>Feature sequence001 895 2823 gene locus_tag LOCUS_00010 895 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2997 4181 gene locus_tag LOCUS_00020 2997 4181 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_00020 5305 4187 gene locus_tag LOCUS_00030 5305 4187 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095352.1 protein_id gnl|my_center|LOCUS_00030 7631 5298 gene locus_tag LOCUS_00040 7631 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8258 7635 gene locus_tag LOCUS_00050 8258 7635 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_00050 8995 8261 gene locus_tag LOCUS_00060 8995 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9075 10976 gene locus_tag LOCUS_00070 gene selB 9075 10976 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_00070 11087 13492 gene locus_tag LOCUS_00080 11087 13492 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243243.1 protein_id gnl|my_center|LOCUS_00080 14030 13569 gene locus_tag LOCUS_00090 14030 13569 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061250122.1 protein_id gnl|my_center|LOCUS_00090 14606 14196 gene locus_tag LOCUS_00100 14606 14196 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093742.1 protein_id gnl|my_center|LOCUS_00100 15186 14752 gene locus_tag LOCUS_00110 15186 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15581 15204 gene locus_tag LOCUS_00120 15581 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16141 15587 gene locus_tag LOCUS_00130 gene rpoE 16141 15587 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_00130 18242 16170 gene locus_tag LOCUS_00140 18242 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 18421 18239 gene locus_tag LOCUS_00150 18421 18239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18743 21568 gene locus_tag LOCUS_00160 18743 21568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22062 21640 gene locus_tag LOCUS_00170 22062 21640 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_00170 22475 22059 gene locus_tag LOCUS_00180 22475 22059 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_00180 23246 22500 gene locus_tag LOCUS_00190 23246 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24211 23279 gene locus_tag LOCUS_00200 24211 23279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24978 24220 gene locus_tag LOCUS_00210 24978 24220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 26219 24987 gene locus_tag LOCUS_00220 26219 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 26515 26261 gene locus_tag LOCUS_00230 26515 26261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27218 26658 gene locus_tag LOCUS_00240 27218 26658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30479 27237 gene locus_tag LOCUS_00250 30479 27237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33618 30505 gene locus_tag LOCUS_00260 33618 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 36400 33629 gene locus_tag LOCUS_00270 36400 33629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 39112 36434 gene locus_tag LOCUS_00280 39112 36434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 41386 39248 gene locus_tag LOCUS_00290 41386 39248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 43356 41455 gene locus_tag LOCUS_00300 43356 41455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 45606 43522 gene locus_tag LOCUS_00310 45606 43522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 45751 47712 gene locus_tag LOCUS_00320 45751 47712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 48444 47719 gene locus_tag LOCUS_00330 48444 47719 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_00330 48571 50565 gene locus_tag LOCUS_00340 48571 50565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 50577 52916 gene locus_tag LOCUS_00350 50577 52916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 52936 54348 gene locus_tag LOCUS_00360 52936 54348 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804149.1 protein_id gnl|my_center|LOCUS_00360 54425 56257 gene locus_tag LOCUS_00370 54425 56257 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_00370 57293 56283 gene locus_tag LOCUS_00380 57293 56283 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_00380 58702 57329 gene locus_tag LOCUS_00390 58702 57329 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582573.1 protein_id gnl|my_center|LOCUS_00390 59520 58735 gene locus_tag LOCUS_00400 59520 58735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 59780 61198 gene locus_tag LOCUS_00410 59780 61198 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_00410 62296 61256 gene locus_tag LOCUS_00420 62296 61256 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_00420 63168 62293 gene locus_tag LOCUS_00430 63168 62293 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_00430 64229 63159 gene locus_tag LOCUS_00440 64229 63159 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013798.1 protein_id gnl|my_center|LOCUS_00440 65064 64231 gene locus_tag LOCUS_00450 65064 64231 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878779.1 protein_id gnl|my_center|LOCUS_00450 65320 65592 gene locus_tag LOCUS_00460 65320 65592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 65589 66035 gene locus_tag LOCUS_00470 65589 66035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 66856 66047 gene locus_tag LOCUS_00480 66856 66047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 68155 66857 gene locus_tag LOCUS_00490 68155 66857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 68217 69059 gene locus_tag LOCUS_00500 68217 69059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 69260 69514 gene locus_tag LOCUS_00510 69260 69514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 69962 69765 gene locus_tag LOCUS_00520 69962 69765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 70460 70002 gene locus_tag LOCUS_00530 70460 70002 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583901.1 protein_id gnl|my_center|LOCUS_00530 70891 70553 gene locus_tag LOCUS_00540 70891 70553 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_00540 71377 70925 gene locus_tag LOCUS_00550 71377 70925 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_00550 71571 71419 gene locus_tag LOCUS_00560 71571 71419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 72805 71576 gene locus_tag LOCUS_00570 72805 71576 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_00570 74094 72802 gene locus_tag LOCUS_00580 gene sufD 74094 72802 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_00580 74840 74091 gene locus_tag LOCUS_00590 gene sufC 74840 74091 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_00590 76392 74929 gene locus_tag LOCUS_00600 gene sufB 76392 74929 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_00600 77372 76473 gene locus_tag LOCUS_00610 77372 76473 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_00610 78363 77374 gene locus_tag LOCUS_00620 78363 77374 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_00620 79895 78453 gene locus_tag LOCUS_00630 79895 78453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 81245 79986 gene locus_tag LOCUS_00640 81245 79986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_00640 82095 81250 gene locus_tag LOCUS_00650 82095 81250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 85412 82092 gene locus_tag LOCUS_00660 85412 82092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839243.1 protein_id gnl|my_center|LOCUS_00660 85629 87773 gene locus_tag LOCUS_00670 85629 87773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 89741 87780 gene locus_tag LOCUS_00680 89741 87780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 89966 92944 gene locus_tag LOCUS_00690 89966 92944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 95192 92949 gene locus_tag LOCUS_00700 95192 92949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 97922 95202 gene locus_tag LOCUS_00710 97922 95202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 98937 98035 gene locus_tag LOCUS_00720 98937 98035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 100869 99070 gene locus_tag LOCUS_00730 100869 99070 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_00730 100952 102691 gene locus_tag LOCUS_00740 100952 102691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 102748 106020 gene locus_tag LOCUS_00750 102748 106020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 106044 107615 gene locus_tag LOCUS_00760 106044 107615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 107701 110634 gene locus_tag LOCUS_00770 107701 110634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 110615 112360 gene locus_tag LOCUS_00780 110615 112360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 114007 112367 gene locus_tag LOCUS_00790 114007 112367 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_00790 114773 113997 gene locus_tag LOCUS_00800 114773 113997 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_00800 116465 114792 gene locus_tag LOCUS_00810 116465 114792 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_00810 117644 116691 gene locus_tag LOCUS_00820 117644 116691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 117772 118998 gene locus_tag LOCUS_00830 117772 118998 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_00830 119126 119335 gene locus_tag LOCUS_00840 119126 119335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 119332 120318 gene locus_tag LOCUS_00850 gene nadA 119332 120318 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_00850 120394 121446 gene locus_tag LOCUS_00860 120394 121446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 122025 121747 gene locus_tag LOCUS_00870 122025 121747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 123288 122245 gene locus_tag LOCUS_00880 123288 122245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 124637 123324 gene locus_tag LOCUS_00890 gene xylA 124637 123324 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_00890 125525 124752 gene locus_tag LOCUS_00900 125525 124752 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_00900 126904 125522 gene locus_tag LOCUS_00910 gene lpdA 126904 125522 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_00910 128195 126936 gene locus_tag LOCUS_00920 gene odhB 128195 126936 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946280.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence002 2562 613 gene locus_tag LOCUS_00930 2562 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 5102 2568 gene locus_tag LOCUS_00940 5102 2568 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_00940 7277 5322 gene locus_tag LOCUS_00950 7277 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 7536 10022 gene locus_tag LOCUS_00960 7536 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 10039 12024 gene locus_tag LOCUS_00970 10039 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 12096 12866 gene locus_tag LOCUS_00980 12096 12866 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765329.1 protein_id gnl|my_center|LOCUS_00980 12978 14705 gene locus_tag LOCUS_00990 12978 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 16858 14723 gene locus_tag LOCUS_01000 16858 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 18779 17022 gene locus_tag LOCUS_01010 18779 17022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_01010 18943 19104 gene locus_tag LOCUS_01020 18943 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 19119 19976 gene locus_tag LOCUS_01030 19119 19976 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_01030 20447 20710 gene locus_tag LOCUS_01040 20447 20710 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249839.1 protein_id gnl|my_center|LOCUS_01040 20707 21108 gene locus_tag LOCUS_01050 20707 21108 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_01050 21221 21463 gene locus_tag LOCUS_01060 21221 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 22283 21546 gene locus_tag LOCUS_01070 22283 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 22781 23623 gene locus_tag LOCUS_01080 22781 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 23639 24988 gene locus_tag LOCUS_01090 23639 24988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 25101 26039 gene locus_tag LOCUS_01100 25101 26039 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_01100 26616 26044 gene locus_tag LOCUS_01110 26616 26044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 27698 27132 gene locus_tag LOCUS_01120 27698 27132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 28618 27695 gene locus_tag LOCUS_01130 28618 27695 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257127.1 protein_id gnl|my_center|LOCUS_01130 28670 29716 gene locus_tag LOCUS_01140 28670 29716 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_01140 29717 30556 gene locus_tag LOCUS_01150 29717 30556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 30638 32572 gene locus_tag LOCUS_01160 30638 32572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 32594 35221 gene locus_tag LOCUS_01170 32594 35221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 35309 36457 gene locus_tag LOCUS_01180 35309 36457 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_01180 36506 37360 gene locus_tag LOCUS_01190 36506 37360 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_01190 37373 38263 gene locus_tag LOCUS_01200 37373 38263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 39642 38296 gene locus_tag LOCUS_01210 39642 38296 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_01210 40153 39827 gene locus_tag LOCUS_01220 40153 39827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 40985 40440 gene locus_tag LOCUS_01230 40985 40440 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026983.1 protein_id gnl|my_center|LOCUS_01230 41321 42766 gene locus_tag LOCUS_01240 41321 42766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 42810 43772 gene locus_tag LOCUS_01250 42810 43772 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398939.1 protein_id gnl|my_center|LOCUS_01250 44090 44884 gene locus_tag LOCUS_01260 44090 44884 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256865.1 protein_id gnl|my_center|LOCUS_01260 44874 45725 gene locus_tag LOCUS_01270 44874 45725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 45676 46692 gene locus_tag LOCUS_01280 45676 46692 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_01280 47391 46696 gene locus_tag LOCUS_01290 gene fkpA 47391 46696 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838241.1 protein_id gnl|my_center|LOCUS_01290 47814 48452 gene locus_tag LOCUS_01300 47814 48452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 49660 48440 gene locus_tag LOCUS_01310 49660 48440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 50480 49674 gene locus_tag LOCUS_01320 50480 49674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 51390 50572 gene locus_tag LOCUS_01330 51390 50572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 52284 51403 gene locus_tag LOCUS_01340 52284 51403 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_01340 53219 52281 gene locus_tag LOCUS_01350 53219 52281 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_01350 54659 53232 gene locus_tag LOCUS_01360 54659 53232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 55552 54701 gene locus_tag LOCUS_01370 55552 54701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 55689 56543 gene locus_tag LOCUS_01380 55689 56543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 57631 56540 gene locus_tag LOCUS_01390 57631 56540 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113026.1 protein_id gnl|my_center|LOCUS_01390 59238 57688 gene locus_tag LOCUS_01400 59238 57688 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_01400 60347 59259 gene locus_tag LOCUS_01410 60347 59259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 60436 61608 gene locus_tag LOCUS_01420 gene dgoD 60436 61608 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_01420 61651 62103 gene locus_tag LOCUS_01430 61651 62103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 62108 62995 gene locus_tag LOCUS_01440 62108 62995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 64112 63000 gene locus_tag LOCUS_01450 64112 63000 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122453.1 protein_id gnl|my_center|LOCUS_01450 64302 65330 gene locus_tag LOCUS_01460 64302 65330 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096411.1 protein_id gnl|my_center|LOCUS_01460 67261 65327 gene locus_tag LOCUS_01470 67261 65327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 69027 67258 gene locus_tag LOCUS_01480 69027 67258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 69244 70209 gene locus_tag LOCUS_01490 69244 70209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 70918 70235 gene locus_tag LOCUS_01500 70918 70235 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973635.1 protein_id gnl|my_center|LOCUS_01500 71240 71845 gene locus_tag LOCUS_01510 71240 71845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 71915 72166 gene locus_tag LOCUS_01520 71915 72166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 72163 72627 gene locus_tag LOCUS_01530 72163 72627 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392211.1 protein_id gnl|my_center|LOCUS_01530 72935 73183 gene locus_tag LOCUS_01540 72935 73183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 74352 73534 gene locus_tag LOCUS_01550 74352 73534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 74873 74349 gene locus_tag LOCUS_01560 74873 74349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 75030 76325 gene locus_tag LOCUS_01570 75030 76325 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841463.1 protein_id gnl|my_center|LOCUS_01570 76608 77525 gene locus_tag LOCUS_01580 gene hemB 76608 77525 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_01580 77533 78267 gene locus_tag LOCUS_01590 77533 78267 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_01590 78300 79037 gene locus_tag LOCUS_01600 78300 79037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 80691 79060 gene locus_tag LOCUS_01610 80691 79060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 82671 80821 gene locus_tag LOCUS_01620 82671 80821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 85296 82681 gene locus_tag LOCUS_01630 85296 82681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 87688 85346 gene locus_tag LOCUS_01640 87688 85346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 89511 87715 gene locus_tag LOCUS_01650 89511 87715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 89923 89552 gene locus_tag LOCUS_01660 89923 89552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 90942 90013 gene locus_tag LOCUS_01670 90942 90013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 91803 91147 gene locus_tag LOCUS_01680 91803 91147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 93879 92119 gene locus_tag LOCUS_01690 93879 92119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 93908 94081 gene locus_tag LOCUS_01700 93908 94081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 96027 94210 gene locus_tag LOCUS_01710 96027 94210 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01710 97131 96118 gene locus_tag LOCUS_01720 97131 96118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 97730 97332 gene locus_tag LOCUS_01730 97730 97332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 98123 98398 gene locus_tag LOCUS_01740 98123 98398 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_01740 98379 98630 gene locus_tag LOCUS_01750 98379 98630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 98894 99832 gene locus_tag LOCUS_01760 98894 99832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 99892 102765 gene locus_tag LOCUS_01770 gene uvrA 99892 102765 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence003 2781 982 gene locus_tag LOCUS_01780 2781 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3798 2887 gene locus_tag LOCUS_01790 3798 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 6376 4031 gene locus_tag LOCUS_01800 6376 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 6567 7478 gene locus_tag LOCUS_01810 6567 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 7471 9081 gene locus_tag LOCUS_01820 7471 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 9083 12283 gene locus_tag LOCUS_01830 9083 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 12472 13389 gene locus_tag LOCUS_01840 12472 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 13485 15395 gene locus_tag LOCUS_01850 13485 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 15429 15905 gene locus_tag LOCUS_01860 15429 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 17591 15966 gene locus_tag LOCUS_01870 17591 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 17788 20796 gene locus_tag LOCUS_01880 17788 20796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 20786 23236 gene locus_tag LOCUS_01890 20786 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_01890 23343 24131 gene locus_tag LOCUS_01900 23343 24131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 24140 25138 gene locus_tag LOCUS_01910 24140 25138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 25169 26401 gene locus_tag LOCUS_01920 25169 26401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 26405 26671 gene locus_tag LOCUS_01930 26405 26671 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_01930 26696 28324 gene locus_tag LOCUS_01940 26696 28324 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_01940 28321 29691 gene locus_tag LOCUS_01950 28321 29691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 29684 31270 gene locus_tag LOCUS_01960 29684 31270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 31260 32312 gene locus_tag LOCUS_01970 31260 32312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 32482 34323 gene locus_tag LOCUS_01980 32482 34323 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776685.1 protein_id gnl|my_center|LOCUS_01980 34442 35284 gene locus_tag LOCUS_01990 34442 35284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 35407 36231 gene locus_tag LOCUS_02000 35407 36231 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_02000 37008 36382 gene locus_tag LOCUS_02010 37008 36382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 38162 37005 gene locus_tag LOCUS_02020 38162 37005 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_02020 39391 38279 gene locus_tag LOCUS_02030 39391 38279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 39489 41555 gene locus_tag LOCUS_02040 39489 41555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 41552 42937 gene locus_tag LOCUS_02050 41552 42937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 42937 43803 gene locus_tag LOCUS_02060 gene yidA 42937 43803 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130632.1 protein_id gnl|my_center|LOCUS_02060 43800 44507 gene locus_tag LOCUS_02070 43800 44507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 44508 46121 gene locus_tag LOCUS_02080 44508 46121 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_02080 46180 47190 gene locus_tag LOCUS_02090 46180 47190 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582577.1 protein_id gnl|my_center|LOCUS_02090 47193 48050 gene locus_tag LOCUS_02100 47193 48050 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582630.1 protein_id gnl|my_center|LOCUS_02100 48047 49054 gene locus_tag LOCUS_02110 48047 49054 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146644.1 protein_id gnl|my_center|LOCUS_02110 49038 50093 gene locus_tag LOCUS_02120 49038 50093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582574.1 protein_id gnl|my_center|LOCUS_02120 50111 51841 gene locus_tag LOCUS_02130 50111 51841 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582578.1 protein_id gnl|my_center|LOCUS_02130 52130 52510 gene locus_tag LOCUS_02140 52130 52510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 52514 53011 gene locus_tag LOCUS_02150 52514 53011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 53048 53344 gene locus_tag LOCUS_02160 53048 53344 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687871.1 protein_id gnl|my_center|LOCUS_02160 53358 54224 gene locus_tag LOCUS_02170 53358 54224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 55398 54346 gene locus_tag LOCUS_02180 55398 54346 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_02180 55508 57451 gene locus_tag LOCUS_02190 55508 57451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 57463 58491 gene locus_tag LOCUS_02200 57463 58491 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_02200 58544 61027 gene locus_tag LOCUS_02210 58544 61027 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_02210 61169 61936 gene locus_tag LOCUS_02220 61169 61936 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_02220 62018 65020 gene locus_tag LOCUS_02230 62018 65020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 65147 66130 gene locus_tag LOCUS_02240 65147 66130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 66246 67037 gene locus_tag LOCUS_02250 66246 67037 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088005.1 protein_id gnl|my_center|LOCUS_02250 68960 67053 gene locus_tag LOCUS_02260 68960 67053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 69015 70820 gene locus_tag LOCUS_02270 69015 70820 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922636.1 protein_id gnl|my_center|LOCUS_02270 72367 70817 gene locus_tag LOCUS_02280 72367 70817 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_02280 72675 72448 gene locus_tag LOCUS_02290 72675 72448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 72959 72672 gene locus_tag LOCUS_02300 72959 72672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 73121 73312 gene locus_tag LOCUS_02310 73121 73312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 73926 73426 gene locus_tag LOCUS_02320 73926 73426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 74156 73908 gene locus_tag LOCUS_02330 74156 73908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 75871 74330 gene locus_tag LOCUS_02340 75871 74330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 75789 76037 gene locus_tag LOCUS_02350 75789 76037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 76222 76046 gene locus_tag LOCUS_02360 76222 76046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 76704 78965 gene locus_tag LOCUS_02370 76704 78965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 79159 81939 gene locus_tag LOCUS_02380 79159 81939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 81944 83536 gene locus_tag LOCUS_02390 81944 83536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 83540 86419 gene locus_tag LOCUS_02400 83540 86419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence004 1168 113 gene locus_tag LOCUS_02410 1168 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2800 1178 gene locus_tag LOCUS_02420 2800 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3390 2803 gene locus_tag LOCUS_02430 3390 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3923 3402 gene locus_tag LOCUS_02440 3923 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4409 3927 gene locus_tag LOCUS_02450 4409 3927 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015938.1 protein_id gnl|my_center|LOCUS_02450 5782 4463 gene locus_tag LOCUS_02460 5782 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6053 6400 gene locus_tag LOCUS_02470 6053 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6397 6696 gene locus_tag LOCUS_02480 6397 6696 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390813.1 protein_id gnl|my_center|LOCUS_02480 6715 7611 gene locus_tag LOCUS_02490 gene thpD 6715 7611 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_02490 7793 10125 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttgttctgttggatcagcccctgagac 10894 10298 gene locus_tag LOCUS_02500 10894 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 11196 10891 gene locus_tag LOCUS_02510 11196 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 12170 11193 gene locus_tag LOCUS_02520 gene cas1 12170 11193 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_02520 12853 12179 gene locus_tag LOCUS_02530 12853 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 15138 12850 gene locus_tag LOCUS_02540 15138 12850 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_02540 15854 15135 gene locus_tag LOCUS_02550 15854 15135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 16832 15864 gene locus_tag LOCUS_02560 gene cas7b 16832 15864 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_02560 18804 16834 gene locus_tag LOCUS_02570 18804 16834 CDS product TIGR02556 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582997.1 protein_id gnl|my_center|LOCUS_02570 19631 19062 gene locus_tag LOCUS_02580 19631 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 19875 19669 gene locus_tag LOCUS_02590 19875 19669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 20948 19971 gene locus_tag LOCUS_02600 20948 19971 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258178.1 protein_id gnl|my_center|LOCUS_02600 21150 21353 gene locus_tag LOCUS_02610 21150 21353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 21409 22503 gene locus_tag LOCUS_02620 21409 22503 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_02620 22503 23816 gene locus_tag LOCUS_02630 22503 23816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 23828 25255 gene locus_tag LOCUS_02640 23828 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 25266 27944 gene locus_tag LOCUS_02650 25266 27944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 28374 28021 gene locus_tag LOCUS_02660 28374 28021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 28729 28511 gene locus_tag LOCUS_02670 28729 28511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02670 29584 28871 gene locus_tag LOCUS_02680 29584 28871 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545422.1 protein_id gnl|my_center|LOCUS_02680 30280 29618 gene locus_tag LOCUS_02690 30280 29618 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_02690 30670 30371 gene locus_tag LOCUS_02700 30670 30371 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_02700 31823 30699 gene locus_tag LOCUS_02710 31823 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 33189 31918 gene locus_tag LOCUS_02720 gene murA 33189 31918 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_02720 33368 33637 gene locus_tag LOCUS_02730 33368 33637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 34155 33634 gene locus_tag LOCUS_02740 34155 33634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 34211 34286 gene locus_tag LOCUS_t00010 34211 34286 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 35261 34344 gene locus_tag LOCUS_02750 35261 34344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 35352 36617 gene locus_tag LOCUS_02760 35352 36617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 38397 36622 gene locus_tag LOCUS_02770 38397 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 38903 38403 gene locus_tag LOCUS_02780 38903 38403 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_02780 41732 39117 gene locus_tag LOCUS_02790 41732 39117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 43708 41795 gene locus_tag LOCUS_02800 43708 41795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 46371 43705 gene locus_tag LOCUS_02810 46371 43705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 48917 46368 gene locus_tag LOCUS_02820 48917 46368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 50721 48919 gene locus_tag LOCUS_02830 50721 48919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 52850 50736 gene locus_tag LOCUS_02840 52850 50736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 54948 52912 gene locus_tag LOCUS_02850 54948 52912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 57098 54972 gene locus_tag LOCUS_02860 57098 54972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 59566 57455 gene locus_tag LOCUS_02870 59566 57455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 62798 59889 gene locus_tag LOCUS_02880 62798 59889 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257471.1 protein_id gnl|my_center|LOCUS_02880 64043 62886 gene locus_tag LOCUS_02890 gene anmK 64043 62886 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_02890 65153 64050 gene locus_tag LOCUS_02900 65153 64050 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_02900 65290 66129 gene locus_tag LOCUS_02910 65290 66129 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_02910 66149 66571 gene locus_tag LOCUS_02920 66149 66571 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903519.1 protein_id gnl|my_center|LOCUS_02920 66650 66937 gene locus_tag LOCUS_02930 66650 66937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 66950 67747 gene locus_tag LOCUS_02940 gene rfbF 66950 67747 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_02940 67744 68805 gene locus_tag LOCUS_02950 gene rfbG 67744 68805 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_02950 68876 70495 gene locus_tag LOCUS_02960 68876 70495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 70685 71692 gene locus_tag LOCUS_02970 70685 71692 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 protein_id gnl|my_center|LOCUS_02970 71689 72627 gene locus_tag LOCUS_02980 71689 72627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 72640 73986 gene locus_tag LOCUS_02990 gene rfbH 72640 73986 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_02990 73983 74960 gene locus_tag