:acetyl-CoA hydrolase/transferase C-terminal domain-containing protein >Feature sequence034 491 1216 gene locus_tag LOCUS_07780 gene fabG 491 1216 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_07780 2692 1250 gene locus_tag LOCUS_07790 2692 1250 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525274.1 protein_id gnl|my_center|LOCUS_07790 3220 2732 gene locus_tag LOCUS_07800 3220 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3964 3248 gene locus_tag LOCUS_07810 3964 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 protein_id gnl|my_center|LOCUS_07810 4819 4031 gene locus_tag LOCUS_07820 4819 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 5330 4878 gene locus_tag LOCUS_07830 5330 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5480 8239 gene locus_tag LOCUS_07840 5480 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 8306 9439 gene locus_tag LOCUS_07850 8306 9439 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_07850 10889 9423 gene locus_tag LOCUS_07860 10889 9423 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015922925.1 protein_id gnl|my_center|LOCUS_07860 13052 10893 gene locus_tag LOCUS_07870 13052 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 13305 14570 gene locus_tag LOCUS_07880 13305 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 15658 14567 gene locus_tag LOCUS_07890 15658 14567 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_07890 16497 15655 gene locus_tag LOCUS_07900 16497 15655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 16662 17165 gene locus_tag LOCUS_07910 gene phaR 16662 17165 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037439.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence035 1197 175 gene locus_tag LOCUS_07920 1197 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1256 2689 gene locus_tag LOCUS_07930 1256 2689 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_07930 2702 3505 gene locus_tag LOCUS_07940 2702 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3502 4386 gene locus_tag LOCUS_07950 3502 4386 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921521.1 protein_id gnl|my_center|LOCUS_07950 5394 4396 gene locus_tag LOCUS_07960 5394 4396 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275525.1 protein_id gnl|my_center|LOCUS_07960 6110 5397 gene locus_tag LOCUS_07970 6110 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6130 6450 gene locus_tag LOCUS_07980 6130 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7314 6463 gene locus_tag LOCUS_07990 7314 6463 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032710620.1 protein_id gnl|my_center|LOCUS_07990 7419 7625 gene locus_tag LOCUS_08000 7419 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 7843 7622 gene locus_tag LOCUS_08010 7843 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 8278 10092 gene locus_tag LOCUS_08020 gene kdpA 8278 10092 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_08020 10085 12199 gene locus_tag LOCUS_08030 gene kdpB 10085 12199 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_08030 12199 12792 gene locus_tag LOCUS_08040 gene kdpC 12199 12792 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_08040 12799 14613 gene locus_tag LOCUS_08050 12799 14613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08050 14614 15504 gene locus_tag LOCUS_08060 14614 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08060 15501 16205 gene locus_tag LOCUS_08070 gene kdpE 15501 16205 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_08070 16661 16215 gene locus_tag LOCUS_08080 16661 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 17035 16661 gene locus_tag LOCUS_08090 17035 16661 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 protein_id gnl|my_center|LOCUS_08090 <17622 17050 gene locus_tag LOCUS_08100 <17622 17050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939350.1:chemotaxis protein CheA >Feature sequence036 385 1440 gene locus_tag LOCUS_08110 gene wlbA 385 1440 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_08110 1460 2044 gene locus_tag LOCUS_08120 gene wlbB 1460 2044 CDS product O-antigen biosynthesis protein WlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807114.1 protein_id gnl|my_center|LOCUS_08120 2052 3116 gene locus_tag LOCUS_08130 gene wlbD 2052 3116 CDS product O-antigen biosynthesis protein WlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447875.1 protein_id gnl|my_center|LOCUS_08130 3131 4321 gene locus_tag LOCUS_08140 3131 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4318 5538 gene locus_tag LOCUS_08150 4318 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 5538 7397 gene locus_tag LOCUS_08160 gene asnB 5538 7397 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396166.1 protein_id gnl|my_center|LOCUS_08160 7394 8134 gene locus_tag LOCUS_08170 7394 8134 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140652.1 protein_id gnl|my_center|LOCUS_08170 9207 8170 gene locus_tag LOCUS_08180 9207 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 10544 9381 gene locus_tag LOCUS_08190 10544 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 11053 12264 gene locus_tag LOCUS_08200 gene wecA 11053 12264 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050972.1 protein_id gnl|my_center|LOCUS_08200 12402 13742 gene locus_tag LOCUS_08210 12402 13742 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_08210 13765 15192 gene locus_tag LOCUS_08220 13765 15192 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_08220 15208 16563 gene locus_tag LOCUS_08230 gene cpsG 15208 16563 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164216.1 protein_id gnl|my_center|LOCUS_08230 17098 16487 gene locus_tag LOCUS_08240 17098 16487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 17274 17095 gene locus_tag LOCUS_08250 17274 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence037 403 1236 gene locus_tag LOCUS_08260 403 1236 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395810.1 protein_id gnl|my_center|LOCUS_08260 1712 1233 gene locus_tag LOCUS_08270 1712 1233 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878142.1 protein_id gnl|my_center|LOCUS_08270 2978 1716 gene locus_tag LOCUS_08280 2978 1716 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_08280 2866 3111 gene locus_tag LOCUS_08290 2866 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3108 4487 gene locus_tag LOCUS_08300 3108 4487 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966425.1 protein_id gnl|my_center|LOCUS_08300 5452 4640 gene locus_tag LOCUS_08310 5452 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 6771 5557 gene locus_tag LOCUS_08320 6771 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7037 6762 gene locus_tag LOCUS_08330 7037 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7522 7043 gene locus_tag LOCUS_08340 7522 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 8219 7551 gene locus_tag LOCUS_08350 8219 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8998 8234 gene locus_tag LOCUS_08360 8998 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 11756 9015 gene locus_tag LOCUS_08370 11756 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12135 13364 gene locus_tag LOCUS_08380 12135 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 13379 15925 gene locus_tag LOCUS_08390 13379 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence038 1330 128 gene locus_tag LOCUS_08400 1330 128 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187588.1 protein_id gnl|my_center|LOCUS_08400 2291 1383 gene locus_tag LOCUS_08410 2291 1383 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917928.1 protein_id gnl|my_center|LOCUS_08410 2790 2389 gene locus_tag LOCUS_08420 2790 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 3403 2933 gene locus_tag LOCUS_08430 3403 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 4419 3613 gene locus_tag LOCUS_08440 4419 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967090.1 protein_id gnl|my_center|LOCUS_08440 5513 4470 gene locus_tag LOCUS_08450 5513 4470 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_08450 5666 6277 gene locus_tag LOCUS_08460 5666 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_08460 7902 6202 gene locus_tag LOCUS_08470 7902 6202 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_08470 7977 8876 gene locus_tag LOCUS_08480 gene asd 7977 8876 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_08480 8911 9522 gene locus_tag LOCUS_08490 8911 9522 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404639.1 protein_id gnl|my_center|LOCUS_08490 9900 9532 gene locus_tag LOCUS_08500 9900 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 10321 9890 gene locus_tag LOCUS_08510 10321 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 10500 10318 gene locus_tag LOCUS_08520 10500 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 11013 10564 gene locus_tag LOCUS_08530 11013 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 11298 11017 gene locus_tag LOCUS_08540 11298 11017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 11604 11332 gene locus_tag LOCUS_08550 11604 11332 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_08550 12075 12332 gene locus_tag LOCUS_08560 12075 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 12363 13355 gene locus_tag LOCUS_08570 12363 13355 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_08570 14437 13256 gene locus_tag LOCUS_08580 14437 13256 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815676.1 protein_id gnl|my_center|LOCUS_08580 15642 14443 gene locus_tag LOCUS_08590 15642 14443 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185551.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence039 2744 1383 gene locus_tag LOCUS_08600 2744 1383 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208435.1 protein_id gnl|my_center|LOCUS_08600 3194 2766 gene locus_tag LOCUS_08610 3194 2766 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948665.1 protein_id gnl|my_center|LOCUS_08610 4630 3197 gene locus_tag LOCUS_08620 gene atpD 4630 3197 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114045.1 protein_id gnl|my_center|LOCUS_08620 5511 4651 gene locus_tag LOCUS_08630 gene atpG 5511 4651 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_08630 7171 5630 gene locus_tag LOCUS_08640 gene atpA 7171 5630 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035799.1 protein_id gnl|my_center|LOCUS_08640 7817 7281 gene locus_tag LOCUS_08650 7817 7281 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_08650 8297 7827 gene locus_tag LOCUS_08660 8297 7827 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948670.1 protein_id gnl|my_center|LOCUS_08660 8603 8337 gene locus_tag LOCUS_08670 gene atpE 8603 8337 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948671.1 protein_id gnl|my_center|LOCUS_08670 9526 8660 gene locus_tag LOCUS_08680 gene atpB 9526 8660 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443864.1 protein_id gnl|my_center|LOCUS_08680 9951 9550 gene locus_tag LOCUS_08690 9951 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 11038 10142 gene locus_tag LOCUS_08700 11038 10142 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_08700 12005 11043 gene locus_tag LOCUS_08710 12005 11043 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_08710 13170 12109 gene locus_tag LOCUS_08720 13170 12109 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388795.1 protein_id gnl|my_center|LOCUS_08720 13301 13774 gene locus_tag LOCUS_08730 13301 13774 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100361.1 protein_id gnl|my_center|LOCUS_08730 14411 13737 gene locus_tag LOCUS_08740 gene rsmG 14411 13737 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377883.1 protein_id gnl|my_center|LOCUS_08740 14493 15125 gene locus_tag LOCUS_08750 14493 15125 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_08750 15122 16438 gene locus_tag LOCUS_08760 15122 16438 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence040 92 1651 gene locus_tag LOCUS_08770 92 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2489 2265 gene locus_tag LOCUS_08780 2489 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2440 4029 gene locus_tag LOCUS_08790 2440 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5387 4041 gene locus_tag LOCUS_08800 gene glrR 5387 4041 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703177.1 protein_id gnl|my_center|LOCUS_08800 5994 5401 gene locus_tag LOCUS_08810 5994 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 7483 6026 gene locus_tag LOCUS_08820 gene qseE 7483 6026 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602450.1 protein_id gnl|my_center|LOCUS_08820 8605 7613 gene locus_tag LOCUS_08830 gene galE 8605 7613 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_08830 8642 9646 gene locus_tag LOCUS_08840 8642 9646 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_08840 9720 10310 gene locus_tag LOCUS_08850 9720 10310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 10405 14025 gene locus_tag LOCUS_08860 10405 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 14022 15596 gene locus_tag LOCUS_08870 14022 15596 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_08870 15606 16352 gene locus_tag LOCUS_08880 15606 16352 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence041 1637 312 gene locus_tag LOCUS_08890 1637 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2075 1812 gene locus_tag LOCUS_08900 2075 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2343 3380 gene locus_tag LOCUS_08910 2343 3380 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140266.1 protein_id gnl|my_center|LOCUS_08910 3377 4645 gene locus_tag LOCUS_08920 3377 4645 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 protein_id gnl|my_center|LOCUS_08920 5963 4653 gene locus_tag LOCUS_08930 5963 4653 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900165.1 protein_id gnl|my_center|LOCUS_08930 5878 6111 gene locus_tag LOCUS_08940 5878 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6108 7271 gene locus_tag LOCUS_08950 6108 7271 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_08950 7936 7268 gene locus_tag LOCUS_08960 gene gph 7936 7268 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390779.1 protein_id gnl|my_center|LOCUS_08960 8026 9156 gene locus_tag LOCUS_08970 8026 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9143 9790 gene locus_tag LOCUS_08980 9143 9790 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114535.1 protein_id gnl|my_center|LOCUS_08980 10478 9813 gene locus_tag LOCUS_08990 10478 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10714 11898 gene locus_tag LOCUS_09000 10714 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 11895 12683 gene locus_tag LOCUS_09010 11895 12683 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_09010 14195 12717 gene locus_tag LOCUS_09020 14195 12717 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501515.1 protein_id gnl|my_center|LOCUS_09020 15045 14272 gene locus_tag LOCUS_09030 gene xth 15045 14272 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969370.1 protein_id gnl|my_center|LOCUS_09030 15233 15547 gene locus_tag LOCUS_09040 15233 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 <16377 15557 gene locus_tag LOCUS_09050 <16377 15557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223174.1:apolipoprotein N-acyltransferase >Feature sequence042 257 883 gene locus_tag LOCUS_09060 257 883 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_09060 997 1377 gene locus_tag LOCUS_09070 997 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1470 2201 gene locus_tag LOCUS_09080 1470 2201 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970398.1 protein_id gnl|my_center|LOCUS_09080 2710 2231 gene locus_tag LOCUS_09090 2710 2231 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484516.1 protein_id gnl|my_center|LOCUS_09090 3182 2718 gene locus_tag LOCUS_09100 3182 2718 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097792.1 protein_id gnl|my_center|LOCUS_09100 3905 3255 gene locus_tag LOCUS_09110 3905 3255 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766614.1 protein_id gnl|my_center|LOCUS_09110 4402 5832 gene locus_tag LOCUS_09120 4402 5832 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_09120 6530 5829 gene locus_tag LOCUS_09130 6530 5829 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970398.1 protein_id gnl|my_center|LOCUS_09130 7629 6643 gene locus_tag LOCUS_09140 7629 6643 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_09140 8449 7766 gene locus_tag LOCUS_09150 8449 7766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 8885 8463 gene locus_tag LOCUS_09160 8885 8463 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524075.1 protein_id gnl|my_center|LOCUS_09160 10828 8882 gene locus_tag LOCUS_09170 10828 8882 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533008.1 protein_id gnl|my_center|LOCUS_09170 11400 10825 gene locus_tag LOCUS_09180 11400 10825 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404446.1 protein_id gnl|my_center|LOCUS_09180 11500 11886 gene locus_tag LOCUS_09190 11500 11886 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190295.1 protein_id gnl|my_center|LOCUS_09190 12283 11867 gene locus_tag LOCUS_09200 12283 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 14663 12255 gene locus_tag LOCUS_09210 gene nirB 14663 12255 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_09210 14923 15771 gene locus_tag LOCUS_09220 14923 15771 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence043 3948 1771 gene locus_tag LOCUS_09230 3948 1771 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965397.1 protein_id gnl|my_center|LOCUS_09230 4821 4024 gene locus_tag LOCUS_09240 4821 4024 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819839.1 protein_id gnl|my_center|LOCUS_09240 6108 4831 gene locus_tag LOCUS_09250 gene serS 6108 4831 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_09250 7430 6105 gene locus_tag LOCUS_09260 7430 6105 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_09260 8326 7427 gene locus_tag LOCUS_09270 8326 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 10657 8330 gene locus_tag LOCUS_09280 10657 8330 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_09280 10719 11702 gene locus_tag LOCUS_09290 gene trxB 10719 11702 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946716.1 protein_id gnl|my_center|LOCUS_09290 11715 12875 gene locus_tag LOCUS_09300 11715 12875 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813554.1 protein_id gnl|my_center|LOCUS_09300 12872 13558 gene locus_tag LOCUS_09310 gene aat 12872 13558 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_09310 13650 13844 gene locus_tag LOCUS_09320 gene infA 13650 13844 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005627617.1 protein_id gnl|my_center|LOCUS_09320 16113 13849 gene locus_tag LOCUS_09330 gene clpA 16113 13849 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence044 510 1115 gene locus_tag LOCUS_09340 gene gstA 510 1115 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 protein_id gnl|my_center|LOCUS_09340 1124 1321 gene locus_tag LOCUS_09350 1124 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1345 1596 gene locus_tag LOCUS_09360 1345 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1622 1834 gene locus_tag LOCUS_09370 1622 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4113 1960 gene locus_tag LOCUS_09380 gene rpoD 4113 1960 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_09380 6047 4233 gene locus_tag LOCUS_09390 6047 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6545 6102 gene locus_tag LOCUS_09400 6545 6102 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_09400 6814 6605 gene locus_tag LOCUS_09410 gene rpsU 6814 6605 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_09410 7001 7402 gene locus_tag LOCUS_09420 7001 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 9321 7417 gene locus_tag LOCUS_09430 9321 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9342 10361 gene locus_tag LOCUS_09440 gene tsaD 9342 10361 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220126.1 protein_id gnl|my_center|LOCUS_09440 10384 10764 gene locus_tag LOCUS_09450 gene folB 10384 10764 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_09450 10774 11262 gene locus_tag LOCUS_09460 gene folK 10774 11262 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_09460 12064 11276 gene locus_tag LOCUS_09470 12064 11276 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_09470 12100 13260 gene locus_tag LOCUS_09480 12100 13260 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_09480 13282 14145 gene locus_tag LOCUS_09490 13282 14145 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_09490 15407 14181 gene locus_tag LOCUS_09500 15407 14181 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence045 915 130 gene locus_tag LOCUS_09510 915 130 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_09510 976 4116 gene locus_tag LOCUS_09520 976 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_09520 4813 4124 gene locus_tag LOCUS_09530 4813 4124 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087036.1 protein_id gnl|my_center|LOCUS_09530 4935 6056 gene locus_tag LOCUS_09540 4935 6056 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125360.1 protein_id gnl|my_center|LOCUS_09540 6643 6170 gene locus_tag LOCUS_09550 6643 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 7039 6647 gene locus_tag LOCUS_09560 7039 6647 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_09560 7374 7036 gene locus_tag LOCUS_09570 7374 7036 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 protein_id gnl|my_center|LOCUS_09570 7526 7729 gene locus_tag LOCUS_09580 7526 7729 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_09580 7747 8814 gene locus_tag LOCUS_09590 7747 8814 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_09590 8811 12110 gene locus_tag LOCUS_09600 8811 12110 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_09600 12113 13390 gene locus_tag LOCUS_09610 12113 13390 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_09610 13396 14700 gene locus_tag LOCUS_09620 13396 14700 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404713.1 protein_id gnl|my_center|LOCUS_09620 15357 14725 gene locus_tag LOCUS_09630 15357 14725 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_09630 15596 15366 gene locus_tag LOCUS_09640 15596 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09640 >Feature sequence046 810 2444 gene locus_tag LOCUS_09650 810 2444 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_09650 2477 3784 gene locus_tag LOCUS_09660 2477 3784 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_09660 5030 3747 gene locus_tag LOCUS_09670 5030 3747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 protein_id gnl|my_center|LOCUS_09670 5599 5027 gene locus_tag LOCUS_09680 5599 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5745 8780 gene locus_tag LOCUS_09690 5745 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 8773 9447 gene locus_tag LOCUS_09700 8773 9447 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090041.1 protein_id gnl|my_center|LOCUS_09700 9783 11771 gene locus_tag LOCUS_09710 9783 11771 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063994.1 protein_id gnl|my_center|LOCUS_09710 11993 12532 gene locus_tag LOCUS_09720 11993 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 13815 12514 gene locus_tag LOCUS_09730 13815 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 14540 14067 gene locus_tag LOCUS_09740 14540 14067 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466276.1 protein_id gnl|my_center|LOCUS_09740 <15521 14555 gene locus_tag LOCUS_09750 <15521 14555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275111.1:HDOD domain-containing protein >Feature sequence047 3394 4206 gene locus_tag LOCUS_09760 3394 4206 CDS product DUF3014 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275299.1 protein_id gnl|my_center|LOCUS_09760 4203 4823 gene locus_tag LOCUS_09770 4203 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4881 5138 gene locus_tag LOCUS_09780 4881 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 5366 6286 gene locus_tag LOCUS_09790 gene pqqB 5366 6286 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113495.1 protein_id gnl|my_center|LOCUS_09790 6283 6981 gene locus_tag LOCUS_09800 gene pqqC 6283 6981 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_09800 6978 7289 gene locus_tag LOCUS_09810 gene pqqD 6978 7289 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_09810 7286 8434 gene locus_tag LOCUS_09820 gene pqqE 7286 8434 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763799.1 protein_id gnl|my_center|LOCUS_09820 8450 8980 gene locus_tag LOCUS_09830 gene def 8450 8980 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_09830 9007 9423 gene locus_tag LOCUS_09840 9007 9423 CDS product DUF3224 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 protein_id gnl|my_center|LOCUS_09840 9877 9395 gene locus_tag LOCUS_09850 gene rimI 9877 9395 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700855.1 protein_id gnl|my_center|LOCUS_09850 10613 9891 gene locus_tag LOCUS_09860 10613 9891 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_09860 11833 10691 gene locus_tag LOCUS_09870 11833 10691 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_09870 11939 12955 gene locus_tag LOCUS_09880 11939 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09880 13086 14690 gene locus_tag LOCUS_09890 13086 14690 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence048 1 954 gene locus_tag LOCUS_09900 1 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1003 1410 gene locus_tag LOCUS_09910 1003 1410 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391031.1 protein_id gnl|my_center|LOCUS_09910 1452 3050 gene locus_tag LOCUS_09920 1452 3050 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_09920 3633 3037 gene locus_tag LOCUS_09930 3633 3037 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_09930 3908 4267 gene locus_tag LOCUS_09940 3908 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4280 4933 gene locus_tag LOCUS_09950 4280 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 5550 4954 gene locus_tag LOCUS_09960 5550 4954 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_09960 6631 5615 gene locus_tag LOCUS_09970 6631 5615 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403237.1 protein_id gnl|my_center|LOCUS_09970 7724 6624 gene locus_tag LOCUS_09980 7724 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7851 9236 gene locus_tag LOCUS_09990 7851 9236 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_09990 9354 9836 gene locus_tag LOCUS_10000 9354 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 9947 11722 gene locus_tag LOCUS_10010 9947 11722 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142721.1 protein_id gnl|my_center|LOCUS_10010 12416 11733 gene locus_tag LOCUS_10020 12416 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 12516 13073 gene locus_tag LOCUS_10030 12516 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 13143 13457 gene locus_tag LOCUS_10040 13143 13457 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729618.1 protein_id gnl|my_center|LOCUS_10040 13454 13948 gene locus_tag LOCUS_10050 13454 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 14013 14420 gene locus_tag LOCUS_10060 14013 14420 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence049 1569 277 gene locus_tag LOCUS_10070 1569 277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_10070 1736 3220 gene locus_tag LOCUS_10080 1736 3220 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525274.1 protein_id gnl|my_center|LOCUS_10080 3341 4492 gene locus_tag LOCUS_10090 3341 4492 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_10090 4892 4497 gene locus_tag LOCUS_10100 4892 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 5370 4894 gene locus_tag LOCUS_10110 5370 4894 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 protein_id gnl|my_center|LOCUS_10110 5414 6850 gene locus_tag LOCUS_10120 5414 6850 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_10120 7400 6822 gene locus_tag LOCUS_10130 7400 6822 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275402.1 protein_id gnl|my_center|LOCUS_10130 7537 7857 gene locus_tag LOCUS_10140 7537 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 7973 8542 gene locus_tag LOCUS_10150 7973 8542 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695952.1 protein_id gnl|my_center|LOCUS_10150 8532 8729 gene locus_tag LOCUS_10160 8532 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8739 10094 gene locus_tag LOCUS_10170 gene rimO 8739 10094 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037694.1 protein_id gnl|my_center|LOCUS_10170 10727 10128 gene locus_tag LOCUS_10180 10727 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 12448 10811 gene locus_tag LOCUS_10190 12448 10811 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526878.1 protein_id gnl|my_center|LOCUS_10190 14268 12466 gene locus_tag LOCUS_10200 gene glmS 14268 12466 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703916.