LOCUS_03000 73983 74960 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_03000 75083 75904 gene locus_tag LOCUS_03010 75083 75904 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_03010 75904 76860 gene locus_tag LOCUS_03020 75904 76860 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_03020 77375 79120 gene locus_tag LOCUS_03030 77375 79120 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03030 80164 79286 gene locus_tag LOCUS_03040 80164 79286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 80332 80589 gene locus_tag LOCUS_03050 80332 80589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 80614 82746 gene locus_tag LOCUS_03060 gene feoB 80614 82746 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_03060 82748 82885 gene locus_tag LOCUS_03070 82748 82885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 84001 82919 gene locus_tag LOCUS_03080 gene dprA 84001 82919 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_03080 84488 83994 gene locus_tag LOCUS_03090 gene coaD 84488 83994 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_03090 84922 84488 gene locus_tag LOCUS_03100 84922 84488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 84855 85121 gene locus_tag LOCUS_03110 84855 85121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence005 931 179 gene locus_tag LOCUS_03120 931 179 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532870.1 protein_id gnl|my_center|LOCUS_03120 1915 935 gene locus_tag LOCUS_03130 1915 935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532869.1 protein_id gnl|my_center|LOCUS_03130 2845 1916 gene locus_tag LOCUS_03140 2845 1916 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532868.1 protein_id gnl|my_center|LOCUS_03140 3121 4062 gene locus_tag LOCUS_03150 3121 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 5644 4136 gene locus_tag LOCUS_03160 5644 4136 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_03160 5702 8395 gene locus_tag LOCUS_03170 5702 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 8425 9210 gene locus_tag LOCUS_03180 8425 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10838 9207 gene locus_tag LOCUS_03190 10838 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11733 10840 gene locus_tag LOCUS_03200 11733 10840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 11758 13092 gene locus_tag LOCUS_03210 11758 13092 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_03210 13083 14429 gene locus_tag LOCUS_03220 13083 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 15198 14431 gene locus_tag LOCUS_03230 15198 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 16879 15212 gene locus_tag LOCUS_03240 16879 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 19551 16879 gene locus_tag LOCUS_03250 19551 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 21898 19574 gene locus_tag LOCUS_03260 21898 19574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 24012 21910 gene locus_tag LOCUS_03270 24012 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 25976 24012 gene locus_tag LOCUS_03280 25976 24012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 26058 27566 gene locus_tag LOCUS_03290 26058 27566 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902592.1 protein_id gnl|my_center|LOCUS_03290 28561 27626 gene locus_tag LOCUS_03300 28561 27626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 28672 30618 gene locus_tag LOCUS_03310 28672 30618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 32210 30615 gene locus_tag LOCUS_03320 32210 30615 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921354.1 protein_id gnl|my_center|LOCUS_03320 32556 33887 gene locus_tag LOCUS_03330 32556 33887 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929231.1 protein_id gnl|my_center|LOCUS_03330 33984 34904 gene locus_tag LOCUS_03340 33984 34904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 35877 34996 gene locus_tag LOCUS_03350 35877 34996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 36000 37172 gene locus_tag LOCUS_03360 36000 37172 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_03360 37203 38039 gene locus_tag LOCUS_03370 37203 38039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 38919 38050 gene locus_tag LOCUS_03380 38919 38050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 40473 39004 gene locus_tag LOCUS_03390 40473 39004 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119047.1 protein_id gnl|my_center|LOCUS_03390 41609 40536 gene locus_tag LOCUS_03400 41609 40536 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532944.1 protein_id gnl|my_center|LOCUS_03400 41986 41606 gene locus_tag LOCUS_03410 41986 41606 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_03410 43914 41983 gene locus_tag LOCUS_03420 43914 41983 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151055443.1 protein_id gnl|my_center|LOCUS_03420 44009 44797 gene locus_tag LOCUS_03430 44009 44797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 44869 45909 gene locus_tag LOCUS_03440 gene ltaE 44869 45909 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_03440 47710 45914 gene locus_tag LOCUS_03450 47710 45914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 47963 49150 gene locus_tag LOCUS_03460 47963 49150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 50504 49167 gene locus_tag LOCUS_03470 50504 49167 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_03470 50940 50512 gene locus_tag LOCUS_03480 50940 50512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 51518 51443 gene locus_tag LOCUS_t00020 51518 51443 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 52362 51550 gene locus_tag LOCUS_03490 52362 51550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 52664 52416 gene locus_tag LOCUS_03500 52664 52416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 53981 52725 gene locus_tag LOCUS_03510 53981 52725 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_03510 54698 54048 gene locus_tag LOCUS_03520 54698 54048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 55429 54695 gene locus_tag LOCUS_03530 55429 54695 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532495.1 protein_id gnl|my_center|LOCUS_03530 55663 58035 gene locus_tag LOCUS_03540 55663 58035 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_03540 60716 58149 gene locus_tag LOCUS_03550 60716 58149 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038151.1 protein_id gnl|my_center|LOCUS_03550 62065 60806 gene locus_tag LOCUS_03560 62065 60806 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_03560 62173 63405 gene locus_tag LOCUS_03570 62173 63405 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_03570 63855 63508 gene locus_tag LOCUS_03580 63855 63508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 64115 63861 gene locus_tag LOCUS_03590 64115 63861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 64293 65051 gene locus_tag LOCUS_03600 gene hpaI 64293 65051 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392271.1 protein_id gnl|my_center|LOCUS_03600 65104 66108 gene locus_tag LOCUS_03610 65104 66108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 66128 66940 gene locus_tag LOCUS_03620 66128 66940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 67136 68413 gene locus_tag LOCUS_03630 67136 68413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 68491 70776 gene locus_tag LOCUS_03640 68491 70776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_03640 72805 70817 gene locus_tag LOCUS_03650 72805 70817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 73580 72882 gene locus_tag LOCUS_03660 73580 72882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 73859 75550 gene locus_tag LOCUS_03670 73859 75550 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_03670 77228 75564 gene locus_tag LOCUS_03680 77228 75564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 79976 77268 gene locus_tag LOCUS_03690 79976 77268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 81739 80015 gene locus_tag LOCUS_03700 81739 80015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 83006 81765 gene locus_tag LOCUS_03710 83006 81765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 83189 83609 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence006 1554 109 gene locus_tag LOCUS_03720 1554 109 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_03720 3850 1571 gene locus_tag LOCUS_03730 3850 1571 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228275.1 protein_id gnl|my_center|LOCUS_03730 4079 3840 gene locus_tag LOCUS_03740 4079 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4556 4116 gene locus_tag LOCUS_03750 gene queD 4556 4116 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966887.1 protein_id gnl|my_center|LOCUS_03750 4815 4543 gene locus_tag LOCUS_03760 4815 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5989 4823 gene locus_tag LOCUS_03770 gene ispC 5989 4823 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_03770 7664 5991 gene locus_tag LOCUS_03780 gene rny 7664 5991 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287336.1 protein_id gnl|my_center|LOCUS_03780 9143 7776 gene locus_tag LOCUS_03790 9143 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9777 9151 gene locus_tag LOCUS_03800 gene folE 9777 9151 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459178.1 protein_id gnl|my_center|LOCUS_03800 10329 9862 gene locus_tag LOCUS_03810 10329 9862 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_03810 10953 10333 gene locus_tag LOCUS_03820 gene sodA 10953 10333 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_03820 11365 10988 gene locus_tag LOCUS_03830 gene nifU 11365 10988 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_03830 11813 11490 gene locus_tag LOCUS_03840 11813 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 13319 11901 gene locus_tag LOCUS_03850 13319 11901 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_03850 14702 13347 gene locus_tag LOCUS_03860 14702 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 15044 14706 gene locus_tag LOCUS_03870 15044 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 15287 15048 gene locus_tag LOCUS_03880 15287 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 15839 15324 gene locus_tag LOCUS_03890 15839 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 16560 15886 gene locus_tag LOCUS_03900 16560 15886 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_03900 16794 18242 gene locus_tag LOCUS_03910 16794 18242 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879805.1 protein_id gnl|my_center|LOCUS_03910 18316 19725 gene locus_tag LOCUS_03920 18316 19725 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_03920 20655 19804 gene locus_tag LOCUS_03930 20655 19804 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389372.1 protein_id gnl|my_center|LOCUS_03930 21429 20665 gene locus_tag LOCUS_03940 21429 20665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 22781 21426 gene locus_tag LOCUS_03950 22781 21426 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_03950 22929 23297 gene locus_tag LOCUS_03960 22929 23297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 24278 23301 gene locus_tag LOCUS_03970 24278 23301 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969225.1 protein_id gnl|my_center|LOCUS_03970 24442 25722 gene locus_tag LOCUS_03980 24442 25722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 26369 25719 gene locus_tag LOCUS_03990 gene nth 26369 25719 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_03990 27580 26384 gene locus_tag LOCUS_04000 27580 26384 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_04000 28647 27580 gene locus_tag LOCUS_04010 28647 27580 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_04010 29764 28661 gene locus_tag LOCUS_04020 29764 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 31487 29784 gene locus_tag LOCUS_04030 31487 29784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 31554 32846 gene locus_tag LOCUS_04040 gene eno 31554 32846 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_04040 34049 32832 gene locus_tag LOCUS_04050 34049 32832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 34815 34042 gene locus_tag LOCUS_04060 34815 34042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 35409 34900 gene locus_tag LOCUS_04070 35409 34900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 35762 36976 gene locus_tag LOCUS_04080 gene ftsA 35762 36976 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 protein_id gnl|my_center|LOCUS_04080 37046 37121 gene locus_tag LOCUS_t00030 37046 37121 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 37214 37627 gene locus_tag LOCUS_04090 37214 37627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 38394 37630 gene locus_tag LOCUS_04100 38394 37630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390252.1 protein_id gnl|my_center|LOCUS_04100 39344 38391 gene locus_tag LOCUS_04110 39344 38391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390251.1 protein_id gnl|my_center|LOCUS_04110 39626 40657 gene locus_tag LOCUS_04120 gene mltG 39626 40657 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_04120 40660 42876 gene locus_tag LOCUS_04130 gene pcrA 40660 42876 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_04130 43990 43430 gene locus_tag LOCUS_04140 43990 43430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 44934 44185 gene locus_tag LOCUS_04150 gene cas5e 44934 44185 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_04150 46103 44931 gene locus_tag LOCUS_04160 gene cas7e 46103 44931 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_04160 46544 46116 gene locus_tag LOCUS_04170 46544 46116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 48204 46618 gene locus_tag LOCUS_04180 48204 46618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 48770 49030 gene locus_tag LOCUS_04190 48770 49030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 49170 50489 gene locus_tag LOCUS_04200 gene mtaB 49170 50489 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_04200 50486 51868 gene locus_tag LOCUS_04210 gene miaB 50486 51868 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_04210 52115 54211 gene locus_tag LOCUS_04220 52115 54211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 54230 57151 gene locus_tag LOCUS_04230 54230 57151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 57182 59356 gene locus_tag LOCUS_04240 57182 59356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 61253 59370 gene locus_tag LOCUS_04250 61253 59370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 63631 61262 gene locus_tag LOCUS_04260 63631 61262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 65996 63648 gene locus_tag LOCUS_04270 65996 63648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 66716 66054 gene locus_tag LOCUS_04280 66716 66054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 69208 66752 gene locus_tag LOCUS_04290 69208 66752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 71265 69220 gene locus_tag LOCUS_04300 71265 69220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 73066 71303 gene locus_tag LOCUS_04310 73066 71303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 74444 73056 gene locus_tag LOCUS_04320 74444 73056 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257544.1 protein_id gnl|my_center|LOCUS_04320 76059 74437 gene locus_tag LOCUS_04330 76059 74437 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_04330 77714 76074 gene locus_tag LOCUS_04340 77714 76074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 79019 77775 gene locus_tag LOCUS_04350 79019 77775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 81719 79098 gene locus_tag LOCUS_04360 81719 79098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 83749 81788 gene locus_tag LOCUS_04370 83749 81788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 84495 83749 gene locus_tag LOCUS_04380 84495 83749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence007 461 267 gene locus_tag LOCUS_04390 461 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1074 2993 gene locus_tag LOCUS_04400 1074 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3184 4434 gene locus_tag LOCUS_04410 3184 4434 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_04410 4431 8480 gene locus_tag LOCUS_04420 4431 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 8885 8493 gene locus_tag LOCUS_04430 8885 8493 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922062.1 protein_id gnl|my_center|LOCUS_04430 10490 8955 gene locus_tag LOCUS_04440 10490 8955 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_04440 10739 11488 gene locus_tag LOCUS_04450 10739 11488 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199071.1 protein_id gnl|my_center|LOCUS_04450 11485 12714 gene locus_tag LOCUS_04460 11485 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 12771 13376 gene locus_tag LOCUS_04470 12771 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 13388 14191 gene locus_tag LOCUS_04480 13388 14191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 14188 15105 gene locus_tag LOCUS_04490 14188 15105 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_04490 15945 15130 gene locus_tag LOCUS_04500 15945 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 16711 15974 gene locus_tag LOCUS_04510 16711 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 17545 16715 gene locus_tag LOCUS_04520 17545 16715 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_04520 17644 18078 gene locus_tag LOCUS_04530 17644 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 18090 18887 gene locus_tag LOCUS_04540 18090 18887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 18905 19276 gene locus_tag LOCUS_04550 18905 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 19284 20102 gene locus_tag LOCUS_04560 19284 20102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 20120 20902 gene locus_tag LOCUS_04570 20120 20902 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_04570 20911 21912 gene locus_tag LOCUS_04580 20911 21912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 21953 23077 gene locus_tag LOCUS_04590 gene dgoD 21953 23077 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_04590 23139 23408 gene locus_tag LOCUS_04600 23139 23408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 23410 23823 gene locus_tag LOCUS_04610 23410 23823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 23943 24137 gene locus_tag LOCUS_04620 23943 24137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 24153 24407 gene locus_tag LOCUS_04630 24153 24407 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390667.1 protein_id gnl|my_center|LOCUS_04630 24460 24804 gene locus_tag LOCUS_04640 24460 24804 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_04640 24818 26065 gene locus_tag LOCUS_04650 24818 26065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 26239 26078 gene locus_tag LOCUS_04660 26239 26078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 26468 26286 gene locus_tag LOCUS_04670 26468 26286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 27031 26747 gene locus_tag LOCUS_04680 27031 26747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 28056 27049 gene locus_tag LOCUS_04690 gene iolG 28056 27049 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_04690 28022 28216 gene locus_tag LOCUS_04700 28022 28216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 28271 30013 gene locus_tag LOCUS_04710 28271 30013 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_04710 30018 32045 gene locus_tag LOCUS_04720 30018 32045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 32063 33139 gene locus_tag LOCUS_04730 gene ribD 32063 33139 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_04730 33108 33014 gene locus_tag LOCUS_t00040 33108 33014 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33154 33750 gene locus_tag LOCUS_04740 33154 33750 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228413.1 protein_id gnl|my_center|LOCUS_04740 33754 35004 gene locus_tag LOCUS_04750 33754 35004 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_04750 34988 35455 gene locus_tag LOCUS_04760 gene ribE 34988 35455 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392435.1 protein_id gnl|my_center|LOCUS_04760 35452 35919 gene locus_tag LOCUS_04770 gene nusB 35452 35919 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393030.1 protein_id gnl|my_center|LOCUS_04770 36002 39262 gene locus_tag LOCUS_04780 gene secA 36002 39262 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_04780 39266 40744 gene locus_tag LOCUS_04790 39266 40744 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_04790 41284 40802 gene locus_tag LOCUS_04800 41284 40802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 41453 42421 gene locus_tag LOCUS_04810 41453 42421 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946655.1 protein_id gnl|my_center|LOCUS_04810 42471 42656 gene locus_tag LOCUS_04820 42471 42656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 42656 42934 gene locus_tag LOCUS_04830 42656 42934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 42931 44400 gene locus_tag LOCUS_04840 42931 44400 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_04840 44479 45327 gene locus_tag LOCUS_04850 44479 45327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 45459 46286 gene locus_tag LOCUS_04860 45459 46286 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_04860 46325 47989 gene locus_tag LOCUS_04870 46325 47989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 47986 48900 gene locus_tag LOCUS_04880 47986 48900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 48907 49761 gene locus_tag LOCUS_04890 48907 49761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 49864 49730 gene locus_tag LOCUS_04900 49864 49730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 49863 50723 gene locus_tag LOCUS_04910 49863 50723 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_04910 50732 51481 gene locus_tag LOCUS_04920 50732 51481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 51556 52224 gene locus_tag LOCUS_04930 51556 52224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 52229 53356 gene locus_tag LOCUS_04940 52229 53356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 53353 54492 gene locus_tag LOCUS_04950 gene tgt 53353 54492 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_04950 55065 54502 gene locus_tag LOCUS_04960 55065 54502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 55249 55587 gene locus_tag LOCUS_04970 gene yajC 55249 55587 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_04970 55587 56510 gene locus_tag LOCUS_04980 gene fmt 55587 56510 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404897.1 protein_id gnl|my_center|LOCUS_04980 56467 56955 gene locus_tag LOCUS_04990 56467 56955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 57304 56945 gene locus_tag LOCUS_05000 57304 56945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 57465 58016 gene locus_tag LOCUS_05010 57465 58016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 58069 58144 gene locus_tag LOCUS_t00050 58069 58144 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 58280 61678 gene locus_tag LOCUS_05020 gene mfd 58280 61678 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_05020 61864 62493 gene locus_tag LOCUS_05030 61864 62493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 62571 63833 gene locus_tag LOCUS_05040 62571 63833 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_05040 63781 64062 gene locus_tag LOCUS_05050 63781 64062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 64073 64831 gene locus_tag LOCUS_05060 64073 64831 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_05060 64828 65784 gene locus_tag LOCUS_05070 64828 65784 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986790.1 protein_id gnl|my_center|LOCUS_05070 65872 66789 gene locus_tag LOCUS_05080 65872 66789 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004530.1 protein_id gnl|my_center|LOCUS_05080 66981 69686 gene locus_tag LOCUS_05090 66981 69686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 69686 72781 gene locus_tag LOCUS_05100 69686 72781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 73296 72817 gene locus_tag LOCUS_05110 gene moaC 73296 72817 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393624.1 protein_id gnl|my_center|LOCUS_05110 74549 73296 gene locus_tag LOCUS_05120 gene icd 74549 73296 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_05120 75327 74650 gene locus_tag LOCUS_05130 gene lipB 75327 74650 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_05130 75461 75748 gene locus_tag LOCUS_05140 75461 75748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 75723 76940 gene locus_tag LOCUS_05150 75723 76940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 77178 76972 gene locus_tag LOCUS_05160 77178 76972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 77184 78824 gene locus_tag LOCUS_05170 gene groL 77184 78824 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_05170 79647 78895 gene locus_tag LOCUS_05180 79647 78895 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460965.1 protein_id gnl|my_center|LOCUS_05180 79755 82064 gene locus_tag LOCUS_05190 79755 82064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence008 782 2740 gene locus_tag LOCUS_05200 782 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2737 6102 gene locus_tag LOCUS_05210 2737 6102 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 protein_id gnl|my_center|LOCUS_05210 6473 6117 gene locus_tag LOCUS_05220 6473 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6948 6520 gene locus_tag LOCUS_05230 gene tolR 6948 6520 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_05230 7649 6957 gene locus_tag LOCUS_05240 gene tolQ 7649 6957 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_05240 9578 7659 gene locus_tag LOCUS_05250 9578 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 9713 10201 gene locus_tag LOCUS_05260 9713 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 10173 11759 gene locus_tag LOCUS_05270 10173 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 11926 13749 gene locus_tag LOCUS_05280 11926 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 13878 14870 gene locus_tag LOCUS_05290 13878 14870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 14914 17043 gene locus_tag LOCUS_05300 14914 17043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 17125 19836 gene locus_tag LOCUS_05310 17125 19836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 19836 20072 gene locus_tag LOCUS_05320 19836 20072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 20072 22741 gene locus_tag LOCUS_05330 20072 22741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 22784 23134 gene locus_tag LOCUS_05340 22784 23134 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967765.1 protein_id gnl|my_center|LOCUS_05340 23134 23646 gene locus_tag LOCUS_05350 23134 23646 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525332.1 protein_id gnl|my_center|LOCUS_05350 23678 26494 gene locus_tag LOCUS_05360 23678 26494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 26499 27626 gene locus_tag LOCUS_05370 26499 27626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 27626 29344 gene locus_tag LOCUS_05380 27626 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 29519 30346 gene locus_tag LOCUS_05390 29519 30346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 30343 32409 gene locus_tag LOCUS_05400 30343 32409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 32406 33161 gene locus_tag LOCUS_05410 32406 33161 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392169.1 protein_id gnl|my_center|LOCUS_05410 33265 35331 gene locus_tag LOCUS_05420 33265 35331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 35488 38742 gene locus_tag LOCUS_05430 35488 38742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 38739 39962 gene locus_tag LOCUS_05440 38739 39962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 39967 41154 gene locus_tag LOCUS_05450 39967 41154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 42826 41321 gene locus_tag LOCUS_05460 42826 41321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 43121 45214 gene locus_tag LOCUS_05470 43121 45214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 45207 47183 gene locus_tag LOCUS_05480 45207 47183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 47184 47378 gene locus_tag LOCUS_05490 47184 47378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 47382 48230 gene locus_tag LOCUS_05500 47382 48230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 48259 50226 gene locus_tag LOCUS_05510 48259 50226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 50343 50579 gene locus_tag LOCUS_05520 50343 50579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 50576 50941 gene locus_tag LOCUS_05530 50576 50941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 52784 51048 gene locus_tag LOCUS_05540 52784 51048 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080060.1 protein_id gnl|my_center|LOCUS_05540 52879 53094 gene locus_tag LOCUS_05550 52879 53094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 53075 54709 gene locus_tag LOCUS_05560 53075 54709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 54799 56397 gene locus_tag LOCUS_05570 54799 56397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 56519 59575 gene locus_tag LOCUS_05580 56519 59575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 59740 62367 gene locus_tag LOCUS_05590 59740 62367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 62503 63414 gene locus_tag LOCUS_05600 62503 63414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 63411 65459 gene locus_tag LOCUS_05610 63411 65459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 65475 67535 gene locus_tag LOCUS_05620 65475 67535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 67545 70268 gene locus_tag LOCUS_05630 67545 70268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 70364 71302 gene locus_tag LOCUS_05640 70364 71302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 72103 71369 gene locus_tag LOCUS_05650 72103 71369 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_05650 72879 72100 gene locus_tag LOCUS_05660 72879 72100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 73724 72885 gene locus_tag LOCUS_05670 73724 72885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 73943 73788 gene locus_tag LOCUS_05680 73943 73788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 74504 74154 gene locus_tag LOCUS_05690 74504 74154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence009 1896 1012 gene locus_tag LOCUS_05700 1896 1012 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_05700 2377 2000 gene locus_tag LOCUS_05710 2377 2000 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_05710 2613 2374 gene locus_tag LOCUS_05720 2613 2374 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_05720 3641 2670 gene locus_tag LOCUS_05730 3641 2670 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_05730 5727 3766 gene locus_tag LOCUS_05740 5727 3766 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272221.1 protein_id gnl|my_center|LOCUS_05740 5955 7856 gene locus_tag LOCUS_05750 5955 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 7941 9542 gene locus_tag LOCUS_05760 7941 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 9555 12614 gene locus_tag LOCUS_05770 9555 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 12633 15299 gene locus_tag LOCUS_05780 12633 15299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 15303 17246 gene locus_tag LOCUS_05790 15303 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 17243 19309 gene locus_tag LOCUS_05800 17243 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 19323 21344 gene locus_tag LOCUS_05810 19323 21344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 21352 23964 gene locus_tag LOCUS_05820 21352 23964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 24091 24987 gene locus_tag LOCUS_05830 24091 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 25070 25936 gene locus_tag LOCUS_05840 25070 25936 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899275.1 protein_id gnl|my_center|LOCUS_05840 25945 27234 gene locus_tag LOCUS_05850 25945 27234 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_05850 27234 28178 gene locus_tag LOCUS_05860 27234 28178 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_05860 28178 29080 gene locus_tag LOCUS_05870 28178 29080 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_05870 29086 29304 gene locus_tag LOCUS_05880 29086 29304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 29318 29542 gene locus_tag LOCUS_05890 29318 29542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 29545 29814 gene locus_tag LOCUS_05900 29545 29814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_05900 29985 30293 gene locus_tag LOCUS_05910 29985 30293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 30280 30639 gene locus_tag LOCUS_05920 30280 30639 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_05920 30709 32535 gene locus_tag LOCUS_05930 30709 32535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_05930 33366 32566 gene locus_tag LOCUS_05940 33366 32566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 34500 33406 gene locus_tag LOCUS_05950 34500 33406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 34991 34494 gene locus_tag LOCUS_05960 34991 34494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 35895 35068 gene locus_tag LOCUS_05970 35895 35068 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_05970 35984 37729 gene locus_tag LOCUS_05980 35984 37729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_05980 37729 39507 gene locus_tag LOCUS_05990 37729 39507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_05990 39529 40038 gene locus_tag LOCUS_06000 39529 40038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 40684 40061 gene locus_tag LOCUS_06010 40684 40061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971331.1 protein_id gnl|my_center|LOCUS_06010 41494 40694 gene locus_tag LOCUS_06020 41494 40694 CDS product galactitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972809.1 protein_id gnl|my_center|LOCUS_06020 42591 41707 gene locus_tag LOCUS_06030 42591 41707 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329802.