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence050 2965 2327 gene locus_tag LOCUS_10210 2965 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3171 5315 gene locus_tag LOCUS_10220 3171 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5691 8243 gene locus_tag LOCUS_10230 5691 8243 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 protein_id gnl|my_center|LOCUS_10230 10166 8316 gene locus_tag LOCUS_10240 10166 8316 CDS product putative 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265854.1 protein_id gnl|my_center|LOCUS_10240 10853 10170 gene locus_tag LOCUS_10250 10853 10170 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_10250 11525 10881 gene locus_tag LOCUS_10260 11525 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 13327 11525 gene locus_tag LOCUS_10270 13327 11525 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_10270 14593 13352 gene locus_tag LOCUS_10280 14593 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence051 855 277 gene locus_tag LOCUS_10290 855 277 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_10290 1329 859 gene locus_tag LOCUS_10300 gene rlmH 1329 859 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037743.1 protein_id gnl|my_center|LOCUS_10300 1750 1343 gene locus_tag LOCUS_10310 gene rsfS 1750 1343 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 protein_id gnl|my_center|LOCUS_10310 2440 1787 gene locus_tag LOCUS_10320 gene nadD 2440 1787 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_10320 3428 2460 gene locus_tag LOCUS_10330 gene holA 3428 2460 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105191.1 protein_id gnl|my_center|LOCUS_10330 5723 3492 gene locus_tag LOCUS_10340 5723 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6119 5805 gene locus_tag LOCUS_10350 6119 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 8102 6246 gene locus_tag LOCUS_10360 8102 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 8687 8109 gene locus_tag LOCUS_10370 8687 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275420.1 protein_id gnl|my_center|LOCUS_10370 9186 8689 gene locus_tag LOCUS_10380 gene lptE 9186 8689 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261459.1 protein_id gnl|my_center|LOCUS_10380 11807 9186 gene locus_tag LOCUS_10390 gene leuS 11807 9186 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268980.1 protein_id gnl|my_center|LOCUS_10390 13449 11908 gene locus_tag LOCUS_10400 13449 11908 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_10400 <14993 13467 gene locus_tag LOCUS_10410 <14993 13467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268977.1:apolipoprotein N-acyltransferase >Feature sequence052 2001 1324 gene locus_tag LOCUS_10420 2001 1324 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_10420 3359 2067 gene locus_tag LOCUS_10430 3359 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4510 3545 gene locus_tag LOCUS_10440 gene thiL 4510 3545 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752139.1 protein_id gnl|my_center|LOCUS_10440 5006 4551 gene locus_tag LOCUS_10450 gene nusB 5006 4551 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_10450 5428 5003 gene locus_tag LOCUS_10460 gene ribE 5428 5003 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_10460 6645 5470 gene locus_tag LOCUS_10470 gene ribBA 6645 5470 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 protein_id gnl|my_center|LOCUS_10470 7251 6712 gene locus_tag LOCUS_10480 7251 6712 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_10480 8110 7262 gene locus_tag LOCUS_10490 8110 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8726 8343 gene locus_tag LOCUS_10500 8726 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 9375 8779 gene locus_tag LOCUS_10510 9375 8779 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_10510 10576 9386 gene locus_tag LOCUS_10520 gene ribD 10576 9386 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704561.1 protein_id gnl|my_center|LOCUS_10520 11160 10573 gene locus_tag LOCUS_10530 gene nrdR 11160 10573 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_10530 12533 11187 gene locus_tag LOCUS_10540 12533 11187 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207236.1 protein_id gnl|my_center|LOCUS_10540 13505 12567 gene locus_tag LOCUS_10550 13505 12567 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence053 552 295 gene locus_tag LOCUS_10560 552 295 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_10560 791 2206 gene locus_tag LOCUS_10570 gene amt 791 2206 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_10570 2391 2909 gene locus_tag LOCUS_10580 2391 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2994 3908 gene locus_tag LOCUS_10590 2994 3908 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_10590 3905 4999 gene locus_tag LOCUS_10600 gene algZ 3905 4999 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_10600 5007 5753 gene locus_tag LOCUS_10610 5007 5753 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_10610 5777 7012 gene locus_tag LOCUS_10620 5777 7012 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_10620 8733 7015 gene locus_tag LOCUS_10630 8733 7015 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_10630 9032 11455 gene locus_tag LOCUS_10640 9032 11455 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_10640 14041 11555 gene locus_tag LOCUS_10650 14041 11555 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence054 1155 229 gene locus_tag LOCUS_10660 1155 229 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036352.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10660 1280 1540 gene locus_tag LOCUS_10670 gene rpsT 1280 1540 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_10670 2679 1603 gene locus_tag LOCUS_10680 gene cgtA 2679 1603 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673554.1 protein_id gnl|my_center|LOCUS_10680 3290 3021 gene locus_tag LOCUS_10690 gene rpmA 3290 3021 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_10690 3629 3315 gene locus_tag LOCUS_10700 gene rplU 3629 3315 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 protein_id gnl|my_center|LOCUS_10700 3812 4780 gene locus_tag LOCUS_10710 gene ispB 3812 4780 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345929.1 protein_id gnl|my_center|LOCUS_10710 4806 6194 gene locus_tag LOCUS_10720 4806 6194 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_10720 6276 6352 gene locus_tag LOCUS_t00150 6276 6352 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7757 6393 gene locus_tag LOCUS_10730 7757 6393 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_10730 8120 7761 gene locus_tag LOCUS_10740 8120 7761 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_10740 11938 8315 gene locus_tag LOCUS_10750 11938 8315 CDS product cellulose biosynthesis protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203171.1 protein_id gnl|my_center|LOCUS_10750 13047 11911 gene locus_tag LOCUS_10760 13047 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10760 <14613 13051 gene locus_tag LOCUS_10770 <14613 13051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205645.1:cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB >Feature sequence055 1084 1980 gene locus_tag LOCUS_10780 1084 1980 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_10780 3151 1994 gene locus_tag LOCUS_10790 3151 1994 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 protein_id gnl|my_center|LOCUS_10790 4765 3194 gene locus_tag LOCUS_10800 4765 3194 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_10800 6800 4878 gene locus_tag LOCUS_10810 6800 4878 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_10810 7445 6900 gene locus_tag LOCUS_10820 7445 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 8073 7543 gene locus_tag LOCUS_10830 8073 7543 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106726554.1 protein_id gnl|my_center|LOCUS_10830 10259 8094 gene locus_tag LOCUS_10840 10259 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 10974 10411 gene locus_tag LOCUS_10850 10974 10411 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_10850 11872 10988 gene locus_tag LOCUS_10860 11872 10988 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813574.1 protein_id gnl|my_center|LOCUS_10860 11865 12596 gene locus_tag LOCUS_10870 11865 12596 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186399.1 protein_id gnl|my_center|LOCUS_10870 13212 12580 gene locus_tag LOCUS_10880 13212 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 13818 13225 gene locus_tag LOCUS_10890 13818 13225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 14354 13815 gene locus_tag LOCUS_10900 14354 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence056 <1 4439 gene locus_tag LOCUS_10910 <1 4439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895708.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase 4479 5237 gene locus_tag LOCUS_10920 4479 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_10920 5390 5707 gene locus_tag LOCUS_10930 5390 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 6802 5720 gene locus_tag LOCUS_10940 6802 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 7419 9311 gene locus_tag LOCUS_10950 7419 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 9440 9940 gene locus_tag LOCUS_10960 9440 9940 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545184.1 protein_id gnl|my_center|LOCUS_10960 9976 11355 gene locus_tag LOCUS_10970 gene ppnN 9976 11355 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_10970 11576 11833 gene locus_tag LOCUS_10980 11576 11833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 12718 11861 gene locus_tag LOCUS_10990 12718 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 12858 13037 gene locus_tag LOCUS_11000 12858 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence057 <1 2952 gene locus_tag LOCUS_11010 <1 2952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140878.1:efflux RND transporter permease subunit 2955 4271 gene locus_tag LOCUS_11020 2955 4271 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_11020 4283 5815 gene locus_tag LOCUS_11030 4283 5815 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268124.1 protein_id gnl|my_center|LOCUS_11030 6020 7543 gene locus_tag LOCUS_11040 6020 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 8911 7562 gene locus_tag LOCUS_11050 8911 7562 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089392.1 protein_id gnl|my_center|LOCUS_11050 9675 8908 gene locus_tag LOCUS_11060 9675 8908 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_11060 10231 9788 gene locus_tag LOCUS_11070 10231 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 10687 11520 gene locus_tag LOCUS_11080 10687 11520 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_11080 11517 13898 gene locus_tag LOCUS_11090 11517 13898 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence058 1888 431 gene locus_tag LOCUS_11100 1888 431 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494095.1 protein_id gnl|my_center|LOCUS_11100 2036 2515 gene locus_tag LOCUS_11110 2036 2515 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102736.1 protein_id gnl|my_center|LOCUS_11110 2519 4768 gene locus_tag LOCUS_11120 2519 4768 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532900.1 protein_id gnl|my_center|LOCUS_11120 5383 4778 gene locus_tag LOCUS_11130 5383 4778 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_11130 5481 7907 gene locus_tag LOCUS_11140 5481 7907 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_11140 7919 9160 gene locus_tag LOCUS_11150 7919 9160 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941036.1 protein_id gnl|my_center|LOCUS_11150 9181 9254 gene locus_tag LOCUS_t00160 9181 9254 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11621 9339 gene locus_tag LOCUS_11160 11621 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 12501 12049 gene locus_tag LOCUS_11170 12501 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 14067 12514 gene locus_tag LOCUS_11180 14067 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence059 2407 4347 gene locus_tag LOCUS_11190 2407 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4379 5161 gene locus_tag LOCUS_11200 4379 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5620 5165 gene locus_tag LOCUS_11210 5620 5165 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920003.1 protein_id gnl|my_center|LOCUS_11210 5669 6340 gene locus_tag LOCUS_11220 5669 6340 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 protein_id gnl|my_center|LOCUS_11220 7497 6337 gene locus_tag LOCUS_11230 7497 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 8440 7535 gene locus_tag LOCUS_11240 8440 7535 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011857652.1 protein_id gnl|my_center|LOCUS_11240 8535 10043 gene locus_tag LOCUS_11250 gene betC 8535 10043 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_11250 10051 11262 gene locus_tag LOCUS_11260 10051 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 11596 12009 gene locus_tag LOCUS_11270 11596 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence060 256 1803 gene locus_tag LOCUS_11280 256 1803 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_11280 3039 1831 gene locus_tag LOCUS_11290 3039 1831 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812659.1 protein_id gnl|my_center|LOCUS_11290 5263 3092 gene locus_tag LOCUS_11300 5263 3092 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269073.1 protein_id gnl|my_center|LOCUS_11300 5397 6617 gene locus_tag LOCUS_11310 5397 6617 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_11310 7179 6625 gene locus_tag LOCUS_11320 7179 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7283 8152 gene locus_tag LOCUS_11330 7283 8152 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 protein_id gnl|my_center|LOCUS_11330 8149 8769 gene locus_tag LOCUS_11340 gene mobB 8149 8769 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812685.1 protein_id gnl|my_center|LOCUS_11340 11539 8693 gene locus_tag LOCUS_11350 gene fdhF 11539 8693 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_11350 13278 11536 gene locus_tag LOCUS_11360 13278 11536 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_11360 13476 14201 gene locus_tag LOCUS_11370 13476 14201 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537174.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence061 <1 776 gene locus_tag LOCUS_11380 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036883.1:5'/3'-nucleotidase SurE 769 1431 gene locus_tag LOCUS_11390 769 1431 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406213.1 protein_id gnl|my_center|LOCUS_11390 2302 1910 gene locus_tag LOCUS_11400 2302 1910 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_11400 2301 3338 gene locus_tag LOCUS_11410 2301 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3352 6201 gene locus_tag LOCUS_11420 3352 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 6206 7741 gene locus_tag LOCUS_11430 gene lysS 6206 7741 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037023.1 protein_id gnl|my_center|LOCUS_11430 8170 7748 gene locus_tag LOCUS_11440 8170 7748 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_11440 9105 8167 gene locus_tag LOCUS_11450 9105 8167 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_11450 9175 9378 gene locus_tag LOCUS_11460 9175 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 9382 9777 gene locus_tag LOCUS_11470 gene sdhC 9382 9777 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528874.1 protein_id gnl|my_center|LOCUS_11470 9774 10160 gene locus_tag LOCUS_11480 gene sdhD 9774 10160 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_11480 10157 11941 gene locus_tag LOCUS_11490 gene sdhA 10157 11941 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388959.1 protein_id gnl|my_center|LOCUS_11490 11952 12731 gene locus_tag LOCUS_11500 11952 12731 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 protein_id gnl|my_center|LOCUS_11500 12737 13006 gene locus_tag LOCUS_11510 12737 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 13078 13683 gene locus_tag LOCUS_11520 gene rpoE 13078 13683 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence062 <1 1078 gene locus_tag LOCUS_11530 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012439496.1:ABC transporter permease 2608 1118 gene locus_tag LOCUS_11540 2608 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2779 3324 gene locus_tag LOCUS_11550 2779 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3370 6066 gene locus_tag LOCUS_11560 3370 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9388 6071 gene locus_tag LOCUS_11570 9388 6071 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_11570 9948 9400 gene locus_tag LOCUS_11580 9948 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 11055 10009 gene locus_tag LOCUS_11590 11055 10009 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_11590 12713 11052 gene locus_tag LOCUS_11600 12713 11052 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087216.1 protein_id gnl|my_center|LOCUS_11600 13738 12878 gene locus_tag LOCUS_11610 13738 12878 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966304.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence063 977 279 gene locus_tag LOCUS_11620 977 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1909 974 gene locus_tag LOCUS_11630 1909 974 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807132.1 protein_id gnl|my_center|LOCUS_11630 2678 1899 gene locus_tag LOCUS_11640 2678 1899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_11640 3844 2678 gene locus_tag LOCUS_11650 3844 2678 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003620.1 protein_id gnl|my_center|LOCUS_11650 4834 3914 gene locus_tag LOCUS_11660 4834 3914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_11660 4986 4831 gene locus_tag LOCUS_11670 4986 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5843 4983 gene locus_tag LOCUS_11680 5843 4983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_11680 6243 5827 gene locus_tag LOCUS_11690 6243 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 6493 6299 gene locus_tag LOCUS_11700 6493 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 6768 7748 gene locus_tag LOCUS_11710 6768 7748 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_11710 7760 10303 gene locus_tag LOCUS_11720 gene fadE 7760 10303 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368121.1 protein_id gnl|my_center|LOCUS_11720 10312 11331 gene locus_tag LOCUS_11730 10312 11331 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928862.1 protein_id gnl|my_center|LOCUS_11730 11349 11768 gene locus_tag LOCUS_11740 11349 11768 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_11740 11785 12936 gene locus_tag LOCUS_11750 gene dinB 11785 12936 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035828.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence064 1515 1222 gene locus_tag LOCUS_11760 1515 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1713 2420 gene locus_tag LOCUS_11770 1713 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2396 2827 gene locus_tag LOCUS_11780 2396 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3094 2897 gene locus_tag LOCUS_11790 3094 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3163 3732 gene locus_tag LOCUS_11800 3163 3732 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 protein_id gnl|my_center|LOCUS_11800 3837 4634 gene locus_tag LOCUS_11810 3837 4634 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_11810 6056 4635 gene locus_tag LOCUS_11820 6056 4635 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_11820 7631 6096 gene locus_tag LOCUS_11830 7631 6096 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530987.1 protein_id gnl|my_center|LOCUS_11830 8855 7692 gene locus_tag LOCUS_11840 8855 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 9119 8868 gene locus_tag LOCUS_11850 9119 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 9295 10548 gene locus_tag LOCUS_11860 9295 10548 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243814.1 protein_id gnl|my_center|LOCUS_11860 10552 11499 gene locus_tag LOCUS_11870 10552 11499 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974587.1 protein_id gnl|my_center|LOCUS_11870 11515 12489 gene locus_tag LOCUS_11880 11515 12489 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257908.1 protein_id gnl|my_center|LOCUS_11880 12616 13221 gene locus_tag LOCUS_11890 12616 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 13338 13505 gene locus_tag LOCUS_11900 13338 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence065 <1 512 gene locus_tag LOCUS_11910 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201419208.1:archaetidylserine decarboxylase 509 1480 gene locus_tag LOCUS_11920 gene epmA 509 1480 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095276.1 protein_id gnl|my_center|LOCUS_11920 1510 2418 gene locus_tag LOCUS_11930 gene rarD 1510 2418 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038990.1 protein_id gnl|my_center|LOCUS_11930 3013 2444 gene locus_tag LOCUS_11940 gene efp 3013 2444 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_11940 3215 5275 gene locus_tag LOCUS_11950 gene fimX 3215 5275 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_11950 7657 5381 gene locus_tag LOCUS_11960 gene parC 7657 5381 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_11960 9546 7654 gene locus_tag LOCUS_11970 gene parE 9546 7654 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431952.1 protein_id gnl|my_center|LOCUS_11970 10186 9605 gene locus_tag LOCUS_11980 10186 9605 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_11980 11559 10183 gene locus_tag LOCUS_11990 11559 10183 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_11990 12024 11611 gene locus_tag LOCUS_12000 12024 11611 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_12000 12189 12458 gene locus_tag LOCUS_12010 12189 12458 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626422.1 protein_id gnl|my_center|LOCUS_12010 12469 13380 gene locus_tag LOCUS_12020 12469 13380 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence066 480 1112 gene locus_tag LOCUS_12030 480 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2195 1263 gene locus_tag LOCUS_12040 2195 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3250 2192 gene locus_tag LOCUS_12050 gene nagZ 3250 2192 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_12050 4557 3247 gene locus_tag LOCUS_12060 gene rlmD 4557 3247 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_12060 5347 4571 gene locus_tag LOCUS_12070 5347 4571 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_12070 5727 5344 gene locus_tag LOCUS_12080 gene acpS 5727 5344 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_12080 6455 5724 gene locus_tag LOCUS_12090 gene pdxJ 6455 5724 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818969.1 protein_id gnl|my_center|LOCUS_12090 7183 6452 gene locus_tag LOCUS_12100 gene recO 7183 6452 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 protein_id gnl|my_center|LOCUS_12100 8082 7180 gene locus_tag LOCUS_12110 gene era 8082 7180 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 protein_id gnl|my_center|LOCUS_12110 8786 8079 gene locus_tag LOCUS_12120 gene rnc 8786 8079 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085565.1 protein_id gnl|my_center|LOCUS_12120 9190 8813 gene locus_tag LOCUS_12130 9190 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 10273 9203 gene locus_tag LOCUS_12140 gene lepB 10273 9203 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_12140 12077 10281 gene locus_tag LOCUS_12150 gene lepA 12077 10281 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958269.1 protein_id gnl|my_center|LOCUS_12150 12455 12177 gene locus_tag LOCUS_12160 12455 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 13506 12466 gene locus_tag LOCUS_12170 13506 12466 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524615.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence067 <1 997 gene locus_tag LOCUS_12180 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204730.1:efflux transporter outer membrane subunit note possible pseudo, internal stop codon 999 2384 gene locus_tag LOCUS_12190 999 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2820 2419 gene locus_tag LOCUS_12200 2820 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4465 2996 gene locus_tag LOCUS_12210 4465 2996 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932680.1 protein_id gnl|my_center|LOCUS_12210 6544 4598 gene locus_tag LOCUS_12220 6544 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 7443 6703 gene locus_tag LOCUS_12230 gene thiD 7443 6703 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_12230 8441 7440 gene locus_tag LOCUS_12240 8441 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 9016 8420 gene locus_tag LOCUS_12250 9016 8420 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969797.1 protein_id gnl|my_center|LOCUS_12250 9786 9013 gene locus_tag LOCUS_12260 9786 9013 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969798.1 protein_id gnl|my_center|LOCUS_12260 9984 9787 gene locus_tag LOCUS_12270 gene thiS 9984 9787 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972407.1 protein_id gnl|my_center|LOCUS_12270 10963 9953 gene locus_tag LOCUS_12280 gene thiO 10963 9953 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969800.1 protein_id gnl|my_center|LOCUS_12280 12770 10968 gene locus_tag LOCUS_12290 gene thiC 12770 10968 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976311.1 protein_id gnl|my_center|LOCUS_12290 13048 13473 gene locus_tag LOCUS_12300 13048 13473 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528627.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence068 <1 2593 gene locus_tag LOCUS_12310 <1 2593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001286823.1:isoleucine--tRNA ligase 2590 3105 gene locus_tag LOCUS_12320 gene lspA 2590 3105 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 protein_id gnl|my_center|LOCUS_12320 3105 4076 gene locus_tag LOCUS_12330 gene ispH 3105 4076 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_12330 4110 5357 gene locus_tag LOCUS_12340 4110 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 6338 5403 gene locus_tag LOCUS_12350 6338 5403 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_12350 9440 6345 gene locus_tag LOCUS_12360 9440 6345 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140808.1 protein_id gnl|my_center|LOCUS_12360 10718 9468 gene locus_tag LOCUS_12370 10718 9468 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928611.1 protein_id gnl|my_center|LOCUS_12370 11060 10985 gene locus_tag LOCUS_t00170 11060 10985 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11531 11100 gene locus_tag LOCUS_12380 11531 11100 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382949.1 protein_id gnl|my_center|LOCUS_12380 <13364 11583 gene locus_tag LOCUS_12390 <13364 11583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002310356.1:mutanobactin A non-ribosomal peptide synthetase MubE >Feature sequence069 21 170 gene locus_tag LOCUS_12400 21 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 182 3688 gene locus_tag LOCUS_12410 gene dnaE 182 3688 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_12410 3740 4711 gene locus_tag LOCUS_12420 gene accA 3740 4711 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391685.1 protein_id gnl|my_center|LOCUS_12420 4762 6126 gene locus_tag LOCUS_12430 gene tilS 4762 6126 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705125.1 protein_id gnl|my_center|LOCUS_12430 6199 7845 gene locus_tag LOCUS_12440 6199 7845 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_12440 7899 8732 gene locus_tag LOCUS_12450 gene kdsA 7899 8732 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958364.1 protein_id gnl|my_center|LOCUS_12450 8729 10021 gene locus_tag LOCUS_12460 gene eno 8729 10021 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_12460 10065 10382 gene locus_tag LOCUS_12470 gene ftsB 10065 10382 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 protein_id gnl|my_center|LOCUS_12470 10408 11121 gene locus_tag LOCUS_12480 gene ispD 10408 11121 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_12480 11118 11591 gene locus_tag LOCUS_12490 gene ispF 11118 11591 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036880.1 protein_id gnl|my_center|LOCUS_12490 11687 12658 gene locus_tag LOCUS_12500 gene truD 11687 12658 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113870.1 protein_id gnl|my_center|LOCUS_12500 13209 12655 gene locus_tag LOCUS_12510 13209 12655 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence070 2277 100 gene locus_tag LOCUS_12520 2277 100 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_12520 2406 2663 gene locus_tag LOCUS_12530 2406 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2653 3048 gene locus_tag LOCUS_12540 2653 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4872 2992 gene locus_tag LOCUS_12550 4872 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5110 5781 gene locus_tag LOCUS_12560 5110 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089409.1 protein_id gnl|my_center|LOCUS_12560 7002 5797 gene locus_tag LOCUS_12570 7002 5797 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_12570 7556 6999 gene locus_tag LOCUS_12580 7556 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 8268 7567 gene locus_tag LOCUS_12590 8268 7567 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090105.1 protein_id gnl|my_center|LOCUS_12590 8292 9506 gene locus_tag LOCUS_12600 8292 9506 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096575.1 protein_id gnl|my_center|LOCUS_12600 11292 9523 gene locus_tag LOCUS_12610 11292 9523 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_12610 12872 11289 gene locus_tag LOCUS_12620 12872 11289 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence071 1198 59 gene locus_tag LOCUS_12630 1198 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3317 1200 gene locus_tag LOCUS_12640 3317 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4299 3481 gene locus_tag LOCUS_12650 4299 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4391 5452 gene locus_tag LOCUS_12660 4391 5452 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_12660 5530 6396 gene locus_tag LOCUS_12670 5530 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 7056 6421 gene locus_tag LOCUS_12680 7056 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 8020 7070 gene locus_tag LOCUS_12690 8020 7070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 9409 8030 gene locus_tag LOCUS_12700 9409 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9912 9412 gene locus_tag LOCUS_12710 9912 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 11560 9914 gene locus_tag LOCUS_12720 11560 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 12624 11560 gene locus_tag LOCUS_12730 gene virB11 12624 11560 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034519683.1 protein_id gnl|my_center|LOCUS_12730 <13147 12641 gene locus_tag LOCUS_12740 <13147 12641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970872.1:type IV secretion system protein VirB10 >Feature sequence072 318 1832 gene locus_tag LOCUS_12750 318 1832 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527999.1 protein_id gnl|my_center|LOCUS_12750 1832 4285 gene locus_tag LOCUS_12760 1832 4285 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_12760 4282 6708 gene locus_tag LOCUS_12770 4282 6708 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112529352.1 protein_id gnl|my_center|LOCUS_12770 8489 6711 gene locus_tag LOCUS_12780 gene ggt 8489 6711 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086881.1 protein_id gnl|my_center|LOCUS_12780 8519 9355 gene locus_tag LOCUS_12790 8519 9355 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532488.1 protein_id gnl|my_center|LOCUS_12790 9399 10550 gene locus_tag LOCUS_12800 9399 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 10562 11812 gene locus_tag LOCUS_12810 10562 11812 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528148.1 protein_id gnl|my_center|LOCUS_12810 11823 12098 gene locus_tag LOCUS_12820 11823 12098 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133703761.