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06030 42941 42627 gene locus_tag LOCUS_06040 42941 42627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 43190 44161 gene locus_tag LOCUS_06050 43190 44161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 45105 44158 gene locus_tag LOCUS_06060 45105 44158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 46611 45148 gene locus_tag LOCUS_06070 46611 45148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 46837 47970 gene locus_tag LOCUS_06080 46837 47970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 48062 48412 gene locus_tag LOCUS_06090 48062 48412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 48409 48684 gene locus_tag LOCUS_06100 48409 48684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 48726 49136 gene locus_tag LOCUS_06110 48726 49136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 51034 49133 gene locus_tag LOCUS_06120 51034 49133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 52572 51034 gene locus_tag LOCUS_06130 52572 51034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 55196 52569 gene locus_tag LOCUS_06140 55196 52569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 57094 55208 gene locus_tag LOCUS_06150 57094 55208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 59820 57091 gene locus_tag LOCUS_06160 59820 57091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 62357 59820 gene locus_tag LOCUS_06170 62357 59820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 63946 62390 gene locus_tag LOCUS_06180 63946 62390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 64167 63943 gene locus_tag LOCUS_06190 64167 63943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 65692 64124 gene locus_tag LOCUS_06200 65692 64124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 65916 66152 gene locus_tag LOCUS_06210 65916 66152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 <66734 66200 gene locus_tag LOCUS_06220 <66734 66200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009195517.1:ABC transporter permease >Feature sequence010 1129 1893 gene locus_tag LOCUS_06230 1129 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1896 3578 gene locus_tag LOCUS_06240 1896 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3698 5341 gene locus_tag LOCUS_06250 3698 5341 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_06250 5344 6870 gene locus_tag LOCUS_06260 5344 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 6959 9037 gene locus_tag LOCUS_06270 6959 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 10603 9128 gene locus_tag LOCUS_06280 gene gltX 10603 9128 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_06280 10782 11990 gene locus_tag LOCUS_06290 10782 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 12808 12032 gene locus_tag LOCUS_06300 12808 12032 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103020948.1 protein_id gnl|my_center|LOCUS_06300 15052 12824 gene locus_tag LOCUS_06310 15052 12824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_06310 16516 15200 gene locus_tag LOCUS_06320 16516 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 17526 16864 gene locus_tag LOCUS_06330 17526 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 18735 17608 gene locus_tag LOCUS_06340 18735 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 19854 19081 gene locus_tag LOCUS_06350 19854 19081 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421578.1 protein_id gnl|my_center|LOCUS_06350 20808 19867 gene locus_tag LOCUS_06360 20808 19867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 21648 20839 gene locus_tag LOCUS_06370 21648 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 22834 21716 gene locus_tag LOCUS_06380 22834 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 24070 25893 gene locus_tag LOCUS_06390 24070 25893 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_06390 25893 27782 gene locus_tag LOCUS_06400 25893 27782 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_06400 28014 28298 gene locus_tag LOCUS_06410 28014 28298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 28323 28589 gene locus_tag LOCUS_06420 28323 28589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 28514 29005 gene locus_tag LOCUS_06430 28514 29005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 29655 29011 gene locus_tag LOCUS_06440 29655 29011 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532941.1 protein_id gnl|my_center|LOCUS_06440 29794 31617 gene locus_tag LOCUS_06450 29794 31617 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480694.1 protein_id gnl|my_center|LOCUS_06450 31669 32427 gene locus_tag LOCUS_06460 31669 32427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 33326 32514 gene locus_tag LOCUS_06470 33326 32514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 33600 33316 gene locus_tag LOCUS_06480 33600 33316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 34493 33672 gene locus_tag LOCUS_06490 34493 33672 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_06490 35055 34633 gene locus_tag LOCUS_06500 gene arfB 35055 34633 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 protein_id gnl|my_center|LOCUS_06500 35208 36374 gene locus_tag LOCUS_06510 35208 36374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 36731 37180 gene locus_tag LOCUS_06520 36731 37180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 37197 37517 gene locus_tag LOCUS_06530 37197 37517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 38758 37625 gene locus_tag LOCUS_06540 38758 37625 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903126.1 protein_id gnl|my_center|LOCUS_06540 43910 38850 gene locus_tag LOCUS_06550 43910 38850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077139241.1 protein_id gnl|my_center|LOCUS_06550 44638 44057 gene locus_tag LOCUS_06560 44638 44057 CDS product MjaI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545491.1 protein_id gnl|my_center|LOCUS_06560 45567 44749 gene locus_tag LOCUS_06570 45567 44749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 45728 46567 gene locus_tag LOCUS_06580 45728 46567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 47310 46570 gene locus_tag LOCUS_06590 47310 46570 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067689.1 protein_id gnl|my_center|LOCUS_06590 47407 48411 gene locus_tag LOCUS_06600 47407 48411 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563310.1 protein_id gnl|my_center|LOCUS_06600 49127 48408 gene locus_tag LOCUS_06610 49127 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 49463 49269 gene locus_tag LOCUS_06620 49463 49269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 49707 50015 gene locus_tag LOCUS_06630 49707 50015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 50092 50343 gene locus_tag LOCUS_06640 50092 50343 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_06640 50835 50413 gene locus_tag LOCUS_06650 50835 50413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 51237 50875 gene locus_tag LOCUS_06660 gene frdD 51237 50875 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407771.1 protein_id gnl|my_center|LOCUS_06660 51638 51240 gene locus_tag LOCUS_06670 51638 51240 CDS product fumarate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298336.1 protein_id gnl|my_center|LOCUS_06670 52381 51635 gene locus_tag LOCUS_06680 gene sdhB 52381 51635 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407767.1 protein_id gnl|my_center|LOCUS_06680 54107 52395 gene locus_tag LOCUS_06690 gene frdA 54107 52395 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898925.1 protein_id gnl|my_center|LOCUS_06690 55138 54200 gene locus_tag LOCUS_06700 55138 54200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 56328 55180 gene locus_tag LOCUS_06710 56328 55180 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056261.1 protein_id gnl|my_center|LOCUS_06710 56733 56365 gene locus_tag LOCUS_06720 56733 56365 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_06720 57004 56741 gene locus_tag LOCUS_06730 57004 56741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 57373 57155 gene locus_tag LOCUS_06740 57373 57155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 57623 57829 gene locus_tag LOCUS_06750 57623 57829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 61673 57855 gene locus_tag LOCUS_06760 61673 57855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 61939 61766 gene locus_tag LOCUS_06770 61939 61766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 62141 61905 gene locus_tag LOCUS_06780 62141 61905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 64303 63794 gene locus_tag LOCUS_06790 64303 63794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence011 <1 989 gene locus_tag LOCUS_06800 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545027.1:lipoprotein-releasing ABC transporter permease subunit 1003 3423 gene locus_tag LOCUS_06810 1003 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3425 4417 gene locus_tag LOCUS_06820 3425 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4341 4790 gene locus_tag LOCUS_06830 4341 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4757 5377 gene locus_tag LOCUS_06840 4757 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 5387 7561 gene locus_tag LOCUS_06850 5387 7561 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140631.1 protein_id gnl|my_center|LOCUS_06850 8370 7642 gene locus_tag LOCUS_06860 8370 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 9872 8385 gene locus_tag LOCUS_06870 9872 8385 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090275.1 protein_id gnl|my_center|LOCUS_06870 10880 9876 gene locus_tag LOCUS_06880 gene dcyD 10880 9876 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365903.1 protein_id gnl|my_center|LOCUS_06880 11085 13376 gene locus_tag LOCUS_06890 11085 13376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_06890 13373 13876 gene locus_tag LOCUS_06900 13373 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 16159 14027 gene locus_tag LOCUS_06910 16159 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 18331 16199 gene locus_tag LOCUS_06920 18331 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 18485 21250 gene locus_tag LOCUS_06930 18485 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 23515 21278 gene locus_tag LOCUS_06940 23515 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 26258 23526 gene locus_tag LOCUS_06950 26258 23526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 27277 26393 gene locus_tag LOCUS_06960 27277 26393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 27680 29389 gene locus_tag LOCUS_06970 27680 29389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 29440 31392 gene locus_tag LOCUS_06980 29440 31392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 31501 34863 gene locus_tag LOCUS_06990 31501 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 34937 36493 gene locus_tag LOCUS_07000 34937 36493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 37348 36536 gene locus_tag LOCUS_07010 37348 36536 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_07010 38393 37371 gene locus_tag LOCUS_07020 38393 37371 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_07020 38451 39212 gene locus_tag LOCUS_07030 gene map 38451 39212 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_07030 39270 39563 gene locus_tag LOCUS_07040 39270 39563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 40199 39642 gene locus_tag LOCUS_07050 40199 39642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 43673 40215 gene locus_tag LOCUS_07060 43673 40215 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_07060 43971 44219 gene locus_tag LOCUS_07070 43971 44219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 44367 44283 gene locus_tag LOCUS_t00060 44367 44283 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44780 44388 gene locus_tag LOCUS_07080 44780 44388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 45582 44830 gene locus_tag LOCUS_07090 gene tpiA 45582 44830 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_07090 46789 45584 gene locus_tag LOCUS_07100 46789 45584 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_07100 47846 46794 gene locus_tag LOCUS_07110 47846 46794 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_07110 48615 47938 gene locus_tag LOCUS_07120 48615 47938 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403831.1 protein_id gnl|my_center|LOCUS_07120 50334 49054 gene locus_tag LOCUS_07130 gene ltrA 50334 49054 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097733.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07130 51982 54870 gene locus_tag LOCUS_07140 51982 54870 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927048.1 protein_id gnl|my_center|LOCUS_07140 54919 54995 gene locus_tag LOCUS_t00070 54919 54995 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 56177 55107 gene locus_tag LOCUS_07150 56177 55107 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_07150 56451 58022 gene locus_tag LOCUS_07160 56451 58022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 58031 61426 gene locus_tag LOCUS_07170 58031 61426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 61616 62380 gene locus_tag LOCUS_07180 61616 62380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 62371 63762 gene locus_tag LOCUS_07190 gene thrC 62371 63762 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence012 114 2570 gene locus_tag LOCUS_07200 114 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2684 2469 gene locus_tag LOCUS_07210 2684 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2867 6181 gene locus_tag LOCUS_07220 2867 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 6222 8693 gene locus_tag LOCUS_07230 6222 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 9473 8754 gene locus_tag LOCUS_07240 9473 8754 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_07240 9573 11882 gene locus_tag LOCUS_07250 9573 11882 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_07250 11925 12839 gene locus_tag LOCUS_07260 11925 12839 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_07260 12836 13741 gene locus_tag LOCUS_07270 12836 13741 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 protein_id gnl|my_center|LOCUS_07270 13884 14153 gene locus_tag LOCUS_07280 13884 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 14132 14521 gene locus_tag LOCUS_07290 14132 14521 CDS product clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327109.1 protein_id gnl|my_center|LOCUS_07290 14580 15707 gene locus_tag LOCUS_07300 14580 15707 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_07300 15998 15717 gene locus_tag LOCUS_07310 15998 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 15939 18560 gene locus_tag LOCUS_07320 15939 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 19506 18553 gene locus_tag LOCUS_07330 19506 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 19569 20033 gene locus_tag LOCUS_07340 19569 20033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 20050 20451 gene locus_tag LOCUS_07350 gene rsfS 20050 20451 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_07350 20451 21491 gene locus_tag LOCUS_07360 gene mtnA 20451 21491 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_07360 21488 22261 gene locus_tag LOCUS_07370 21488 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 22268 24148 gene locus_tag LOCUS_07380 22268 24148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 24150 24617 gene locus_tag LOCUS_07390 24150 24617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 24620 26392 gene locus_tag LOCUS_07400 gene mrdA 24620 26392 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_07400 26396 27634 gene locus_tag LOCUS_07410 gene rodA 26396 27634 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926830.1 protein_id gnl|my_center|LOCUS_07410 27635 28684 gene locus_tag LOCUS_07420 27635 28684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 29438 28686 gene locus_tag LOCUS_07430 29438 28686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 30588 29812 gene locus_tag LOCUS_07440 30588 29812 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_07440 30988 31788 gene locus_tag LOCUS_07450 gene mazG 30988 31788 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_07450 31798 32511 gene locus_tag LOCUS_07460 31798 32511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 33992 32460 gene locus_tag LOCUS_07470 33992 32460 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_07470 34138 34941 gene locus_tag LOCUS_07480 gene ppk2 34138 34941 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_07480 34985 35683 gene locus_tag LOCUS_07490 34985 35683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 35694 37319 gene locus_tag LOCUS_07500 35694 37319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 38322 37339 gene locus_tag LOCUS_07510 38322 37339 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 protein_id gnl|my_center|LOCUS_07510 38482 39915 gene locus_tag LOCUS_07520 38482 39915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 39912 40811 gene locus_tag LOCUS_07530 gene rfbD 39912 40811 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_07530 40741 41547 gene locus_tag LOCUS_07540 40741 41547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 41538 43220 gene locus_tag LOCUS_07550 41538 43220 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_07550 43290 43991 gene locus_tag LOCUS_07560 43290 43991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 44013 44786 gene locus_tag LOCUS_07570 44013 44786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_07570 44786 45574 gene locus_tag LOCUS_07580 44786 45574 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066886.1 protein_id gnl|my_center|LOCUS_07580 45564 46511 gene locus_tag LOCUS_07590 45564 46511 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_07590 46523 49513 gene locus_tag LOCUS_07600 46523 49513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 50044 49685 gene locus_tag LOCUS_07610 50044 49685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 50474 50193 gene locus_tag LOCUS_07620 50474 50193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 51652 51266 gene locus_tag LOCUS_07630 51652 51266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 52863 53420 gene locus_tag LOCUS_07640 52863 53420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 53630 55807 gene locus_tag LOCUS_07650 53630 55807 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_07650 55812 56375 gene locus_tag LOCUS_07660 gene pabA 55812 56375 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_07660 56386 57396 gene locus_tag LOCUS_07670 gene trpD 56386 57396 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_07670 57399 58178 gene locus_tag LOCUS_07680 gene trpC 57399 58178 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919765.1 protein_id gnl|my_center|LOCUS_07680 58175 59158 gene locus_tag LOCUS_07690 gene trpS 58175 59158 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_07690 59169 59441 gene locus_tag LOCUS_07700 59169 59441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 59426 60538 gene locus_tag LOCUS_07710 59426 60538 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839036.1 protein_id gnl|my_center|LOCUS_07710 60542 61765 gene locus_tag LOCUS_07720 gene aroA 60542 61765 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246068.1 protein_id gnl|my_center|LOCUS_07720 61768 61908 gene locus_tag LOCUS_07730 61768 61908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 61905 62753 gene locus_tag LOCUS_07740 gene aroE 61905 62753 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence013 431 1927 gene locus_tag LOCUS_07750 431 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2198 2022 gene locus_tag LOCUS_07760 2198 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3002 2475 gene locus_tag LOCUS_07770 3002 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5151 4606 gene locus_tag LOCUS_07780 5151 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7444 5510 gene locus_tag LOCUS_07790 7444 5510 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 protein_id gnl|my_center|LOCUS_07790 7773 7549 gene locus_tag LOCUS_07800 7773 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8992 7856 gene locus_tag LOCUS_07810 8992 7856 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_07810 9246 8989 gene locus_tag LOCUS_07820 9246 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 10091 9294 gene locus_tag LOCUS_07830 10091 9294 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_07830 10995 10117 gene locus_tag LOCUS_07840 10995 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 11970 11014 gene locus_tag LOCUS_07850 11970 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 12969 12058 gene locus_tag LOCUS_07860 12969 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 13083 14138 gene locus_tag LOCUS_07870 13083 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 16887 14410 gene locus_tag LOCUS_07880 16887 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 17309 16992 gene locus_tag LOCUS_07890 17309 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 17612 17463 gene locus_tag LOCUS_07900 17612 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 18696 17797 gene locus_tag LOCUS_07910 18696 17797 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_07910 19794 18721 gene locus_tag LOCUS_07920 19794 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 20027 20782 gene locus_tag LOCUS_07930 20027 20782 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_07930 20798 21448 gene locus_tag LOCUS_07940 20798 21448 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 protein_id gnl|my_center|LOCUS_07940 21574 22299 gene locus_tag LOCUS_07950 21574 22299 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775994.1 protein_id gnl|my_center|LOCUS_07950 22496 22329 gene locus_tag LOCUS_07960 22496 22329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 22864 22532 gene locus_tag LOCUS_07970 22864 22532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 23762 22878 gene locus_tag LOCUS_07980 23762 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 24215 23898 gene locus_tag LOCUS_07990 24215 23898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 26559 24940 gene locus_tag LOCUS_08000 26559 24940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 27565 26651 gene locus_tag LOCUS_08010 27565 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08010 28633 27611 gene locus_tag LOCUS_08020 28633 27611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08020 29925 28927 gene locus_tag LOCUS_08030 29925 28927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 30953 29985 gene locus_tag LOCUS_08040 30953 29985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 31827 31099 gene locus_tag LOCUS_08050 31827 31099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 34973 31851 gene locus_tag LOCUS_08060 34973 31851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 37627 34973 gene locus_tag LOCUS_08070 37627 34973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 39295 37640 gene locus_tag LOCUS_08080 39295 37640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 39999 39601 gene locus_tag LOCUS_08090 39999 39601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 42012 40180 gene locus_tag LOCUS_08100 42012 40180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 43286 42087 gene locus_tag LOCUS_08110 43286 42087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 44353 43283 gene locus_tag LOCUS_08120 44353 43283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 46853 44355 gene locus_tag LOCUS_08130 46853 44355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 47266 47072 gene locus_tag LOCUS_08140 47266 47072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 48533 47256 gene locus_tag LOCUS_08150 48533 47256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 50767 48623 gene locus_tag LOCUS_08160 50767 48623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 51215 50859 gene locus_tag LOCUS_08170 51215 50859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 51899 51333 gene locus_tag LOCUS_08180 51899 51333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 52454 51915 gene locus_tag LOCUS_08190 52454 51915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 53074 52451 gene locus_tag LOCUS_08200 53074 52451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 54222 53071 gene locus_tag LOCUS_08210 54222 53071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 54975 54715 gene locus_tag LOCUS_08220 54975 54715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 55355 55065 gene locus_tag LOCUS_08230 55355 55065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 58791 55639 gene locus_tag LOCUS_08240 58791 55639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 62367 59230 gene locus_tag LOCUS_08250 62367 59230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence014 723 52 gene locus_tag LOCUS_08260 723 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1416 976 gene locus_tag LOCUS_08270 1416 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 1842 1552 gene locus_tag LOCUS_08280 1842 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2719 1859 gene locus_tag LOCUS_08290 2719 1859 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_08290 2833 3726 gene locus_tag LOCUS_08300 2833 3726 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_08300 4182 3820 gene locus_tag LOCUS_08310 4182 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4427 4179 gene locus_tag LOCUS_08320 4427 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6050 4767 gene locus_tag LOCUS_08330 6050 4767 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_08330 7507 6053 gene locus_tag LOCUS_08340 7507 6053 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_08340 7728 7504 gene locus_tag LOCUS_08350 7728 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8981 7725 gene locus_tag LOCUS_08360 8981 7725 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_08360 10255 8978 gene locus_tag LOCUS_08370 10255 8978 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_08370 12378 10252 gene locus_tag LOCUS_08380 12378 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 13616 12375 gene locus_tag LOCUS_08390 13616 12375 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_08390 14860 13613 gene locus_tag LOCUS_08400 14860 13613 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_08400 16211 14874 gene locus_tag LOCUS_08410 16211 14874 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_08410 17296 16208 gene locus_tag LOCUS_08420 17296 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 17841 17572 gene locus_tag LOCUS_08430 17841 17572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18130 19344 gene locus_tag LOCUS_08440 18130 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 19390 20196 gene locus_tag LOCUS_08450 19390 20196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 20321 20572 gene locus_tag LOCUS_08460 20321 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 21745 20618 gene locus_tag LOCUS_08470 21745 20618 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_08470 23136 21742 gene locus_tag LOCUS_08480 23136 21742 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_08480 23232 25367 gene locus_tag LOCUS_08490 23232 25367 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_08490 25836 25444 gene locus_tag LOCUS_08500 25836 25444 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414592.1 protein_id gnl|my_center|LOCUS_08500 26114 25833 gene locus_tag LOCUS_08510 26114 25833 CDS product antitoxin VapB23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003913411.1 protein_id gnl|my_center|LOCUS_08510 26178 26936 gene locus_tag LOCUS_08520 26178 26936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 27152 30466 gene locus_tag LOCUS_08530 27152 30466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 32187 30604 gene locus_tag LOCUS_08540 32187 30604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 33728 32196 gene locus_tag LOCUS_08550 33728 32196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 34936 33860 gene locus_tag LOCUS_08560 34936 33860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_08560 36354 34933 gene locus_tag LOCUS_08570 36354 34933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 38495 36354 gene locus_tag LOCUS_08580 38495 36354 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146514631.1 protein_id gnl|my_center|LOCUS_08580 38621 39832 gene locus_tag LOCUS_08590 38621 39832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 40821 39841 gene locus_tag LOCUS_08600 40821 39841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117899.1 protein_id gnl|my_center|LOCUS_08600 41808 40834 gene locus_tag LOCUS_08610 41808 40834 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 protein_id gnl|my_center|LOCUS_08610 42397 41927 gene locus_tag LOCUS_08620 42397 41927 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_08620 42909 42394 gene locus_tag LOCUS_08630 42909 42394 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095512524.1 protein_id gnl|my_center|LOCUS_08630 45343 43073 gene locus_tag LOCUS_08640 45343 43073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 46171 45362 gene locus_tag LOCUS_08650 46171 45362 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036011.1 protein_id gnl|my_center|LOCUS_08650 46925 46164 gene locus_tag LOCUS_08660 46925 46164 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_08660 48417 46930 gene locus_tag LOCUS_08670 48417 46930 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836208.1 protein_id gnl|my_center|LOCUS_08670 49814 48432 gene locus_tag LOCUS_08680 gene cysS 49814 48432 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_08680 50865 49858 gene locus_tag LOCUS_08690 50865 49858 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162273421.1 protein_id gnl|my_center|LOCUS_08690 51135 52196 gene locus_tag LOCUS_08700 51135 52196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 52196 53257 gene locus_tag LOCUS_08710 52196 53257 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_08710 53286 54281 gene locus_tag LOCUS_08720 53286 54281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 54339 55043 gene locus_tag LOCUS_08730 gene lepB 54339 55043 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_08730 55056 56750 gene locus_tag LOCUS_08740 gene arc 55056 56750 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_08740 56759 58303 gene locus_tag LOCUS_08750 gene dop 56759 58303 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226726.1 protein_id gnl|my_center|LOCUS_08750 58300 58491 gene locus_tag LOCUS_08760 58300 58491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 58498 59256 gene locus_tag LOCUS_08770 gene prcB 58498 59256 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_08770 59262 60029 gene locus_tag LOCUS_08780 gene prcA 59262 60029 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence015 52 243 gene locus_tag LOCUS_08790 52 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 384 1766 gene locus_tag LOCUS_08800 384 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1895 3844 gene locus_tag LOCUS_08810 1895 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3876 5909 gene locus_tag LOCUS_08820 3876 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5936 6766 gene locus_tag LOCUS_08830 5936 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 6772 8196 gene locus_tag LOCUS_08840 gene betC 6772 8196 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974043.1 protein_id gnl|my_center|LOCUS_08840 8212 10425 gene locus_tag LOCUS_08850 8212 10425 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063907.1 protein_id gnl|my_center|LOCUS_08850 10556 12133 gene locus_tag LOCUS_08860 10556 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 13508 12138 gene locus_tag LOCUS_08870 13508 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 14283 13528 gene locus_tag LOCUS_08880 14283 13528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 14349 15521 gene locus_tag LOCUS_08890 14349 15521 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_08890 16493 15537 gene locus_tag LOCUS_08900 16493 15537 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_08900 17508 16507 gene locus_tag LOCUS_08910 17508 16507 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339822.1 protein_id gnl|my_center|LOCUS_08910 17717 18190 gene locus_tag LOCUS_08920 gene infC 17717 18190 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942163.1 protein_id gnl|my_center|LOCUS_08920 19122 18322 gene locus_tag LOCUS_08930 19122 