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence073 122 1066 gene locus_tag LOCUS_12830 122 1066 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_12830 1063 1962 gene locus_tag LOCUS_12840 gene metF 1063 1962 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_12840 1959 5771 gene locus_tag LOCUS_12850 gene metH 1959 5771 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_12850 6112 6609 gene locus_tag LOCUS_12860 6112 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7063 6734 gene locus_tag LOCUS_12870 7063 6734 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243739.1 protein_id gnl|my_center|LOCUS_12870 7615 8481 gene locus_tag LOCUS_12880 7615 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10448 8688 gene locus_tag LOCUS_12890 gene aceK 10448 8688 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112397.1 protein_id gnl|my_center|LOCUS_12890 10639 10818 gene locus_tag LOCUS_12900 10639 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 11056 11754 gene locus_tag LOCUS_12910 11056 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 <13077 12104 gene locus_tag LOCUS_12920 <13077 12104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838626.1:amidohydrolase >Feature sequence074 3083 456 gene locus_tag LOCUS_12930 gene ndvB 3083 456 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_12930 3522 3103 gene locus_tag LOCUS_12940 gene gloA 3522 3103 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_12940 5564 3519 gene locus_tag LOCUS_12950 5564 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 7423 5564 gene locus_tag LOCUS_12960 gene ilvB 7423 5564 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149674780.1 protein_id gnl|my_center|LOCUS_12960 7537 8055 gene locus_tag LOCUS_12970 gene ilvN 7537 8055 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_12970 9134 8157 gene locus_tag LOCUS_12980 9134 8157 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 protein_id gnl|my_center|LOCUS_12980 9511 9173 gene locus_tag LOCUS_12990 gene glnK 9511 9173 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_12990 9718 10941 gene locus_tag LOCUS_13000 9718 10941 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_13000 11541 10945 gene locus_tag LOCUS_13010 11541 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 <13052 11647 gene locus_tag LOCUS_13020 <13052 11647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388876.1:pyruvate carboxylase >Feature sequence075 1686 1366 gene locus_tag LOCUS_13030 1686 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1594 2085 gene locus_tag LOCUS_13040 1594 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13040 2438 2905 gene locus_tag LOCUS_13050 gene ruvC 2438 2905 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072406.1 protein_id gnl|my_center|LOCUS_13050 2902 3492 gene locus_tag LOCUS_13060 gene ruvA 2902 3492 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_13060 3503 4543 gene locus_tag LOCUS_13070 gene ruvB 3503 4543 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_13070 4540 4968 gene locus_tag LOCUS_13080 4540 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4965 5684 gene locus_tag LOCUS_13090 gene tolQ 4965 5684 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_13090 5686 6129 gene locus_tag LOCUS_13100 gene tolR 5686 6129 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_13100 6146 6964 gene locus_tag LOCUS_13110 6146 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6964 8298 gene locus_tag LOCUS_13120 gene tolB 6964 8298 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_13120 8334 8921 gene locus_tag LOCUS_13130 gene pal 8334 8921 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814650.1 protein_id gnl|my_center|LOCUS_13130 8928 9779 gene locus_tag LOCUS_13140 gene ybgF 8928 9779 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_13140 9807 10454 gene locus_tag LOCUS_13150 gene queE 9807 10454 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_13150 10454 11143 gene locus_tag LOCUS_13160 gene queC 10454 11143 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_13160 11519 11148 gene locus_tag LOCUS_13170 11519 11148 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524104.1 protein_id gnl|my_center|LOCUS_13170 <12994 11686 gene locus_tag LOCUS_13180 <12994 11686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085934.1:oxalate/formate MFS antiporter >Feature sequence076 1468 104 gene locus_tag LOCUS_13190 1468 104 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941477.1 protein_id gnl|my_center|LOCUS_13190 3714 1465 gene locus_tag LOCUS_13200 3714 1465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807333.1 protein_id gnl|my_center|LOCUS_13200 4271 3696 gene locus_tag LOCUS_13210 4271 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 5684 4344 gene locus_tag LOCUS_13220 gene rsmB 5684 4344 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_13220 6633 5677 gene locus_tag LOCUS_13230 gene fmt 6633 5677 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 protein_id gnl|my_center|LOCUS_13230 7270 6644 gene locus_tag LOCUS_13240 gene def 7270 6644 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038831.1 protein_id gnl|my_center|LOCUS_13240 7380 8621 gene locus_tag LOCUS_13250 7380 8621 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_13250 8721 9812 gene locus_tag LOCUS_13260 gene dprA 8721 9812 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_13260 9815 10303 gene locus_tag LOCUS_13270 9815 10303 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704269.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence077 719 414 gene locus_tag LOCUS_13280 gene nuoK 719 414 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_13280 1327 716 gene locus_tag LOCUS_13290 1327 716 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_13290 1820 1338 gene locus_tag LOCUS_13300 gene nuoI 1820 1338 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508211.1 protein_id gnl|my_center|LOCUS_13300 2899 1832 gene locus_tag LOCUS_13310 gene nuoH 2899 1832 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_13310 5103 2917 gene locus_tag LOCUS_13320 gene nuoG 5103 2917 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186393.1 protein_id gnl|my_center|LOCUS_13320 6434 5106 gene locus_tag LOCUS_13330 gene nuoF 6434 5106 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_13330 6946 6431 gene locus_tag LOCUS_13340 gene nuoE 6946 6431 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_13340 8232 6964 gene locus_tag LOCUS_13350 8232 6964 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068422.1 protein_id gnl|my_center|LOCUS_13350 8927 8232 gene locus_tag LOCUS_13360 8927 8232 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037657.1 protein_id gnl|my_center|LOCUS_13360 9439 8945 gene locus_tag LOCUS_13370 9439 8945 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_13370 9798 9430 gene locus_tag LOCUS_13380 9798 9430 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_13380 10020 11402 gene locus_tag LOCUS_13390 10020 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence078 103 1026 gene locus_tag LOCUS_13400 103 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1957 1085 gene locus_tag LOCUS_13410 gene pbpG 1957 1085 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809563.1 protein_id gnl|my_center|LOCUS_13410 2657 2091 gene locus_tag LOCUS_13420 2657 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2860 3759 gene locus_tag LOCUS_13430 gene rpoH 2860 3759 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038853.1 protein_id gnl|my_center|LOCUS_13430 3848 4315 gene locus_tag LOCUS_13440 3848 4315 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_13440 5973 4309 gene locus_tag LOCUS_13450 5973 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 7286 5979 gene locus_tag LOCUS_13460 7286 5979 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942945.1 protein_id gnl|my_center|LOCUS_13460 7350 8552 gene locus_tag LOCUS_13470 7350 8552 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 protein_id gnl|my_center|LOCUS_13470 10305 8656 gene locus_tag LOCUS_13480 10305 8656 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763085.1 protein_id gnl|my_center|LOCUS_13480 10733 11422 gene locus_tag LOCUS_13490 gene pdsR 10733 11422 CDS product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence079 1578 982 gene locus_tag LOCUS_13500 1578 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1665 2504 gene locus_tag LOCUS_13510 1665 2504 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_13510 4122 2527 gene locus_tag LOCUS_13520 4122 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 4358 4283 gene locus_tag LOCUS_t00180 4358 4283 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4548 6413 gene locus_tag LOCUS_13530 4548 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 6413 7048 gene locus_tag LOCUS_13540 6413 7048 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_13540 7489 7061 gene locus_tag LOCUS_13550 7489 7061 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870211.1 protein_id gnl|my_center|LOCUS_13550 7766 7491 gene locus_tag LOCUS_13560 7766 7491 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947644.1 protein_id gnl|my_center|LOCUS_13560 8887 7769 gene locus_tag LOCUS_13570 gene mutY 8887 7769 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_13570 9850 8939 gene locus_tag LOCUS_13580 9850 8939 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036501.1 protein_id gnl|my_center|LOCUS_13580 10428 9853 gene locus_tag LOCUS_13590 10428 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 10993 10430 gene locus_tag LOCUS_13600 10993 10430 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_13600 11121 11351 gene locus_tag LOCUS_13610 11121 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 <12144 11290 gene locus_tag LOCUS_13620 <12144 11290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918394.1:oxygen-dependent coproporphyrinogen oxidase >Feature sequence080 1022 2254 gene locus_tag LOCUS_13630 1022 2254 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763607.1 protein_id gnl|my_center|LOCUS_13630 2268 3068 gene locus_tag LOCUS_13640 gene lgt 2268 3068 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937326.1 protein_id gnl|my_center|LOCUS_13640 3065 3859 gene locus_tag LOCUS_13650 gene thyA 3065 3859 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369929.1 protein_id gnl|my_center|LOCUS_13650 3856 4362 gene locus_tag LOCUS_13660 3856 4362 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944109.1 protein_id gnl|my_center|LOCUS_13660 4367 6226 gene locus_tag LOCUS_13670 4367 6226 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_13670 6227 6760 gene locus_tag LOCUS_13680 6227 6760 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531029.1 protein_id gnl|my_center|LOCUS_13680 7255 6863 gene locus_tag LOCUS_13690 7255 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7199 8395 gene locus_tag LOCUS_13700 7199 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 8436 10328 gene locus_tag LOCUS_13710 8436 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 11714 10347 gene locus_tag LOCUS_13720 11714 10347 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence081 1590 2180 gene locus_tag LOCUS_13730 1590 2180 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_13730 2177 2593 gene locus_tag LOCUS_13740 2177 2593 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112456.1 protein_id gnl|my_center|LOCUS_13740 2590 3504 gene locus_tag LOCUS_13750 2590 3504 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 protein_id gnl|my_center|LOCUS_13750 4848 3541 gene locus_tag LOCUS_13760 4848 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5438 4845 gene locus_tag LOCUS_13770 5438 4845 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532299.1 protein_id gnl|my_center|LOCUS_13770 7527 5449 gene locus_tag LOCUS_13780 7527 5449 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923339.1 protein_id gnl|my_center|LOCUS_13780 8878 7589 gene locus_tag LOCUS_13790 gene fucP 8878 7589 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_13790 10378 8891 gene locus_tag LOCUS_13800 gene treA 10378 8891 CDS product alpha,alpha-trehalase TreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553270.1 protein_id gnl|my_center|LOCUS_13800 10908 10438 gene locus_tag LOCUS_13810 10908 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 <11829 10905 gene locus_tag LOCUS_13820 <11829 10905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525144.1:methanol/ethanol family PQQ-dependent dehydrogenase >Feature sequence082 1628 255 gene locus_tag LOCUS_13830 gene gcvPA 1628 255 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_13830 2027 1629 gene locus_tag LOCUS_13840 gene gcvH 2027 1629 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703428.1 protein_id gnl|my_center|LOCUS_13840 3141 2050 gene locus_tag LOCUS_13850 gene gcvT 3141 2050 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_13850 3488 4723 gene locus_tag LOCUS_13860 gene ispG 3488 4723 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_13860 4720 5061 gene locus_tag LOCUS_13870 4720 5061 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_13870 5433 5092 gene locus_tag LOCUS_13880 5433 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5840 5445 gene locus_tag LOCUS_13890 5840 5445 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088450.1 protein_id gnl|my_center|LOCUS_13890 6364 5942 gene locus_tag LOCUS_13900 6364 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 6648 6364 gene locus_tag LOCUS_13910 6648 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 7061 6645 gene locus_tag LOCUS_13920 7061 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 7501 7076 gene locus_tag LOCUS_13930 7501 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 8769 7525 gene locus_tag LOCUS_13940 8769 7525 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819774.1 protein_id gnl|my_center|LOCUS_13940 9760 8762 gene locus_tag LOCUS_13950 9760 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 11082 9757 gene locus_tag LOCUS_13960 gene pepP 11082 9757 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_13960 11655 11098 gene locus_tag LOCUS_13970 11655 11098 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621372.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence083 383 1285 gene locus_tag LOCUS_13980 383 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3080 1308 gene locus_tag LOCUS_13990 3080 1308 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_13990 3242 5224 gene locus_tag LOCUS_14000 3242 5224 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_14000 5221 5919 gene locus_tag LOCUS_14010 gene tsaB 5221 5919 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 protein_id gnl|my_center|LOCUS_14010 6009 6704 gene locus_tag LOCUS_14020 gene phoB 6009 6704 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071727.1 protein_id gnl|my_center|LOCUS_14020 6741 8069 gene locus_tag LOCUS_14030 gene phoR 6741 8069 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_14030 8185 8997 gene locus_tag LOCUS_14040 8185 8997 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813679.1 protein_id gnl|my_center|LOCUS_14040 9107 9847 gene locus_tag LOCUS_14050 gene phoU 9107 9847 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378397.1 protein_id gnl|my_center|LOCUS_14050 10044 10544 gene locus_tag LOCUS_14060 10044 10544 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_14060 <11655 10516 gene locus_tag LOCUS_14070 <11655 10516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705377.1:succinyl-diaminopimelate desuccinylase >Feature sequence084 676 592 gene locus_tag LOCUS_t00190 676 592 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 724 2829 gene locus_tag LOCUS_14080 gene rnr 724 2829 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704173.1 protein_id gnl|my_center|LOCUS_14080 3038 2826 gene locus_tag LOCUS_14090 3038 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 2943 3587 gene locus_tag LOCUS_14100 2943 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3592 4794 gene locus_tag LOCUS_14110 3592 4794 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 protein_id gnl|my_center|LOCUS_14110 4796 5866 gene locus_tag LOCUS_14120 4796 5866 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_14120 6132 6551 gene locus_tag LOCUS_14130 gene rpsF 6132 6551 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216668.1 protein_id gnl|my_center|LOCUS_14130 6591 6851 gene locus_tag LOCUS_14140 gene rpsR 6591 6851 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_14140 6864 7313 gene locus_tag LOCUS_14150 gene rplI 6864 7313 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095627.1 protein_id gnl|my_center|LOCUS_14150 7329 9314 gene locus_tag LOCUS_14160 gene dnaB 7329 9314 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957860.1 protein_id gnl|my_center|LOCUS_14160 9311 10387 gene locus_tag LOCUS_14170 gene alr 9311 10387 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261110.1 protein_id gnl|my_center|LOCUS_14170 10450 11148 gene locus_tag LOCUS_14180 10450 11148 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence085 1205 60 gene locus_tag LOCUS_14190 1205 60 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_14190 2101 1220 gene locus_tag LOCUS_14200 2101 1220 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_14200 3789 2101 gene locus_tag LOCUS_14210 3789 2101 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_14210 4366 3791 gene locus_tag LOCUS_14220 gene lacC 4366 3791 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_14220 4440 5369 gene locus_tag LOCUS_14230 4440 5369 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392191.1 protein_id gnl|my_center|LOCUS_14230 5366 6883 gene locus_tag LOCUS_14240 5366 6883 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972980.1 protein_id gnl|my_center|LOCUS_14240 6868 7893 gene locus_tag LOCUS_14250 6868 7893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972979.1 protein_id gnl|my_center|LOCUS_14250 7916 8905 gene locus_tag LOCUS_14260 gene speB 7916 8905 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 protein_id gnl|my_center|LOCUS_14260 10249 8921 gene locus_tag LOCUS_14270 10249 8921 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063972.1 protein_id gnl|my_center|LOCUS_14270 11250 10246 gene locus_tag LOCUS_14280 gene iolG 11250 10246 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence086 257 664 gene locus_tag LOCUS_14290 257 664 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_14290 1966 677 gene locus_tag LOCUS_14300 1966 677 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_14300 2719 2084 gene locus_tag LOCUS_14310 2719 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2789 3451 gene locus_tag LOCUS_14320 2789 3451 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_14320 3483 4826 gene locus_tag LOCUS_14330 3483 4826 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_14330 4835 5599 gene locus_tag LOCUS_14340 4835 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 5666 6127 gene locus_tag LOCUS_14350 5666 6127 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038959.1 protein_id gnl|my_center|LOCUS_14350 6131 8269 gene locus_tag LOCUS_14360 6131 8269 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_14360 9991 8270 gene locus_tag LOCUS_14370 9991 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 10085 11161 gene locus_tag LOCUS_14380 10085 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence087 <1 686 gene locus_tag LOCUS_14390 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113542.1:amidohydrolase 700 1596 gene locus_tag LOCUS_14400 700 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1814 1659 gene locus_tag LOCUS_14410 1814 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1798 2163 gene locus_tag LOCUS_14420 1798 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089897.1 protein_id gnl|my_center|LOCUS_14420 2909 2229 gene locus_tag LOCUS_14430 gene lipB 2909 2229 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_14430 3934 2906 gene locus_tag LOCUS_14440 gene lipA 3934 2906 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946482.1 protein_id gnl|my_center|LOCUS_14440 4607 3939 gene locus_tag LOCUS_14450 gene murU 4607 3939 CDS product N-acetylmuramate alpha-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_14450 5662 4604 gene locus_tag LOCUS_14460 5662 4604 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_14460 5711 8098 gene locus_tag LOCUS_14470 gene lptD 5711 8098 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_14470 8116 9426 gene locus_tag LOCUS_14480 8116 9426 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_14480 9464 10453 gene locus_tag LOCUS_14490 gene pdxA 9464 10453 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093001.1 protein_id gnl|my_center|LOCUS_14490 10460 11269 gene locus_tag LOCUS_14500 gene rsmA 10460 11269 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence088 1617 661 gene locus_tag LOCUS_14510 1617 661 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_14510 2057 1614 gene locus_tag LOCUS_14520 gene ruvX 2057 1614 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017108.1 protein_id gnl|my_center|LOCUS_14520 2703 2050 gene locus_tag LOCUS_14530 2703 2050 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_14530 2584 2817 gene locus_tag LOCUS_14540 2584 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 3659 2757 gene locus_tag LOCUS_14550 3659 2757 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567783.1 protein_id gnl|my_center|LOCUS_14550 4639 3662 gene locus_tag LOCUS_14560 gene gshB 4639 3662 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_14560 4905 5297 gene locus_tag LOCUS_14570 gene pilG 4905 5297 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_14570 5303 5668 gene locus_tag LOCUS_14580 gene pilH 5303 5668 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 protein_id gnl|my_center|LOCUS_14580 5706 6284 gene locus_tag LOCUS_14590 5706 6284 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_14590 6281 7597 gene locus_tag LOCUS_14600 6281 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence089 255 34 gene locus_tag LOCUS_14610 255 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1203 334 gene locus_tag LOCUS_14620 1203 334 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_14620 1403 1200 gene locus_tag LOCUS_14630 1403 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2428 1478 gene locus_tag LOCUS_14640 2428 1478 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_14640 3101 2439 gene locus_tag LOCUS_14650 3101 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5238 3118 gene locus_tag LOCUS_14660 5238 3118 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257598.1 protein_id gnl|my_center|LOCUS_14660 5710 5231 gene locus_tag LOCUS_14670 5710 5231 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_14670 5992 6201 gene locus_tag LOCUS_14680 5992 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 6281 7051 gene locus_tag LOCUS_14690 6281 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7667 6945 gene locus_tag LOCUS_14700 7667 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 9214 7685 gene locus_tag LOCUS_14710 9214 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 10118 9303 gene locus_tag LOCUS_14720 10118 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence090 2147 1746 gene locus_tag LOCUS_14730 2147 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2590 2198 gene locus_tag LOCUS_14740 2590 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5427 2614 gene locus_tag LOCUS_14750 gene secA 5427 2614 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220108.1 protein_id gnl|my_center|LOCUS_14750 6489 5575 gene locus_tag LOCUS_14760 6489 5575 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_14760 6776 7066 gene locus_tag LOCUS_14770 6776 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 8023 7097 gene locus_tag LOCUS_14780 gene lpxC 8023 7097 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_14780 9357 8167 gene locus_tag LOCUS_14790 gene ftsZ 9357 8167 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035966.1 protein_id gnl|my_center|LOCUS_14790 10653 9418 gene locus_tag LOCUS_14800 gene ftsA 10653 9418 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence091 722 3079 gene locus_tag LOCUS_14810 gene ppsA 722 3079 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_14810 3465 3076 gene locus_tag LOCUS_14820 3465 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4028 3462 gene locus_tag LOCUS_14830 gene orn 4028 3462 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189767.1 protein_id gnl|my_center|LOCUS_14830 4080 4997 gene locus_tag LOCUS_14840 gene rsgA 4080 4997 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_14840 5623 5027 gene locus_tag LOCUS_14850 gene recR 5623 5027 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 protein_id gnl|my_center|LOCUS_14850 5951 5628 gene locus_tag LOCUS_14860 5951 5628 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_14860 7627 5996 gene locus_tag LOCUS_14870 7627 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 7853 7762 gene locus_tag LOCUS_t00200 7853 7762 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8208 7924 gene locus_tag LOCUS_14880 8208 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 9121 8231 gene locus_tag LOCUS_14890 gene dapA 9121 8231 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_14890 9329 9811 gene locus_tag LOCUS_14900 9329 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 9817 10284 gene locus_tag LOCUS_14910 9817 10284 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence092 5778 3208 gene locus_tag LOCUS_14920 5778 3208 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919915.1 protein_id gnl|my_center|LOCUS_14920 5948 7516 gene locus_tag LOCUS_14930 5948 7516 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405542.1 protein_id gnl|my_center|LOCUS_14930 7533 8165 gene locus_tag LOCUS_14940 7533 8165 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_14940 8177 9157 gene locus_tag LOCUS_14950 8177 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 9187 9528 gene locus_tag LOCUS_14960 9187 9528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 <10824 9858 gene locus_tag LOCUS_14970 <10824 9858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113366.1:siroheme synthase CysG >Feature sequence093 2105 327 gene locus_tag LOCUS_14980 2105 327 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207976.1 protein_id gnl|my_center|LOCUS_14980 2248 3459 gene locus_tag LOCUS_14990 2248 3459 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969494.1 protein_id gnl|my_center|LOCUS_14990 2557 2643 gene locus_tag LOCUS_t00210 2557 2643 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5706 3493 gene locus_tag LOCUS_15000 5706 3493 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764525.1 protein_id gnl|my_center|LOCUS_15000 5621 5941 gene locus_tag LOCUS_15010 5621 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5911 6651 gene locus_tag LOCUS_15020 5911 6651 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224270.1 protein_id gnl|my_center|LOCUS_15020 6708 7796 gene locus_tag LOCUS_15030 6708 7796 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086130.1 protein_id gnl|my_center|LOCUS_15030 9670 7793 gene locus_tag LOCUS_15040 9670 7793 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence094 <1 1765 gene locus_tag LOCUS_15050 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141384.1:tetratricopeptide repeat protein 3747 1762 gene locus_tag LOCUS_15060 3747 1762 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_15060 3840 5159 gene locus_tag LOCUS_15070 3840 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 5180 5773 gene locus_tag LOCUS_15080 5180 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 8781 5836 gene locus_tag LOCUS_15090 8781 5836 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_15090 9840 9193 gene locus_tag LOCUS_15100 9840 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 10517 9837 gene locus_tag LOCUS_15110 10517 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence095 2028 715 gene locus_tag LOCUS_15120 2028 715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883303.1 protein_id gnl|my_center|LOCUS_15120 2559 2218 gene locus_tag LOCUS_15130 2559 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2749 3342 gene locus_tag LOCUS_15140 2749 3342 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046120731.1 protein_id gnl|my_center|LOCUS_15140 3401 4930 gene locus_tag LOCUS_15150 3401 4930 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_15150 4940 5461 gene locus_tag LOCUS_15160 4940 5461 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_15160 5482 5946 gene locus_tag LOCUS_15170 5482 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5943 7103 gene locus_tag LOCUS_15180 5943 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 8267 7146 gene locus_tag LOCUS_15190 8267 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8601 8329 gene locus_tag LOCUS_15200 8601 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9163 8591 gene locus_tag LOCUS_15210 9163 8591 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919522.1 protein_id gnl|my_center|LOCUS_15210 9601 9188 gene locus_tag LOCUS_15220 9601 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 10409 9699 gene locus_tag LOCUS_15230 10409 9699 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence096 1 948 gene locus_tag LOCUS_15240 1 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 995 2008 gene locus_tag LOCUS_15250 995 2008 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530364.1 protein_id gnl|my_center|LOCUS_15250 2216 2456 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cagcaccgtcaacggctcgatc 3529 2888 gene locus_tag LOCUS_15260 3529 2888 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_15260 3684 4076 gene locus_tag LOCUS_15270 3684 4076 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087131.1 protein_id gnl|my_center|LOCUS_15270 5425 4181 gene locus_tag LOCUS_15280 5425 4181 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 protein_id gnl|my_center|LOCUS_15280 6192 5422 gene locus_tag LOCUS_15290 6192 5422 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967118.1 protein_id gnl|my_center|LOCUS_15290 6896 6189 gene locus_tag LOCUS_15300 6896 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8006 6984 gene locus_tag LOCUS_15310 8006 6984 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836264.1 protein_id gnl|my_center|LOCUS_15310 7887 9809 gene locus_tag LOCUS_15320 gene iolC 7887 9809 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330810.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence097 148 756 gene locus_tag LOCUS_15330 148 756 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528318.1 protein_id gnl|my_center|LOCUS_15330 753 1991 gene locus_tag LOCUS_15340 gene trpB 753 1991 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_15340 1988 2755 gene locus_tag LOCUS_15350 gene trpA 1988 2755 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_15350 2731 3564 gene locus_tag LOCUS_15360 2731 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088487.1 protein_id gnl|my_center|LOCUS_15360 4018 3623 gene locus_tag LOCUS_15370 4018 3623 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_15370 4245 4015 gene locus_tag LOCUS_15380 4245 4015 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 protein_id gnl|my_center|LOCUS_15380 5715 4339 gene locus_tag LOCUS_15390 5715 4339 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036400.1 protein_id gnl|my_center|LOCUS_15390 7360 5717 gene locus_tag LOCUS_15400 gene ubiB 7360 5717 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_15400 7962 7357 gene locus_tag LOCUS_15410 7962 7357 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 protein_id gnl|my_center|LOCUS_15410 8722 7973 gene locus_tag LOCUS_15420 gene ubiE 8722 7973 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948588.1 protein_id gnl|my_center|LOCUS_15420 9279 8932 gene locus_tag LOCUS_15430 9279 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence098 <1 1554 gene locus_tag LOCUS_15440 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106411.1:DNA mismatch repair endonuclease MutL 1555 2511 gene locus_tag LOCUS_15450 gene miaA 1555 2511 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814337.1 protein_id gnl|my_center|LOCUS_15450 2664 2918 gene locus_tag LOCUS_15460 gene hfq 2664 2918 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 protein_id gnl|my_center|LOCUS_15460 2946 4298 gene locus_tag LOCUS_15470 gene hflX 2946 4298 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036894.1 protein_id gnl|my_center|LOCUS_15470 4235 5416 gene locus_tag LOCUS_15480 gene hflK 4235 5416 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262723.1 protein_id gnl|my_center|LOCUS_15480 5416 6294 gene locus_tag LOCUS_15490 gene hflC 5416 6294 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763025.1 protein_id gnl|my_center|LOCUS_15490 6305 6493 gene locus_tag LOCUS_15500 6305 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6500 7795 gene locus_tag LOCUS_15510 6500 7795 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_15510 7788 9488 gene locus_tag LOCUS_15520 7788 9488 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_15520 9527 9787 gene locus_tag LOCUS_15530 9527 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 9811 10596 gene locus_tag LOCUS_15540 9811 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence099 1164 625 gene locus_tag LOCUS_15550 1164 625 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704283.1 protein_id gnl|my_center|LOCUS_15550 2784 1375 gene locus_tag LOCUS_15560 gene glnA 2784 1375 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456818.1 protein_id gnl|my_center|LOCUS_15560 3093 4034 gene locus_tag LOCUS_15570 gene glyQ 3093 4034 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_15570 4031 6274 gene locus_tag LOCUS_15580 gene glyS 4031 6274 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_15580 6280 7035 gene locus_tag LOCUS_15590 6280 7035 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_15590 7555 7064 gene locus_tag LOCUS_15600 7555 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8133 7552 gene locus_tag LOCUS_15610 8133 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 10562 8265 gene locus_tag LOCUS_15620 gene gyrB 10562 8265 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072067.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence100 47 2068 gene locus_tag LOCUS_15630 47 2068 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_15630 2258 4741 gene locus_tag LOCUS_15640 2258 4741 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_15640 5529 4852 gene locus_tag LOCUS_15650 5529 4852 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_15650 5622 5873 gene locus_tag LOCUS_15660 5622 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 7095 5878 gene locus_tag LOCUS_15670 7095 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 8485 7070 gene locus_tag LOCUS_15680 8485 7070 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_15680 9942 8551 gene locus_tag LOCUS_15690 9942 8551 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537978.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence101 3049 1988 gene locus_tag LOCUS_15700 3049 1988 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_15700 4171 3062 gene locus_tag LOCUS_15710 4171 3062 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_15710 6797 4338 gene locus_tag LOCUS_15720 6797 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 6905 8002 gene locus_tag LOCUS_15730 gene apbC 6905 8002 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_15730 8002 9195 gene locus_tag LOCUS_15740 8002 9195 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 protein_id gnl|my_center|LOCUS_15740 9934 9215 gene locus_tag LOCUS_15750 9934 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence102 411 830 gene locus_tag LOCUS_15760 411 830 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_15760 841 2103 gene locus_tag LOCUS_15770 841 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 2106 2588 gene locus_tag LOCUS_15780 2106 2588 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_15780 3526 2585 gene locus_tag LOCUS_15790 3526 2585 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_15790 4275 3523 gene locus_tag LOCUS_15800 4275 3523 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 protein_id gnl|my_center|LOCUS_15800 4342 5295 gene locus_tag LOCUS_15810 gene oppB 4342 5295 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_15810 5288 6151 gene locus_tag LOCUS_15820 5288 6151 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_15820 6126 7961 gene locus_tag LOCUS_15830 6126 7961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336772.1 protein_id gnl|my_center|LOCUS_15830 8037 9323 gene locus_tag LOCUS_15840 8037 9323 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence103 244 1458 gene locus_tag LOCUS_15850 244 1458 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_15850 1479 2360 gene locus_tag LOCUS_15860 1479 2360 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_15860 2357 3076 gene locus_tag LOCUS_15870 2357 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3076 3849 gene locus_tag LOCUS_15880 3076 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 4601 3780 gene locus_tag LOCUS_15890 4601 3780 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_15890 5428 4598 gene locus_tag LOCUS_15900 5428 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6708 5425 gene locus_tag LOCUS_15910 6708 5425 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_15910 7436 6708 gene locus_tag LOCUS_15920 gene ubiG 7436 6708 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence104 12 1121 gene locus_tag LOCUS_15930 12 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1121 1255 gene locus_tag LOCUS_15940 1121 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1252 1794 gene locus_tag LOCUS_15950 1252 1794 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_15950 1813 2706 gene locus_tag LOCUS_15960 1813 2706 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_15960 2961 2725 gene locus_tag LOCUS_15970 2961 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2960 3691 gene locus_tag LOCUS_15980 2960 3691 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_15980 3723 4301 gene locus_tag LOCUS_15990 3723 4301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931624.1 protein_id gnl|my_center|LOCUS_15990 4323 5357 gene locus_tag LOCUS_16000 4323 5357 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16000 5413 6270 gene locus_tag LOCUS_16010 gene cyoE 5413 6270 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 protein_id gnl|my_center|LOCUS_16010 6801 6364 gene locus_tag LOCUS_16020 6801 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6880 7671 gene locus_tag LOCUS_16030 6880 7671 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010657.1 protein_id gnl|my_center|LOCUS_16030 7773 8828 gene locus_tag LOCUS_16040 7773 8828 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365665.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence105 2003 765 gene locus_tag LOCUS_16050 2003 765 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 protein_id gnl|my_center|LOCUS_16050 3665 2022 gene locus_tag LOCUS_16060 gene pilB 3665 2022 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_16060 4535 3966 gene locus_tag LOCUS_16070 4535 3966 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 protein_id gnl|my_center|LOCUS_16070 6175 4769 gene locus_tag LOCUS_16080 6175 4769 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594919.1 protein_id gnl|my_center|LOCUS_16080 7776 6172 gene locus_tag LOCUS_16090 gene pilS 7776 6172 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_16090 7959 9128 gene locus_tag LOCUS_16100 gene sucC 7959 9128 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence106 <1 559 gene locus_tag LOCUS_16110 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412778.1:acetyl-/propionyl-CoA carboxylase subunit beta 565 2562 gene locus_tag LOCUS_16120 565 2562 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_16120 2604 3155 gene locus_tag LOCUS_16130 2604 3155 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 protein_id gnl|my_center|LOCUS_16130 3904 3185 gene locus_tag LOCUS_16140 3904 3185 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815939.1 protein_id gnl|my_center|LOCUS_16140 4479 3880 gene locus_tag LOCUS_16150 4479 3880 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946602.1 protein_id gnl|my_center|LOCUS_16150 4525 5529 gene locus_tag LOCUS_16160 4525 5529 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267417.1 protein_id gnl|my_center|LOCUS_16160 5855 5526 gene locus_tag LOCUS_16170 5855 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 6250 5852 gene locus_tag LOCUS_16180 6250 5852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 6534 6247 gene locus_tag LOCUS_16190 6534 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 6662 7792 gene locus_tag LOCUS_16200 6662 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 7792 8154 gene locus_tag LOCUS_16210 7792 8154 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379501.1 protein_id gnl|my_center|LOCUS_16210 8181 8987 gene locus_tag LOCUS_16220 8181 8987 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_16220 9131 9346 gene locus_tag LOCUS_16230 9131 9346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence107 1550 378 gene locus_tag LOCUS_16240 gene metK 1550 378 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071209.1 protein_id gnl|my_center|LOCUS_16240 2554 1592 gene locus_tag LOCUS_16250 2554 1592 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_16250 3377 2559 gene locus_tag LOCUS_16260 gene fdhD 3377 2559 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_16260 3497 4303 gene locus_tag LOCUS_16270 3497 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 4381 4998 gene locus_tag LOCUS_16280 4381 4998 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036842.1 protein_id gnl|my_center|LOCUS_16280 4995 5663 gene locus_tag LOCUS_16290 4995 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 5663 7027 gene locus_tag LOCUS_16300 5663 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7052 8026 gene locus_tag LOCUS_16310 7052 8026 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_16310 9218 8007 gene locus_tag LOCUS_16320 gene pcaF 9218 8007 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705263.1 protein_id gnl|my_center|LOCUS_16320 9324 9911 gene locus_tag LOCUS_16330 9324 9911 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence108 653 2455 gene locus_tag LOCUS_16340 653 2455 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_16340 2467 6195 gene locus_tag LOCUS_16350 2467 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 6677 6204 gene locus_tag LOCUS_16360 6677 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 6813 7265 gene locus_tag LOCUS_16370 6813 7265 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908325.1 protein_id gnl|my_center|LOCUS_16370 7271 8518 gene locus_tag LOCUS_16380 gene argG 7271 8518 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404940.1 protein_id gnl|my_center|LOCUS_16380 8520 9593 gene locus_tag LOCUS_16390 8520 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence109 615 1265 gene locus_tag LOCUS_16400 615 1265 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_16400 1307 1891 gene locus_tag LOCUS_16410 1307 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1888 2412 gene locus_tag LOCUS_16420 1888 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2419 3339 gene locus_tag LOCUS_16430 2419 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3372 3731 gene locus_tag LOCUS_16440 3372 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3788 5092 gene locus_tag LOCUS_16450 3788 5092 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_16450 5785 5117 gene locus_tag LOCUS_16460 5785 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 6446 5799 gene locus_tag LOCUS_16470 6446 5799 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971475.1 protein_id gnl|my_center|LOCUS_16470 6968 6459 gene locus_tag LOCUS_16480 6968 6459 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089251.1 protein_id gnl|my_center|LOCUS_16480 <9617 6970 gene locus_tag LOCUS_16490 <9617 6970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035990.1:phosphoenolpyruvate carboxylase >Feature sequence110 2395 1133 gene locus_tag LOCUS_16500 2395 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3223 2426 gene locus_tag LOCUS_16510 gene ppk2 3223 2426 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921245.1 protein_id gnl|my_center|LOCUS_16510 3355 4062 gene locus_tag LOCUS_16520 3355 4062 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990768.1 protein_id gnl|my_center|LOCUS_16520 4071 5726 gene locus_tag LOCUS_16530 4071 5726 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_16530 5723 7039 gene locus_tag LOCUS_16540 5723 7039 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389421.1 protein_id gnl|my_center|LOCUS_16540 7036 8799 gene locus_tag LOCUS_16550 7036 8799 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_16550 <9600 8905 gene locus_tag LOCUS_16560 <9600 8905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967232.1:threonine synthase >Feature sequence111 <1 856 gene locus_tag LOCUS_16570 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000996996.1:flagellin 946 2415 gene locus_tag LOCUS_16580 gene fliD 946 2415 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 protein_id gnl|my_center|LOCUS_16580 2483 2887 gene locus_tag LOCUS_16590 gene fliS 2483 2887 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160351.1 protein_id gnl|my_center|LOCUS_16590 4330 2918 gene locus_tag LOCUS_16600 4330 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 4723 5634 gene locus_tag LOCUS_16610 gene motA 4723 5634 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_16610 5642 6637 gene locus_tag LOCUS_16620 5642 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 6654 7703 gene locus_tag LOCUS_16630 6654 7703 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_16630 8787 7693 gene locus_tag LOCUS_16640 gene ychF 8787 7693 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_16640 9393 8791 gene locus_tag LOCUS_16650 gene pth 9393 8791 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence112 279 1637 gene locus_tag LOCUS_16660 279 1637 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812025.1 protein_id gnl|my_center|LOCUS_16660 1794 1612 gene locus_tag LOCUS_16670 1794 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1935 3983 gene locus_tag LOCUS_16680 gene fusA 1935 3983 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_16680 3984 4838 gene locus_tag LOCUS_16690 3984 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5718 4858 gene locus_tag LOCUS_16700 5718 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6843 5728 gene locus_tag LOCUS_16710 gene rfbB 6843 5728 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_16710 7706 6840 gene locus_tag LOCUS_16720 gene rfbD 7706 6840 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_16720 8257 7709 gene locus_tag LOCUS_16730 gene rfbC 8257 7709 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_16730 9138 8257 gene locus_tag LOCUS_16740 gene rfbA 9138 8257 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097851.1 protein_id gnl|my_center|LOCUS_16740 9174 9437 gene locus_tag LOCUS_16750 9174 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence113 1282 545 gene locus_tag LOCUS_16760 1282 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1823 1263 gene locus_tag LOCUS_16770 1823 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2317 1820 gene locus_tag LOCUS_16780 gene kdsC 2317 1820 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_16780 3343 2330 gene locus_tag LOCUS_16790 3343 2330 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_16790 3393 3629 gene locus_tag LOCUS_16800 3393 3629 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_16800 3756 5015 gene locus_tag LOCUS_16810 gene murA 3756 5015 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739059.1 protein_id gnl|my_center|LOCUS_16810 5026 6042 gene locus_tag LOCUS_16820 gene gnd 5026 6042 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_16820 6054 7469 gene locus_tag LOCUS_16830 gene zwf 6054 7469 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_16830 7466 9292 gene locus_tag LOCUS_16840 7466 9292 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence114 <1 1705 gene locus_tag LOCUS_16850 <1 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:EAL domain-containing protein 1750 2718 gene locus_tag LOCUS_16860 1750 2718 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242008.1 protein_id gnl|my_center|LOCUS_16860 2715 3371 gene locus_tag LOCUS_16870 gene plsY 2715 3371 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390940.1 protein_id gnl|my_center|LOCUS_16870 3371 4366 gene locus_tag LOCUS_16880 gene birA 3371 4366 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_16880 4368 5141 gene locus_tag LOCUS_16890 4368 5141 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039010.1 protein_id gnl|my_center|LOCUS_16890 5158 5982 gene locus_tag LOCUS_16900 5158 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 6526 5984 gene locus_tag LOCUS_16910 6526 5984 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_16910 6641 6567 gene locus_tag LOCUS_t00220 6641 6567 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6697 8220 gene locus_tag LOCUS_16920 6697 8220 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_16920 8230 8874 gene locus_tag LOCUS_16930 8230 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence115 <1 803 gene locus_tag LOCUS_16940 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530888.1:FAD-dependent oxidoreductase 1264 800 gene locus_tag LOCUS_16950 1264 800 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531248.1 protein_id gnl|my_center|LOCUS_16950 1489 1863 gene locus_tag LOCUS_16960 1489 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1959 3227 gene locus_tag LOCUS_16970 1959 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088844313.1 protein_id gnl|my_center|LOCUS_16970 3678 3319 gene locus_tag LOCUS_16980 3678 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 3925 5172 gene locus_tag LOCUS_16990 3925 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 5172 5963 gene locus_tag LOCUS_17000 5172 5963 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_17000 6020 7273 gene locus_tag LOCUS_17010 6020 7273 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_17010 7270 7881 gene locus_tag LOCUS_17020 7270 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 8654 7878 gene locus_tag LOCUS_17030 8654 7878 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_17030 9039 8785 gene locus_tag LOCUS_17040 9039 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence116 626 294 gene locus_tag LOCUS_17050 626 294 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528592.1 protein_id gnl|my_center|LOCUS_17050 1670 732 gene locus_tag LOCUS_17060 1670 732 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_17060 1785 2345 gene locus_tag LOCUS_17070 1785 2345 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035729.1 protein_id gnl|my_center|LOCUS_17070 2357 3109 gene locus_tag LOCUS_17080 2357 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3135 3524 gene locus_tag LOCUS_17090 3135 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 3638 3997 gene locus_tag LOCUS_17100 gene erpA 3638 3997 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_17100 4127 5575 gene locus_tag LOCUS_17110 gene ppx 4127 5575 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_17110 7744 5666 gene locus_tag LOCUS_17120 gene ppk1 7744 5666 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 protein_id gnl|my_center|LOCUS_17120 7938 7795 gene locus_tag LOCUS_17130 7938 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 9216 8068 gene locus_tag LOCUS_17140 9216 8068 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence117 <1 859 gene locus_tag LOCUS_17150 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940806.1:methionyl-tRNA formyltransferase 901 1383 gene locus_tag LOCUS_17160 901 1383 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_17160 2207 1377 gene locus_tag LOCUS_17170 2207 1377 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087019.1 protein_id gnl|my_center|LOCUS_17170 2263 2922 gene locus_tag LOCUS_17180 2263 2922 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 protein_id gnl|my_center|LOCUS_17180 4169 2958 gene locus_tag LOCUS_17190 4169 2958 CDS product YXWGXW repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063851.1 protein_id gnl|my_center|LOCUS_17190 4942 4325 gene locus_tag LOCUS_17200 4942 4325 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_17200 4997 6556 gene locus_tag LOCUS_17210 4997 6556 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200059.1 protein_id gnl|my_center|LOCUS_17210 6584 7216 gene locus_tag LOCUS_17220 6584 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 7340 7495 gene locus_tag LOCUS_17230 7340 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 8871 7531 gene locus_tag LOCUS_17240 gene aceA 8871 7531 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237144.1 protein_id gnl|my_center|LOCUS_17240 <9477 8898 gene locus_tag LOCUS_17250 <9477 8898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000107325.1:malate synthase A >Feature sequence118 916 599 gene locus_tag LOCUS_17260 916 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1018 2208 gene locus_tag LOCUS_17270 gene proB 1018 2208 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330090.1 protein_id gnl|my_center|LOCUS_17270 2213 3484 gene locus_tag LOCUS_17280 2213 3484 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083261.1 protein_id gnl|my_center|LOCUS_17280 3964 3494 gene locus_tag LOCUS_17290 3964 3494 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_17290 4826 3984 gene locus_tag LOCUS_17300 4826 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5323 4823 gene locus_tag LOCUS_17310 gene moaC 5323 4823 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_17310 6309 5323 gene locus_tag LOCUS_17320 gene moaA 6309 5323 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275431.1 protein_id gnl|my_center|LOCUS_17320 7655 6453 gene locus_tag LOCUS_17330 7655 6453 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_17330 8031 7657 gene locus_tag LOCUS_17340 8031 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 8686 8096 gene locus_tag LOCUS_17350 8686 8096 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_17350 <9402 8689 gene locus_tag LOCUS_17360 <9402 8689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223635.1:HAMP domain-containing sensor histidine kinase >Feature sequence119 1200 727 gene locus_tag LOCUS_17370 gene paaJ 1200 727 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451216.1 protein_id gnl|my_center|LOCUS_17370 1991 1197 gene locus_tag LOCUS_17380 gene paaC 1991 1197 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 protein_id gnl|my_center|LOCUS_17380 2296 1988 gene locus_tag LOCUS_17390 gene paaB 2296 1988 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813296.1 protein_id gnl|my_center|LOCUS_17390 3290 2289 gene locus_tag LOCUS_17400 gene paaA 3290 2289 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172418.1 protein_id gnl|my_center|LOCUS_17400 5406 3391 gene locus_tag LOCUS_17410 5406 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 7148 5568 gene locus_tag LOCUS_17420 7148 5568 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_17420 8456 7152 gene locus_tag LOCUS_17430 gene paaF 8456 7152 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 protein_id gnl|my_center|LOCUS_17430 <9394 8471 gene locus_tag LOCUS_17440 <9394 8471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974946.1:2-oxo acid dehydrogenase subunit E2 >Feature sequence120 775 299 gene locus_tag LOCUS_17450 775 299 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_17450 869 1192 gene locus_tag LOCUS_17460 869 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1960 1238 gene locus_tag LOCUS_17470 1960 1238 CDS product DUF6515 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114323.1 protein_id gnl|my_center|LOCUS_17470 2604 1957 gene locus_tag LOCUS_17480 2604 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3504 2740 gene locus_tag LOCUS_17490 gene kdsB 3504 2740 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770642.1 protein_id gnl|my_center|LOCUS_17490 3702 3514 gene locus_tag LOCUS_17500 3702 3514 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064092.1 protein_id gnl|my_center|LOCUS_17500 4729 3710 gene locus_tag LOCUS_17510 gene lpxK 4729 3710 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037270.1 protein_id gnl|my_center|LOCUS_17510 6558 4744 gene locus_tag LOCUS_17520 gene msbA 6558 4744 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186431.1 protein_id gnl|my_center|LOCUS_17520 6989 6555 gene locus_tag LOCUS_17530 6989 6555 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_17530 7596 7000 gene locus_tag LOCUS_17540 7596 7000 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_17540 7714 8244 gene locus_tag LOCUS_17550 7714 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 8936 8253 gene locus_tag LOCUS_17560 gene lolD 8936 8253 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence121 <1 2084 gene locus_tag LOCUS_17570 <1 2084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928446.1:S9 family peptidase 2180 2105 gene locus_tag LOCUS_t00230 2180 2105 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2280 2786 gene locus_tag LOCUS_17580 2280 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 3330 2776 gene locus_tag LOCUS_17590 3330 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 3399 4436 gene locus_tag LOCUS_17600 3399 4436 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942315.1 protein_id gnl|my_center|LOCUS_17600 4565 5200 gene locus_tag LOCUS_17610 4565 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5203 5739 gene locus_tag LOCUS_17620 5203 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 6005 7057 gene locus_tag LOCUS_17630 6005 7057 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533329.