18322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 19204 20943 gene locus_tag LOCUS_08940 19204 20943 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880808.1 protein_id gnl|my_center|LOCUS_08940 21280 20951 gene locus_tag LOCUS_08950 21280 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 21620 24454 gene locus_tag LOCUS_08960 21620 24454 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_08960 24475 24999 gene locus_tag LOCUS_08970 24475 24999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 25003 25227 gene locus_tag LOCUS_08980 25003 25227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 25237 26499 gene locus_tag LOCUS_08990 gene larA 25237 26499 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_08990 27398 26496 gene locus_tag LOCUS_09000 27398 26496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 28350 27385 gene locus_tag LOCUS_09010 28350 27385 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_09010 31399 28364 gene locus_tag LOCUS_09020 31399 28364 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839328.1 protein_id gnl|my_center|LOCUS_09020 32664 31396 gene locus_tag LOCUS_09030 32664 31396 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838314.1 protein_id gnl|my_center|LOCUS_09030 32869 33339 gene locus_tag LOCUS_09040 gene greA 32869 33339 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940503.1 protein_id gnl|my_center|LOCUS_09040 33504 33580 gene locus_tag LOCUS_t00080 33504 33580 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 33600 33675 gene locus_tag LOCUS_t00090 33600 33675 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33871 33946 gene locus_tag LOCUS_t00100 33871 33946 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 33969 34157 gene locus_tag LOCUS_09050 gene secE 33969 34157 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630510.1 protein_id gnl|my_center|LOCUS_09050 34261 34806 gene locus_tag LOCUS_09060 gene nusG 34261 34806 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_09060 34825 35247 gene locus_tag LOCUS_09070 gene rplK 34825 35247 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_09070 35285 35983 gene locus_tag LOCUS_09080 gene rplA 35285 35983 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002020168.1 protein_id gnl|my_center|LOCUS_09080 36000 36533 gene locus_tag LOCUS_09090 gene rplJ 36000 36533 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_09090 36582 36992 gene locus_tag LOCUS_09100 gene rplL 36582 36992 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_09100 37180 40896 gene locus_tag LOCUS_09110 gene rpoB 37180 40896 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_09110 40935 45023 gene locus_tag LOCUS_09120 gene rpoC 40935 45023 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_09120 45258 45467 gene locus_tag LOCUS_09130 45258 45467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 45479 45949 gene locus_tag LOCUS_09140 gene rpsG 45479 45949 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417210.1 protein_id gnl|my_center|LOCUS_09140 45966 48044 gene locus_tag LOCUS_09150 gene fusA 45966 48044 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_09150 48089 49279 gene locus_tag LOCUS_09160 gene tuf 48089 49279 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_09160 49308 49616 gene locus_tag LOCUS_09170 gene rpsJ 49308 49616 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 protein_id gnl|my_center|LOCUS_09170 49624 50262 gene locus_tag LOCUS_09180 gene rplD 49624 50262 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_09180 50246 50551 gene locus_tag LOCUS_09190 gene rplW 50246 50551 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_09190 50568 51401 gene locus_tag LOCUS_09200 gene rplB 50568 51401 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_09200 51411 51698 gene locus_tag LOCUS_09210 gene rpsS 51411 51698 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_09210 51706 52053 gene locus_tag LOCUS_09220 gene rplV 51706 52053 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701308.1 protein_id gnl|my_center|LOCUS_09220 52064 52720 gene locus_tag LOCUS_09230 gene rpsC 52064 52720 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403801.1 protein_id gnl|my_center|LOCUS_09230 52739 53146 gene locus_tag LOCUS_09240 gene rplP 52739 53146 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567820.1 protein_id gnl|my_center|LOCUS_09240 53151 53366 gene locus_tag LOCUS_09250 gene rpmC 53151 53366 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854304.1 protein_id gnl|my_center|LOCUS_09250 53375 53632 gene locus_tag LOCUS_09260 gene rpsQ 53375 53632 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301190.1 protein_id gnl|my_center|LOCUS_09260 53661 54029 gene locus_tag LOCUS_09270 gene rplN 53661 54029 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_09270 54041 54358 gene locus_tag LOCUS_09280 gene rplX 54041 54358 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_09280 54362 54907 gene locus_tag LOCUS_09290 gene rplE 54362 54907 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_09290 54927 55112 gene locus_tag LOCUS_09300 54927 55112 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_09300 55131 55529 gene locus_tag LOCUS_09310 gene rpsH 55131 55529 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_09310 55555 56112 gene locus_tag LOCUS_09320 gene rplF 55555 56112 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357306.1 protein_id gnl|my_center|LOCUS_09320 56112 56486 gene locus_tag LOCUS_09330 gene rplR 56112 56486 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 protein_id gnl|my_center|LOCUS_09330 56498 57031 gene locus_tag LOCUS_09340 gene rpsE 56498 57031 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_09340 57038 57217 gene locus_tag LOCUS_09350 gene rpmD 57038 57217 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869911.1 protein_id gnl|my_center|LOCUS_09350 57234 57683 gene locus_tag LOCUS_09360 gene rplO 57234 57683 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence016 1060 2841 gene locus_tag LOCUS_09370 1060 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2932 5547 gene locus_tag LOCUS_09380 2932 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5535 6842 gene locus_tag LOCUS_09390 5535 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6865 7629 gene locus_tag LOCUS_09400 6865 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 7711 12336 gene locus_tag LOCUS_09410 7711 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 12333 14243 gene locus_tag LOCUS_09420 12333 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 14247 16229 gene locus_tag LOCUS_09430 14247 16229 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_09430 16418 17710 gene locus_tag LOCUS_09440 16418 17710 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_09440 18784 17735 gene locus_tag LOCUS_09450 18784 17735 CDS product malate/lactate/ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014496845.1 protein_id gnl|my_center|LOCUS_09450 19209 18784 gene locus_tag LOCUS_09460 19209 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 20227 19226 gene locus_tag LOCUS_09470 20227 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 20498 22039 gene locus_tag LOCUS_09480 20498 22039 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_09480 22045 22224 gene locus_tag LOCUS_09490 22045 22224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 22221 23819 gene locus_tag LOCUS_09500 22221 23819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 23892 24707 gene locus_tag LOCUS_09510 23892 24707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 24725 26689 gene locus_tag LOCUS_09520 24725 26689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 26740 28260 gene locus_tag LOCUS_09530 26740 28260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 28277 28795 gene locus_tag LOCUS_09540 28277 28795 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415815.1 protein_id gnl|my_center|LOCUS_09540 28799 30043 gene locus_tag LOCUS_09550 28799 30043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 30068 30610 gene locus_tag LOCUS_09560 30068 30610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 30615 30935 gene locus_tag LOCUS_09570 30615 30935 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258148.1 protein_id gnl|my_center|LOCUS_09570 32546 30993 gene locus_tag LOCUS_09580 32546 30993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 32650 33801 gene locus_tag LOCUS_09590 32650 33801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 33912 35213 gene locus_tag LOCUS_09600 33912 35213 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975020.1 protein_id gnl|my_center|LOCUS_09600 35952 35227 gene locus_tag LOCUS_09610 35952 35227 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_09610 36463 36155 gene locus_tag LOCUS_09620 36463 36155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 37190 36555 gene locus_tag LOCUS_09630 37190 36555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 39215 37194 gene locus_tag LOCUS_09640 39215 37194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 39533 39339 gene locus_tag LOCUS_09650 39533 39339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 39444 40616 gene locus_tag LOCUS_09660 39444 40616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615918.1 protein_id gnl|my_center|LOCUS_09660 40678 40893 gene locus_tag LOCUS_09670 40678 40893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 41117 42190 gene locus_tag LOCUS_09680 41117 42190 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_09680 43213 42323 gene locus_tag LOCUS_09690 43213 42323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 43451 44581 gene locus_tag LOCUS_09700 43451 44581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 47188 44591 gene locus_tag LOCUS_09710 47188 44591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 48180 47293 gene locus_tag LOCUS_09720 48180 47293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 48367 49947 gene locus_tag LOCUS_09730 48367 49947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 50047 51057 gene locus_tag LOCUS_09740 50047 51057 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970647.1 protein_id gnl|my_center|LOCUS_09740 51706 51146 gene locus_tag LOCUS_09750 51706 51146 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957123.1 protein_id gnl|my_center|LOCUS_09750 53399 51816 gene locus_tag LOCUS_09760 53399 51816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 54369 53440 gene locus_tag LOCUS_09770 54369 53440 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_09770 55470 54511 gene locus_tag LOCUS_09780 55470 54511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 56329 55475 gene locus_tag LOCUS_09790 56329 55475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence017 262 1401 gene locus_tag LOCUS_09800 262 1401 CDS product ISAs1-like element ISEc1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014966182.1 protein_id gnl|my_center|LOCUS_09800 2480 1425 gene locus_tag LOCUS_09810 gene msrB 2480 1425 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825088.1 protein_id gnl|my_center|LOCUS_09810 3882 2542 gene locus_tag LOCUS_09820 3882 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3790 3981 gene locus_tag LOCUS_09830 3790 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4200 4715 gene locus_tag LOCUS_09840 4200 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 4976 5383 gene locus_tag LOCUS_09850 4976 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5390 6232 gene locus_tag LOCUS_09860 5390 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 7072 6257 gene locus_tag LOCUS_09870 7072 6257 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_09870 7149 8522 gene locus_tag LOCUS_09880 7149 8522 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_09880 8526 10574 gene locus_tag LOCUS_09890 8526 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 10856 10605 gene locus_tag LOCUS_09900 10856 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 11143 10853 gene locus_tag LOCUS_09910 11143 10853 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_09910 11466 11140 gene locus_tag LOCUS_09920 11466 11140 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_09920 11570 13510 gene locus_tag LOCUS_09930 11570 13510 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922636.1 protein_id gnl|my_center|LOCUS_09930 13627 15636 gene locus_tag LOCUS_09940 13627 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 15767 16234 gene locus_tag LOCUS_09950 15767 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 16283 18157 gene locus_tag LOCUS_09960 16283 18157 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_09960 18173 19192 gene locus_tag LOCUS_09970 18173 19192 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_09970 19205 19723 gene locus_tag LOCUS_09980 19205 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 19774 20256 gene locus_tag LOCUS_09990 19774 20256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 20505 20269 gene locus_tag LOCUS_10000 20505 20269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 21550 20519 gene locus_tag LOCUS_10010 gene hemE 21550 20519 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_10010 23885 21555 gene locus_tag LOCUS_10020 23885 21555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 24061 25275 gene locus_tag LOCUS_10030 24061 25275 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_10030 25315 25920 gene locus_tag LOCUS_10040 25315 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 25924 27024 gene locus_tag LOCUS_10050 25924 27024 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272343.1 protein_id gnl|my_center|LOCUS_10050 27014 28024 gene locus_tag LOCUS_10060 27014 28024 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612378.1 protein_id gnl|my_center|LOCUS_10060 28021 28767 gene locus_tag LOCUS_10070 28021 28767 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_10070 31335 28756 gene locus_tag LOCUS_10080 31335 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 32055 31372 gene locus_tag LOCUS_10090 32055 31372 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_10090 32789 32052 gene locus_tag LOCUS_10100 32789 32052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 33933 32869 gene locus_tag LOCUS_10110 33933 32869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 35388 34444 gene locus_tag LOCUS_10120 35388 34444 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891503.1 protein_id gnl|my_center|LOCUS_10120 35842 35381 gene locus_tag LOCUS_10130 35842 35381 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_10130 36024 37274 gene locus_tag LOCUS_10140 36024 37274 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404704.1 protein_id gnl|my_center|LOCUS_10140 37394 39289 gene locus_tag LOCUS_10150 gene ftsH 37394 39289 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_10150 39741 39286 gene locus_tag LOCUS_10160 39741 39286 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_10160 39815 41041 gene locus_tag LOCUS_10170 39815 41041 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_10170 41127 42422 gene locus_tag LOCUS_10180 41127 42422 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_10180 42412 42858 gene locus_tag LOCUS_10190 42412 42858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 42882 43715 gene locus_tag LOCUS_10200 42882 43715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 45275 44079 gene locus_tag LOCUS_10210 45275 44079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_10210 45429 47831 gene locus_tag LOCUS_10220 45429 47831 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_10220 47849 48733 gene locus_tag LOCUS_10230 47849 48733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 48867 49631 gene locus_tag LOCUS_10240 48867 49631 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_10240 49642 50823 gene locus_tag LOCUS_10250 49642 50823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 50836 51612 gene locus_tag LOCUS_10260 50836 51612 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530480.1 protein_id gnl|my_center|LOCUS_10260 51614 55012 gene locus_tag LOCUS_10270 51614 55012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence018 1550 678 gene locus_tag LOCUS_10280 1550 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2637 1849 gene locus_tag LOCUS_10290 2637 1849 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479631.1 protein_id gnl|my_center|LOCUS_10290 3123 2710 gene locus_tag LOCUS_10300 3123 2710 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263483.1 protein_id gnl|my_center|LOCUS_10300 4124 3381 gene locus_tag LOCUS_10310 4124 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7422 4237 gene locus_tag LOCUS_10320 7422 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 7903 7472 gene locus_tag LOCUS_10330 7903 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 8737 8444 gene locus_tag LOCUS_10340 8737 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 10835 8775 gene locus_tag LOCUS_10350 10835 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 14346 11191 gene locus_tag LOCUS_10360 14346 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 14550 15380 gene locus_tag LOCUS_10370 14550 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 15391 15948 gene locus_tag LOCUS_10380 gene efp 15391 15948 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_10380 15967 16422 gene locus_tag LOCUS_10390 gene accB 15967 16422 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931852.1 protein_id gnl|my_center|LOCUS_10390 16429 17763 gene locus_tag LOCUS_10400 gene accC 16429 17763 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_10400 17795 18187 gene locus_tag LOCUS_10410 gene gcvH 17795 18187 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_10410 18341 18844 gene locus_tag LOCUS_10420 18341 18844 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932408.1 protein_id gnl|my_center|LOCUS_10420 18858 19643 gene locus_tag LOCUS_10430 18858 19643 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_10430 19633 20289 gene locus_tag LOCUS_10440 gene scpB 19633 20289 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404243.1 protein_id gnl|my_center|LOCUS_10440 20276 21025 gene locus_tag LOCUS_10450 20276 21025 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_10450 21022 21693 gene locus_tag LOCUS_10460 gene cmk 21022 21693 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_10460 21775 23649 gene locus_tag LOCUS_10470 gene rpsA 21775 23649 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_10470 23783 26362 gene locus_tag LOCUS_10480 gene mutS 23783 26362 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_10480 26352 26726 gene locus_tag LOCUS_10490 26352 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 26763 27071 gene locus_tag LOCUS_10500 26763 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 27228 27485 gene locus_tag LOCUS_10510 27228 27485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 27489 27755 gene locus_tag LOCUS_10520 27489 27755 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_10520 28039 28863 gene locus_tag LOCUS_10530 28039 28863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 29953 29087 gene locus_tag LOCUS_10540 29953 29087 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_10540 30581 29946 gene locus_tag LOCUS_10550 30581 29946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_10550 30899 31642 gene locus_tag LOCUS_10560 gene rlmB 30899 31642 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393958.1 protein_id gnl|my_center|LOCUS_10560 31639 34101 gene locus_tag LOCUS_10570 31639 34101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 34490 34143 gene locus_tag LOCUS_10580 34490 34143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 34389 34649 gene locus_tag LOCUS_10590 34389 34649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 34646 35233 gene locus_tag LOCUS_10600 34646 35233 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_10600 35230 36141 gene locus_tag LOCUS_10610 35230 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 36138 38588 gene locus_tag LOCUS_10620 gene priA 36138 38588 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405449.1 protein_id gnl|my_center|LOCUS_10620 38598 40808 gene locus_tag LOCUS_10630 38598 40808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 40810 41463 gene locus_tag LOCUS_10640 40810 41463 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_10640 41849 41460 gene locus_tag LOCUS_10650 41849 41460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 42276 41830 gene locus_tag LOCUS_10660 42276 41830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 43881 42283 gene locus_tag LOCUS_10670 43881 42283 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_10670 47097 43888 gene locus_tag LOCUS_10680 47097 43888 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_10680 48341 47094 gene locus_tag LOCUS_10690 48341 47094 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930722.1 protein_id gnl|my_center|LOCUS_10690 49780 48338 gene locus_tag LOCUS_10700 49780 48338 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035535025.1 protein_id gnl|my_center|LOCUS_10700 50643 49777 gene locus_tag LOCUS_10710 50643 49777 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978441.1 protein_id gnl|my_center|LOCUS_10710 51654 50719 gene locus_tag LOCUS_10720 51654 50719 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_10720 52421 51654 gene locus_tag LOCUS_10730 52421 51654 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_10730 52704 53168 gene locus_tag LOCUS_10740 52704 53168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence019 1408 167 gene locus_tag LOCUS_10750 gene rhaI 1408 167 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582814.1 protein_id gnl|my_center|LOCUS_10750 2453 1491 gene locus_tag LOCUS_10760 2453 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3638 2715 gene locus_tag LOCUS_10770 gene pyrB 3638 2715 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871106.1 protein_id gnl|my_center|LOCUS_10770 4086 3649 gene locus_tag LOCUS_10780 gene fabZ 4086 3649 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_10780 4619 4083 gene locus_tag LOCUS_10790 4619 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5018 4716 gene locus_tag LOCUS_10800 5018 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810433.1 protein_id gnl|my_center|LOCUS_10800 7589 5187 gene locus_tag LOCUS_10810 gene bamA 7589 5187 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_10810 10059 7591 gene locus_tag LOCUS_10820 10059 7591 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_10820 11262 10198 gene locus_tag LOCUS_10830 11262 10198 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_10830 11771 11265 gene locus_tag LOCUS_10840 11771 11265 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_10840 12460 11768 gene locus_tag LOCUS_10850 12460 11768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421592.1 protein_id gnl|my_center|LOCUS_10850 13727 12462 gene locus_tag LOCUS_10860 13727 12462 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_10860 14707 13724 gene locus_tag LOCUS_10870 gene prfB 14707 13724 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_10870 15333 14806 gene locus_tag LOCUS_10880 15333 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 17014 15341 gene locus_tag LOCUS_10890 17014 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 17651 17007 gene locus_tag LOCUS_10900 17651 17007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 19966 17648 gene locus_tag LOCUS_10910 19966 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 22211 20070 gene locus_tag LOCUS_10920 22211 20070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_10920 23205 22204 gene locus_tag LOCUS_10930 gene tsaD 23205 22204 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_10930 24175 23216 gene locus_tag LOCUS_10940 24175 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 24432 24238 gene locus_tag LOCUS_10950 24432 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 24999 24529 gene locus_tag LOCUS_10960 24999 24529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 25429 25001 gene locus_tag LOCUS_10970 25429 25001 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_10970 25688 25431 gene locus_tag LOCUS_10980 gene moaD 25688 25431 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_10980 27854 25794 gene locus_tag LOCUS_10990 27854 25794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 35612 27957 gene locus_tag LOCUS_11000 35612 27957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 38564 36120 gene locus_tag LOCUS_11010 38564 36120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933858.1 protein_id gnl|my_center|LOCUS_11010 39937 38825 gene locus_tag LOCUS_11020 39937 38825 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250672.1 protein_id gnl|my_center|LOCUS_11020 40569 39973 gene locus_tag LOCUS_11030 gene hisB 40569 39973 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_11030 41870 40566 gene locus_tag LOCUS_11040 gene hisD 41870 40566 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404855.1 protein_id gnl|my_center|LOCUS_11040 42748 41870 gene locus_tag LOCUS_11050 gene hisG 42748 41870 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_11050 43678 42761 gene locus_tag LOCUS_11060 43678 42761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 43908 44084 gene locus_tag LOCUS_11070 43908 44084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 44128 45186 gene locus_tag LOCUS_11080 44128 45186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 45192 45794 gene locus_tag LOCUS_11090 45192 45794 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_11090 45796 47532 gene locus_tag LOCUS_11100 45796 47532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257958.1 protein_id gnl|my_center|LOCUS_11100 47529 49313 gene locus_tag LOCUS_11110 47529 49313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_11110 49567 49316 gene locus_tag LOCUS_11120 49567 49316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 49704 51185 gene locus_tag LOCUS_11130 49704 51185 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_11130 51190 51879 gene locus_tag LOCUS_11140 51190 51879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 51876 52610 gene locus_tag LOCUS_11150 51876 52610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 52614 53639 gene locus_tag LOCUS_11160 52614 53639 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729799.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence020 4259 2301 gene locus_tag LOCUS_11170 gene gyrB 4259 2301 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_11170 4615 4256 gene locus_tag LOCUS_11180 4615 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5678 4590 gene locus_tag LOCUS_11190 gene recF 5678 4590 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391554.1 protein_id gnl|my_center|LOCUS_11190 6856 5693 gene locus_tag LOCUS_11200 gene dnaN 6856 5693 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_11200 8907 7513 gene locus_tag LOCUS_11210 gene dnaA 8907 7513 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_11210 9749 11467 gene locus_tag LOCUS_11220 gene yidC 9749 11467 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_11220 11554 12852 gene locus_tag LOCUS_11230 gene mnmE 11554 12852 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_11230 13899 14516 gene locus_tag LOCUS_11240 13899 14516 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_11240 14748 15239 gene locus_tag LOCUS_11250 14748 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 15242 17110 gene locus_tag LOCUS_11260 15242 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 17180 18703 gene locus_tag LOCUS_11270 gene rng 17180 18703 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_11270 18779 19096 gene locus_tag LOCUS_11280 gene rplU 18779 19096 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258181.1 protein_id gnl|my_center|LOCUS_11280 19116 19370 gene locus_tag LOCUS_11290 gene rpmA 19116 19370 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056021.1 protein_id gnl|my_center|LOCUS_11290 20211 19459 gene locus_tag LOCUS_11300 20211 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 20371 21528 gene locus_tag LOCUS_11310 gene sucC 20371 21528 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_11310 21542 22411 gene locus_tag LOCUS_11320 gene sucD 21542 22411 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_11320 23261 22446 gene locus_tag LOCUS_11330 23261 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 24234 23293 gene locus_tag LOCUS_11340 24234 23293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 25334 24231 gene locus_tag LOCUS_11350 25334 24231 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_11350 25719 26252 gene locus_tag LOCUS_11360 25719 26252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 26783 26301 gene locus_tag LOCUS_11370 26783 26301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 27527 26832 gene locus_tag LOCUS_11380 27527 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 28144 27527 gene locus_tag LOCUS_11390 28144 27527 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_11390 28394 28215 gene locus_tag LOCUS_11400 28394 28215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 29060 28401 gene locus_tag LOCUS_11410 gene ccsA 29060 28401 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_11410 29734 29057 gene locus_tag LOCUS_11420 29734 29057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 30471 29731 gene locus_tag LOCUS_11430 30471 29731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_11430 31544 30471 gene locus_tag LOCUS_11440 31544 30471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 31835 31548 gene locus_tag LOCUS_11450 31835 31548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 34484 32028 gene locus_tag LOCUS_11460 34484 32028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 34951 34517 gene locus_tag LOCUS_11470 34951 34517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 36156 35017 gene locus_tag LOCUS_11480 36156 35017 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_11480 37668 36160 gene locus_tag LOCUS_11490 gene mucD 37668 36160 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_11490 39224 37665 gene locus_tag LOCUS_11500 39224 37665 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_11500 42915 39247 gene locus_tag LOCUS_11510 42915 39247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 43006 43863 gene locus_tag LOCUS_11520 gene ispE 43006 43863 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923490.1 protein_id gnl|my_center|LOCUS_11520 43894 43968 gene locus_tag LOCUS_t00110 43894 43968 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 44013 44732 gene locus_tag LOCUS_11530 44013 44732 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_11530 44735 45292 gene locus_tag LOCUS_11540 gene pth 44735 45292 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281463.1 protein_id gnl|my_center|LOCUS_11540 45328 47367 gene locus_tag LOCUS_11550 45328 47367 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_11550 47407 47958 gene locus_tag LOCUS_11560 47407 47958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 47974 48786 gene locus_tag LOCUS_11570 47974 48786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 48831 49274 gene locus_tag LOCUS_11580 gene rplI 48831 49274 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_11580 49315 50244 gene locus_tag LOCUS_11590 49315 50244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 50315 50413 gene locus_tag LOCUS_t00120 50315 50413 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence021 1695 175 gene locus_tag LOCUS_11600 1695 175 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_11600 3116 1758 gene locus_tag LOCUS_11610 3116 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4685 3126 gene locus_tag LOCUS_11620 4685 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6379 4670 gene locus_tag LOCUS_11630 6379 4670 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_11630 6702 7595 gene locus_tag LOCUS_11640 6702 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 7793 8410 gene locus_tag LOCUS_11650 7793 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 8412 10298 gene locus_tag LOCUS_11660 8412 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 10322 12391 gene locus_tag LOCUS_11670 10322 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 12404 14749 gene locus_tag LOCUS_11680 12404 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 14808 17447 gene locus_tag LOCUS_11690 14808 17447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 17444 19051 gene locus_tag LOCUS_11700 17444 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 19076 20296 gene locus_tag LOCUS_11710 19076 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 20375 21397 gene locus_tag LOCUS_11720 20375 21397 CDS product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194073.1 protein_id gnl|my_center|LOCUS_11720 21407 22915 gene locus_tag LOCUS_11730 gene araG 21407 22915 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705779.1 protein_id gnl|my_center|LOCUS_11730 23009 23908 gene locus_tag LOCUS_11740 gene araH 23009 23908 CDS product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987903.1 protein_id gnl|my_center|LOCUS_11740 24061 25212 gene locus_tag LOCUS_11750 24061 25212 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_11750 25284 26069 gene locus_tag LOCUS_11760 25284 26069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 26105 27175 gene locus_tag