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence122 <1 871 gene locus_tag LOCUS_17640 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003021315.1:cyanophycin synthetase 967 2679 gene locus_tag LOCUS_17650 967 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3335 2676 gene locus_tag LOCUS_17660 3335 2676 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919535.1 protein_id gnl|my_center|LOCUS_17660 3431 4291 gene locus_tag LOCUS_17670 3431 4291 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_17670 4288 4752 gene locus_tag LOCUS_17680 gene greA 4288 4752 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920063.1 protein_id gnl|my_center|LOCUS_17680 6813 4771 gene locus_tag LOCUS_17690 6813 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 7509 6889 gene locus_tag LOCUS_17700 7509 6889 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532428.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence123 387 971 gene locus_tag LOCUS_17710 387 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 2393 972 gene locus_tag LOCUS_17720 gene hemN 2393 972 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037247.1 protein_id gnl|my_center|LOCUS_17720 2905 2465 gene locus_tag LOCUS_17730 2905 2465 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_17730 3000 4733 gene locus_tag LOCUS_17740 3000 4733 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936411.1 protein_id gnl|my_center|LOCUS_17740 4744 6027 gene locus_tag LOCUS_17750 4744 6027 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534105.1 protein_id gnl|my_center|LOCUS_17750 6032 6961 gene locus_tag LOCUS_17760 gene ligD 6032 6961 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090754.1 protein_id gnl|my_center|LOCUS_17760 7957 6968 gene locus_tag LOCUS_17770 7957 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 8032 8598 gene locus_tag LOCUS_17780 8032 8598 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626398.1 protein_id gnl|my_center|LOCUS_17780 <9266 8602 gene locus_tag LOCUS_17790 <9266 8602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986802.1:L,D-transpeptidase family protein >Feature sequence124 2470 1772 gene locus_tag LOCUS_17800 2470 1772 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528918.1 protein_id gnl|my_center|LOCUS_17800 2575 3249 gene locus_tag LOCUS_17810 2575 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 protein_id gnl|my_center|LOCUS_17810 3897 3304 gene locus_tag LOCUS_17820 3897 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5316 4003 gene locus_tag LOCUS_17830 5316 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 5398 5898 gene locus_tag LOCUS_17840 5398 5898 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_17840 5895 6635 gene locus_tag LOCUS_17850 5895 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 7542 6640 gene locus_tag LOCUS_17860 7542 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 <9237 7562 gene locus_tag LOCUS_17870 <9237 7562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529948.1:formate--tetrahydrofolate ligase >Feature sequence125 185 646 gene locus_tag LOCUS_17880 185 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2147 672 gene locus_tag LOCUS_17890 gene glgA 2147 672 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393434.1 protein_id gnl|my_center|LOCUS_17890 2367 3281 gene locus_tag LOCUS_17900 2367 3281 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705863.1 protein_id gnl|my_center|LOCUS_17900 3430 4947 gene locus_tag LOCUS_17910 3430 4947 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_17910 4971 5834 gene locus_tag LOCUS_17920 gene ttcA 4971 5834 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 protein_id gnl|my_center|LOCUS_17920 5818 7290 gene locus_tag LOCUS_17930 5818 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 7357 8436 gene locus_tag LOCUS_17940 7357 8436 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124130.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence126 814 1482 gene locus_tag LOCUS_17950 814 1482 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_17950 1501 2163 gene locus_tag LOCUS_17960 1501 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2061 2495 gene locus_tag LOCUS_17970 2061 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17970 4870 2504 gene locus_tag LOCUS_17980 4870 2504 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_17980 5089 4880 gene locus_tag LOCUS_17990 5089 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 5257 6324 gene locus_tag LOCUS_18000 5257 6324 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_18000 8207 6321 gene locus_tag LOCUS_18010 8207 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 <9071 8298 gene locus_tag LOCUS_18020 <9071 8298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193964.1:SAM-dependent methyltransferase >Feature sequence127 30 947 gene locus_tag LOCUS_18030 30 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 1691 978 gene locus_tag LOCUS_18040 1691 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1798 4107 gene locus_tag LOCUS_18050 1798 4107 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_18050 4122 5150 gene locus_tag LOCUS_18060 4122 5150 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970412.1 protein_id gnl|my_center|LOCUS_18060 5174 7210 gene locus_tag LOCUS_18070 5174 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 7210 8220 gene locus_tag LOCUS_18080 7210 8220 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence128 879 184 gene locus_tag LOCUS_18090 879 184 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_18090 946 2229 gene locus_tag LOCUS_18100 946 2229 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103263.1 protein_id gnl|my_center|LOCUS_18100 2260 3621 gene locus_tag LOCUS_18110 2260 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 3656 3982 gene locus_tag LOCUS_18120 3656 3982 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 protein_id gnl|my_center|LOCUS_18120 4003 5583 gene locus_tag LOCUS_18130 gene gshA 4003 5583 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535409.1 protein_id gnl|my_center|LOCUS_18130 5633 6871 gene locus_tag LOCUS_18140 5633 6871 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 protein_id gnl|my_center|LOCUS_18140 6955 7944 gene locus_tag LOCUS_18150 6955 7944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_18150 7950 8753 gene locus_tag LOCUS_18160 7950 8753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence129 488 99 gene locus_tag LOCUS_18170 488 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 567 1361 gene locus_tag LOCUS_18180 567 1361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_18180 1361 2065 gene locus_tag LOCUS_18190 1361 2065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_18190 2097 3302 gene locus_tag LOCUS_18200 2097 3302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524520.1 protein_id gnl|my_center|LOCUS_18200 3313 4197 gene locus_tag LOCUS_18210 3313 4197 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067080.1 protein_id gnl|my_center|LOCUS_18210 4203 5144 gene locus_tag LOCUS_18220 4203 5144 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313874.1 protein_id gnl|my_center|LOCUS_18220 6077 5169 gene locus_tag LOCUS_18230 gene mdcH 6077 5169 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105302.1 protein_id gnl|my_center|LOCUS_18230 6725 6078 gene locus_tag LOCUS_18240 6725 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 7542 6715 gene locus_tag LOCUS_18250 gene mdcE 7542 6715 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112668.1 protein_id gnl|my_center|LOCUS_18250 8402 7539 gene locus_tag LOCUS_18260 8402 7539 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084003.1 protein_id gnl|my_center|LOCUS_18260 8692 8399 gene locus_tag LOCUS_18270 8692 8399 CDS product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287548.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence130 2156 1812 gene locus_tag LOCUS_18280 gene rplS 2156 1812 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065250.1 protein_id gnl|my_center|LOCUS_18280 2919 2158 gene locus_tag LOCUS_18290 gene trmD 2919 2158 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_18290 3428 2916 gene locus_tag LOCUS_18300 gene rimM 3428 2916 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957579.1 protein_id gnl|my_center|LOCUS_18300 3753 3478 gene locus_tag LOCUS_18310 gene rpsP 3753 3478 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863133.1 protein_id gnl|my_center|LOCUS_18310 5219 3858 gene locus_tag LOCUS_18320 gene ffh 5219 3858 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_18320 5298 6599 gene locus_tag LOCUS_18330 5298 6599 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_18330 7959 6604 gene locus_tag LOCUS_18340 gene radA 7959 6604 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438953.1 protein_id gnl|my_center|LOCUS_18340 8145 8963 gene locus_tag LOCUS_18350 gene prpC 8145 8963 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence131 343 948 gene locus_tag LOCUS_18360 343 948 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_18360 1569 940 gene locus_tag LOCUS_18370 gene ampD 1569 940 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923721.1 protein_id gnl|my_center|LOCUS_18370 1578 2933 gene locus_tag LOCUS_18380 1578 2933 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105299.1 protein_id gnl|my_center|LOCUS_18380 2924 3652 gene locus_tag LOCUS_18390 2924 3652 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_18390 5769 3745 gene locus_tag LOCUS_18400 5769 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5982 5773 gene locus_tag LOCUS_18410 5982 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 6293 5979 gene locus_tag LOCUS_18420 6293 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6479 6303 gene locus_tag LOCUS_18430 6479 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6721 6476 gene locus_tag LOCUS_18440 6721 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 7214 6741 gene locus_tag LOCUS_18450 7214 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 <8941 7214 gene locus_tag LOCUS_18460 <8941 7214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114893.1:chemotaxis signal transduction system protein ChpA >Feature sequence132 2006 732 gene locus_tag LOCUS_18470 gene glgC 2006 732 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_18470 4632 2062 gene locus_tag LOCUS_18480 4632 2062 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 protein_id gnl|my_center|LOCUS_18480 4779 5138 gene locus_tag LOCUS_18490 4779 5138 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944172.1 protein_id gnl|my_center|LOCUS_18490 5135 6070 gene locus_tag LOCUS_18500 5135 6070 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 protein_id gnl|my_center|LOCUS_18500 6101 6724 gene locus_tag LOCUS_18510 6101 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6735 7241 gene locus_tag LOCUS_18520 6735 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 <8928 7254 gene locus_tag LOCUS_18530 <8928 7254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265854.1:putative 2OG-Fe(II) oxygenase >Feature sequence133 2282 1107 gene locus_tag LOCUS_18540 2282 1107 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941496.1 protein_id gnl|my_center|LOCUS_18540 3762 2272 gene locus_tag LOCUS_18550 3762 2272 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_18550 4079 3759 gene locus_tag LOCUS_18560 4079 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3972 5438 gene locus_tag LOCUS_18570 gene zwf 3972 5438 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_18570 5934 5464 gene locus_tag LOCUS_18580 5934 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6448 5939 gene locus_tag LOCUS_18590 6448 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6535 7326 gene locus_tag LOCUS_18600 6535 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 <8823 7289 gene locus_tag LOCUS_18610 <8823 7289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930692.1:FlxA-like family protein >Feature sequence134 535 2166 gene locus_tag LOCUS_18620 535 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 5289 2191 gene locus_tag LOCUS_18630 5289 2191 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_18630 6275 5292 gene locus_tag LOCUS_18640 6275 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 7659 6262 gene locus_tag LOCUS_18650 gene ompQ 7659 6262 CDS product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_18650 7830 8495 gene locus_tag LOCUS_18660 7830 8495 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence135 <1 673 gene locus_tag LOCUS_18670 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147933.1:DEAD/DEAH box helicase 1471 686 gene locus_tag LOCUS_18680 1471 686 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222729.1 protein_id gnl|my_center|LOCUS_18680 1507 2172 gene locus_tag LOCUS_18690 1507 2172 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_18690 2302 3189 gene locus_tag LOCUS_18700 2302 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3713 3201 gene locus_tag LOCUS_18710 3713 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 4063 3710 gene locus_tag LOCUS_18720 4063 3710 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071582.1 protein_id gnl|my_center|LOCUS_18720 4681 4076 gene locus_tag LOCUS_18730 4681 4076 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560301.1 protein_id gnl|my_center|LOCUS_18730 5853 4678 gene locus_tag LOCUS_18740 5853 4678 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705184.1 protein_id gnl|my_center|LOCUS_18740 6887 5868 gene locus_tag LOCUS_18750 6887 5868 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence136 276 545 gene locus_tag LOCUS_18760 276 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 623 3220 gene locus_tag LOCUS_18770 623 3220 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_18770 3581 3234 gene locus_tag LOCUS_18780 3581 3234 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190277.1 protein_id gnl|my_center|LOCUS_18780 4857 3592 gene locus_tag LOCUS_18790 4857 3592 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_18790 5364 4945 gene locus_tag LOCUS_18800 5364 4945 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143935.1 protein_id gnl|my_center|LOCUS_18800 6222 5473 gene locus_tag LOCUS_18810 6222 5473 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259317.1 protein_id gnl|my_center|LOCUS_18810 6638 6198 gene locus_tag LOCUS_18820 6638 6198 CDS product DUF2231 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529160.1 protein_id gnl|my_center|LOCUS_18820 6996 6649 gene locus_tag LOCUS_18830 6996 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 <8787 7068 gene locus_tag LOCUS_18840 <8787 7068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040383028.1:sorbosone dehydrogenase family protein >Feature sequence137 504 31 gene locus_tag LOCUS_18850 504 31 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_18850 693 1715 gene locus_tag LOCUS_18860 693 1715 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_18860 1743 2591 gene locus_tag LOCUS_18870 1743 2591 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313589.1 protein_id gnl|my_center|LOCUS_18870 2588 3352 gene locus_tag LOCUS_18880 gene mlaE 2588 3352 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 protein_id gnl|my_center|LOCUS_18880 3369 3881 gene locus_tag LOCUS_18890 gene mlaD 3369 3881 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_18890 3878 4558 gene locus_tag LOCUS_18900 3878 4558 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815780.1 protein_id gnl|my_center|LOCUS_18900 4579 4911 gene locus_tag LOCUS_18910 4579 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5748 4924 gene locus_tag LOCUS_18920 5748 4924 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_18920 7360 5804 gene locus_tag LOCUS_18930 7360 5804 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444590.1 protein_id gnl|my_center|LOCUS_18930 <8670 7495 gene locus_tag LOCUS_18940 <8670 7495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813082.1:PhoH family protein >Feature sequence138 1347 73 gene locus_tag LOCUS_18950 1347 73 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_18950 2249 1380 gene locus_tag LOCUS_18960 2249 1380 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_18960 3815 2256 gene locus_tag LOCUS_18970 3815 2256 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921024.1 protein_id gnl|my_center|LOCUS_18970 6172 3830 gene locus_tag LOCUS_18980 6172 3830 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_18980 6373 7107 gene locus_tag LOCUS_18990 6373 7107 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 protein_id gnl|my_center|LOCUS_18990 7485 7108 gene locus_tag LOCUS_19000 7485 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence139 1092 154 gene locus_tag LOCUS_19010 1092 154 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968613.1 protein_id gnl|my_center|LOCUS_19010 1655 1089 gene locus_tag LOCUS_19020 1655 1089 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327147.1 protein_id gnl|my_center|LOCUS_19020 2325 1693 gene locus_tag LOCUS_19030 2325 1693 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974325.1 protein_id gnl|my_center|LOCUS_19030 2353 3327 gene locus_tag LOCUS_19040 2353 3327 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_19040 3418 4812 gene locus_tag LOCUS_19050 3418 4812 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897068.1 protein_id gnl|my_center|LOCUS_19050 4821 5468 gene locus_tag LOCUS_19060 4821 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7914 5479 gene locus_tag LOCUS_19070 7914 5479 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_19070 8651 7911 gene locus_tag LOCUS_19080 8651 7911 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967912.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence140 2092 2008 gene locus_tag LOCUS_t00240 2092 2008 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2547 2101 gene locus_tag LOCUS_19090 2547 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3285 2560 gene locus_tag LOCUS_19100 gene tpiA 3285 2560 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_19100 4734 3439 gene locus_tag LOCUS_19110 gene glmM 4734 3439 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_19110 5601 4777 gene locus_tag LOCUS_19120 gene folP 5601 4777 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_19120 7575 5668 gene locus_tag LOCUS_19130 gene ftsH 7575 5668 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 protein_id gnl|my_center|LOCUS_19130 8268 7642 gene locus_tag LOCUS_19140 gene rlmE 8268 7642 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence141 208 723 gene locus_tag LOCUS_19150 208 723 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036486.1 protein_id gnl|my_center|LOCUS_19150 720 1283 gene locus_tag LOCUS_19160 720 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3043 1295 gene locus_tag LOCUS_19170 3043 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_19170 3169 4002 gene locus_tag LOCUS_19180 gene modA 3169 4002 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090881.1 protein_id gnl|my_center|LOCUS_19180 4921 3974 gene locus_tag LOCUS_19190 4921 3974 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_19190 5502 4921 gene locus_tag LOCUS_19200 5502 4921 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969187.1 protein_id gnl|my_center|LOCUS_19200 5619 6518 gene locus_tag LOCUS_19210 5619 6518 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_19210 6709 6936 gene locus_tag LOCUS_19220 6709 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence142 2658 130 gene locus_tag LOCUS_19230 2658 130 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 protein_id gnl|my_center|LOCUS_19230 2645 3289 gene locus_tag LOCUS_19240 2645 3289 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268752.1 protein_id gnl|my_center|LOCUS_19240 3294 4526 gene locus_tag LOCUS_19250 3294 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 5208 4537 gene locus_tag LOCUS_19260 5208 4537 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_19260 6298 5240 gene locus_tag LOCUS_19270 6298 5240 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_19270 8173 6335 gene locus_tag LOCUS_19280 8173 6335 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence143 901 296 gene locus_tag LOCUS_19290 901 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2138 978 gene locus_tag LOCUS_19300 2138 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 3288 2164 gene locus_tag LOCUS_19310 gene tyrA 3288 2164 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 protein_id gnl|my_center|LOCUS_19310 4787 3327 gene locus_tag LOCUS_19320 4787 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4768 5520 gene locus_tag LOCUS_19330 gene pdxH 4768 5520 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390377.1 protein_id gnl|my_center|LOCUS_19330 5539 6312 gene locus_tag LOCUS_19340 5539 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_19340 6297 7115 gene locus_tag LOCUS_19350 6297 7115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973001.1 protein_id gnl|my_center|LOCUS_19350 7822 7112 gene locus_tag LOCUS_19360 gene hisN 7822 7112 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728137.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence144 1172 357 gene locus_tag LOCUS_19370 1172 357 CDS product MOSC N-terminal beta barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194630.1 protein_id gnl|my_center|LOCUS_19370 1261 3153 gene locus_tag LOCUS_19380 1261 3153 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039194.1 protein_id gnl|my_center|LOCUS_19380 3474 3166 gene locus_tag LOCUS_19390 3474 3166 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_19390 3763 4134 gene locus_tag LOCUS_19400 3763 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4879 4178 gene locus_tag LOCUS_19410 4879 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5512 4994 gene locus_tag LOCUS_19420 5512 4994 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 protein_id gnl|my_center|LOCUS_19420 5958 5506 gene locus_tag LOCUS_19430 5958 5506 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 protein_id gnl|my_center|LOCUS_19430 6320 6865 gene locus_tag LOCUS_19440 6320 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 7818 6949 gene locus_tag LOCUS_19450 7818 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 7699 8034 gene locus_tag LOCUS_19460 7699 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 8117 8039 gene locus_tag LOCUS_r00010 8117 8039 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 66 percent of the 5S ribosomal RNA >Feature sequence145 <1 1209 gene locus_tag LOCUS_19470 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528606.1:CDGSH iron-sulfur domain-containing protein 3174 1210 gene locus_tag LOCUS_19480 gene tgpA 3174 1210 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_19480 4177 3161 gene locus_tag LOCUS_19490 4177 3161 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_19490 5137 4196 gene locus_tag LOCUS_19500 5137 4196 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_19500 7914 5134 gene locus_tag LOCUS_19510 7914 5134 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence146 <1 592 gene locus_tag LOCUS_19520 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966830.1:MFS transporter 1363 611 gene locus_tag LOCUS_19530 1363 611 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_19530 2844 1360 gene locus_tag LOCUS_19540 2844 1360 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_19540 5948 2859 gene locus_tag LOCUS_19550 5948 2859 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109387.1 protein_id gnl|my_center|LOCUS_19550 7230 5941 gene locus_tag LOCUS_19560 7230 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 <8121 7358 gene locus_tag LOCUS_19570 <8121 7358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482477.1:small-conductance mechanosensitive channel MscS >Feature sequence147 863 1306 gene locus_tag LOCUS_19580 863 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2227 1310 gene locus_tag LOCUS_19590 gene aguB 2227 1310 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_19590 3231 2239 gene locus_tag LOCUS_19600 3231 2239 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_19600 3244 3687 gene locus_tag LOCUS_19610 3244 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3959 3672 gene locus_tag LOCUS_19620 3959 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 4044 6161 gene locus_tag LOCUS_19630 4044 6161 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_19630 7238 6201 gene locus_tag LOCUS_19640 7238 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 7746 7267 gene locus_tag LOCUS_19650 7746 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence148 146 1408 gene locus_tag LOCUS_19660 gene waaA 146 1408 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891584.1 protein_id gnl|my_center|LOCUS_19660 2972 1515 gene locus_tag LOCUS_19670 gene tolC 2972 1515 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735274.1 protein_id gnl|my_center|LOCUS_19670 3648 2998 gene locus_tag LOCUS_19680 3648 2998 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_19680 3886 6186 gene locus_tag LOCUS_19690 3886 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 <8010 6279 gene locus_tag LOCUS_19700 <8010 6279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038412.1:sodium-translocating pyrophosphatase >Feature sequence149 1585 266 gene locus_tag LOCUS_19710 1585 266 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523139.1 protein_id gnl|my_center|LOCUS_19710 3087 1582 gene locus_tag LOCUS_19720 3087 1582 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102988.1 protein_id gnl|my_center|LOCUS_19720 4644 3160 gene locus_tag LOCUS_19730 gene glpK 4644 3160 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531806.1 protein_id gnl|my_center|LOCUS_19730 4531 4854 gene locus_tag LOCUS_19740 4531 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 5054 7834 gene locus_tag LOCUS_19750 5054 7834 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence150 1571 288 gene locus_tag LOCUS_19760 1571 288 CDS product Cache 3/Cache 2 fusion domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037327.1 protein_id gnl|my_center|LOCUS_19760 1817 3106 gene locus_tag LOCUS_19770 1817 3106 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056733.1 protein_id gnl|my_center|LOCUS_19770 3872 3138 gene locus_tag LOCUS_19780 3872 3138 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_19780 5287 3881 gene locus_tag LOCUS_19790 5287 3881 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence151 483 1244 gene locus_tag LOCUS_19800 483 1244 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640216.1 protein_id gnl|my_center|LOCUS_19800 2139 1357 gene locus_tag LOCUS_19810 2139 1357 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_19810 2732 2268 gene locus_tag LOCUS_19820 2732 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 4477 2756 gene locus_tag LOCUS_19830 4477 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4503 4721 gene locus_tag LOCUS_19840 4503 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 4819 5193 gene locus_tag LOCUS_19850 gene rpsL 4819 5193 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874480.1 protein_id gnl|my_center|LOCUS_19850 5207 5686 gene locus_tag LOCUS_19860 gene rpsG 5207 5686 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 protein_id gnl|my_center|LOCUS_19860 5705 7792 gene locus_tag LOCUS_19870 gene fusA 5705 7792 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946076.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence152 961 2 gene locus_tag LOCUS_19880 gene fabD 961 2 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147872.1 protein_id gnl|my_center|LOCUS_19880 1607 993 gene locus_tag LOCUS_19890 1607 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 1649 2122 gene locus_tag LOCUS_19900 gene gspG 1649 2122 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738789.1 protein_id gnl|my_center|LOCUS_19900 2193 2675 gene locus_tag LOCUS_19910 2193 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2672 3232 gene locus_tag LOCUS_19920 2672 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3229 3954 gene locus_tag LOCUS_19930 gene gspJ 3229 3954 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 protein_id gnl|my_center|LOCUS_19930 3954 4940 gene locus_tag LOCUS_19940 gene xcpX 3954 4940 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_19940 4950 6230 gene locus_tag LOCUS_19950 gene gspL 4950 6230 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070571.1 protein_id gnl|my_center|LOCUS_19950 6241 6744 gene locus_tag LOCUS_19960 6241 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 6746 7477 gene locus_tag LOCUS_19970 gene exeN 6746 7477 CDS product GspN family type II secretion system protein ExeN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704549.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence153 966 739 gene locus_tag LOCUS_19980 966 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1569 1390 gene locus_tag LOCUS_19990 1569 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1767 1576 gene locus_tag LOCUS_20000 1767 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 1860 2474 gene locus_tag LOCUS_20010 1860 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2471 2956 gene locus_tag LOCUS_20020 2471 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2953 4587 gene locus_tag LOCUS_20030 2953 4587 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197647811.1 protein_id gnl|my_center|LOCUS_20030 4620 4544 gene locus_tag LOCUS_t00250 4620 4544 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5318 4719 gene locus_tag LOCUS_20040 5318 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 5813 5358 gene locus_tag LOCUS_20050 5813 5358 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 protein_id gnl|my_center|LOCUS_20050 5895 7004 gene locus_tag LOCUS_20060 5895 7004 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_20060 7038 7616 gene locus_tag LOCUS_20070 gene gfa 7038 7616 CDS product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337580.