LOCUS_11770 26105 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 27187 27936 gene locus_tag LOCUS_11780 27187 27936 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_11780 28013 28909 gene locus_tag LOCUS_11790 28013 28909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 29059 31356 gene locus_tag LOCUS_11800 29059 31356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 31359 32216 gene locus_tag LOCUS_11810 31359 32216 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_11810 32696 32265 gene locus_tag LOCUS_11820 32696 32265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 32983 32693 gene locus_tag LOCUS_11830 32983 32693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 33033 33278 gene locus_tag LOCUS_11840 33033 33278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 33329 36745 gene locus_tag LOCUS_11850 33329 36745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 36995 36807 gene locus_tag LOCUS_11860 36995 36807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 38346 38089 gene locus_tag LOCUS_11870 38346 38089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 38807 38553 gene locus_tag LOCUS_11880 38807 38553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 39198 38983 gene locus_tag LOCUS_11890 39198 38983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 40001 40198 gene locus_tag LOCUS_11900 40001 40198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 40654 40265 gene locus_tag LOCUS_11910 40654 40265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 41935 41063 gene locus_tag LOCUS_11920 41935 41063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 42216 42353 gene locus_tag LOCUS_11930 42216 42353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 42906 43181 gene locus_tag LOCUS_11940 42906 43181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 43183 44403 gene locus_tag LOCUS_11950 43183 44403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 44996 44766 gene locus_tag LOCUS_11960 44996 44766 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024016.1 protein_id gnl|my_center|LOCUS_11960 45214 44993 gene locus_tag LOCUS_11970 45214 44993 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_11970 45586 45260 gene locus_tag LOCUS_11980 45586 45260 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_11980 46642 45689 gene locus_tag LOCUS_11990 46642 45689 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675041.1 protein_id gnl|my_center|LOCUS_11990 46740 47405 gene locus_tag LOCUS_12000 46740 47405 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_12000 49930 47402 gene locus_tag LOCUS_12010 49930 47402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_12010 50616 49927 gene locus_tag LOCUS_12020 50616 49927 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence022 <1 723 gene locus_tag LOCUS_12030 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084264.1:DEAD/DEAH box helicase 829 1497 gene locus_tag LOCUS_12040 829 1497 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_12040 1519 1923 gene locus_tag LOCUS_12050 1519 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2253 1978 gene locus_tag LOCUS_12060 2253 1978 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_12060 2531 2250 gene locus_tag LOCUS_12070 2531 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4110 2851 gene locus_tag LOCUS_12080 4110 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4885 4172 gene locus_tag LOCUS_12090 4885 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 5278 5487 gene locus_tag LOCUS_12100 5278 5487 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_12100 5557 5826 gene locus_tag LOCUS_12110 5557 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7605 5830 gene locus_tag LOCUS_12120 7605 5830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_12120 9410 7602 gene locus_tag LOCUS_12130 9410 7602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_12130 9628 12183 gene locus_tag LOCUS_12140 9628 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 13116 12343 gene locus_tag LOCUS_12150 13116 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 14325 13498 gene locus_tag LOCUS_12160 14325 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 15139 14336 gene locus_tag LOCUS_12170 15139 14336 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212063.1 protein_id gnl|my_center|LOCUS_12170 15273 15348 gene locus_tag LOCUS_t00130 15273 15348 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15820 15425 gene locus_tag LOCUS_12180 15820 15425 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_12180 17267 15882 gene locus_tag LOCUS_12190 17267 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 18007 17273 gene locus_tag LOCUS_12200 18007 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 18774 18019 gene locus_tag LOCUS_12210 18774 18019 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811135.1 protein_id gnl|my_center|LOCUS_12210 20994 18805 gene locus_tag LOCUS_12220 20994 18805 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 protein_id gnl|my_center|LOCUS_12220 21127 22041 gene locus_tag LOCUS_12230 21127 22041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 22996 22460 gene locus_tag LOCUS_12240 22996 22460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 23200 23496 gene locus_tag LOCUS_12250 23200 23496 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976332.1 protein_id gnl|my_center|LOCUS_12250 25332 23572 gene locus_tag LOCUS_12260 gene aspS 25332 23572 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_12260 28053 25534 gene locus_tag LOCUS_12270 28053 25534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 28230 28496 gene locus_tag LOCUS_12280 28230 28496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 28493 29002 gene locus_tag LOCUS_12290 28493 29002 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393694.1 protein_id gnl|my_center|LOCUS_12290 29017 29994 gene locus_tag LOCUS_12300 29017 29994 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_12300 30054 30962 gene locus_tag LOCUS_12310 30054 30962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 30907 31491 gene locus_tag LOCUS_12320 30907 31491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 31873 32727 gene locus_tag LOCUS_12330 gene legD1 31873 32727 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_12330 32827 34155 gene locus_tag LOCUS_12340 32827 34155 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070381.1 protein_id gnl|my_center|LOCUS_12340 34201 35340 gene locus_tag LOCUS_12350 34201 35340 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_12350 35362 36105 gene locus_tag LOCUS_12360 35362 36105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 36138 38924 gene locus_tag LOCUS_12370 36138 38924 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071943.1 protein_id gnl|my_center|LOCUS_12370 41771 39120 gene locus_tag LOCUS_12380 41771 39120 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_12380 42034 42261 gene locus_tag LOCUS_12390 42034 42261 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_12390 42343 43578 gene locus_tag LOCUS_12400 42343 43578 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259289.1 protein_id gnl|my_center|LOCUS_12400 43646 44449 gene locus_tag LOCUS_12410 43646 44449 CDS product Bpu10I family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259288.1 protein_id gnl|my_center|LOCUS_12410 45933 44581 gene locus_tag LOCUS_12420 45933 44581 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_12420 47299 45923 gene locus_tag LOCUS_12430 47299 45923 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202702.1 protein_id gnl|my_center|LOCUS_12430 47793 47356 gene locus_tag LOCUS_12440 47793 47356 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_12440 48058 47798 gene locus_tag LOCUS_12450 48058 47798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence023 267 1574 gene locus_tag LOCUS_12460 267 1574 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674204.1 protein_id gnl|my_center|LOCUS_12460 1620 2453 gene locus_tag LOCUS_12470 1620 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2750 2529 gene locus_tag LOCUS_12480 2750 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 4904 3726 gene locus_tag LOCUS_12490 4904 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5047 6489 gene locus_tag LOCUS_12500 5047 6489 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_12500 6619 7632 gene locus_tag LOCUS_12510 6619 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 7700 8764 gene locus_tag LOCUS_12520 7700 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 8876 9940 gene locus_tag LOCUS_12530 8876 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 10094 11578 gene locus_tag LOCUS_12540 10094 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 11701 12270 gene locus_tag LOCUS_12550 11701 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 14241 12415 gene locus_tag LOCUS_12560 14241 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 14183 14344 gene locus_tag LOCUS_12570 14183 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 16166 14379 gene locus_tag LOCUS_12580 16166 14379 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_12580 17086 16190 gene locus_tag LOCUS_12590 17086 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 17499 17062 gene locus_tag LOCUS_12600 17499 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12600 18416 17583 gene locus_tag LOCUS_12610 18416 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 18469 20685 gene locus_tag LOCUS_12620 18469 20685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 20706 21785 gene locus_tag LOCUS_12630 20706 21785 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029019.1 protein_id gnl|my_center|LOCUS_12630 22696 21773 gene locus_tag LOCUS_12640 22696 21773 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_12640 24669 22708 gene locus_tag LOCUS_12650 24669 22708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 25441 24680 gene locus_tag LOCUS_12660 25441 24680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 27295 25457 gene locus_tag LOCUS_12670 27295 25457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 29895 27295 gene locus_tag LOCUS_12680 29895 27295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 32282 29907 gene locus_tag LOCUS_12690 32282 29907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 34235 32463 gene locus_tag LOCUS_12700 34235 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 34651 34250 gene locus_tag LOCUS_12710 34651 34250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 35079 34663 gene locus_tag LOCUS_12720 35079 34663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 36115 35204 gene locus_tag LOCUS_12730 36115 35204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 36478 37902 gene locus_tag LOCUS_12740 36478 37902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 37932 38525 gene locus_tag LOCUS_12750 37932 38525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 39273 38545 gene locus_tag LOCUS_12760 39273 38545 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391476.1 protein_id gnl|my_center|LOCUS_12760 39766 41028 gene locus_tag LOCUS_12770 39766 41028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 41085 42290 gene locus_tag LOCUS_12780 41085 42290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 42492 43910 gene locus_tag LOCUS_12790 42492 43910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 43993 45459 gene locus_tag LOCUS_12800 43993 45459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 45524 46867 gene locus_tag LOCUS_12810 45524 46867 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 protein_id gnl|my_center|LOCUS_12810 46954 48270 gene locus_tag LOCUS_12820 46954 48270 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869357.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence024 2035 155 gene locus_tag LOCUS_12830 2035 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2198 3454 gene locus_tag LOCUS_12840 2198 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4473 3451 gene locus_tag LOCUS_12850 4473 3451 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_12850 4552 5748 gene locus_tag LOCUS_12860 4552 5748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262969.1 protein_id gnl|my_center|LOCUS_12860 5758 6297 gene locus_tag LOCUS_12870 5758 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 7783 6290 gene locus_tag LOCUS_12880 7783 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8821 7790 gene locus_tag LOCUS_12890 8821 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 9686 8835 gene locus_tag LOCUS_12900 9686 8835 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_12900 9999 10787 gene locus_tag LOCUS_12910 gene iolO 9999 10787 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_12910 11149 10784 gene locus_tag LOCUS_12920 gene crcB 11149 10784 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963905.1 protein_id gnl|my_center|LOCUS_12920 12870 11263 gene locus_tag LOCUS_12930 12870 11263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13786 12875 gene locus_tag LOCUS_12940 13786 12875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 14293 14060 gene locus_tag LOCUS_12950 14293 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 14479 15696 gene locus_tag LOCUS_12960 14479 15696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 15752 17143 gene locus_tag LOCUS_12970 15752 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 17179 19146 gene locus_tag LOCUS_12980 17179 19146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 20295 19189 gene locus_tag LOCUS_12990 20295 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 20533 20306 gene locus_tag LOCUS_13000 20533 20306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 20571 21866 gene locus_tag LOCUS_13010 20571 21866 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_13010 23385 21871 gene locus_tag LOCUS_13020 23385 21871 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390071.1 protein_id gnl|my_center|LOCUS_13020 23622 24566 gene locus_tag LOCUS_13030 23622 24566 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_13030 25672 24785 gene locus_tag LOCUS_13040 25672 24785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_13040 26637 25672 gene locus_tag LOCUS_13050 gene dppB 26637 25672 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245446.1 protein_id gnl|my_center|LOCUS_13050 28274 26673 gene locus_tag LOCUS_13060 28274 26673 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_13060 29278 28568 gene locus_tag LOCUS_13070 29278 28568 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_13070 32469 29278 gene locus_tag LOCUS_13080 32469 29278 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_13080 33695 33447 gene locus_tag LOCUS_13090 33695 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 34033 33731 gene locus_tag LOCUS_13100 34033 33731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 36010 34088 gene locus_tag LOCUS_13110 36010 34088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 40155 36007 gene locus_tag LOCUS_13120 40155 36007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 41360 40137 gene locus_tag LOCUS_13130 41360 40137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 41845 41396 gene locus_tag LOCUS_13140 41845 41396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 42363 41839 gene locus_tag LOCUS_13150 42363 41839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 42738 42388 gene locus_tag LOCUS_13160 42738 42388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 42956 42744 gene locus_tag LOCUS_13170 42956 42744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 43524 43132 gene locus_tag LOCUS_13180 43524 43132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 45095 43521 gene locus_tag LOCUS_13190 45095 43521 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_13190 45701 45108 gene locus_tag LOCUS_13200 45701 45108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 45917 45714 gene locus_tag LOCUS_13210 45917 45714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 46131 46616 gene locus_tag LOCUS_13220 46131 46616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 46620 47618 gene locus_tag LOCUS_13230 46620 47618 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence025 1712 411 gene locus_tag LOCUS_13240 1712 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1881 2216 gene locus_tag LOCUS_13250 1881 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2233 3027 gene locus_tag LOCUS_13260 2233 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3947 3084 gene locus_tag LOCUS_13270 3947 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4818 3949 gene locus_tag LOCUS_13280 4818 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 5042 7309 gene locus_tag LOCUS_13290 5042 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 10947 7420 gene locus_tag LOCUS_13300 10947 7420 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_13300 14293 10955 gene locus_tag LOCUS_13310 14293 10955 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_13310 14345 14785 gene locus_tag LOCUS_13320 14345 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 14788 15141 gene locus_tag LOCUS_13330 14788 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 15474 15184 gene locus_tag LOCUS_13340 15474 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 18909 16003 gene locus_tag LOCUS_13350 18909 16003 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_13350 19091 18906 gene locus_tag LOCUS_13360 19091 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 20899 19370 gene locus_tag LOCUS_13370 20899 19370 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_13370 21478 21053 gene locus_tag LOCUS_13380 21478 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 22179 21475 gene locus_tag LOCUS_13390 22179 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 22877 22176 gene locus_tag LOCUS_13400 22877 22176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 23080 22910 gene locus_tag LOCUS_13410 23080 22910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 23893 23099 gene locus_tag LOCUS_13420 23893 23099 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_13420 24796 23999 gene locus_tag LOCUS_13430 24796 23999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_13430 26297 24843 gene locus_tag LOCUS_13440 26297 24843 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_13440 26641 26375 gene locus_tag LOCUS_13450 26641 26375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 27092 26658 gene locus_tag LOCUS_13460 27092 26658 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123239.1 protein_id gnl|my_center|LOCUS_13460 28226 27102 gene locus_tag LOCUS_13470 28226 27102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 30038 28341 gene locus_tag LOCUS_13480 30038 28341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 30061 31245 gene locus_tag LOCUS_13490 30061 31245 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929105.1 protein_id gnl|my_center|LOCUS_13490 31278 32024 gene locus_tag LOCUS_13500 31278 32024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 32144 33037 gene locus_tag LOCUS_13510 32144 33037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 33819 33034 gene locus_tag LOCUS_13520 33819 33034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 34505 33816 gene locus_tag LOCUS_13530 34505 33816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661367.1 protein_id gnl|my_center|LOCUS_13530 34873 34502 gene locus_tag LOCUS_13540 34873 34502 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392689.1 protein_id gnl|my_center|LOCUS_13540 36237 35092 gene locus_tag LOCUS_13550 36237 35092 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_13550 36375 38213 gene locus_tag LOCUS_13560 36375 38213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 39722 38235 gene locus_tag LOCUS_13570 39722 38235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 39974 41239 gene locus_tag LOCUS_13580 39974 41239 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731603.1 protein_id gnl|my_center|LOCUS_13580 42932 41262 gene locus_tag LOCUS_13590 gene ilvD 42932 41262 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980252.1 protein_id gnl|my_center|LOCUS_13590 43098 43760 gene locus_tag LOCUS_13600 43098 43760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 44801 43770 gene locus_tag LOCUS_13610 44801 43770 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_13610 45630 44809 gene locus_tag LOCUS_13620 45630 44809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 45890 46483 gene locus_tag LOCUS_13630 45890 46483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 46488 47531 gene locus_tag LOCUS_13640 46488 47531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence026 581 2644 gene locus_tag LOCUS_13650 581 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2678 3085 gene locus_tag LOCUS_13660 2678 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13660 3119 3316 gene locus_tag LOCUS_13670 3119 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13670 4046 3351 gene locus_tag LOCUS_13680 4046 3351 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_13680 4465 4043 gene locus_tag LOCUS_13690 4465 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4638 5714 gene locus_tag LOCUS_13700 4638 5714 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_13700 5723 9628 gene locus_tag LOCUS_13710 5723 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9638 12781 gene locus_tag LOCUS_13720 9638 12781 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072022.1 protein_id gnl|my_center|LOCUS_13720 14260 12770 gene locus_tag LOCUS_13730 14260 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 14294 14902 gene locus_tag LOCUS_13740 14294 14902 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056914.1 protein_id gnl|my_center|LOCUS_13740 15802 14957 gene locus_tag LOCUS_13750 gene mutM 15802 14957 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260990.1 protein_id gnl|my_center|LOCUS_13750 16029 17390 gene locus_tag LOCUS_13760 16029 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 17390 18082 gene locus_tag LOCUS_13770 17390 18082 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403732.1 protein_id gnl|my_center|LOCUS_13770 18096 19073 gene locus_tag LOCUS_13780 18096 19073 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_13780 19127 19693 gene locus_tag LOCUS_13790 19127 19693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 19711 20478 gene locus_tag LOCUS_13800 19711 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 20489 20749 gene locus_tag LOCUS_13810 20489 20749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 21923 22393 gene locus_tag LOCUS_13820 21923 22393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 22399 24492 gene locus_tag LOCUS_13830 22399 24492 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 protein_id gnl|my_center|LOCUS_13830 24545 25555 gene locus_tag LOCUS_13840 24545 25555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 25802 26398 gene locus_tag LOCUS_13850 25802 26398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 26409 28598 gene locus_tag LOCUS_13860 26409 28598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 29028 28702 gene locus_tag LOCUS_13870 29028 28702 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_13870 29303 29028 gene locus_tag LOCUS_13880 29303 29028 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_13880 29441 30259 gene locus_tag LOCUS_13890 29441 30259 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_13890 31143 30463 gene locus_tag LOCUS_13900 31143 30463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 31216 32556 gene locus_tag LOCUS_13910 31216 32556 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017936.1 protein_id gnl|my_center|LOCUS_13910 32570 33472 gene locus_tag LOCUS_13920 32570 33472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 33553 34617 gene locus_tag LOCUS_13930 33553 34617 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_13930 35628 34621 gene locus_tag LOCUS_13940 35628 34621 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963887.1 protein_id gnl|my_center|LOCUS_13940 36730 35666 gene locus_tag LOCUS_13950 36730 35666 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_13950 38025 36787 gene locus_tag LOCUS_13960 38025 36787 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_13960 38735 38334 gene locus_tag LOCUS_13970 38735 38334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 39901 39194 gene locus_tag LOCUS_13980 39901 39194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 40815 40003 gene locus_tag LOCUS_13990 gene ccsA 40815 40003 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941366.1 protein_id gnl|my_center|LOCUS_13990 42119 40812 gene locus_tag LOCUS_14000 gene hemA 42119 40812 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_14000 42182 43054 gene locus_tag LOCUS_14010 42182 43054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 44718 43051 gene locus_tag LOCUS_14020 44718 43051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14020 45263 44715 gene locus_tag LOCUS_14030 45263 44715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 45282 45926 gene locus_tag LOCUS_14040 45282 45926 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_14040 45923 46333 gene locus_tag LOCUS_14050 45923 46333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence027 <1 602 gene locus_tag LOCUS_14060 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha 1056 865 gene locus_tag LOCUS_14070 1056 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1202 2476 gene locus_tag LOCUS_14080 1202 2476 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 protein_id gnl|my_center|LOCUS_14080 2487 3644 gene locus_tag LOCUS_14090 gene rhmD 2487 3644 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297916.1 protein_id gnl|my_center|LOCUS_14090 5185 3677 gene locus_tag LOCUS_14100 5185 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 protein_id gnl|my_center|LOCUS_14100 5385 7010 gene locus_tag LOCUS_14110 5385 7010 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_14110 7032 7838 gene locus_tag LOCUS_14120 7032 7838 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187868.1 protein_id gnl|my_center|LOCUS_14120 7871 8716 gene locus_tag LOCUS_14130 7871 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 10821 8971 gene locus_tag LOCUS_14140 10821 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 11075 11317 gene locus_tag LOCUS_14150 11075 11317 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389965.1 protein_id gnl|my_center|LOCUS_14150 11326 11745 gene locus_tag LOCUS_14160 11326 11745 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_14160 12316 11759 gene locus_tag LOCUS_14170 12316 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 13200 12328 gene locus_tag LOCUS_14180 13200 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 13557 13273 gene locus_tag LOCUS_14190 13557 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 13800 13564 gene locus_tag LOCUS_14200 13800 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 14699 13881 gene locus_tag LOCUS_14210 gene fdhD 14699 13881 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_14210 16123 14699 gene locus_tag LOCUS_14220 16123 14699 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_14220 17067 16120 gene locus_tag LOCUS_14230 17067 16120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 17153 18508 gene locus_tag LOCUS_14240 17153 18508 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_14240 18514 19752 gene locus_tag LOCUS_14250 18514 19752 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_14250 19877 20548 gene locus_tag LOCUS_14260 gene nthB 19877 20548 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531053.1 protein_id gnl|my_center|LOCUS_14260 20578 21186 gene locus_tag LOCUS_14270 gene nthA 20578 21186 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_14270 21194 21535 gene locus_tag LOCUS_14280 21194 21535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 22890 21568 gene locus_tag LOCUS_14290 22890 21568 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_14290 23882 22896 gene locus_tag LOCUS_14300 23882 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 23995 24888 gene locus_tag LOCUS_14310 23995 24888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 24885 26927 gene locus_tag LOCUS_14320 24885 26927 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_14320 28042 26936 gene locus_tag LOCUS_14330 28042 26936 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100937.1 protein_id gnl|my_center|LOCUS_14330 29330 28107 gene locus_tag LOCUS_14340 29330 28107 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186349.1 protein_id gnl|my_center|LOCUS_14340 30734 29340 gene locus_tag LOCUS_14350 gene lpdA 30734 29340 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830912.1 protein_id gnl|my_center|LOCUS_14350 31089 31532 gene locus_tag LOCUS_14360 gene rnhA 31089 31532 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056154.1 protein_id gnl|my_center|LOCUS_14360 31559 32329 gene locus_tag LOCUS_14370 31559 32329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 32369 34546 gene locus_tag LOCUS_14380 32369 34546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 34549 35955 gene locus_tag LOCUS_14390 34549 35955 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_14390 36365 37279 gene locus_tag LOCUS_14400 36365 37279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 37354 38925 gene locus_tag LOCUS_14410 37354 38925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 38966 40417 gene locus_tag LOCUS_14420 38966 40417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 40430 41941 gene locus_tag LOCUS_14430 40430 41941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 41938 43323 gene locus_tag LOCUS_14440 41938 43323 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405552.1 protein_id gnl|my_center|LOCUS_14440 43338 44060 gene locus_tag LOCUS_14450 43338 44060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_14450 44266 44916 gene locus_tag LOCUS_14460 44266 44916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 45342 46181 gene locus_tag LOCUS_14470 45342 46181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence028 551 108 gene locus_tag LOCUS_14480 551 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 673 1272 gene locus_tag LOCUS_14490 673 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2081 1278 gene locus_tag LOCUS_14500 2081 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2716 2078 gene locus_tag LOCUS_14510 2716 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 5080 2783 gene locus_tag LOCUS_14520 5080 2783 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_14520 5281 5520 gene locus_tag LOCUS_14530 5281 5520 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887061.1 protein_id gnl|my_center|LOCUS_14530 5517 5867 gene locus_tag LOCUS_14540 gene mazF 5517 5867 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_14540 6717 5953 gene locus_tag LOCUS_14550 6717 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 8091 6937 gene locus_tag LOCUS_14560 8091 6937 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_14560 9365 8088 gene locus_tag LOCUS_14570 9365 8088 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_14570 10258 9362 gene locus_tag LOCUS_14580 10258 9362 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_14580 10451 11500 gene locus_tag LOCUS_14590 gene moaA 10451 11500 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900633.1 protein_id gnl|my_center|LOCUS_14590 11519 13630 gene locus_tag LOCUS_14600 11519 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 13650 14789 gene locus_tag LOCUS_14610 13650 14789 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_14610 14874 15623 gene locus_tag LOCUS_14620 14874 15623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 16550 15756 gene locus_tag LOCUS_14630 16550 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 17095 16904 gene locus_tag LOCUS_14640 17095 16904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 17792 17154 gene locus_tag LOCUS_14650 17792 17154 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_14650 19459 18161 gene locus_tag LOCUS_14660 19459 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 20303 19470 gene locus_tag LOCUS_14670 20303 19470 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_14670 21349 20300 gene locus_tag LOCUS_14680 21349 20300 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_14680 22272 21424 gene locus_tag LOCUS_14690 22272 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 24370 22265 gene locus_tag LOCUS_14700 24370 22265 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_14700 27172 24446 gene locus_tag LOCUS_14710 gene polA 27172 24446 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_14710 28031 27192 gene locus_tag LOCUS_14720 28031 27192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 29052 28039 gene locus_tag LOCUS_14730 29052 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 31044 29170 gene locus_tag LOCUS_14740 31044 29170 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_14740 31631 31047 gene locus_tag LOCUS_14750 31631 31047 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_14750 32126 31638 gene locus_tag LOCUS_14760 32126 31638 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_14760 32884 32123 gene locus_tag LOCUS_14770 32884 32123 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777099.1 protein_id gnl|my_center|LOCUS_14770 