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence154 3866 624 gene locus_tag LOCUS_20080 3866 624 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943038.1 protein_id gnl|my_center|LOCUS_20080 4124 4969 gene locus_tag LOCUS_20090 4124 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4971 6389 gene locus_tag LOCUS_20100 4971 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 6637 6458 gene locus_tag LOCUS_20110 6637 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 7461 6658 gene locus_tag LOCUS_20120 7461 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20120 >Feature sequence155 1981 476 gene locus_tag LOCUS_20130 1981 476 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918535.1 protein_id gnl|my_center|LOCUS_20130 3435 1978 gene locus_tag LOCUS_20140 3435 1978 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_20140 4499 3444 gene locus_tag LOCUS_20150 4499 3444 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_20150 5317 4496 gene locus_tag LOCUS_20160 5317 4496 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_20160 5820 5314 gene locus_tag LOCUS_20170 5820 5314 CDS product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036520.1 protein_id gnl|my_center|LOCUS_20170 7022 5817 gene locus_tag LOCUS_20180 7022 5817 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence156 960 40 gene locus_tag LOCUS_20190 gene murB 960 40 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_20190 2438 957 gene locus_tag LOCUS_20200 gene murC 2438 957 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_20200 3523 2438 gene locus_tag LOCUS_20210 gene murG 3523 2438 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035962.1 protein_id gnl|my_center|LOCUS_20210 4728 3520 gene locus_tag LOCUS_20220 gene ftsW 4728 3520 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_20220 6065 4725 gene locus_tag LOCUS_20230 gene murD 6065 4725 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_20230 7147 6062 gene locus_tag LOCUS_20240 gene mraY 7147 6062 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence157 3 632 gene locus_tag LOCUS_20250 gene ccmA 3 632 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815896.1 protein_id gnl|my_center|LOCUS_20250 625 1371 gene locus_tag LOCUS_20260 gene ccmB 625 1371 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037365.1 protein_id gnl|my_center|LOCUS_20260 1382 2119 gene locus_tag LOCUS_20270 gene ccmC 1382 2119 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036839.1 protein_id gnl|my_center|LOCUS_20270 2116 2277 gene locus_tag LOCUS_20280 2116 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2274 2798 gene locus_tag LOCUS_20290 gene ccmE 2274 2798 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765255.1 protein_id gnl|my_center|LOCUS_20290 2803 4761 gene locus_tag LOCUS_20300 2803 4761 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_20300 4758 5297 gene locus_tag LOCUS_20310 4758 5297 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036835.1 protein_id gnl|my_center|LOCUS_20310 5294 5749 gene locus_tag LOCUS_20320 5294 5749 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055068.1 protein_id gnl|my_center|LOCUS_20320 5749 6759 gene locus_tag LOCUS_20330 5749 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 6899 7246 gene locus_tag LOCUS_20340 6899 7246 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390766.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence158 2048 675 gene locus_tag LOCUS_20350 gene rseP 2048 675 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_20350 3256 2045 gene locus_tag LOCUS_20360 gene ispC 3256 2045 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_20360 4065 3253 gene locus_tag LOCUS_20370 4065 3253 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_20370 4800 4069 gene locus_tag LOCUS_20380 gene uppS 4800 4069 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921694.1 protein_id gnl|my_center|LOCUS_20380 5357 4800 gene locus_tag LOCUS_20390 gene frr 5357 4800 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_20390 6108 5383 gene locus_tag LOCUS_20400 gene pyrH 6108 5383 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_20400 7056 6178 gene locus_tag LOCUS_20410 gene tsf 7056 6178 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence159 1116 325 gene locus_tag LOCUS_20420 gene virB9 1116 325 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035201477.1 protein_id gnl|my_center|LOCUS_20420 1832 1119 gene locus_tag LOCUS_20430 1832 1119 CDS product virB8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974428.1 protein_id gnl|my_center|LOCUS_20430 2955 1999 gene locus_tag LOCUS_20440 2955 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3697 2978 gene locus_tag LOCUS_20450 3697 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 6180 3727 gene locus_tag LOCUS_20460 6180 3727 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528660.1 protein_id gnl|my_center|LOCUS_20460 6545 6180 gene locus_tag LOCUS_20470 6545 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 6852 6547 gene locus_tag LOCUS_20480 6852 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 7282 6881 gene locus_tag LOCUS_20490 7282 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence160 565 801 gene locus_tag LOCUS_20500 gene rpmE 565 801 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_20500 978 2273 gene locus_tag LOCUS_20510 gene gltA 978 2273 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312523.1 protein_id gnl|my_center|LOCUS_20510 2893 2270 gene locus_tag LOCUS_20520 2893 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 protein_id gnl|my_center|LOCUS_20520 5304 2896 gene locus_tag LOCUS_20530 5304 2896 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_20530 5881 6945 gene locus_tag LOCUS_20540 5881 6945 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence161 809 519 gene locus_tag LOCUS_20550 809 519 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973738.1 protein_id gnl|my_center|LOCUS_20550 2070 820 gene locus_tag LOCUS_20560 2070 820 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_20560 3698 2181 gene locus_tag LOCUS_20570 3698 2181 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229315.1 protein_id gnl|my_center|LOCUS_20570 3821 5920 gene locus_tag LOCUS_20580 gene betB 3821 5920 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173573908.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence162 2041 911 gene locus_tag LOCUS_20590 2041 911 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037110.1 protein_id gnl|my_center|LOCUS_20590 2709 2041 gene locus_tag LOCUS_20600 gene flgH 2709 2041 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106240.1 protein_id gnl|my_center|LOCUS_20600 3505 2720 gene locus_tag LOCUS_20610 gene flgG 3505 2720 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946953.1 protein_id gnl|my_center|LOCUS_20610 4286 3537 gene locus_tag LOCUS_20620 gene flgF 4286 3537 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_20620 5524 4313 gene locus_tag LOCUS_20630 gene flgE 5524 4313 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_20630 6235 5537 gene locus_tag LOCUS_20640 6235 5537 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_20640 6707 6276 gene locus_tag LOCUS_20650 gene flgC 6707 6276 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082150.1 protein_id gnl|my_center|LOCUS_20650 7143 6721 gene locus_tag LOCUS_20660 gene flgB 7143 6721 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence163 740 997 gene locus_tag LOCUS_20670 740 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1136 2398 gene locus_tag LOCUS_20680 1136 2398 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120884.1 protein_id gnl|my_center|LOCUS_20680 4874 2379 gene locus_tag LOCUS_20690 4874 2379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267415.1 protein_id gnl|my_center|LOCUS_20690 5581 4871 gene locus_tag LOCUS_20700 5581 4871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_20700 5523 6179 gene locus_tag LOCUS_20710 5523 6179 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence164 <1 2214 gene locus_tag LOCUS_20720 <1 2214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524070.1:S8 family peptidase 3033 4145 gene locus_tag LOCUS_20730 3033 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4156 6786 gene locus_tag LOCUS_20740 4156 6786 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence165 489 118 gene locus_tag LOCUS_20750 489 118 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 protein_id gnl|my_center|LOCUS_20750 2050 533 gene locus_tag LOCUS_20760 2050 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2175 3053 gene locus_tag LOCUS_20770 gene rsmI 2175 3053 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_20770 4002 3601 gene locus_tag LOCUS_20780 4002 3601 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377610.1 protein_id gnl|my_center|LOCUS_20780 4611 4006 gene locus_tag LOCUS_20790 gene sspA 4611 4006 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_20790 5468 4662 gene locus_tag LOCUS_20800 5468 4662 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_20800 6738 5458 gene locus_tag LOCUS_20810 6738 5458 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence166 873 508 gene locus_tag LOCUS_20820 873 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1222 899 gene locus_tag LOCUS_20830 1222 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1551 1219 gene locus_tag LOCUS_20840 1551 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1951 1860 gene locus_tag LOCUS_t00260 1951 1860 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2827 2252 gene locus_tag LOCUS_20850 2827 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085967914.1 protein_id gnl|my_center|LOCUS_20850 2996 3655 gene locus_tag LOCUS_20860 2996 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 5576 3672 gene locus_tag LOCUS_20870 5576 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 6240 5656 gene locus_tag LOCUS_20880 6240 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 6624 6247 gene locus_tag LOCUS_20890 6624 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence167 400 23 gene locus_tag LOCUS_20900 400 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 526 795 gene locus_tag LOCUS_20910 gene rpsO 526 795 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_20910 875 2965 gene locus_tag LOCUS_20920 gene pnp 875 2965 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821234.1 protein_id gnl|my_center|LOCUS_20920 3419 3084 gene locus_tag LOCUS_20930 3419 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 4286 3534 gene locus_tag LOCUS_20940 gene gluQRS 4286 3534 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_20940 5175 4402 gene locus_tag LOCUS_20950 5175 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 5713 5324 gene locus_tag LOCUS_20960 gene queF 5713 5324 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence168 1389 409 gene locus_tag LOCUS_20970 gene hemB 1389 409 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_20970 2146 1403 gene locus_tag LOCUS_20980 2146 1403 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141649149.1 protein_id gnl|my_center|LOCUS_20980 3141 2170 gene locus_tag LOCUS_20990 gene hemC 3141 2170 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_20990 3848 3138 gene locus_tag LOCUS_21000 3848 3138 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_21000 4948 3866 gene locus_tag LOCUS_21010 4948 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 6237 4945 gene locus_tag LOCUS_21020 gene hemL 6237 4945 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228305.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence169 1843 1136 gene locus_tag LOCUS_21030 gene cmk 1843 1136 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_21030 3195 1861 gene locus_tag LOCUS_21040 gene aroA 3195 1861 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036773.1 protein_id gnl|my_center|LOCUS_21040 4361 3192 gene locus_tag LOCUS_21050 gene pheA 4361 3192 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275386.1 protein_id gnl|my_center|LOCUS_21050 5535 4366 gene locus_tag LOCUS_21060 5535 4366 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_21060 6630 5548 gene locus_tag LOCUS_21070 gene serC 6630 5548 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705848.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence170 1937 894 gene locus_tag LOCUS_21080 gene mreB 1937 894 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_21080 2015 2362 gene locus_tag LOCUS_21090 gene gatC 2015 2362 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_21090 2388 3833 gene locus_tag LOCUS_21100 gene gatA 2388 3833 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766477.1 protein_id gnl|my_center|LOCUS_21100 3830 5269 gene locus_tag LOCUS_21110 gene gatB 3830 5269 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313612.1 protein_id gnl|my_center|LOCUS_21110 5735 5259 gene locus_tag LOCUS_21120 5735 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence171 565 194 gene locus_tag LOCUS_21130 565 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 905 570 gene locus_tag LOCUS_21140 gene fliN 905 570 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037084.1 protein_id gnl|my_center|LOCUS_21140 1924 902 gene locus_tag LOCUS_21150 gene fliM 1924 902 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037085.1 protein_id gnl|my_center|LOCUS_21150 2484 1936 gene locus_tag LOCUS_21160 2484 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4107 2680 gene locus_tag LOCUS_21170 4107 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21170 4552 4097 gene locus_tag LOCUS_21180 4552 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5950 4556 gene locus_tag LOCUS_21190 gene fliI 5950 4556 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_21190 6615 5947 gene locus_tag LOCUS_21200 6615 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence172 <1 1479 gene locus_tag LOCUS_21210 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537669.1:alkaline phosphatase family protein 2916 1555 gene locus_tag LOCUS_21220 2916 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3302 2913 gene locus_tag LOCUS_21230 3302 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3446 4369 gene locus_tag LOCUS_21240 3446 4369 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268378.1 protein_id gnl|my_center|LOCUS_21240 4496 4948 gene locus_tag LOCUS_21250 4496 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037360.1 protein_id gnl|my_center|LOCUS_21250 5742 5080 gene locus_tag LOCUS_21260 5742 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6307 5753 gene locus_tag LOCUS_21270 6307 5753 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence173 1620 2096 gene locus_tag LOCUS_21280 1620 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2093 3163 gene locus_tag LOCUS_21290 2093 3163 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117074.1 protein_id gnl|my_center|LOCUS_21290 4656 3139 gene locus_tag LOCUS_21300 gene ilvA 4656 3139 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_21300 6649 4691 gene locus_tag LOCUS_21310 6649 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence174 1150 1626 gene locus_tag LOCUS_21320 1150 1626 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083953.1 protein_id gnl|my_center|LOCUS_21320 2252 1629 gene locus_tag LOCUS_21330 2252 1629 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391430.1 protein_id gnl|my_center|LOCUS_21330 2810 2265 gene locus_tag LOCUS_21340 2810 2265 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 protein_id gnl|my_center|LOCUS_21340 2809 3561 gene locus_tag LOCUS_21350 2809 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 4301 3564 gene locus_tag LOCUS_21360 4301 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 5371 4301 gene locus_tag LOCUS_21370 gene hemH 5371 4301 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927663.1 protein_id gnl|my_center|LOCUS_21370 <6656 5376 gene locus_tag LOCUS_21380 <6656 5376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015368063.1:NADP-dependent succinate-semialdehyde dehydrogenase >Feature sequence175 931 464 gene locus_tag LOCUS_21390 gene smpB 931 464 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_21390 960 1385 gene locus_tag LOCUS_21400 960 1385 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 protein_id gnl|my_center|LOCUS_21400 1382 1714 gene locus_tag LOCUS_21410 1382 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2085 1711 gene locus_tag LOCUS_21420 2085 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 2147 2578 gene locus_tag LOCUS_21430 gene fur 2147 2578 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_21430 4357 2603 gene locus_tag LOCUS_21440 gene recN 4357 2603 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_21440 5254 4370 gene locus_tag LOCUS_21450 5254 4370 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_21450 5355 6413 gene locus_tag LOCUS_21460 gene hrcA 5355 6413 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence176 <1 1999 gene locus_tag LOCUS_21470 <1 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929092.1:ATP-binding protein 2763 2023 gene locus_tag LOCUS_21480 2763 2023 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970206.1 protein_id gnl|my_center|LOCUS_21480 3320 2853 gene locus_tag LOCUS_21490 gene msrB 3320 2853 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038734.1 protein_id gnl|my_center|LOCUS_21490 3447 4466 gene locus_tag LOCUS_21500 3447 4466 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084015.1 protein_id gnl|my_center|LOCUS_21500 4463 4849 gene locus_tag LOCUS_21510 4463 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 5452 4922 gene locus_tag LOCUS_21520 5452 4922 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966385.1 protein_id gnl|my_center|LOCUS_21520 5645 6253 gene locus_tag LOCUS_21530 5645 6253 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence177 556 906 gene locus_tag LOCUS_21540 556 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 972 2732 gene locus_tag LOCUS_21550 972 2732 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 protein_id gnl|my_center|LOCUS_21550 2819 3580 gene locus_tag LOCUS_21560 2819 3580 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_21560 3601 4596 gene locus_tag LOCUS_21570 3601 4596 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196629.1 protein_id gnl|my_center|LOCUS_21570 5936 4593 gene locus_tag LOCUS_21580 5936 4593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence178 3437 1392 gene locus_tag LOCUS_21590 3437 1392 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819543.1 protein_id gnl|my_center|LOCUS_21590 4259 3519 gene locus_tag LOCUS_21600 4259 3519 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_21600 5709 4285 gene locus_tag LOCUS_21610 5709 4285 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 protein_id gnl|my_center|LOCUS_21610 <6232 5715 gene locus_tag LOCUS_21620 <6232 5715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246175.1:nickel/cobalt efflux protein RcnA >Feature sequence179 1155 583 gene locus_tag LOCUS_21630 gene hslV 1155 583 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769770.1 protein_id gnl|my_center|LOCUS_21630 2150 1206 gene locus_tag LOCUS_21640 gene xerC 2150 1206 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 protein_id gnl|my_center|LOCUS_21640 2885 2178 gene locus_tag LOCUS_21650 2885 2178 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_21650 3699 2890 gene locus_tag LOCUS_21660 gene dapF 3699 2890 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459097.1 protein_id gnl|my_center|LOCUS_21660 4339 3737 gene locus_tag LOCUS_21670 4339 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 4226 5272 gene locus_tag LOCUS_21680 4226 5272 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930577.1 protein_id gnl|my_center|LOCUS_21680 5679 5269 gene locus_tag LOCUS_21690 5679 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771586.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence180 1312 401 gene locus_tag LOCUS_21700 1312 401 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958251.1 protein_id gnl|my_center|LOCUS_21700 1465 2004 gene locus_tag LOCUS_21710 1465 2004 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014844498.1 protein_id gnl|my_center|LOCUS_21710 2006 2572 gene locus_tag LOCUS_21720 2006 2572 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_21720 2605 3561 gene locus_tag LOCUS_21730 2605 3561 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_21730 4059 3577 gene locus_tag LOCUS_21740 4059 3577 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457116.1 protein_id gnl|my_center|LOCUS_21740 4491 4072 gene locus_tag LOCUS_21750 4491 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5681 4488 gene locus_tag LOCUS_21760 5681 4488 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence181 953 2512 gene locus_tag LOCUS_21770 953 2512 CDS product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 protein_id gnl|my_center|LOCUS_21770 2551 3510 gene locus_tag LOCUS_21780 2551 3510 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_21780 5125 3512 gene locus_tag LOCUS_21790 5125 3512 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190823.1 protein_id gnl|my_center|LOCUS_21790 <6110 5136 gene locus_tag LOCUS_21800 <6110 5136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113728.1:dihydrolipoamide acetyltransferase family protein >Feature sequence182 2424 904 gene locus_tag LOCUS_21810 2424 904 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_21810 4172 2421 gene locus_tag LOCUS_21820 gene ftsI 4172 2421 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_21820 4447 4169 gene locus_tag LOCUS_21830 4447 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 5373 4444 gene locus_tag LOCUS_21840 gene rsmH 5373 4444 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769446.1 protein_id gnl|my_center|LOCUS_21840 5867 5460 gene locus_tag LOCUS_21850 gene mraZ 5867 5460 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence183 <1 1015 gene locus_tag LOCUS_21860 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531168.1:methylenetetrahydrofolate reductase 1012 1956 gene locus_tag LOCUS_21870 1012 1956 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975922.1 protein_id gnl|my_center|LOCUS_21870 1953 3959 gene locus_tag LOCUS_21880 1953 3959 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153435973.1 protein_id gnl|my_center|LOCUS_21880 4929 3979 gene locus_tag LOCUS_21890 4929 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 6025 4943 gene locus_tag LOCUS_21900 6025 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence184 259 924 gene locus_tag LOCUS_21910 259 924 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_21910 928 1461 gene locus_tag LOCUS_21920 gene pilP 928 1461 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_21920 1483 3651 gene locus_tag LOCUS_21930 1483 3651 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_21930 3781 4266 gene locus_tag LOCUS_21940 gene aroK 3781 4266 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946667.1 protein_id gnl|my_center|LOCUS_21940 4344 5423 gene locus_tag LOCUS_21950 gene aroB 4344 5423 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence185 262 657 gene locus_tag LOCUS_21960 262 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 654 2567 gene locus_tag LOCUS_21970 654 2567 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_21970 2564 2839 gene locus_tag LOCUS_21980 2564 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3308 2784 gene locus_tag LOCUS_21990 3308 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3647 3396 gene locus_tag LOCUS_22000 3647 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3845 5209 gene locus_tag LOCUS_22010 gene pepQ 3845 5209 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038359.1 protein_id gnl|my_center|LOCUS_22010 5634 5233 gene locus_tag LOCUS_22020 gene mscL 5634 5233 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243783.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence186 1920 2537 gene locus_tag LOCUS_22030 1920 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3917 2577 gene locus_tag LOCUS_22040 3917 2577 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_22040 4392 3955 gene locus_tag LOCUS_22050 gene ohrR 4392 3955 CDS product organic hydroperoxide resistance protein OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_22050 4564 4863 gene locus_tag LOCUS_22060 4564 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 5678 4869 gene locus_tag LOCUS_22070 5678 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence187 <1 500 gene locus_tag LOCUS_22080 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808362.1:arginase 637 858 gene locus_tag LOCUS_22090 637 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1579 878 gene locus_tag LOCUS_22100 1579 878 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036958.1 protein_id gnl|my_center|LOCUS_22100 1595 3790 gene locus_tag LOCUS_22110 1595 3790 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_22110 3787 5454 gene locus_tag LOCUS_22120 gene mdcA 3787 5454 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099050.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence188 1563 16 gene locus_tag LOCUS_22130 1563 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2201 1560 gene locus_tag LOCUS_22140 2201 1560 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 protein_id gnl|my_center|LOCUS_22140 3230 2205 gene locus_tag LOCUS_22150 3230 2205 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 protein_id gnl|my_center|LOCUS_22150 4099 3227 gene locus_tag LOCUS_22160 4099 3227 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_22160 4410 4111 gene locus_tag LOCUS_22170 4410 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5603 4407 gene locus_tag LOCUS_22180 5603 4407 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence189 <1 921 gene locus_tag LOCUS_22190 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036237.1:TonB-dependent receptor 1409 966 gene locus_tag LOCUS_22200 1409 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1891 1412 gene locus_tag LOCUS_22210 1891 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 2403 1888 gene locus_tag LOCUS_22220 2403 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3585 2422 gene locus_tag LOCUS_22230 3585 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3787 5103 gene locus_tag LOCUS_22240 3787 5103 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063785.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence190 1957 2526 gene locus_tag LOCUS_22250 1957 2526 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529569.1 protein_id gnl|my_center|LOCUS_22250 2593 3195 gene locus_tag LOCUS_22260 2593 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3289 4698 gene locus_tag LOCUS_22270 gene miaB 3289 4698 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 protein_id gnl|my_center|LOCUS_22270 4699 5673 gene locus_tag LOCUS_22280 4699 5673 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence191 1030 350 gene locus_tag LOCUS_22290 1030 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2750 1032 gene locus_tag LOCUS_22300 2750 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2966 3172 gene locus_tag LOCUS_22310 2966 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 5482 3215 gene locus_tag LOCUS_22320 5482 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence192 <1 536 gene locus_tag LOCUS_22330 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173573908.1:betaine-aldehyde dehydrogenase 545 2209 gene locus_tag LOCUS_22340 gene betA 545 2209 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532681.1 protein_id gnl|my_center|LOCUS_22340 2841 2206 gene locus_tag LOCUS_22350 2841 2206 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220205807.1 protein_id gnl|my_center|LOCUS_22350 4856 2838 gene locus_tag LOCUS_22360 4856 2838 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_22360 <5711 4906 gene locus_tag LOCUS_22370 <5711 4906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920963.1:TonB-dependent receptor >Feature sequence193 554 252 gene locus_tag LOCUS_22380 554 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 5645 570 gene locus_tag LOCUS_22390 gene uvrA 5645 570 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039164.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence194 1765 419 gene locus_tag LOCUS_22400 gene tig 1765 419 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245213.1 protein_id gnl|my_center|LOCUS_22400 1916 1832 gene locus_tag LOCUS_t00270 1916 1832 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2054 1979 gene locus_tag LOCUS_t00280 2054 1979 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2256 2181 gene locus_tag LOCUS_t00290 2256 2181 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2356 2280 gene locus_tag LOCUS_t00300 2356 2280 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2543 3634 gene locus_tag LOCUS_22410 2543 3634 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222939.1 protein_id gnl|my_center|LOCUS_22410 3663 4160 gene locus_tag LOCUS_22420 gene sixA 3663 4160 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_22420 5668 4196 gene locus_tag LOCUS_22430 5668 4196 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813155.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence195 2448 373 gene locus_tag LOCUS_22440 gene flhA 2448 373 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_22440 3581 2451 gene locus_tag LOCUS_22450 gene flhB 3581 2451 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_22450 4371 3586 gene locus_tag LOCUS_22460 gene fliR 4371 3586 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_22460 4667 4398 gene locus_tag LOCUS_22470 gene fliQ 4667 4398 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500315.1 protein_id gnl|my_center|LOCUS_22470 5434 4664 gene locus_tag LOCUS_22480 gene fliP 5434 4664 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549847.