33647 32946 gene locus_tag LOCUS_14780 33647 32946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 34633 33662 gene locus_tag LOCUS_14790 34633 33662 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256068.1 protein_id gnl|my_center|LOCUS_14790 36024 35032 gene locus_tag LOCUS_14800 36024 35032 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_14800 37966 36065 gene locus_tag LOCUS_14810 gene metG 37966 36065 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228577.1 protein_id gnl|my_center|LOCUS_14810 38843 38061 gene locus_tag LOCUS_14820 38843 38061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 39994 38840 gene locus_tag LOCUS_14830 39994 38840 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808460.1 protein_id gnl|my_center|LOCUS_14830 41221 40004 gene locus_tag LOCUS_14840 gene mhpT 41221 40004 CDS product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920270.1 protein_id gnl|my_center|LOCUS_14840 42184 41225 gene locus_tag LOCUS_14850 42184 41225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 42272 42838 gene locus_tag LOCUS_14860 42272 42838 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_14860 44101 42884 gene locus_tag LOCUS_14870 44101 42884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 44387 44085 gene locus_tag LOCUS_14880 44387 44085 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_14880 45197 44583 gene locus_tag LOCUS_14890 45197 44583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 45475 45816 gene locus_tag LOCUS_14900 45475 45816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 45807 46199 gene locus_tag LOCUS_14910 45807 46199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence029 239 454 gene locus_tag LOCUS_14920 239 454 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065663.1 protein_id gnl|my_center|LOCUS_14920 1855 464 gene locus_tag LOCUS_14930 1855 464 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161935.1 protein_id gnl|my_center|LOCUS_14930 2789 1896 gene locus_tag LOCUS_14940 2789 1896 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_14940 2994 4559 gene locus_tag LOCUS_14950 2994 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4549 6765 gene locus_tag LOCUS_14960 4549 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 6823 8319 gene locus_tag LOCUS_14970 6823 8319 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_14970 9712 8354 gene locus_tag LOCUS_14980 9712 8354 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 protein_id gnl|my_center|LOCUS_14980 10818 9715 gene locus_tag LOCUS_14990 10818 9715 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384956.1 protein_id gnl|my_center|LOCUS_14990 11649 10822 gene locus_tag LOCUS_15000 11649 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 11663 12676 gene locus_tag LOCUS_15010 11663 12676 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_15010 13884 12673 gene locus_tag LOCUS_15020 13884 12673 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_15020 14762 13965 gene locus_tag LOCUS_15030 14762 13965 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_15030 14981 17413 gene locus_tag LOCUS_15040 14981 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 17426 19750 gene locus_tag LOCUS_15050 17426 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 19907 20110 gene locus_tag LOCUS_15060 19907 20110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 20115 20501 gene locus_tag LOCUS_15070 gene vapc11 20115 20501 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_15070 21252 20623 gene locus_tag LOCUS_15080 21252 20623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256711.1 protein_id gnl|my_center|LOCUS_15080 22508 21249 gene locus_tag LOCUS_15090 22508 21249 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_15090 23165 22638 gene locus_tag LOCUS_15100 23165 22638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 23986 23201 gene locus_tag LOCUS_15110 23986 23201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 24938 24000 gene locus_tag LOCUS_15120 24938 24000 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145034007.1 protein_id gnl|my_center|LOCUS_15120 25232 25432 gene locus_tag LOCUS_15130 25232 25432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 26664 25645 gene locus_tag LOCUS_15140 26664 25645 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532188.1 protein_id gnl|my_center|LOCUS_15140 27563 26667 gene locus_tag LOCUS_15150 27563 26667 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_15150 28676 27585 gene locus_tag LOCUS_15160 gene ogl 28676 27585 CDS product oligogalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816209.1 protein_id gnl|my_center|LOCUS_15160 29959 28679 gene locus_tag LOCUS_15170 29959 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 30934 29975 gene locus_tag LOCUS_15180 30934 29975 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_15180 31064 32317 gene locus_tag LOCUS_15190 31064 32317 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967366.1 protein_id gnl|my_center|LOCUS_15190 32506 33942 gene locus_tag LOCUS_15200 32506 33942 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_15200 33943 34917 gene locus_tag LOCUS_15210 33943 34917 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257879.1 protein_id gnl|my_center|LOCUS_15210 34914 35795 gene locus_tag LOCUS_15220 34914 35795 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_15220 35848 36288 gene locus_tag LOCUS_15230 35848 36288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 37397 36372 gene locus_tag LOCUS_15240 37397 36372 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539819.1 protein_id gnl|my_center|LOCUS_15240 39772 37430 gene locus_tag LOCUS_15250 39772 37430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 41801 39783 gene locus_tag LOCUS_15260 41801 39783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 42043 43230 gene locus_tag LOCUS_15270 42043 43230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 43227 44258 gene locus_tag LOCUS_15280 43227 44258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 44281 45030 gene locus_tag LOCUS_15290 44281 45030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence030 265 777 gene locus_tag LOCUS_15300 265 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1556 852 gene locus_tag LOCUS_15310 1556 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1726 2511 gene locus_tag LOCUS_15320 gene hpaI 1726 2511 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067428.1 protein_id gnl|my_center|LOCUS_15320 3251 2520 gene locus_tag LOCUS_15330 3251 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3347 4498 gene locus_tag LOCUS_15340 3347 4498 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_15340 4495 5658 gene locus_tag LOCUS_15350 4495 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 6448 5678 gene locus_tag LOCUS_15360 gene fabG 6448 5678 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_15360 7693 6461 gene locus_tag LOCUS_15370 7693 6461 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_15370 9668 7770 gene locus_tag LOCUS_15380 9668 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 10458 9685 gene locus_tag LOCUS_15390 10458 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 10908 10714 gene locus_tag LOCUS_15400 10908 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 12481 11276 gene locus_tag LOCUS_15410 12481 11276 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_15410 13489 12557 gene locus_tag LOCUS_15420 13489 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 13587 14426 gene locus_tag LOCUS_15430 13587 14426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 14419 15384 gene locus_tag LOCUS_15440 14419 15384 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112678.1 protein_id gnl|my_center|LOCUS_15440 15747 17894 gene locus_tag LOCUS_15450 15747 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 17925 19580 gene locus_tag LOCUS_15460 17925 19580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 19702 20157 gene locus_tag LOCUS_15470 19702 20157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 21404 20274 gene locus_tag LOCUS_15480 gene dgoD 21404 20274 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_15480 23160 21544 gene locus_tag LOCUS_15490 gene ggt 23160 21544 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_15490 24214 23180 gene locus_tag LOCUS_15500 24214 23180 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969225.1 protein_id gnl|my_center|LOCUS_15500 25809 24325 gene locus_tag LOCUS_15510 gene rbsA 25809 24325 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 protein_id gnl|my_center|LOCUS_15510 26777 25806 gene locus_tag LOCUS_15520 gene rbsC 26777 25806 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 protein_id gnl|my_center|LOCUS_15520 27763 26774 gene locus_tag LOCUS_15530 27763 26774 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061699.1 protein_id gnl|my_center|LOCUS_15530 28757 27918 gene locus_tag LOCUS_15540 28757 27918 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533026.1 protein_id gnl|my_center|LOCUS_15540 29345 28845 gene locus_tag LOCUS_15550 29345 28845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 30349 29444 gene locus_tag LOCUS_15560 30349 29444 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339520.1 protein_id gnl|my_center|LOCUS_15560 31517 30339 gene locus_tag LOCUS_15570 31517 30339 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061827.1 protein_id gnl|my_center|LOCUS_15570 31751 32497 gene locus_tag LOCUS_15580 31751 32497 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_15580 32509 33330 gene locus_tag LOCUS_15590 32509 33330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 33417 33968 gene locus_tag LOCUS_15600 33417 33968 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_15600 33968 34153 gene locus_tag LOCUS_15610 33968 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 34181 34489 gene locus_tag LOCUS_15620 34181 34489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 34798 34538 gene locus_tag LOCUS_15630 34798 34538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 36633 34906 gene locus_tag LOCUS_15640 36633 34906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 36839 36630 gene locus_tag LOCUS_15650 36839 36630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 36975 37205 gene locus_tag LOCUS_15660 36975 37205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 37489 39096 gene locus_tag LOCUS_15670 37489 39096 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927003.1 protein_id gnl|my_center|LOCUS_15670 39181 41178 gene locus_tag LOCUS_15680 39181 41178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 42436 41180 gene locus_tag LOCUS_15690 42436 41180 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_15690 42717 43250 gene locus_tag LOCUS_15700 42717 43250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 43237 44877 gene locus_tag LOCUS_15710 43237 44877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence031 2814 238 gene locus_tag LOCUS_15720 2814 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 4808 2895 gene locus_tag LOCUS_15730 4808 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6746 4821 gene locus_tag LOCUS_15740 6746 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7823 6861 gene locus_tag LOCUS_15750 7823 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 9701 7947 gene locus_tag LOCUS_15760 9701 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 12664 9713 gene locus_tag LOCUS_15770 12664 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 15447 12664 gene locus_tag LOCUS_15780 15447 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 17730 15475 gene locus_tag LOCUS_15790 17730 15475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 17888 19591 gene locus_tag LOCUS_15800 17888 19591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 19606 21054 gene locus_tag LOCUS_15810 19606 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 21059 22966 gene locus_tag LOCUS_15820 21059 22966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 24719 23040 gene locus_tag LOCUS_15830 24719 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 24875 25882 gene locus_tag LOCUS_15840 24875 25882 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365774.1 protein_id gnl|my_center|LOCUS_15840 26096 28360 gene locus_tag LOCUS_15850 26096 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 28411 31209 gene locus_tag LOCUS_15860 28411 31209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 31212 34178 gene locus_tag LOCUS_15870 31212 34178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 34228 36759 gene locus_tag LOCUS_15880 34228 36759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 36864 38816 gene locus_tag LOCUS_15890 36864 38816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 39861 38944 gene locus_tag LOCUS_15900 39861 38944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 41978 40089 gene locus_tag LOCUS_15910 41978 40089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 42706 42002 gene locus_tag LOCUS_15920 42706 42002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence032 201 1130 gene locus_tag LOCUS_15930 201 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1134 2504 gene locus_tag LOCUS_15940 1134 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2688 3701 gene locus_tag LOCUS_15950 2688 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3842 5002 gene locus_tag LOCUS_15960 3842 5002 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986854.1 protein_id gnl|my_center|LOCUS_15960 5212 5454 gene locus_tag LOCUS_15970 5212 5454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5558 5791 gene locus_tag LOCUS_15980 5558 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5816 6244 gene locus_tag LOCUS_15990 5816 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172139.1 protein_id gnl|my_center|LOCUS_15990 6297 8534 gene locus_tag LOCUS_16000 6297 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 8689 9780 gene locus_tag LOCUS_16010 8689 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 10785 9790 gene locus_tag LOCUS_16020 10785 9790 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_16020 12344 10845 gene locus_tag LOCUS_16030 12344 10845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 12766 12398 gene locus_tag LOCUS_16040 gene pcaC 12766 12398 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315610.1 protein_id gnl|my_center|LOCUS_16040 13662 12835 gene locus_tag LOCUS_16050 13662 12835 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_16050 13803 15314 gene locus_tag LOCUS_16060 13803 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 15850 15413 gene locus_tag LOCUS_16070 15850 15413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 16989 15859 gene locus_tag LOCUS_16080 16989 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962254.1 protein_id gnl|my_center|LOCUS_16080 18228 17023 gene locus_tag LOCUS_16090 18228 17023 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_16090 18940 19737 gene locus_tag LOCUS_16100 18940 19737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 19862 20698 gene locus_tag LOCUS_16110 19862 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 20983 22290 gene locus_tag LOCUS_16120 20983 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 22297 24777 gene locus_tag LOCUS_16130 22297 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 24904 25479 gene locus_tag LOCUS_16140 24904 25479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 25634 25861 gene locus_tag LOCUS_16150 25634 25861 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_16150 25858 26256 gene locus_tag LOCUS_16160 25858 26256 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_16160 26404 27858 gene locus_tag LOCUS_16170 26404 27858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 29012 27855 gene locus_tag LOCUS_16180 29012 27855 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_16180 29706 29032 gene locus_tag LOCUS_16190 29706 29032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 31011 29725 gene locus_tag LOCUS_16200 31011 29725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_16200 31529 31008 gene locus_tag LOCUS_16210 31529 31008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 32122 31529 gene locus_tag LOCUS_16220 32122 31529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 32756 32133 gene locus_tag LOCUS_16230 32756 32133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 33081 32875 gene locus_tag LOCUS_16240 33081 32875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 33951 33103 gene locus_tag LOCUS_16250 33951 33103 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_16250 35161 33953 gene locus_tag LOCUS_16260 35161 33953 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_16260 36898 35231 gene locus_tag LOCUS_16270 36898 35231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 37069 38277 gene locus_tag LOCUS_16280 37069 38277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 38281 39597 gene locus_tag LOCUS_16290 gene rsmB 38281 39597 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_16290 39594 40367 gene locus_tag LOCUS_16300 39594 40367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 40364 41011 gene locus_tag LOCUS_16310 gene rpe 40364 41011 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence033 284 886 gene locus_tag LOCUS_16320 284 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1885 893 gene locus_tag LOCUS_16330 1885 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3115 2039 gene locus_tag LOCUS_16340 3115 2039 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015092.1 protein_id gnl|my_center|LOCUS_16340 3320 3637 gene locus_tag LOCUS_16350 3320 3637 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525420.1 protein_id gnl|my_center|LOCUS_16350 4036 4497 gene locus_tag LOCUS_16360 4036 4497 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_16360 4620 4922 gene locus_tag LOCUS_16370 4620 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6180 5110 gene locus_tag LOCUS_16380 6180 5110 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_16380 7176 6184 gene locus_tag LOCUS_16390 7176 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 7270 7088 gene locus_tag LOCUS_16400 7270 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7465 8394 gene locus_tag LOCUS_16410 7465 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 9498 8452 gene locus_tag LOCUS_16420 9498 8452 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_16420 10980 9559 gene locus_tag LOCUS_16430 10980 9559 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_16430 11083 12288 gene locus_tag LOCUS_16440 gene nhaA 11083 12288 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387889.1 protein_id gnl|my_center|LOCUS_16440 12309 13259 gene locus_tag LOCUS_16450 12309 13259 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_16450 13256 15361 gene locus_tag LOCUS_16460 13256 15361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 17026 15404 gene locus_tag LOCUS_16470 17026 15404 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582481.1 protein_id gnl|my_center|LOCUS_16470 18489 17083 gene locus_tag LOCUS_16480 gene gspE 18489 17083 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219895.1 protein_id gnl|my_center|LOCUS_16480 19307 18492 gene locus_tag LOCUS_16490 19307 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 20460 19300 gene locus_tag LOCUS_16500 20460 19300 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289393.1 protein_id gnl|my_center|LOCUS_16500 22673 20487 gene locus_tag LOCUS_16510 22673 20487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 24983 22731 gene locus_tag LOCUS_16520 24983 22731 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_16520 26099 25023 gene locus_tag LOCUS_16530 26099 25023 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_16530 27014 26103 gene locus_tag LOCUS_16540 gene rimK 27014 26103 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_16540 27542 27042 gene locus_tag LOCUS_16550 27542 27042 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_16550 28985 27681 gene locus_tag LOCUS_16560 28985 27681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 30349 29186 gene locus_tag LOCUS_16570 30349 29186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 32042 30426 gene locus_tag LOCUS_16580 32042 30426 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200075.1 protein_id gnl|my_center|LOCUS_16580 32359 33684 gene locus_tag LOCUS_16590 32359 33684 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_16590 36139 33875 gene locus_tag LOCUS_16600 36139 33875 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_16600 37314 36136 gene locus_tag LOCUS_16610 37314 36136 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_16610 38504 37320 gene locus_tag LOCUS_16620 38504 37320 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_16620 38730 38930 gene locus_tag LOCUS_16630 38730 38930 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670205.1 protein_id gnl|my_center|LOCUS_16630 38927 39334 gene locus_tag LOCUS_16640 38927 39334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 40931 39336 gene locus_tag LOCUS_16650 40931 39336 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530716.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence034 2522 1782 gene locus_tag LOCUS_16660 2522 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3306 2587 gene locus_tag LOCUS_16670 3306 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4332 3307 gene locus_tag LOCUS_16680 gene dcyD 4332 3307 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 protein_id gnl|my_center|LOCUS_16680 5555 4329 gene locus_tag LOCUS_16690 5555 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5554 6312 gene locus_tag LOCUS_16700 5554 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6325 7293 gene locus_tag LOCUS_16710 6325 7293 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027021.1 protein_id gnl|my_center|LOCUS_16710 7343 9457 gene locus_tag LOCUS_16720 7343 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 9482 10288 gene locus_tag LOCUS_16730 9482 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 14192 10374 gene locus_tag LOCUS_16740 gene hrpA 14192 10374 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139543.1 protein_id gnl|my_center|LOCUS_16740 15723 14455 gene locus_tag LOCUS_16750 15723 14455 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_16750 15856 17175 gene locus_tag LOCUS_16760 15856 17175 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_16760 17172 17681 gene locus_tag LOCUS_16770 17172 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 17706 18692 gene locus_tag LOCUS_16780 gene floA 17706 18692 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_16780 18696 19184 gene locus_tag LOCUS_16790 18696 19184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 19194 19280 gene locus_tag LOCUS_t00140 19194 19280 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19626 21416 gene locus_tag LOCUS_16800 19626 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_16800 21437 22183 gene locus_tag LOCUS_16810 21437 22183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 22216 23388 gene locus_tag LOCUS_16820 gene cdaA 22216 23388 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_16820 23411 24145 gene locus_tag LOCUS_16830 23411 24145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 24280 24513 gene locus_tag LOCUS_16840 24280 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 24724 25662 gene locus_tag LOCUS_16850 24724 25662 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616239.1 protein_id gnl|my_center|LOCUS_16850 25675 26451 gene locus_tag LOCUS_16860 25675 26451 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_16860 26525 27304 gene locus_tag LOCUS_16870 gene fabG 26525 27304 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_16870 27319 28296 gene locus_tag LOCUS_16880 27319 28296 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_16880 28293 29321 gene locus_tag LOCUS_16890 28293 29321 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868029.1 protein_id gnl|my_center|LOCUS_16890 29347 30324 gene locus_tag LOCUS_16900 29347 30324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 30395 31516 gene locus_tag LOCUS_16910 30395 31516 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256466.1 protein_id gnl|my_center|LOCUS_16910 31551 33923 gene locus_tag LOCUS_16920 31551 33923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 34799 33993 gene locus_tag LOCUS_16930 34799 33993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 36003 34870 gene locus_tag LOCUS_16940 36003 34870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 36483 36818 gene locus_tag LOCUS_16950 36483 36818 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_16950 36899 37090 gene locus_tag LOCUS_16960 36899 37090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 38077 37046 gene locus_tag LOCUS_16970 38077 37046 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267724.1 protein_id gnl|my_center|LOCUS_16970 38175 39743 gene locus_tag LOCUS_16980 38175 39743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence035 <1 3163 gene locus_tag LOCUS_16990 <1 3163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211921382.1:putative Ig domain-containing protein 3343 3864 gene locus_tag LOCUS_17000 3343 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3908 5704 gene locus_tag LOCUS_17010 gene lepA 3908 5704 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_17010 5762 6892 gene locus_tag LOCUS_17020 gene hemW 5762 6892 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_17020 7050 6965 gene locus_tag LOCUS_t00150 7050 6965 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7911 7063 gene locus_tag LOCUS_17030 7911 7063 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_17030 9221 8061 gene locus_tag LOCUS_17040 9221 8061 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383848.1 protein_id gnl|my_center|LOCUS_17040 9377 10366 gene locus_tag LOCUS_17050 9377 10366 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_17050 10368 11111 gene locus_tag LOCUS_17060 10368 11111 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_17060 11165 12064 gene locus_tag LOCUS_17070 11165 12064 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974694.1 protein_id gnl|my_center|LOCUS_17070 12066 12935 gene locus_tag LOCUS_17080 12066 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 14130 12871 gene locus_tag LOCUS_17090 14130 12871 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_17090 14272 15144 gene locus_tag LOCUS_17100 14272 15144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 15167 16144 gene locus_tag LOCUS_17110 15167 16144 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_17110 16156 16926 gene locus_tag LOCUS_17120 16156 16926 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_17120 16992 18179 gene locus_tag LOCUS_17130 16992 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 18167 18952 gene locus_tag LOCUS_17140 18167 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 18949 19368 gene locus_tag LOCUS_17150 18949 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 20195 19377 gene locus_tag LOCUS_17160 20195 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 20937 20206 gene locus_tag LOCUS_17170 20937 20206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 21051 22130 gene locus_tag LOCUS_17180 21051 22130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 22854 22111 gene locus_tag LOCUS_17190 22854 22111 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_17190 23030 24142 gene locus_tag LOCUS_17200 23030 24142 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 protein_id gnl|my_center|LOCUS_17200 24164 25024 gene locus_tag LOCUS_17210 24164 25024 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_17210 25027 26631 gene locus_tag LOCUS_17220 25027 26631 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_17220 26688 27674 gene locus_tag LOCUS_17230 26688 27674 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_17230 27664 28692 gene locus_tag LOCUS_17240 27664 28692 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612339.1 protein_id gnl|my_center|LOCUS_17240 28881 30083 gene locus_tag LOCUS_17250 gene rhmD 28881 30083 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174589.1 protein_id gnl|my_center|LOCUS_17250 30086 31096 gene locus_tag LOCUS_17260 30086 31096 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970647.1 protein_id gnl|my_center|LOCUS_17260 31128 33413 gene locus_tag LOCUS_17270 31128 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 33520 33595 gene locus_tag LOCUS_t00160 33520 33595 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 34455 33655 gene locus_tag LOCUS_17280 34455 33655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 35283 34456 gene locus_tag LOCUS_17290 35283 34456 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_17290 35437 35634 gene locus_tag LOCUS_17300 35437 35634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 35628 36956 gene locus_tag LOCUS_17310 35628 36956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 36992 38206 gene locus_tag LOCUS_17320 36992 38206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 38221 38583 gene locus_tag LOCUS_17330 38221 38583 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545317.1 protein_id gnl|my_center|LOCUS_17330 38605 39186 gene locus_tag LOCUS_17340 38605 39186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 39614 39273 gene locus_tag LOCUS_17350 39614 39273 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258010.