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence196 1436 255 gene locus_tag LOCUS_22490 1436 255 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390746.1 protein_id gnl|my_center|LOCUS_22490 2821 1436 gene locus_tag LOCUS_22500 2821 1436 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228082.1 protein_id gnl|my_center|LOCUS_22500 4593 2839 gene locus_tag LOCUS_22510 gene xsc 4593 2839 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061783.1 protein_id gnl|my_center|LOCUS_22510 4736 5533 gene locus_tag LOCUS_22520 4736 5533 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312277.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence197 1972 1226 gene locus_tag LOCUS_22530 1972 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3928 2195 gene locus_tag LOCUS_22540 3928 2195 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640131.1 protein_id gnl|my_center|LOCUS_22540 <5578 3944 gene locus_tag LOCUS_22550 <5578 3944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765563.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence198 <1 734 gene locus_tag LOCUS_22560 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814870.1:helix-turn-helix domain-containing protein 1452 775 gene locus_tag LOCUS_22570 gene dsbA 1452 775 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_22570 2377 1469 gene locus_tag LOCUS_22580 2377 1469 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_22580 3432 2398 gene locus_tag LOCUS_22590 3432 2398 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_22590 3492 5534 gene locus_tag LOCUS_22600 3492 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence199 2949 145 gene locus_tag LOCUS_22610 2949 145 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_22610 5003 2946 gene locus_tag LOCUS_22620 5003 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence200 689 1450 gene locus_tag LOCUS_22630 689 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 2660 1494 gene locus_tag LOCUS_22640 2660 1494 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230064.1 protein_id gnl|my_center|LOCUS_22640 4492 2669 gene locus_tag LOCUS_22650 4492 2669 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence201 736 936 gene locus_tag LOCUS_22660 736 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2365 971 gene locus_tag LOCUS_22670 2365 971 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_22670 4018 2477 gene locus_tag LOCUS_22680 4018 2477 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186395.1 protein_id gnl|my_center|LOCUS_22680 4253 4044 gene locus_tag LOCUS_22690 4253 4044 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194775.1 protein_id gnl|my_center|LOCUS_22690 <5540 4282 gene locus_tag LOCUS_22700 <5540 4282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064062.1:MFS transporter >Feature sequence202 <1 621 gene locus_tag LOCUS_22710 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038915.1:bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA 648 1073 gene locus_tag LOCUS_22720 648 1073 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084037.1 protein_id gnl|my_center|LOCUS_22720 1312 1623 gene locus_tag LOCUS_22730 1312 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 3658 1547 gene locus_tag LOCUS_22740 3658 1547 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460118.1 protein_id gnl|my_center|LOCUS_22740 <5507 3663 gene locus_tag LOCUS_22750 <5507 3663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484633.1:sialidase family protein >Feature sequence203 2508 3110 gene locus_tag LOCUS_22760 2508 3110 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389687.1 protein_id gnl|my_center|LOCUS_22760 3128 4312 gene locus_tag LOCUS_22770 3128 4312 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818204.1 protein_id gnl|my_center|LOCUS_22770 4309 5076 gene locus_tag LOCUS_22780 4309 5076 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537945.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence204 1171 155 gene locus_tag LOCUS_22790 1171 155 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315045.1 protein_id gnl|my_center|LOCUS_22790 2393 1176 gene locus_tag LOCUS_22800 2393 1176 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089071.1 protein_id gnl|my_center|LOCUS_22800 2556 2882 gene locus_tag LOCUS_22810 2556 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 2933 3538 gene locus_tag LOCUS_22820 2933 3538 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404639.1 protein_id gnl|my_center|LOCUS_22820 5487 3574 gene locus_tag LOCUS_22830 5487 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence205 420 650 gene locus_tag LOCUS_22840 420 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 647 1045 gene locus_tag LOCUS_22850 647 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1048 1416 gene locus_tag LOCUS_22860 gene rplN 1048 1416 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486699.1 protein_id gnl|my_center|LOCUS_22860 1420 1737 gene locus_tag LOCUS_22870 gene rplX 1420 1737 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_22870 1730 2419 gene locus_tag LOCUS_22880 gene rplE 1730 2419 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003031123.1 protein_id gnl|my_center|LOCUS_22880 2423 2728 gene locus_tag LOCUS_22890 gene rpsN 2423 2728 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_22890 2739 3134 gene locus_tag LOCUS_22900 gene rpsH 2739 3134 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185153.1 protein_id gnl|my_center|LOCUS_22900 3152 3682 gene locus_tag LOCUS_22910 gene rplF 3152 3682 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_22910 3679 4038 gene locus_tag LOCUS_22920 gene rplR 3679 4038 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005435088.1 protein_id gnl|my_center|LOCUS_22920 4053 4559 gene locus_tag LOCUS_22930 gene rpsE 4053 4559 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703641.1 protein_id gnl|my_center|LOCUS_22930 4565 4753 gene locus_tag LOCUS_22940 gene rpmD 4565 4753 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_22940 4759 5223 gene locus_tag LOCUS_22950 gene rplO 4759 5223 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957463.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence206 2260 422 gene locus_tag LOCUS_22960 2260 422 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_22960 2387 4405 gene locus_tag LOCUS_22970 2387 4405 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198752.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence207 <1 632 gene locus_tag LOCUS_22980 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003019960.1:peptide chain release factor 1 629 1378 gene locus_tag LOCUS_22990 629 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 1375 2370 gene locus_tag LOCUS_23000 1375 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 3642 2347 gene locus_tag LOCUS_23010 3642 2347 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_23010 4605 3655 gene locus_tag LOCUS_23020 4605 3655 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence208 352 1638 gene locus_tag LOCUS_23030 352 1638 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525489.1 protein_id gnl|my_center|LOCUS_23030 1685 1897 gene locus_tag LOCUS_23040 1685 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2000 2527 gene locus_tag LOCUS_23050 2000 2527 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530718.1 protein_id gnl|my_center|LOCUS_23050 3564 2524 gene locus_tag LOCUS_23060 3564 2524 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087456.1 protein_id gnl|my_center|LOCUS_23060 <5434 3578 gene locus_tag LOCUS_23070 <5434 3578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113961.1:bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL >Feature sequence209 518 2293 gene locus_tag LOCUS_23080 518 2293 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_23080 2283 2876 gene locus_tag LOCUS_23090 gene lolB 2283 2876 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096231.1 protein_id gnl|my_center|LOCUS_23090 2873 3742 gene locus_tag LOCUS_23100 gene ispE 2873 3742 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096230.1 protein_id gnl|my_center|LOCUS_23100 3791 3865 gene locus_tag LOCUS_t00310 3791 3865 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3904 4860 gene locus_tag LOCUS_23110 3904 4860 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence210 103 738 gene locus_tag LOCUS_23120 103 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1228 761 gene locus_tag LOCUS_23130 gene dut 1228 761 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 protein_id gnl|my_center|LOCUS_23130 2459 1236 gene locus_tag LOCUS_23140 gene coaBC 2459 1236 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_23140 2621 3295 gene locus_tag LOCUS_23150 gene radC 2621 3295 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_23150 3434 3670 gene locus_tag LOCUS_23160 gene rpmB 3434 3670 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048256.1 protein_id gnl|my_center|LOCUS_23160 3696 3851 gene locus_tag LOCUS_23170 gene rpmG 3696 3851 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 protein_id gnl|my_center|LOCUS_23170 3877 4692 gene locus_tag LOCUS_23180 gene mutM 3877 4692 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763611.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence211 854 3394 gene locus_tag LOCUS_23190 gene bcsA 854 3394 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528862.1 protein_id gnl|my_center|LOCUS_23190 3406 4968 gene locus_tag LOCUS_23200 gene bcsG 3406 4968 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187271.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence212 <1 1084 gene locus_tag LOCUS_23210 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194180.1:adenylosuccinate lyase 1261 1869 gene locus_tag LOCUS_23220 1261 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1913 3043 gene locus_tag LOCUS_23230 gene mnmA 1913 3043 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022640.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence213 1503 931 gene locus_tag LOCUS_23240 gene leuD 1503 931 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_23240 2909 1503 gene locus_tag LOCUS_23250 gene leuC 2909 1503 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_23250 3871 2912 gene locus_tag LOCUS_23260 3871 2912 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_23260 <5293 3887 gene locus_tag LOCUS_23270 <5293 3887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922561.1:2-isopropylmalate synthase >Feature sequence214 <1 860 gene locus_tag LOCUS_23280 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099255.1:DNA helicase II 874 2244 gene locus_tag LOCUS_23290 gene trkA 874 2244 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_23290 2271 3719 gene locus_tag LOCUS_23300 2271 3719 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219613.1 protein_id gnl|my_center|LOCUS_23300 4166 3738 gene locus_tag LOCUS_23310 4166 3738 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_23310 4951 4184 gene locus_tag LOCUS_23320 4951 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence215 134 1009 gene locus_tag LOCUS_23330 gene rlmJ 134 1009 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037826.1 protein_id gnl|my_center|LOCUS_23330 1006 1845 gene locus_tag LOCUS_23340 gene aroE 1006 1845 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103018.1 protein_id gnl|my_center|LOCUS_23340 3199 1847 gene locus_tag LOCUS_23350 gene gorA 3199 1847 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160795.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence216 3131 2166 gene locus_tag LOCUS_23360 3131 2166 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417875.1 protein_id gnl|my_center|LOCUS_23360 3721 3218 gene locus_tag LOCUS_23370 3721 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 <5223 3714 gene locus_tag LOCUS_23380 <5223 3714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202495.1:sarcosine oxidase subunit alpha family protein >Feature sequence217 1713 418 gene locus_tag LOCUS_23390 gene oxlT 1713 418 CDS product oxalate/formate MFS antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085933.1 protein_id gnl|my_center|LOCUS_23390 2084 2797 gene locus_tag LOCUS_23400 2084 2797 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_23400 3765 2776 gene locus_tag LOCUS_23410 3765 2776 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_23410 3875 4141 gene locus_tag LOCUS_23420 3875 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 4253 5176 gene locus_tag LOCUS_23430 4253 5176 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189376240.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence218 2495 909 gene locus_tag LOCUS_23440 2495 909 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037984.1 protein_id gnl|my_center|LOCUS_23440 2958 2512 gene locus_tag LOCUS_23450 gene rimI 2958 2512 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_23450 3754 2993 gene locus_tag LOCUS_23460 3754 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 4545 3757 gene locus_tag LOCUS_23470 gene pssA 4545 3757 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence219 1358 363 gene locus_tag LOCUS_23480 gene ilvC 1358 363 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038422.1 protein_id gnl|my_center|LOCUS_23480 1691 3394 gene locus_tag LOCUS_23490 gene ilvD 1691 3394 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_23490 3617 4246 gene locus_tag LOCUS_23500 3617 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 4296 5045 gene locus_tag LOCUS_23510 4296 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence220 80 862 gene locus_tag LOCUS_23520 80 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 898 2277 gene locus_tag LOCUS_23530 898 2277 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 protein_id gnl|my_center|LOCUS_23530 2286 3452 gene locus_tag LOCUS_23540 2286 3452 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_23540 4002 3460 gene locus_tag LOCUS_23550 4002 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence221 2400 1558 gene locus_tag LOCUS_23560 gene pyrF 2400 1558 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_23560 4340 2397 gene locus_tag LOCUS_23570 gene mnmG 4340 2397 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_23570 4782 4393 gene locus_tag LOCUS_23580 4782 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence222 <1 1931 gene locus_tag LOCUS_23590 <1 1931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404926.1:T9SS type A sorting domain-containing protein 2596 1928 gene locus_tag LOCUS_23600 2596 1928 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_23600 2729 3310 gene locus_tag LOCUS_23610 2729 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 3397 4362 gene locus_tag LOCUS_23620 3397 4362 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 protein_id gnl|my_center|LOCUS_23620 4383 4862 gene locus_tag LOCUS_23630 4383 4862 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109429.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence223 380 1507 gene locus_tag LOCUS_23640 gene spuE 380 1507 CDS product spermidine-binding protein SpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084301.1 protein_id gnl|my_center|LOCUS_23640 1509 3011 gene locus_tag LOCUS_23650 1509 3011 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538734.1 protein_id gnl|my_center|LOCUS_23650 3016 4077 gene locus_tag LOCUS_23660 gene glcE 3016 4077 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence224 679 1029 gene locus_tag LOCUS_23670 679 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1122 1910 gene locus_tag LOCUS_23680 1122 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence225 <1 518 gene locus_tag LOCUS_23690 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225665804.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 533 1651 gene locus_tag LOCUS_23700 gene tgt 533 1651 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 protein_id gnl|my_center|LOCUS_23700 1687 2010 gene locus_tag LOCUS_23710 gene yajC 1687 2010 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_23710 2015 3883 gene locus_tag LOCUS_23720 gene secD 2015 3883 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262437.1 protein_id gnl|my_center|LOCUS_23720 3894 4829 gene locus_tag LOCUS_23730 gene secF 3894 4829 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772700.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence226 1439 2542 gene locus_tag LOCUS_23740 gene lptF 1439 2542 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 protein_id gnl|my_center|LOCUS_23740 2539 3606 gene locus_tag LOCUS_23750 gene lptG 2539 3606 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212823.1 protein_id gnl|my_center|LOCUS_23750 4038 3628 gene locus_tag LOCUS_23760 4038 3628 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071172.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence227 152 991 gene locus_tag LOCUS_23770 gene dapB 152 991 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_23770 1180 2367 gene locus_tag LOCUS_23780 gene carA 1180 2367 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence228 29 718 gene locus_tag LOCUS_23790 gene trmB 29 718 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786911.1 protein_id gnl|my_center|LOCUS_23790 1369 737 gene locus_tag LOCUS_23800 1369 737 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_23800 1495 1812 gene locus_tag LOCUS_23810 1495 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2215 1826 gene locus_tag LOCUS_23820 2215 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3483 2212 gene locus_tag LOCUS_23830 gene ampG 3483 2212 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223277.1 protein_id gnl|my_center|LOCUS_23830 4247 3480 gene locus_tag LOCUS_23840 4247 3480 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence229 2123 1080 gene locus_tag LOCUS_23850 2123 1080 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083827.1 protein_id gnl|my_center|LOCUS_23850 2886 2152 gene locus_tag LOCUS_23860 2886 2152 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_23860 3502 3927 gene locus_tag LOCUS_23870 3502 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 3958 4536 gene locus_tag LOCUS_23880 3958 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence230 239 979 gene locus_tag LOCUS_23890 239 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1032 1355 gene locus_tag LOCUS_23900 1032 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1359 1841 gene locus_tag LOCUS_23910 1359 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 3612 1855 gene locus_tag LOCUS_23920 3612 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2587 2665 gene locus_tag LOCUS_t00320 2587 2665 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <4780 3845 gene locus_tag LOCUS_23930 <4780 3845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707806.1:HDOD domain-containing protein >Feature sequence231 <1 569 gene locus_tag LOCUS_23940 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039192.1:lipocalin family protein 603 1169 gene locus_tag LOCUS_23950 603 1169 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 protein_id gnl|my_center|LOCUS_23950 1178 1927 gene locus_tag LOCUS_23960 1178 1927 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275404.1 protein_id gnl|my_center|LOCUS_23960 2007 2951 gene locus_tag LOCUS_23970 2007 2951 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_23970 2951 4264 gene locus_tag LOCUS_23980 2951 4264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 protein_id gnl|my_center|LOCUS_23980 4261 4692 gene locus_tag LOCUS_23990 4261 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23990 >Feature sequence232 1620 1024 gene locus_tag LOCUS_24000 1620 1024 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_24000 1653 2576 gene locus_tag LOCUS_24010 1653 2576 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 protein_id gnl|my_center|LOCUS_24010 2625 4403 gene locus_tag LOCUS_24020 2625 4403 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence233 <1 1147 gene locus_tag LOCUS_24030 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141370.1:Fe-S cluster assembly protein SufB 1149 1913 gene locus_tag LOCUS_24040 gene sufC 1149 1913 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_24040 1923 3233 gene locus_tag LOCUS_24050 gene sufD 1923 3233 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_24050 3233 4495 gene locus_tag LOCUS_24060 3233 4495 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence234 <1 1262 gene locus_tag LOCUS_24070 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000019075.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE 1337 3946 gene locus_tag LOCUS_24080 1337 3946 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941614.1 protein_id gnl|my_center|LOCUS_24080 4604 3990 gene locus_tag LOCUS_24090 4604 3990 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence235 1447 176 gene locus_tag LOCUS_24100 gene folC 1447 176 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_24100 2354 1491 gene locus_tag LOCUS_24110 gene accD 2354 1491 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 protein_id gnl|my_center|LOCUS_24110 3156 2362 gene locus_tag LOCUS_24120 gene truA 3156 2362 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 protein_id gnl|my_center|LOCUS_24120 <4683 3156 gene locus_tag LOCUS_24130 <4683 3156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104738.1:FimV/HubP family polar landmark protein >Feature sequence236 <1 1049 gene locus_tag LOCUS_24140 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042440436.1:ATP-dependent helicase HrpB 1102 1728 gene locus_tag LOCUS_24150 1102 1728 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_24150 2017 1793 gene locus_tag LOCUS_24160 2017 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2759 2181 gene locus_tag LOCUS_24170 2759 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2758 3354 gene locus_tag LOCUS_24180 2758 3354 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706006.1 protein_id gnl|my_center|LOCUS_24180 3351 4034 gene locus_tag LOCUS_24190 3351 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence237 144 3113 gene locus_tag LOCUS_24200 144 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 4456 3074 gene locus_tag LOCUS_24210 4456 3074 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061359.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence238 <1 1053 gene locus_tag LOCUS_24220 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089417.1:alpha/beta fold hydrolase 2238 1060 gene locus_tag LOCUS_24230 2238 1060 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 protein_id gnl|my_center|LOCUS_24230 4100 2265 gene locus_tag LOCUS_24240 4100 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence239 1094 63 gene locus_tag LOCUS_24250 gene purM 1094 63 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262407.1 protein_id gnl|my_center|LOCUS_24250 1267 2172 gene locus_tag LOCUS_24260 1267 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2208 2756 gene locus_tag LOCUS_24270 2208 2756 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_24270 2762 3460 gene locus_tag LOCUS_24280 2762 3460 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100388.1 protein_id gnl|my_center|LOCUS_24280 4046 3423 gene locus_tag LOCUS_24290 gene wrbA 4046 3423 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_24290 4100 4399 gene locus_tag LOCUS_24300 4100 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence240 <1 1441 gene locus_tag LOCUS_24310 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266458.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase 1474 1671 gene locus_tag LOCUS_24320 1474 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence241 1951 2244 gene locus_tag LOCUS_24330 gene groES 1951 2244 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_24330 2259 3893 gene locus_tag LOCUS_24340 gene groL 2259 3893 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_24340 >Feature sequence242 313 1455 gene locus_tag LOCUS_24350 gene lapB 313 1455 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930104.1 protein_id gnl|my_center|LOCUS_24350 1469 2416 gene locus_tag LOCUS_24360 gene galU 1469 2416 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525207.1 protein_id gnl|my_center|LOCUS_24360 2658 2927 gene locus_tag LOCUS_24370 2658 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 4009 2951 gene locus_tag LOCUS_24380 4009 2951 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence243 1450 131 gene locus_tag LOCUS_24390 gene dnaA 1450 131 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_24390 1620 1820 gene locus_tag LOCUS_24400 1620 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 1976 2227 gene locus_tag LOCUS_24410 1976 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2227 2472 gene locus_tag LOCUS_24420 gene yidD 2227 2472 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_24420 2447 4216 gene locus_tag LOCUS_24430 gene yidC 2447 4216 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105595.1 protein_id gnl|my_center|LOCUS_24430 >Feature sequence244 1518 499 gene locus_tag LOCUS_24440 1518 499 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_24440 2192 1524 gene locus_tag LOCUS_24450 2192 1524 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_24450 2639 2202 gene locus_tag LOCUS_24460 2639 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 <4464 2694 gene locus_tag LOCUS_24470 <4464 2694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947476.1:ATP-dependent chaperone ClpB >Feature sequence245 <1 1301 gene locus_tag LOCUS_24480 <1 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035873.1:electron transfer flavoprotein-ubiquinone oxidoreductase 1327 3282 gene locus_tag LOCUS_24490 1327 3282 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_24490 3290 4393 gene locus_tag LOCUS_24500 gene zapE 3290 4393 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707598.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence246 1253 309 gene locus_tag LOCUS_24510 1253 309 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_24510 2209 1250 gene locus_tag LOCUS_24520 2209 1250 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 protein_id gnl|my_center|LOCUS_24520 2886 2218 gene locus_tag LOCUS_24530 2886 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 4342 2948 gene locus_tag LOCUS_24540 4342 2948 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534176.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence247 270 1004 gene locus_tag LOCUS_24550 270 1004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_24550 1008 2903 gene locus_tag LOCUS_24560 1008 2903 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_24560 2900 4021 gene locus_tag LOCUS_24570 2900 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 4243 4043 gene locus_tag LOCUS_24580 4243 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence248 1656 847 gene locus_tag LOCUS_24590 gene pstB 1656 847 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083914.1 protein_id gnl|my_center|LOCUS_24590 2507 1656 gene locus_tag LOCUS_24600 gene pstA 2507 1656 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_24600 3472 2504 gene locus_tag LOCUS_24610 gene pstC 3472 2504 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036711.1 protein_id gnl|my_center|LOCUS_24610 <4374 3488 gene locus_tag LOCUS_24620 <4374 3488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965256.1:phosphate ABC transporter substrate-binding protein PstS >Feature sequence249 2 538 gene locus_tag LOCUS_24630 2 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 535 1212 gene locus_tag LOCUS_24640 535 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2333 1218 gene locus_tag LOCUS_24650 2333 1218 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_24650 3841 2357 gene locus_tag LOCUS_24660 gene ntrC 3841 2357 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413458.1 protein_id gnl|my_center|LOCUS_24660 >Feature sequence250 1668 337 gene locus_tag LOCUS_24670 1668 337 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088779.1 protein_id gnl|my_center|LOCUS_24670 2822 1665 gene locus_tag LOCUS_24680 2822 1665 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_24680 <4327 2819 gene locus_tag LOCUS_24690 <4327 2819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530454.1:NAD(P)-binding protein >Feature sequence251 637 1995 gene locus_tag LOCUS_24700 637 1995 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_24700 3313 1967 gene locus_tag LOCUS_24710 gene pmbA 3313 1967 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_24710 <4257 3422 gene locus_tag LOCUS_24720 <4257 3422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000561483.1:group II intron reverse transcriptase/maturase >Feature sequence252 <1 858 gene locus_tag LOCUS_24730 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975818.1:FAD-dependent oxidoreductase 851 1054 gene locus_tag LOCUS_24740 851 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1051 1431 gene locus_tag LOCUS_24750 1051 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1826 1413 gene locus_tag LOCUS_24760 1826 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1926 3023 gene locus_tag LOCUS_24770 1926 3023 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_24770 3568 3020 gene locus_tag LOCUS_24780 3568 3020 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833874.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence253 1639 899 gene locus_tag LOCUS_24790 1639 899 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 protein_id gnl|my_center|LOCUS_24790 2411 1680 gene locus_tag LOCUS_24800 gene fliA 2411 1680 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_24800 3292 2408 gene locus_tag LOCUS_24810 3292 2408 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010374294.1 protein_id gnl|my_center|LOCUS_24810 4229 3279 gene locus_tag LOCUS_24820 4229 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence254 1555 1968 gene locus_tag LOCUS_24830 1555 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2188 2484 gene locus_tag LOCUS_24840 2188 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2495 2803 gene locus_tag LOCUS_24850 2495 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 3601 2816 gene locus_tag LOCUS_24860 3601 2816 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727762.1 protein_id gnl|my_center|LOCUS_24860 <4205 3618 gene locus_tag LOCUS_24870 <4205 3618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876185.1:amino acid permease >Feature sequence255 808 884 gene locus_tag LOCUS_t00330 808 884 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3448 944 gene locus_tag LOCUS_24880 3448 944 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920963.