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence036 592 1578 gene locus_tag LOCUS_17360 592 1578 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814134.1 protein_id gnl|my_center|LOCUS_17360 1622 2761 gene locus_tag LOCUS_17370 1622 2761 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_17370 2905 2705 gene locus_tag LOCUS_17380 2905 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3715 3029 gene locus_tag LOCUS_17390 3715 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5987 4098 gene locus_tag LOCUS_17400 5987 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 8555 6003 gene locus_tag LOCUS_17410 8555 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 9425 8619 gene locus_tag LOCUS_17420 9425 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 10981 9422 gene locus_tag LOCUS_17430 10981 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 11896 11024 gene locus_tag LOCUS_17440 11896 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 13179 11959 gene locus_tag LOCUS_17450 13179 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 14202 13504 gene locus_tag LOCUS_17460 14202 13504 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530391.1 protein_id gnl|my_center|LOCUS_17460 15527 14280 gene locus_tag LOCUS_17470 15527 14280 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040369.1 protein_id gnl|my_center|LOCUS_17470 18890 15537 gene locus_tag LOCUS_17480 18890 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 19039 20058 gene locus_tag LOCUS_17490 19039 20058 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_17490 20051 20380 gene locus_tag LOCUS_17500 20051 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 20377 20853 gene locus_tag LOCUS_17510 20377 20853 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_17510 21775 20906 gene locus_tag LOCUS_17520 gene nadC 21775 20906 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389186.1 protein_id gnl|my_center|LOCUS_17520 21874 23595 gene locus_tag LOCUS_17530 21874 23595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 23597 24661 gene locus_tag LOCUS_17540 23597 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 25847 24663 gene locus_tag LOCUS_17550 25847 24663 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155697526.1 protein_id gnl|my_center|LOCUS_17550 26629 25856 gene locus_tag LOCUS_17560 26629 25856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 27201 26713 gene locus_tag LOCUS_17570 gene folA 27201 26713 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_17570 27944 27198 gene locus_tag LOCUS_17580 27944 27198 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_17580 29032 27938 gene locus_tag LOCUS_17590 29032 27938 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454927.1 protein_id gnl|my_center|LOCUS_17590 30531 29029 gene locus_tag LOCUS_17600 30531 29029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 31298 30540 gene locus_tag LOCUS_17610 31298 30540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 32259 31282 gene locus_tag LOCUS_17620 32259 31282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 33215 32310 gene locus_tag LOCUS_17630 33215 32310 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_17630 33282 33428 gene locus_tag LOCUS_17640 33282 33428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 33494 37714 gene locus_tag LOCUS_17650 33494 37714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 37717 38472 gene locus_tag LOCUS_17660 gene lgt 37717 38472 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence037 <1 1009 gene locus_tag LOCUS_17670 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259547.1:N-methyl-L-tryptophan oxidase 1010 1786 gene locus_tag LOCUS_17680 1010 1786 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_17680 4473 1810 gene locus_tag LOCUS_17690 4473 1810 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069655.1 protein_id gnl|my_center|LOCUS_17690 5190 4771 gene locus_tag LOCUS_17700 5190 4771 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_17700 5479 5180 gene locus_tag LOCUS_17710 5479 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 6339 5557 gene locus_tag LOCUS_17720 6339 5557 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392440.1 protein_id gnl|my_center|LOCUS_17720 6573 6403 gene locus_tag LOCUS_17730 6573 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 7932 6724 gene locus_tag LOCUS_17740 7932 6724 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391496.1 protein_id gnl|my_center|LOCUS_17740 11065 8147 gene locus_tag LOCUS_17750 11065 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 11641 11387 gene locus_tag LOCUS_17760 11641 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 11962 13221 gene locus_tag LOCUS_17770 11962 13221 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_17770 13224 14282 gene locus_tag LOCUS_17780 13224 14282 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243015.1 protein_id gnl|my_center|LOCUS_17780 14266 15402 gene locus_tag LOCUS_17790 14266 15402 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728145.1 protein_id gnl|my_center|LOCUS_17790 15399 16370 gene locus_tag LOCUS_17800 15399 16370 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249115.1 protein_id gnl|my_center|LOCUS_17800 16367 17494 gene locus_tag LOCUS_17810 gene mutY 16367 17494 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_17810 17481 18380 gene locus_tag LOCUS_17820 17481 18380 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_17820 18666 18388 gene locus_tag LOCUS_17830 18666 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 20800 18656 gene locus_tag LOCUS_17840 20800 18656 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942130.1 protein_id gnl|my_center|LOCUS_17840 22406 20991 gene locus_tag LOCUS_17850 gene lpdA 22406 20991 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_17850 23703 22414 gene locus_tag LOCUS_17860 23703 22414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 26378 23718 gene locus_tag LOCUS_17870 gene aceE 26378 23718 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_17870 26540 28297 gene locus_tag LOCUS_17880 26540 28297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 29091 28303 gene locus_tag LOCUS_17890 29091 28303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 30069 29119 gene locus_tag LOCUS_17900 30069 29119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 31610 30300 gene locus_tag LOCUS_17910 gene mgtE 31610 30300 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_17910 32452 31610 gene locus_tag LOCUS_17920 32452 31610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 33278 32442 gene locus_tag LOCUS_17930 33278 32442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 34008 33292 gene locus_tag LOCUS_17940 34008 33292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 34155 36149 gene locus_tag LOCUS_17950 34155 36149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 36206 37300 gene locus_tag LOCUS_17960 36206 37300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence038 267 2297 gene locus_tag LOCUS_17970 267 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 3081 2353 gene locus_tag LOCUS_17980 3081 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 4055 3078 gene locus_tag LOCUS_17990 4055 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4614 4099 gene locus_tag LOCUS_18000 4614 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4771 5019 gene locus_tag LOCUS_18010 4771 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5355 5279 gene locus_tag LOCUS_t00170 5355 5279 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5437 6489 gene locus_tag LOCUS_18020 5437 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 6495 6923 gene locus_tag LOCUS_18030 gene rlmH 6495 6923 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027004.1 protein_id gnl|my_center|LOCUS_18030 8132 7002 gene locus_tag LOCUS_18040 8132 7002 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811039.1 protein_id gnl|my_center|LOCUS_18040 8315 9298 gene locus_tag LOCUS_18050 8315 9298 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_18050 9889 9299 gene locus_tag LOCUS_18060 9889 9299 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_18060 11115 9958 gene locus_tag LOCUS_18070 11115 9958 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_18070 12140 11112 gene locus_tag LOCUS_18080 12140 11112 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932223.1 protein_id gnl|my_center|LOCUS_18080 14671 12137 gene locus_tag LOCUS_18090 14671 12137 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_18090 16574 14808 gene locus_tag LOCUS_18100 16574 14808 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_18100 16861 17265 gene locus_tag LOCUS_18110 16861 17265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 18103 17720 gene locus_tag LOCUS_18120 18103 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 18870 18217 gene locus_tag LOCUS_18130 18870 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 24536 18867 gene locus_tag LOCUS_18140 gene uvrA 24536 18867 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121648.1 protein_id gnl|my_center|LOCUS_18140 24690 25022 gene locus_tag LOCUS_18150 24690 25022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 25025 25327 gene locus_tag LOCUS_18160 25025 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 25444 26244 gene locus_tag LOCUS_18170 25444 26244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 26234 26785 gene locus_tag LOCUS_18180 gene thpR 26234 26785 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_18180 26946 27707 gene locus_tag LOCUS_18190 26946 27707 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_18190 27710 28768 gene locus_tag LOCUS_18200 27710 28768 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259167.1 protein_id gnl|my_center|LOCUS_18200 28812 29600 gene locus_tag LOCUS_18210 gene bacC 28812 29600 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 protein_id gnl|my_center|LOCUS_18210 29649 30560 gene locus_tag LOCUS_18220 29649 30560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 30819 31964 gene locus_tag LOCUS_18230 30819 31964 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_18230 31969 32583 gene locus_tag LOCUS_18240 31969 32583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 32610 32780 gene locus_tag LOCUS_18250 32610 32780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 32752 32919 gene locus_tag LOCUS_18260 32752 32919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 34528 32951 gene locus_tag LOCUS_18270 34528 32951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 35615 34542 gene locus_tag LOCUS_18280 35615 34542 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 protein_id gnl|my_center|LOCUS_18280 36261 35617 gene locus_tag LOCUS_18290 36261 35617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence039 <1 1412 gene locus_tag LOCUS_18300 <1 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000970100.1:phosphoribosylformylglycinamidine synthase 1980 1489 gene locus_tag LOCUS_18310 1980 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2268 3251 gene locus_tag LOCUS_18320 2268 3251 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_18320 3266 4234 gene locus_tag LOCUS_18330 3266 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18330 4236 5696 gene locus_tag LOCUS_18340 4236 5696 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_18340 5773 7053 gene locus_tag LOCUS_18350 5773 7053 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155021.1 protein_id gnl|my_center|LOCUS_18350 7055 7555 gene locus_tag LOCUS_18360 7055 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 8901 7552 gene locus_tag LOCUS_18370 8901 7552 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_18370 9272 8898 gene locus_tag LOCUS_18380 9272 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 9546 10007 gene locus_tag LOCUS_18390 9546 10007 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090684.1 protein_id gnl|my_center|LOCUS_18390 10415 10083 gene locus_tag LOCUS_18400 10415 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 10949 10590 gene locus_tag LOCUS_18410 10949 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 12458 11115 gene locus_tag LOCUS_18420 12458 11115 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038811.1 protein_id gnl|my_center|LOCUS_18420 14280 12601 gene locus_tag LOCUS_18430 14280 12601 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063696.1 protein_id gnl|my_center|LOCUS_18430 15664 14753 gene locus_tag LOCUS_18440 15664 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140322.1 protein_id gnl|my_center|LOCUS_18440 15575 15766 gene locus_tag LOCUS_18450 15575 15766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 16146 15814 gene locus_tag LOCUS_18460 16146 15814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 16352 16149 gene locus_tag LOCUS_18470 16352 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 20792 16554 gene locus_tag LOCUS_18480 20792 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 22407 20824 gene locus_tag LOCUS_18490 22407 20824 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256724.1 protein_id gnl|my_center|LOCUS_18490 23199 22495 gene locus_tag LOCUS_18500 23199 22495 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243013.1 protein_id gnl|my_center|LOCUS_18500 23554 23228 gene locus_tag LOCUS_18510 23554 23228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 23919 23557 gene locus_tag LOCUS_18520 23919 23557 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_18520 24706 24161 gene locus_tag LOCUS_18530 24706 24161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 26402 24801 gene locus_tag LOCUS_18540 26402 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 26835 26996 gene locus_tag LOCUS_18550 26835 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 27135 30050 gene locus_tag LOCUS_18560 27135 30050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 30608 30072 gene locus_tag LOCUS_18570 30608 30072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 30897 32123 gene locus_tag LOCUS_18580 30897 32123 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_18580 32161 33912 gene locus_tag LOCUS_18590 32161 33912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 34056 35273 gene locus_tag LOCUS_18600 34056 35273 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence040 1349 2392 gene locus_tag LOCUS_18610 1349 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2623 3666 gene locus_tag LOCUS_18620 2623 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3783 4841 gene locus_tag LOCUS_18630 3783 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 4883 6163 gene locus_tag LOCUS_18640 4883 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 6194 7315 gene locus_tag LOCUS_18650 gene dgoD 6194 7315 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_18650 7323 9815 gene locus_tag LOCUS_18660 7323 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 10007 11629 gene locus_tag LOCUS_18670 10007 11629 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_18670 11784 12659 gene locus_tag LOCUS_18680 11784 12659 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_18680 12763 14589 gene locus_tag LOCUS_18690 12763 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 14762 15670 gene locus_tag LOCUS_18700 14762 15670 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_18700 15790 16269 gene locus_tag LOCUS_18710 15790 16269 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_18710 16290 18572 gene locus_tag LOCUS_18720 16290 18572 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968069.1 protein_id gnl|my_center|LOCUS_18720 18579 18848 gene locus_tag LOCUS_18730 18579 18848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 19422 18982 gene locus_tag LOCUS_18740 gene dut 19422 18982 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_18740 20621 19419 gene locus_tag LOCUS_18750 20621 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 22452 20710 gene locus_tag LOCUS_18760 22452 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 23359 22610 gene locus_tag LOCUS_18770 23359 22610 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_18770 24307 23360 gene locus_tag LOCUS_18780 gene argC 24307 23360 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 protein_id gnl|my_center|LOCUS_18780 25271 24315 gene locus_tag LOCUS_18790 25271 24315 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_18790 26112 25276 gene locus_tag LOCUS_18800 26112 25276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 26431 26294 gene locus_tag LOCUS_18810 26431 26294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 27465 26428 gene locus_tag LOCUS_18820 27465 26428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 27839 27462 gene locus_tag LOCUS_18830 27839 27462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 27888 29276 gene locus_tag LOCUS_18840 gene murD 27888 29276 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_18840 29341 30264 gene locus_tag LOCUS_18850 29341 30264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 30281 31747 gene locus_tag LOCUS_18860 30281 31747 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_18860 32706 31744 gene locus_tag LOCUS_18870 32706 31744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 33922 32708 gene locus_tag LOCUS_18880 33922 32708 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_18880 34332 34054 gene locus_tag LOCUS_18890 34332 34054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 <35057 34418 gene locus_tag LOCUS_18900 <35057 34418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192841.1:phosphoadenylyl-sulfate reductase >Feature sequence041 894 148 gene locus_tag LOCUS_18910 894 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1817 891 gene locus_tag LOCUS_18920 1817 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2272 4926 gene locus_tag LOCUS_18930 2272 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 5024 7114 gene locus_tag LOCUS_18940 5024 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7210 8544 gene locus_tag LOCUS_18950 7210 8544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 8541 10043 gene locus_tag LOCUS_18960 8541 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 10045 11766 gene locus_tag LOCUS_18970 10045 11766 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_18970 13759 11741 gene locus_tag LOCUS_18980 13759 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 15423 13762 gene locus_tag LOCUS_18990 15423 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 16265 15507 gene locus_tag LOCUS_19000 16265 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 19026 16276 gene locus_tag LOCUS_19010 19026 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 22408 19073 gene locus_tag LOCUS_19020 22408 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 24927 22450 gene locus_tag LOCUS_19030 24927 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 26008 25106 gene locus_tag LOCUS_19040 26008 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 27202 26297 gene locus_tag LOCUS_19050 27202 26297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 27918 27223 gene locus_tag LOCUS_19060 27918 27223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 29590 27998 gene locus_tag LOCUS_19070 29590 27998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 30790 29615 gene locus_tag LOCUS_19080 30790 29615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 31508 30825 gene locus_tag LOCUS_19090 31508 30825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 31941 31513 gene locus_tag LOCUS_19100 31941 31513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 33058 31976 gene locus_tag LOCUS_19110 33058 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 34332 33058 gene locus_tag LOCUS_19120 gene larA 34332 33058 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence042 919 578 gene locus_tag LOCUS_19130 919 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2029 1022 gene locus_tag LOCUS_19140 2029 1022 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_19140 2833 2033 gene locus_tag LOCUS_19150 2833 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2913 4403 gene locus_tag LOCUS_19160 2913 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4388 5842 gene locus_tag LOCUS_19170 4388 5842 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_19170 5845 6735 gene locus_tag LOCUS_19180 5845 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7134 6778 gene locus_tag LOCUS_19190 gene speD 7134 6778 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_19190 7374 7186 gene locus_tag LOCUS_19200 7374 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 8710 7463 gene locus_tag LOCUS_19210 8710 7463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_19210 10089 8710 gene locus_tag LOCUS_19220 10089 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 11260 10079 gene locus_tag LOCUS_19230 11260 10079 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_19230 11916 11257 gene locus_tag LOCUS_19240 11916 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 12233 15337 gene locus_tag LOCUS_19250 12233 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 15693 17837 gene locus_tag LOCUS_19260 15693 17837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 17899 20049 gene locus_tag LOCUS_19270 17899 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 20595 21533 gene locus_tag LOCUS_19280 20595 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 21552 21845 gene locus_tag LOCUS_19290 21552 21845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 21838 23493 gene locus_tag LOCUS_19300 21838 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 23506 26136 gene locus_tag LOCUS_19310 23506 26136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 26136 29258 gene locus_tag LOCUS_19320 26136 29258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 29282 30016 gene locus_tag LOCUS_19330 29282 30016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 30135 31016 gene locus_tag LOCUS_19340 30135 31016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 31020 31154 gene locus_tag LOCUS_19350 31020 31154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 31294 31884 gene locus_tag LOCUS_19360 31294 31884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 31877 32539 gene locus_tag LOCUS_19370 31877 32539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 32540 33826 gene locus_tag LOCUS_19380 32540 33826 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144027.1 protein_id gnl|my_center|LOCUS_19380 33839 34495 gene locus_tag LOCUS_19390 33839 34495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence043 <1 2528 gene locus_tag LOCUS_19400 <1 2528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705583.1:glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase 2521 5472 gene locus_tag LOCUS_19410 2521 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5465 8488 gene locus_tag LOCUS_19420 5465 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 8540 9748 gene locus_tag LOCUS_19430 8540 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 10725 9772 gene locus_tag LOCUS_19440 10725 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_19440 10880 11476 gene locus_tag LOCUS_19450 10880 11476 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_19450 14580 11569 gene locus_tag LOCUS_19460 14580 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 15701 14619 gene locus_tag LOCUS_19470 15701 14619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 17780 15798 gene locus_tag LOCUS_19480 17780 15798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 18960 17785 gene locus_tag LOCUS_19490 18960 17785 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966707.1 protein_id gnl|my_center|LOCUS_19490 20717 19011 gene locus_tag LOCUS_19500 20717 19011 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_19500 20883 21629 gene locus_tag LOCUS_19510 20883 21629 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089099.1 protein_id gnl|my_center|LOCUS_19510 23249 21648 gene locus_tag LOCUS_19520 23249 21648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 24062 23286 gene locus_tag LOCUS_19530 24062 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 25340 24165 gene locus_tag LOCUS_19540 25340 24165 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_19540 26002 26952 gene locus_tag LOCUS_19550 26002 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19550 26953 27579 gene locus_tag LOCUS_19560 26953 27579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19560 27595 28362 gene locus_tag LOCUS_19570 27595 28362 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_19570 28363 29601 gene locus_tag LOCUS_19580 28363 29601 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531108.1 protein_id gnl|my_center|LOCUS_19580 29598 30836 gene locus_tag LOCUS_19590 gene lolE 29598 30836 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072271.1 protein_id gnl|my_center|LOCUS_19590 30829 31539 gene locus_tag LOCUS_19600 30829 31539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_19600 31530 32747 gene locus_tag LOCUS_19610 31530 32747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence044 <1 1367 gene locus_tag LOCUS_19620 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038264.1:M20/M25/M40 family metallo-hydrolase 2453 1377 gene locus_tag LOCUS_19630 2453 1377 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_19630 2645 3430 gene locus_tag LOCUS_19640 2645 3430 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868772.1 protein_id gnl|my_center|LOCUS_19640 3508 4155 gene locus_tag LOCUS_19650 3508 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 4173 4961 gene locus_tag LOCUS_19660 4173 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 6396 4948 gene locus_tag LOCUS_19670 6396 4948 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_19670 7742 6585 gene locus_tag LOCUS_19680 7742 6585 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_19680 9254 7809 gene locus_tag LOCUS_19690 9254 7809 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616190.1 protein_id gnl|my_center|LOCUS_19690 10887 9277 gene locus_tag LOCUS_19700 10887 9277 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 protein_id gnl|my_center|LOCUS_19700 12418 10931 gene locus_tag LOCUS_19710 12418 10931 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_19710 13629 12415 gene locus_tag LOCUS_19720 13629 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 14493 14092 gene locus_tag LOCUS_19730 14493 14092 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_19730 17586 14821 gene locus_tag LOCUS_19740 17586 14821 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_19740 18015 17773 gene locus_tag LOCUS_19750 18015 17773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 18255 18058 gene locus_tag LOCUS_19760 18255 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 18684 18326 gene locus_tag LOCUS_tm00010 18684 18326 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 20986 18725 gene locus_tag LOCUS_19770 20986 18725 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_19770 21960 21004 gene locus_tag LOCUS_19780 21960 21004 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_19780 23859 22018 gene locus_tag LOCUS_19790 gene ilvD 23859 22018 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244135.1 protein_id gnl|my_center|LOCUS_19790 24758 23898 gene locus_tag LOCUS_19800 24758 23898 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615409.1 protein_id gnl|my_center|LOCUS_19800 26888 24759 gene locus_tag LOCUS_19810 26888 24759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 31162 26885 gene locus_tag LOCUS_19820 31162 26885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 31989 31159 gene locus_tag LOCUS_19830 31989 31159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 32839 32180 gene locus_tag LOCUS_19840 32839 32180 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109966.1 protein_id gnl|my_center|LOCUS_19840 33547 32945 gene locus_tag LOCUS_19850 33547 32945 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence045 428 2482 gene locus_tag LOCUS_19860 428 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2827 2561 gene locus_tag LOCUS_19870 2827 2561 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932679.1 protein_id gnl|my_center|LOCUS_19870 3068 2877 gene locus_tag LOCUS_19880 3068 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4731 3181 gene locus_tag LOCUS_19890 4731 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 4799 5014 gene locus_tag LOCUS_19900 4799 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 5027 6181 gene locus_tag LOCUS_19910 5027 6181 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_19910 7458 6178 gene locus_tag LOCUS_19920 7458 6178 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_19920 7379 7558 gene locus_tag LOCUS_19930 7379 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7586 8632 gene locus_tag LOCUS_19940 gene hisC 7586 8632 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868985.1 protein_id gnl|my_center|LOCUS_19940 8648 9628 gene locus_tag LOCUS_19950 8648 9628 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_19950 9785 10138 gene locus_tag LOCUS_19960 9785 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 10138 11088 gene locus_tag LOCUS_19970 10138 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 11075 13459 gene locus_tag LOCUS_19980 11075 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 13456 13812 gene locus_tag LOCUS_19990 13456 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 13816 14955 gene locus_tag LOCUS_20000 13816 14955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 15058 15795 gene locus_tag LOCUS_20010 15058 15795 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970447.1 protein_id gnl|my_center|LOCUS_20010 16131 16580 gene locus_tag LOCUS_20020 16131 16580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 16625 17383 gene locus_tag LOCUS_20030 gene fabG 16625 17383 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_20030 17487 19499 gene locus_tag LOCUS_20040 17487 19499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 19496 20602 gene locus_tag LOCUS_20050 gene mraY 19496 20602 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939777.1 protein_id gnl|my_center|LOCUS_20050 21042 20605 gene locus_tag LOCUS_20060 21042 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 21132 23135 gene locus_tag LOCUS_20070 gene recG 21132 23135 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403048.1 protein_id gnl|my_center|LOCUS_20070 24326 23184 gene locus_tag LOCUS_20080 24326 23184 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 protein_id gnl|my_center|LOCUS_20080 24440 25570 gene locus_tag LOCUS_20090 24440 25570 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383463.1 protein_id gnl|my_center|LOCUS_20090 26081 26407 gene locus_tag LOCUS_20100 26081 26407 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_20100 27787 26435 gene locus_tag LOCUS_20110 27787 26435 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931234.1 protein_id gnl|my_center|LOCUS_20110 27997 28698 gene locus_tag LOCUS_20120 27997 28698 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466681.1 protein_id gnl|my_center|LOCUS_20120 28712 29821 gene locus_tag LOCUS_20130 28712 29821 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223438.1 protein_id gnl|my_center|LOCUS_20130 29992 30963 gene locus_tag LOCUS_20140 29992 30963 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_20140 30984 32228 gene locus_tag LOCUS_20150 30984 32228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 32230 33480 gene locus_tag LOCUS_20160 gene trpB 32230 33480 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence046 380 1654 gene locus_tag LOCUS_20170 380 1654 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_20170 1686 2501 gene locus_tag LOCUS_20180 1686 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2512 3477 gene locus_tag LOCUS_20190 2512 3477 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_20190 3474 5150 gene locus_tag LOCUS_20200 3474 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5792 5145 gene locus_tag LOCUS_20210 5792 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 6993 5866 gene locus_tag LOCUS_20220 6993 5866 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229000.1 protein_id gnl|my_center|LOCUS_20220 7101 7856 gene locus_tag LOCUS_20230 7101 7856 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_20230 7883 9811 gene locus_tag LOCUS_20240 7883 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_20240 9941 10909 gene locus_tag LOCUS_20250 9941 10909 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_20250 11966 11016 gene locus_tag LOCUS_20260 11966 11016 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_20260 12164 12463 gene locus_tag LOCUS_20270 12164 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 12460 13269 gene locus_tag LOCUS_20280 12460 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 13339 14511 gene locus_tag LOCUS_20290 13339 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 14633 15802 gene locus_tag LOCUS_20300 14633 15802 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_20300 15805 16257 gene locus_tag LOCUS_20310 15805 16257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 17487 16345 gene locus_tag LOCUS_20320 17487 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 18436 17489 gene locus_tag LOCUS_20330 18436 17489 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_20330 18560 19360 gene locus_tag LOCUS_20340 18560 19360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 19376 20800 gene locus_tag LOCUS_20350 19376 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 20843 22921 gene locus_tag LOCUS_20360 20843 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 23224 23616 gene locus_tag LOCUS_20370 23224 23616 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118554.1 protein_id gnl|my_center|LOCUS_20370 23613 24512 gene locus_tag LOCUS_20380 23613 24512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_20380 24509 26521 gene locus_tag LOCUS_20390 24509 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 26655 27065 gene locus_tag LOCUS_20400 26655 27065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 27094 27666 gene locus_tag LOCUS_20410 27094 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 27684 28544 gene locus_tag LOCUS_20420 27684 28544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 28541 29794 gene locus_tag LOCUS_20430 28541 29794 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_20430 29830 31566 gene locus_tag LOCUS_20440 29830 31566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_20440 33084 31831 gene locus_tag LOCUS_20450 33084 31831 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250942.