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence256 359 2506 gene locus_tag LOCUS_24890 359 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence257 3472 1013 gene locus_tag LOCUS_24900 3472 1013 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 protein_id gnl|my_center|LOCUS_24900 <4107 3583 gene locus_tag LOCUS_24910 <4107 3583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529660.1:sarcosine oxidase subunit gamma >Feature sequence258 <1 1931 gene locus_tag LOCUS_24920 <1 1931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640291.1:CocE/NonD family hydrolase >Feature sequence259 1246 743 gene locus_tag LOCUS_24930 1246 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967700.1 protein_id gnl|my_center|LOCUS_24930 3199 1334 gene locus_tag LOCUS_24940 3199 1334 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357009.1 protein_id gnl|my_center|LOCUS_24940 3502 3224 gene locus_tag LOCUS_24950 3502 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 >Feature sequence260 2365 1064 gene locus_tag LOCUS_24960 2365 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2660 3976 gene locus_tag LOCUS_24970 2660 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence261 121 1512 gene locus_tag LOCUS_24980 121 1512 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114855.1 protein_id gnl|my_center|LOCUS_24980 1509 2681 gene locus_tag LOCUS_24990 1509 2681 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_24990 3657 2671 gene locus_tag LOCUS_25000 3657 2671 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162996.1 protein_id gnl|my_center|LOCUS_25000 >Feature sequence262 2410 479 gene locus_tag LOCUS_25010 2410 479 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_25010 2450 2722 gene locus_tag LOCUS_25020 2450 2722 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009941095.1 protein_id gnl|my_center|LOCUS_25020 3389 2727 gene locus_tag LOCUS_25030 3389 2727 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_25030 3559 3864 gene locus_tag LOCUS_25040 3559 3864 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921019.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence263 1634 615 gene locus_tag LOCUS_25050 gene rluD 1634 615 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 protein_id gnl|my_center|LOCUS_25050 1653 2453 gene locus_tag LOCUS_25060 1653 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 <3975 2458 gene locus_tag LOCUS_25070 <3975 2458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526341.1:NAD+ synthase >Feature sequence264 1143 2315 gene locus_tag LOCUS_25080 1143 2315 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975571.1 protein_id gnl|my_center|LOCUS_25080 2312 3049 gene locus_tag LOCUS_25090 2312 3049 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_25090 3162 3734 gene locus_tag LOCUS_25100 3162 3734 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence265 484 104 gene locus_tag LOCUS_25110 484 104 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730827.1 protein_id gnl|my_center|LOCUS_25110 1613 588 gene locus_tag LOCUS_25120 1613 588 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086130.1 protein_id gnl|my_center|LOCUS_25120 2446 1601 gene locus_tag LOCUS_25130 gene rhlP 2446 1601 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_25130 2610 2948 gene locus_tag LOCUS_25140 2610 2948 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888481.1 protein_id gnl|my_center|LOCUS_25140 2941 3624 gene locus_tag LOCUS_25150 2941 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence266 548 66 gene locus_tag LOCUS_25160 gene coaD 548 66 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_25160 1178 549 gene locus_tag LOCUS_25170 gene rsmD 1178 549 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704347.1 protein_id gnl|my_center|LOCUS_25170 1385 3613 gene locus_tag LOCUS_25180 1385 3613 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 protein_id gnl|my_center|LOCUS_25180 1531 1442 gene locus_tag LOCUS_t00340 1531 1442 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence267 1214 51 gene locus_tag LOCUS_25190 1214 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461741.1 protein_id gnl|my_center|LOCUS_25190 1339 2742 gene locus_tag LOCUS_25200 1339 2742 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112664.1 protein_id gnl|my_center|LOCUS_25200 <3755 2739 gene locus_tag LOCUS_25210 <3755 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421524.1:amidase >Feature sequence268 897 2333 gene locus_tag LOCUS_25220 gene mdtD 897 2333 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280821.1 protein_id gnl|my_center|LOCUS_25220 2772 3038 gene locus_tag LOCUS_25230 2772 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence269 <1 1978 gene locus_tag LOCUS_25240 <1 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259000.1:aconitate hydratase AcnA 1991 2686 gene locus_tag LOCUS_25250 1991 2686 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039537.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence270 <1 978 gene locus_tag LOCUS_25260 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003110324.1:tRNA epoxyqueuosine(34) reductase QueG 1826 975 gene locus_tag LOCUS_25270 gene panC 1826 975 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246105.1 protein_id gnl|my_center|LOCUS_25270 2691 1861 gene locus_tag LOCUS_25280 gene panB 2691 1861 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_25280 3363 2707 gene locus_tag LOCUS_25290 3363 2707 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence271 1026 268 gene locus_tag LOCUS_25300 gene ddaH 1026 268 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_25300 2005 1061 gene locus_tag LOCUS_25310 2005 1061 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665750.1 protein_id gnl|my_center|LOCUS_25310 3104 2067 gene locus_tag LOCUS_25320 3104 2067 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_25320 3550 3128 gene locus_tag LOCUS_25330 3550 3128 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729322.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence272 <1 1396 gene locus_tag LOCUS_25340 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225318.1:2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase 1487 2944 gene locus_tag LOCUS_25350 gene lpdA 1487 2944 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267378.1 protein_id gnl|my_center|LOCUS_25350 <3662 2986 gene locus_tag LOCUS_25360 <3662 2986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003086042.1:GTP diphosphokinase >Feature sequence273 383 934 gene locus_tag LOCUS_25370 gene sufT 383 934 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_25370 979 1245 gene locus_tag LOCUS_25380 979 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 1253 1765 gene locus_tag LOCUS_25390 1253 1765 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_25390 3142 1775 gene locus_tag LOCUS_25400 3142 1775 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence274 2485 1376 gene locus_tag LOCUS_25410 2485 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3231 2482 gene locus_tag LOCUS_25420 3231 2482 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence275 450 136 gene locus_tag LOCUS_25430 450 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2295 607 gene locus_tag LOCUS_25440 gene sulP 2295 607 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_25440 3404 2298 gene locus_tag LOCUS_25450 3404 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence276 14 499 gene locus_tag LOCUS_25460 14 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence277 301 690 gene locus_tag LOCUS_25470 gene apaG 301 690 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316251.1 protein_id gnl|my_center|LOCUS_25470 687 1505 gene locus_tag LOCUS_25480 687 1505 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929738.1 protein_id gnl|my_center|LOCUS_25480 1979 1515 gene locus_tag LOCUS_25490 1979 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2036 2551 gene locus_tag LOCUS_25500 2036 2551 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_25500 2548 3363 gene locus_tag LOCUS_25510 2548 3363 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence278 1322 741 gene locus_tag LOCUS_25520 1322 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25520 2236 1319 gene locus_tag LOCUS_25530 2236 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 <3336 2245 gene locus_tag LOCUS_25540 <3336 2245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114676.1:chromosome segregation protein SMC >Feature sequence279 <1 1517 gene locus_tag LOCUS_25550 <1 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918336.1:phosphoenolpyruvate--protein phosphotransferase 1514 3277 gene locus_tag LOCUS_25560 gene nagE 1514 3277 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918426.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence280 <1 1160 gene locus_tag LOCUS_25570 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389058.1:imidazolonepropionase 1139 2677 gene locus_tag LOCUS_25580 gene hutH 1139 2677 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192520.1 protein_id gnl|my_center|LOCUS_25580 2929 2681 gene locus_tag LOCUS_25590 2929 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence281 960 22 gene locus_tag LOCUS_25600 960 22 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889322.1 protein_id gnl|my_center|LOCUS_25600 1065 1829 gene locus_tag LOCUS_25610 1065 1829 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_25610 2986 1853 gene locus_tag LOCUS_25620 gene moeB 2986 1853 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence282 <3261 757 gene locus_tag LOCUS_25630 <3261 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase >Feature sequence283 1223 480 gene locus_tag LOCUS_25640 gene rpe 1223 480 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237199.1 protein_id gnl|my_center|LOCUS_25640 2138 1248 gene locus_tag LOCUS_25650 2138 1248 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_25650 2161 2982 gene locus_tag LOCUS_25660 gene djlA 2161 2982 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence284 >Feature sequence285 1708 338 gene locus_tag LOCUS_25670 1708 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2498 1779 gene locus_tag LOCUS_25680 gene bfmR 2498 1779 CDS product two-component system response regulator BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113023.1 protein_id gnl|my_center|LOCUS_25680 3179 2589 gene locus_tag LOCUS_25690 gene miaE 3179 2589 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368536.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence286 754 1821 gene locus_tag LOCUS_25700 754 1821 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037982.1 protein_id gnl|my_center|LOCUS_25700 1818 3023 gene locus_tag LOCUS_25710 1818 3023 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence287 492 1943 gene locus_tag LOCUS_25720 492 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 1940 2785 gene locus_tag LOCUS_25730 1940 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence288 <1 771 gene locus_tag LOCUS_25740 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114954.1:4-hydroxyproline epimerase 768 1430 gene locus_tag LOCUS_25750 768 1430 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967141.1 protein_id gnl|my_center|LOCUS_25750 1561 2148 gene locus_tag LOCUS_25760 1561 2148 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919903.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence289 457 35 gene locus_tag LOCUS_25770 457 35 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089001.1 protein_id gnl|my_center|LOCUS_25770 595 2325 gene locus_tag LOCUS_25780 595 2325 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173645.1 protein_id gnl|my_center|LOCUS_25780 <3096 2322 gene locus_tag LOCUS_25790 <3096 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531858.1:cytochrome c >Feature sequence290 <1 1695 gene locus_tag LOCUS_25800 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707088.1:1-deoxy-D-xylulose-5-phosphate synthase 1751 2593 gene locus_tag LOCUS_25810 gene folE2 1751 2593 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_25810 2691 2948 gene locus_tag LOCUS_25820 2691 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence291 <1 587 gene locus_tag LOCUS_25830 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189804125.1:ketopantoate reductase family protein 2769 595 gene locus_tag LOCUS_25840 2769 595 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994073.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence292 1167 103 gene locus_tag LOCUS_25850 gene plsX 1167 103 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919245.1 protein_id gnl|my_center|LOCUS_25850 1394 1200 gene locus_tag LOCUS_25860 gene rpmF 1394 1200 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_25860 1925 1425 gene locus_tag LOCUS_25870 1925 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 2042 2620 gene locus_tag LOCUS_25880 2042 2620 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821345.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence293 558 31 gene locus_tag LOCUS_25890 558 31 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404543.1 protein_id gnl|my_center|LOCUS_25890 1370 555 gene locus_tag LOCUS_25900 gene proC 1370 555 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_25900 2105 1410 gene locus_tag LOCUS_25910 2105 1410 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence294 2064 955 gene locus_tag LOCUS_25920 2064 955 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_25920 2561 2061 gene locus_tag LOCUS_25930 gene purE 2561 2061 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106314.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence295 <1 1257 gene locus_tag LOCUS_25940 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994023.1:DUF885 family protein 1327 1689 gene locus_tag LOCUS_25950 1327 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 1712 2197 gene locus_tag LOCUS_25960 1712 2197 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528237.1 protein_id gnl|my_center|LOCUS_25960 >Feature sequence296 <1 521 gene locus_tag LOCUS_25970 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197236.1:complex I NDUFA9 subunit family protein 1602 526 gene locus_tag LOCUS_25980 1602 526 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_25980 1601 2833 gene locus_tag LOCUS_25990 1601 2833 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence297 <1 911 gene locus_tag LOCUS_26000 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521939.1:Do family serine endopeptidase note possible pseudo, internal stop codon 1019 1711 gene locus_tag LOCUS_26010 1019 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence298 319 1314 gene locus_tag LOCUS_26020 319 1314 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198247.1 protein_id gnl|my_center|LOCUS_26020 1453 2184 gene locus_tag LOCUS_26030 1453 2184 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975914.1 protein_id gnl|my_center|LOCUS_26030 2202 2801 gene locus_tag LOCUS_26040 2202 2801 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence299 18 1157 gene locus_tag LOCUS_26050 gene rodA 18 1157 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_26050 1434 2360 gene locus_tag LOCUS_26060 gene mltB 1434 2360 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_26060 >Feature sequence300 885 1511 gene locus_tag LOCUS_26070 885 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 2914 1508 gene locus_tag LOCUS_26080 gene cls 2914 1508 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937731.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence301 357 743 gene locus_tag LOCUS_26090 357 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 831 1301 gene locus_tag LOCUS_26100 831 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1431 2228 gene locus_tag LOCUS_26110 1431 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 2266 2838 gene locus_tag LOCUS_26120 2266 2838 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence302 <1 1060 gene locus_tag LOCUS_26130 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035842.1:cystathionine gamma-synthase 1502 1089 gene locus_tag LOCUS_26140 1502 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 <2895 1555 gene locus_tag LOCUS_26150 <2895 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545636.1:alpha-glucan family phosphorylase >Feature sequence303 924 4 gene locus_tag LOCUS_26160 924 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2201 1032 gene locus_tag LOCUS_26170 gene nagA 2201 1032 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918331.1 protein_id gnl|my_center|LOCUS_26170 <2887 2203 gene locus_tag LOCUS_26180 <2887 2203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918332.1:SIS domain-containing protein >Feature sequence304 <1 1342 gene locus_tag LOCUS_26190 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190102.1:EAL domain-containing protein 1495 2619 gene locus_tag LOCUS_26200 1495 2619 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_26200 >Feature sequence305 217 1005 gene locus_tag LOCUS_26210 gene paaG 217 1005 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931073.1 protein_id gnl|my_center|LOCUS_26210 1023 1475 gene locus_tag LOCUS_26220 gene paaI 1023 1475 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence306 <1 1784 gene locus_tag LOCUS_26230 <1 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266976.1:outer membrane protein assembly factor BamA 2003 2566 gene locus_tag LOCUS_26240 2003 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence307 3 2294 gene locus_tag LOCUS_26250 3 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence308 >Feature sequence309 781 272 gene locus_tag LOCUS_26260 781 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 1466 987 gene locus_tag LOCUS_26270 1466 987 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407330.1 protein_id gnl|my_center|LOCUS_26270 1505 2524 gene locus_tag LOCUS_26280 1505 2524 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence310 675 274 gene locus_tag LOCUS_26290 675 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 803 1732 gene locus_tag LOCUS_26300 803 1732 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036310.1 protein_id gnl|my_center|LOCUS_26300 >Feature sequence311 <1 541 gene locus_tag LOCUS_26310 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035896.1:DsbC family protein 916 593 gene locus_tag LOCUS_26320 916 593 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_26320 1562 1008 gene locus_tag LOCUS_26330 1562 1008 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_26330 >Feature sequence312 1453 209 gene locus_tag LOCUS_26340 gene fabF 1453 209 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072710.1 protein_id gnl|my_center|LOCUS_26340 1724 1482 gene locus_tag LOCUS_26350 gene acpP 1724 1482 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_26350 2617 1877 gene locus_tag LOCUS_26360 gene fabG 2617 1877 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence313 147 623 gene locus_tag LOCUS_26370 147 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence314 741 100 gene locus_tag LOCUS_26380 741 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 819 1034 gene locus_tag LOCUS_26390 819 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1056 2030 gene locus_tag LOCUS_26400 1056 2030 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966893.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence315 1152 550 gene locus_tag LOCUS_26410 1152 550 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_26410 2577 1174 gene locus_tag LOCUS_26420 2577 1174 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992377.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence316 <1 716 gene locus_tag LOCUS_26430 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704969.1:ketoacyl-ACP synthase III 1253 957 gene locus_tag LOCUS_26440 1253 957 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_26440 2301 2377 gene locus_tag LOCUS_t00350 2301 2377 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence317 1126 293 gene locus_tag LOCUS_26450 gene dapD 1126 293 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391708.1 protein_id gnl|my_center|LOCUS_26450 <2564 1131 gene locus_tag LOCUS_26460 <2564 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113862.1:[protein-PII] uridylyltransferase >Feature sequence318 576 2051 gene locus_tag LOCUS_26470 576 2051 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence319 <1 1038 gene locus_tag LOCUS_26480 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086679.1:multidrug efflux RND transporter permease subunit 1043 1723 gene locus_tag LOCUS_26490 1043 1723 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_26490 >Feature sequence320 <1 562 gene locus_tag LOCUS_26500 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679544.1:integron integrase 1232 516 gene locus_tag LOCUS_26510 1232 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2221 1274 gene locus_tag LOCUS_26520 2221 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence321 >Feature sequence322 1174 29 gene locus_tag LOCUS_26530 1174 29 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_26530 1965 1183 gene locus_tag LOCUS_26540 1965 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 <2488 1977 gene locus_tag LOCUS_26550 <2488 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974204.1:glucan 1,4-alpha-glucosidase >Feature sequence323 <2485 583 gene locus_tag LOCUS_26560 <2485 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119442.1:EAL domain-containing protein >Feature sequence324 1675 410 gene locus_tag LOCUS_26570 1675 410 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_26570 >Feature sequence325 1437 355 gene locus_tag LOCUS_26580 1437 355 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387785.1 protein_id gnl|my_center|LOCUS_26580 1955 1536 gene locus_tag LOCUS_26590 1955 1536 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence326 1029 391 gene locus_tag LOCUS_26600 gene coq7 1029 391 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931327.1 protein_id gnl|my_center|LOCUS_26600 1224 1655 gene locus_tag LOCUS_26610 gene rplM 1224 1655 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_26610 1662 2063 gene locus_tag LOCUS_26620 gene rpsI 1662 2063 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_26620 2109 2182 gene locus_tag LOCUS_t00360 2109 2182 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence327 <1 1021 gene locus_tag LOCUS_26630 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943867.1:glycoside hydrolase family 57 protein >Feature sequence328 1252 758 gene locus_tag LOCUS_26640 1252 758 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640520.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence329 1794 691 gene locus_tag LOCUS_26650 gene aroC 1794 691 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087653.1 protein_id gnl|my_center|LOCUS_26650 <2329 1799 gene locus_tag LOCUS_26660 <2329 1799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948010.1:50S ribosomal protein L3 N(5)-glutamine methyltransferase >Feature sequence330 >Feature sequence331 139 318 gene locus_tag LOCUS_26670 139 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26670 978 319 gene locus_tag LOCUS_26680 gene rpiA 978 319 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038367.1 protein_id gnl|my_center|LOCUS_26680 1772 1290 gene locus_tag LOCUS_26690 1772 1290 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_26690 <2301 1757 gene locus_tag LOCUS_26700 <2301 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096321.1:5-formyltetrahydrofolate cyclo-ligase >Feature sequence332 <1 1250 gene locus_tag LOCUS_26710 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004539575.1:glycine C-acetyltransferase >Feature sequence333 <1 734 gene locus_tag LOCUS_26720 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084725968.1:sigma-54 dependent transcriptional regulator 2016 790 gene locus_tag LOCUS_26730 2016 790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence334 <2261 1556 gene locus_tag LOCUS_26740 <2261 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930274.1:ZIP family metal transporter >Feature sequence335 361 1527 gene locus_tag LOCUS_26750 361 1527 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958109.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence336 1693 689 gene locus_tag LOCUS_26760 1693 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence337 >Feature sequence338 1209 127 gene locus_tag LOCUS_26770 gene rnd 1209 127 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_26770 1279 1797 gene locus_tag LOCUS_26780 1279 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 >Feature sequence339 <1 616 gene locus_tag LOCUS_26790 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339149.1:ATP-binding protein <2096 591 gene locus_tag LOCUS_26800 <2096 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197480502.1:S10 family peptidase >Feature sequence340 1538 348 gene locus_tag LOCUS_26810 gene lpxB 1538 348 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741216.1 protein_id gnl|my_center|LOCUS_26810 <2095 1535 gene locus_tag LOCUS_26820 <2095 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071796.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase >Feature sequence341 338 829 gene locus_tag LOCUS_26830 gene ppiA 338 829 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114812.1 protein_id gnl|my_center|LOCUS_26830 845 1570 gene locus_tag LOCUS_26840 gene mtgA 845 1570 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence342 10 86 gene locus_tag LOCUS_t00370 10 86 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 280 768 gene locus_tag LOCUS_26850 280 768 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388616.1 protein_id gnl|my_center|LOCUS_26850 804 2042 gene locus_tag LOCUS_26860 804 2042 CDS product EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205096.1 protein_id gnl|my_center|LOCUS_26860 902 806 gene locus_tag LOCUS_t00380 902 806 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence343 1540 704 gene locus_tag LOCUS_26870 1540 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence344 >Feature sequence345 173 1315 gene locus_tag LOCUS_26880 173 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26880 <1993 1350 gene locus_tag LOCUS_26890 <1993 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115817.1:glycosyltransferase NdvB >Feature sequence346 1333 452 gene locus_tag LOCUS_26900 gene iolE 1333 452 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_26900 <1984 1337 gene locus_tag LOCUS_26910 <1984 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528372.1:3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) >Feature sequence347 658 101 gene locus_tag LOCUS_26920 658 101 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence348 352 1536 gene locus_tag LOCUS_26930 352 1536 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence349 <1955 1195 gene locus_tag LOCUS_26940 <1955 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868664.1:glycerate kinase >Feature sequence350 <1947 669 gene locus_tag LOCUS_26950 <1947 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967420.1:NirA family protein >Feature sequence351 >Feature sequence352 883 476 gene locus_tag LOCUS_26960 883 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1467 913 gene locus_tag LOCUS_26970 1467 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence353 1416 1036 gene locus_tag LOCUS_26980 1416 1036 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence354 38 1762 gene locus_tag LOCUS_26990 38 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence355 >Feature sequence356 536 165 gene locus_tag LOCUS_27000 536 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1492 704 gene locus_tag LOCUS_27010 1492 704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387888.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence357 <1 557 gene locus_tag LOCUS_27020 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195118.1:cell division protein ZapD 574 789 gene locus_tag LOCUS_27030 574 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 786 1541 gene locus_tag LOCUS_27040 786 1541 CDS product fimb protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224433.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence358 >Feature sequence359 1021 20 gene locus_tag LOCUS_27050 1021 20 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence360 512 1162 gene locus_tag LOCUS_27060 512 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence361 >Feature sequence362 514 1053 gene locus_tag LOCUS_27070 514 1053 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_27070 >Feature sequence363 797 468 gene locus_tag LOCUS_27080 797 468 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554203.1 protein_id gnl|my_center|LOCUS_27080 1179 799 gene locus_tag LOCUS_27090 gene crcB 1179 799 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_27090 >Feature sequence364 324 1229 gene locus_tag LOCUS_27100 gene xerD 324 1229 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence365 >Feature sequence366 1501 1115 gene locus_tag LOCUS_27110 1501 1115 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209089.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence367 1153 656 gene locus_tag LOCUS_27120 1153 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence368 >Feature sequence369 <1518 771 gene locus_tag LOCUS_27130 <1518 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191984.1:lipoprotein-releasing ABC transporter permease subunit