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence047 <1 797 gene locus_tag LOCUS_20460 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338340.1:choline-sulfatase 3958 878 gene locus_tag LOCUS_20470 3958 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 5390 4104 gene locus_tag LOCUS_20480 5390 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 6412 5369 gene locus_tag LOCUS_20490 6412 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 7416 6403 gene locus_tag LOCUS_20500 7416 6403 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_20500 7598 9895 gene locus_tag LOCUS_20510 7598 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 11012 9972 gene locus_tag LOCUS_20520 11012 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 11203 11865 gene locus_tag LOCUS_20530 11203 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 11868 13340 gene locus_tag LOCUS_20540 11868 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 13527 13763 gene locus_tag LOCUS_20550 gene vapB 13527 13763 CDS product toxin-antitoxin system antitoxin VapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450524.1 protein_id gnl|my_center|LOCUS_20550 13763 14164 gene locus_tag LOCUS_20560 gene vapC 13763 14164 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_20560 14220 16319 gene locus_tag LOCUS_20570 14220 16319 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922418.1 protein_id gnl|my_center|LOCUS_20570 16316 17437 gene locus_tag LOCUS_20580 16316 17437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 17434 17958 gene locus_tag LOCUS_20590 17434 17958 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_20590 17955 18182 gene locus_tag LOCUS_20600 17955 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 18643 18329 gene locus_tag LOCUS_20610 18643 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 18635 19402 gene locus_tag LOCUS_20620 18635 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 19526 21034 gene locus_tag LOCUS_20630 19526 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 21036 22514 gene locus_tag LOCUS_20640 21036 22514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 22511 25732 gene locus_tag LOCUS_20650 22511 25732 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968692.1 protein_id gnl|my_center|LOCUS_20650 26534 25758 gene locus_tag LOCUS_20660 26534 25758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 26623 27681 gene locus_tag LOCUS_20670 26623 27681 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_20670 27690 29126 gene locus_tag LOCUS_20680 27690 29126 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816500.1 protein_id gnl|my_center|LOCUS_20680 30349 29174 gene locus_tag LOCUS_20690 gene pepQ 30349 29174 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 protein_id gnl|my_center|LOCUS_20690 30878 30390 gene locus_tag LOCUS_20700 30878 30390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_20700 31230 30838 gene locus_tag LOCUS_20710 31230 30838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 32380 31298 gene locus_tag LOCUS_20720 32380 31298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence048 1378 5793 gene locus_tag LOCUS_20730 1378 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 5923 7983 gene locus_tag LOCUS_20740 5923 7983 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_20740 7980 8933 gene locus_tag LOCUS_20750 gene cysK 7980 8933 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_20750 11447 8919 gene locus_tag LOCUS_20760 11447 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 12006 11437 gene locus_tag LOCUS_20770 12006 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 12237 12698 gene locus_tag LOCUS_20780 gene zntR 12237 12698 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285610.1 protein_id gnl|my_center|LOCUS_20780 12710 13033 gene locus_tag LOCUS_20790 12710 13033 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_20790 13044 14216 gene locus_tag LOCUS_20800 13044 14216 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_20800 14213 15400 gene locus_tag LOCUS_20810 14213 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 15474 16076 gene locus_tag LOCUS_20820 gene trmB 15474 16076 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941189.1 protein_id gnl|my_center|LOCUS_20820 16373 16816 gene locus_tag LOCUS_20830 gene mraZ 16373 16816 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_20830 16829 17761 gene locus_tag LOCUS_20840 gene rsmH 16829 17761 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_20840 17763 18062 gene locus_tag LOCUS_20850 17763 18062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 18062 20026 gene locus_tag LOCUS_20860 18062 20026 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_20860 20027 21538 gene locus_tag LOCUS_20870 20027 21538 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_20870 21526 22902 gene locus_tag LOCUS_20880 21526 22902 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_20880 22958 24082 gene locus_tag LOCUS_20890 gene ftsW 22958 24082 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_20890 24070 25464 gene locus_tag LOCUS_20900 gene murC 24070 25464 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_20900 25461 26267 gene locus_tag LOCUS_20910 25461 26267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 26264 27436 gene locus_tag LOCUS_20920 gene ftsA 26264 27436 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_20920 27473 28672 gene locus_tag LOCUS_20930 gene ftsZ 27473 28672 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_20930 28759 29214 gene locus_tag LOCUS_20940 gene purE 28759 29214 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817242.1 protein_id gnl|my_center|LOCUS_20940 29323 29946 gene locus_tag LOCUS_20950 29323 29946 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249257.1 protein_id gnl|my_center|LOCUS_20950 29957 30295 gene locus_tag LOCUS_20960 gene glnB 29957 30295 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420517.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence049 1665 229 gene locus_tag LOCUS_20970 gene phnY 1665 229 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 protein_id gnl|my_center|LOCUS_20970 1923 2729 gene locus_tag LOCUS_20980 1923 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 3682 5577 gene locus_tag LOCUS_20990 3682 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_20990 5586 6362 gene locus_tag LOCUS_21000 5586 6362 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971334.1 protein_id gnl|my_center|LOCUS_21000 6365 7354 gene locus_tag LOCUS_21010 6365 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 7541 8551 gene locus_tag LOCUS_21020 7541 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 8578 8871 gene locus_tag LOCUS_21030 8578 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 8896 9579 gene locus_tag LOCUS_21040 8896 9579 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438215.1 protein_id gnl|my_center|LOCUS_21040 9886 9590 gene locus_tag LOCUS_21050 9886 9590 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_21050 10177 9899 gene locus_tag LOCUS_21060 10177 9899 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_21060 10332 11513 gene locus_tag LOCUS_21070 10332 11513 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_21070 12565 11552 gene locus_tag LOCUS_21080 12565 11552 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530831.1 protein_id gnl|my_center|LOCUS_21080 13511 12777 gene locus_tag LOCUS_21090 13511 12777 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_21090 14389 13514 gene locus_tag LOCUS_21100 14389 13514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 15127 14465 gene locus_tag LOCUS_21110 15127 14465 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 protein_id gnl|my_center|LOCUS_21110 15353 16900 gene locus_tag LOCUS_21120 15353 16900 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_21120 16914 17648 gene locus_tag LOCUS_21130 16914 17648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 17664 18449 gene locus_tag LOCUS_21140 gene fabG 17664 18449 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_21140 18479 20398 gene locus_tag LOCUS_21150 18479 20398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 20824 22803 gene locus_tag LOCUS_21160 20824 22803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 22821 23951 gene locus_tag LOCUS_21170 22821 23951 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_21170 24737 24009 gene locus_tag LOCUS_21180 24737 24009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 25558 24758 gene locus_tag LOCUS_21190 25558 24758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 25652 26281 gene locus_tag LOCUS_21200 25652 26281 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539817.1 protein_id gnl|my_center|LOCUS_21200 26694 26365 gene locus_tag LOCUS_21210 26694 26365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 27145 28806 gene locus_tag LOCUS_21220 27145 28806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 28836 30608 gene locus_tag LOCUS_21230 28836 30608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence050 <1 1172 gene locus_tag LOCUS_21240 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258192.1:TRAP transporter large permease subunit 1463 2374 gene locus_tag LOCUS_21250 1463 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2447 3151 gene locus_tag LOCUS_21260 2447 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 3148 4326 gene locus_tag LOCUS_21270 3148 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5718 4372 gene locus_tag LOCUS_21280 5718 4372 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_21280 7732 5720 gene locus_tag LOCUS_21290 7732 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 7892 7770 gene locus_tag LOCUS_21300 7892 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 10159 8057 gene locus_tag LOCUS_21310 10159 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 10479 11498 gene locus_tag LOCUS_21320 10479 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 11503 12981 gene locus_tag LOCUS_21330 11503 12981 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389022.1 protein_id gnl|my_center|LOCUS_21330 12992 13330 gene locus_tag LOCUS_21340 12992 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 13374 16238 gene locus_tag LOCUS_21350 13374 16238 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_21350 16844 16326 gene locus_tag LOCUS_21360 16844 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 17592 17221 gene locus_tag LOCUS_21370 17592 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 17722 17976 gene locus_tag LOCUS_21380 17722 17976 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 protein_id gnl|my_center|LOCUS_21380 17973 18305 gene locus_tag LOCUS_21390 17973 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 18618 18322 gene locus_tag LOCUS_21400 18618 18322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 19694 18660 gene locus_tag LOCUS_21410 19694 18660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 20025 19768 gene locus_tag LOCUS_21420 20025 19768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 21009 20041 gene locus_tag LOCUS_21430 21009 20041 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584013.1 protein_id gnl|my_center|LOCUS_21430 22547 21270 gene locus_tag LOCUS_21440 22547 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 27850 22544 gene locus_tag LOCUS_21450 27850 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 29615 28107 gene locus_tag LOCUS_21460 29615 28107 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973123.1 protein_id gnl|my_center|LOCUS_21460 30632 29619 gene locus_tag LOCUS_21470 30632 29619 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973120.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence051 1823 6 gene locus_tag LOCUS_21480 1823 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2527 1847 gene locus_tag LOCUS_21490 2527 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3482 2577 gene locus_tag LOCUS_21500 3482 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 5325 3886 gene locus_tag LOCUS_21510 5325 3886 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_21510 6306 5359 gene locus_tag LOCUS_21520 6306 5359 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_21520 6407 6679 gene locus_tag LOCUS_21530 6407 6679 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_21530 6689 7060 gene locus_tag LOCUS_21540 6689 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 7087 8718 gene locus_tag LOCUS_21550 7087 8718 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_21550 10381 8726 gene locus_tag LOCUS_21560 10381 8726 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_21560 11461 10517 gene locus_tag LOCUS_21570 11461 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 12061 11897 gene locus_tag LOCUS_21580 12061 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 13852 12071 gene locus_tag LOCUS_21590 13852 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 14615 13869 gene locus_tag LOCUS_21600 14615 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 15066 14647 gene locus_tag LOCUS_21610 15066 14647 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_21610 15485 15066 gene locus_tag LOCUS_21620 15485 15066 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_21620 16231 15485 gene locus_tag LOCUS_21630 16231 15485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 16466 19714 gene locus_tag LOCUS_21640 16466 19714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 19722 20945 gene locus_tag LOCUS_21650 19722 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 20942 22183 gene locus_tag LOCUS_21660 20942 22183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 22183 22650 gene locus_tag LOCUS_21670 22183 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 22647 24698 gene locus_tag LOCUS_21680 22647 24698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 24700 27417 gene locus_tag LOCUS_21690 24700 27417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 27422 30148 gene locus_tag LOCUS_21700 27422 30148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence052 1333 377 gene locus_tag LOCUS_21710 1333 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2597 1641 gene locus_tag LOCUS_21720 2597 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2804 3880 gene locus_tag LOCUS_21730 2804 3880 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_21730 3906 4694 gene locus_tag LOCUS_21740 3906 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 6151 4787 gene locus_tag LOCUS_21750 6151 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 7837 6164 gene locus_tag LOCUS_21760 7837 6164 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_21760 9241 7883 gene locus_tag LOCUS_21770 9241 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 10880 9222 gene locus_tag LOCUS_21780 10880 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 11660 10893 gene locus_tag LOCUS_21790 11660 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 13776 11701 gene locus_tag LOCUS_21800 13776 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 16475 13830 gene locus_tag LOCUS_21810 16475 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 18814 16508 gene locus_tag LOCUS_21820 18814 16508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 20666 18831 gene locus_tag LOCUS_21830 20666 18831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 20590 20757 gene locus_tag LOCUS_21840 20590 20757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 21275 21123 gene locus_tag LOCUS_21850 21275 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 21256 23073 gene locus_tag LOCUS_21860 21256 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 23137 25686 gene locus_tag LOCUS_21870 23137 25686 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_21870 25810 27795 gene locus_tag LOCUS_21880 25810 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 27827 28660 gene locus_tag LOCUS_21890 27827 28660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 28657 29766 gene locus_tag LOCUS_21900 gene iolG 28657 29766 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612369.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence053 608 336 gene locus_tag LOCUS_21910 608 336 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_21910 1602 982 gene locus_tag LOCUS_21920 1602 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2228 3307 gene locus_tag LOCUS_21930 2228 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3693 3617 gene locus_tag LOCUS_t00180 3693 3617 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4907 3732 gene locus_tag LOCUS_21940 4907 3732 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_21940 5485 4898 gene locus_tag LOCUS_21950 gene nadD 5485 4898 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_21950 6234 5488 gene locus_tag LOCUS_21960 6234 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 6864 6241 gene locus_tag LOCUS_21970 6864 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7604 6864 gene locus_tag LOCUS_21980 7604 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 8195 7680 gene locus_tag LOCUS_21990 8195 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 8294 8218 gene locus_tag LOCUS_t00190 8294 8218 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8393 8317 gene locus_tag LOCUS_t00200 8393 8317 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10512 8482 gene locus_tag LOCUS_22000 10512 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_22000 11753 10581 gene locus_tag LOCUS_22010 11753 10581 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_22010 12860 11805 gene locus_tag LOCUS_22020 12860 11805 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_22020 13645 12857 gene locus_tag LOCUS_22030 13645 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 14014 13655 gene locus_tag LOCUS_22040 14014 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 15108 14086 gene locus_tag LOCUS_22050 15108 14086 CDS product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971599.1 protein_id gnl|my_center|LOCUS_22050 15232 16203 gene locus_tag LOCUS_22060 15232 16203 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_22060 16300 16213 gene locus_tag LOCUS_t00210 16300 16213 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16389 16316 gene locus_tag LOCUS_t00220 16389 16316 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16587 17378 gene locus_tag LOCUS_22070 gene thyA 16587 17378 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704637.1 protein_id gnl|my_center|LOCUS_22070 17779 17423 gene locus_tag LOCUS_22080 17779 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 19332 17770 gene locus_tag LOCUS_22090 19332 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 20278 19322 gene locus_tag LOCUS_22100 gene xerC 20278 19322 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_22100 22601 20310 gene locus_tag LOCUS_22110 gene topA 22601 20310 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_22110 22771 23526 gene locus_tag LOCUS_22120 gene map 22771 23526 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_22120 23523 24281 gene locus_tag LOCUS_22130 23523 24281 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_22130 26697 24349 gene locus_tag LOCUS_22140 26697 24349 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_22140 27426 26974 gene locus_tag LOCUS_22150 gene nrdR 27426 26974 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_22150 28196 27537 gene locus_tag LOCUS_22160 28196 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 28606 28193 gene locus_tag LOCUS_22170 28606 28193 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence054 1853 285 gene locus_tag LOCUS_22180 1853 285 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_22180 1999 2823 gene locus_tag LOCUS_22190 1999 2823 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027042.1 protein_id gnl|my_center|LOCUS_22190 2825 3691 gene locus_tag LOCUS_22200 2825 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3732 4862 gene locus_tag LOCUS_22210 3732 4862 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_22210 4874 5887 gene locus_tag LOCUS_22220 4874 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 5899 6906 gene locus_tag LOCUS_22230 5899 6906 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257505.1 protein_id gnl|my_center|LOCUS_22230 7845 6955 gene locus_tag LOCUS_22240 7845 6955 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531399.1 protein_id gnl|my_center|LOCUS_22240 7972 8763 gene locus_tag LOCUS_22250 7972 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 8783 9505 gene locus_tag LOCUS_22260 8783 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 9509 9733 gene locus_tag LOCUS_22270 9509 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 9741 10046 gene locus_tag LOCUS_22280 9741 10046 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058130.1 protein_id gnl|my_center|LOCUS_22280 10043 11374 gene locus_tag LOCUS_22290 gene dinF 10043 11374 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480864.1 protein_id gnl|my_center|LOCUS_22290 11386 11757 gene locus_tag LOCUS_22300 11386 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 11776 12705 gene locus_tag LOCUS_22310 11776 12705 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028418.1 protein_id gnl|my_center|LOCUS_22310 12702 13808 gene locus_tag LOCUS_22320 12702 13808 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_22320 13820 14614 gene locus_tag LOCUS_22330 13820 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 16121 14598 gene locus_tag LOCUS_22340 gene lnt 16121 14598 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_22340 16449 16123 gene locus_tag LOCUS_22350 16449 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 16565 16489 gene locus_tag LOCUS_t00230 16565 16489 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17948 16617 gene locus_tag LOCUS_22360 17948 16617 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_22360 18438 17986 gene locus_tag LOCUS_22370 18438 17986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 20582 18423 gene locus_tag LOCUS_22380 20582 18423 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964604.1 protein_id gnl|my_center|LOCUS_22380 21616 20660 gene locus_tag LOCUS_22390 21616 20660 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816443.1 protein_id gnl|my_center|LOCUS_22390 22563 21736 gene locus_tag LOCUS_22400 22563 21736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 22862 22578 gene locus_tag LOCUS_22410 22862 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 24780 22996 gene locus_tag LOCUS_22420 gene aspS 24780 22996 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_22420 24918 25838 gene locus_tag LOCUS_22430 24918 25838 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_22430 25851 26345 gene locus_tag LOCUS_22440 25851 26345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 26441 26719 gene locus_tag LOCUS_22450 26441 26719 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_22450 26760 27677 gene locus_tag LOCUS_22460 gene cysK 26760 27677 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_22460 27941 27687 gene locus_tag LOCUS_22470 gene rpsT 27941 27687 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence055 301 2205 gene locus_tag LOCUS_22480 301 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2202 4172 gene locus_tag LOCUS_22490 2202 4172 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_22490 5165 4179 gene locus_tag LOCUS_22500 5165 4179 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020371.1 protein_id gnl|my_center|LOCUS_22500 5552 6544 gene locus_tag LOCUS_22510 gene ilvC 5552 6544 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_22510 6705 8264 gene locus_tag LOCUS_22520 6705 8264 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_22520 8277 9674 gene locus_tag LOCUS_22530 gene leuC 8277 9674 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920779.1 protein_id gnl|my_center|LOCUS_22530 9688 10281 gene locus_tag LOCUS_22540 gene leuD 9688 10281 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_22540 10296 10544 gene locus_tag LOCUS_22550 10296 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 10549 11607 gene locus_tag LOCUS_22560 10549 11607 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_22560 11630 13225 gene locus_tag LOCUS_22570 gene cimA 11630 13225 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_22570 13250 13474 gene locus_tag LOCUS_22580 13250 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 13474 13737 gene locus_tag LOCUS_22590 13474 13737 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_22590 13846 15039 gene locus_tag LOCUS_22600 gene argJ 13846 15039 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_22600 15046 16227 gene locus_tag LOCUS_22610 15046 16227 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_22610 16281 17243 gene locus_tag LOCUS_22620 16281 17243 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_22620 18427 17288 gene locus_tag LOCUS_22630 18427 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 19354 18485 gene locus_tag LOCUS_22640 19354 18485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 19753 19394 gene locus_tag LOCUS_22650 gene queF 19753 19394 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_22650 22855 19850 gene locus_tag LOCUS_22660 22855 19850 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_22660 23334 22999 gene locus_tag LOCUS_22670 23334 22999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 23557 23315 gene locus_tag LOCUS_22680 23557 23315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 23845 23624 gene locus_tag LOCUS_22690 23845 23624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 25735 24236 gene locus_tag LOCUS_22700 25735 24236 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_22700 26184 25741 gene locus_tag LOCUS_22710 26184 25741 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22710 26742 26398 gene locus_tag LOCUS_22720 26742 26398 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096894563.1 protein_id gnl|my_center|LOCUS_22720 <27938 26834 gene locus_tag LOCUS_22730 <27938 26834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114406.1:class I SAM-dependent DNA methyltransferase >Feature sequence056 128 2068 gene locus_tag LOCUS_22740 128 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 5295 2065 gene locus_tag LOCUS_22750 5295 2065 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_22750 6222 5326 gene locus_tag LOCUS_22760 6222 5326 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390908.1 protein_id gnl|my_center|LOCUS_22760 6775 6224 gene locus_tag LOCUS_22770 gene ppiB 6775 6224 CDS product peptidylprolyl isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367878.1 protein_id gnl|my_center|LOCUS_22770 9143 6906 gene locus_tag LOCUS_22780 9143 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 10372 9362 gene locus_tag LOCUS_22790 10372 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 11249 10374 gene locus_tag LOCUS_22800 11249 10374 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_22800 11407 12561 gene locus_tag LOCUS_22810 gene araD 11407 12561 CDS product arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979122.1 protein_id gnl|my_center|LOCUS_22810 12568 13401 gene locus_tag LOCUS_22820 12568 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 13406 14287 gene locus_tag LOCUS_22830 gene rfbA 13406 14287 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706707.1 protein_id gnl|my_center|LOCUS_22830 14356 14607 gene locus_tag LOCUS_22840 14356 14607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 14614 15741 gene locus_tag LOCUS_22850 14614 15741 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258904.1 protein_id gnl|my_center|LOCUS_22850 15759 17567 gene locus_tag LOCUS_22860 15759 17567 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_22860 18310 17564 gene locus_tag LOCUS_22870 18310 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 18494 19879 gene locus_tag LOCUS_22880 18494 19879 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_22880 20102 22036 gene locus_tag LOCUS_22890 gene recQ 20102 22036 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_22890 22060 23031 gene locus_tag LOCUS_22900 22060 23031 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_22900 23194 24486 gene locus_tag LOCUS_22910 gene amt 23194 24486 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109815.1 protein_id gnl|my_center|LOCUS_22910 24514 25368 gene locus_tag LOCUS_22920 24514 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 25368 26381 gene locus_tag LOCUS_22930 25368 26381 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_22930 26378 27454 gene locus_tag LOCUS_22940 26378 27454 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403516.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence057 <1 566 gene locus_tag LOCUS_22950 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094661859.1:aldose 1-epimerase family protein 605 1549 gene locus_tag LOCUS_22960 605 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 1566 3452 gene locus_tag LOCUS_22970 1566 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_22970 4373 3465 gene locus_tag LOCUS_22980 4373 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4684 6219 gene locus_tag LOCUS_22990 4684 6219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 6468 7370 gene locus_tag LOCUS_23000 6468 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 7442 9490 gene locus_tag LOCUS_23010 7442 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 9580 12105 gene locus_tag LOCUS_23020 9580 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 12155 14305 gene locus_tag LOCUS_23030 12155 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 14343 17147 gene locus_tag LOCUS_23040 14343 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 17147 20032 gene locus_tag LOCUS_23050 17147 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 20029 21741 gene locus_tag LOCUS_23060 20029 21741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 21844 23985 gene locus_tag LOCUS_23070 21844 23985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 24187 26598 gene locus_tag LOCUS_23080 24187 26598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 26772 26697 gene locus_tag LOCUS_t00240 26772 26697 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence058 <1 1706 gene locus_tag LOCUS_23090 <1 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869562.1:SpoIVB peptidase S55 domain-containing protein 2908 1814 gene locus_tag LOCUS_23100 gene dgoD 2908 1814 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_23100 3576 2944 gene locus_tag LOCUS_23110 3576 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 5142 3589 gene locus_tag LOCUS_23120 5142 3589 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530049.1 protein_id gnl|my_center|LOCUS_23120 5331 6071 gene locus_tag LOCUS_23130 5331 6071 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225011.1 protein_id gnl|my_center|LOCUS_23130 6075 7832 gene locus_tag LOCUS_23140 6075 7832 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117792.1 protein_id gnl|my_center|LOCUS_23140 8017 7835 gene locus_tag LOCUS_23150 8017 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 8495 8022 gene locus_tag LOCUS_23160 8495 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 8795 8538 gene locus_tag LOCUS_23170 8795 8538 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_23170 9361 8858 gene locus_tag LOCUS_23180 9361 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 11335 9362 gene locus_tag LOCUS_23190 11335 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 13254 11332 gene locus_tag LOCUS_23200 13254 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 14966 13251 gene locus_tag LOCUS_23210 14966 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 17486 15102 gene locus_tag LOCUS_23220 17486 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 19104 17584 gene locus_tag LOCUS_23230 19104 17584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 19207 20208 gene locus_tag LOCUS_23240 19207 20208 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803813.1 protein_id gnl|my_center|LOCUS_23240 20218 21666 gene locus_tag LOCUS_23250 20218 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 22135 21848 gene locus_tag LOCUS_23260 22135 21848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 24178 22214 gene locus_tag LOCUS_23270 24178 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 24973 24242 gene locus_tag LOCUS_23280 24973 24242 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528117.1 protein_id gnl|my_center|LOCUS_23280 24960 25145 gene locus_tag LOCUS_23290 24960 25145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 25142 26398 gene locus_tag LOCUS_23300 25142 26398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence059 1998 280 gene locus_tag LOCUS_23310 1998 280 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403891.1 protein_id gnl|my_center|LOCUS_23310 4467 2032 gene locus_tag LOCUS_23320 4467 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 6069 4486 gene locus_tag LOCUS_23330 6069 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 7185 6082 gene locus_tag LOCUS_23340 7185 6082 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_23340 7269 7703 gene locus_tag LOCUS_23350 7269 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 7890 9020 gene locus_tag LOCUS_23360 7890 9020 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616070.1 protein_id gnl|my_center|LOCUS_23360 9914 9105 gene locus_tag LOCUS_23370 9914 9105 CDS product DUF1479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030607.1 protein_id gnl|my_center|LOCUS_23370 10957 9929 gene locus_tag LOCUS_23380 10957 9929 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_23380 12138 10948 gene locus_tag LOCUS_23390 12138 10948 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_23390 13460 12141 gene locus_tag LOCUS_23400 13460 12141 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_23400 13582 13869 gene locus_tag LOCUS_23410 13582 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_23410 15371 13866 gene locus_tag LOCUS_23420 15371 13866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 15453 16415 gene locus_tag LOCUS_23430 15453 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 16968 16417 gene locus_tag LOCUS_23440 16968 16417 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_23440 17150 17413 gene locus_tag LOCUS_23450 17150 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 17486 20740 gene locus_tag LOCUS_23460 17486 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 21368 24382 gene locus_tag LOCUS_23470 21368 24382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 24637 26295 gene locus_tag LOCUS_23480 24637 26295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 26315 27397 gene locus_tag LOCUS_23490 26315 27397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence060 2939 591 gene locus_tag LOCUS_23500 2939 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 4953 2941 gene locus_tag LOCUS_23510 4953 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 6246 5026 gene locus_tag LOCUS_23520 6246 5026 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_23520 6342 6548 gene locus_tag LOCUS_23530 6342 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 6771 6586 gene locus_tag LOCUS_23540 6771 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 7336 7037 gene locus_tag LOCUS_23550 7336 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 8480 7485 gene locus_tag LOCUS_23560 gene dusB 8480 7485 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_23560 8850 8527 gene locus_tag LOCUS_23570 8850 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 8966 10060 gene locus_tag LOCUS_23580 8966 10060 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_23580 10146 10604 gene locus_tag LOCUS_23590 10146 10604 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814912.1 protein_id gnl|my_center|LOCUS_23590 13069 10664 gene locus_tag LOCUS_23600 13069 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 16280 13269 gene locus_tag LOCUS_23610 16280 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 17409 16495 gene locus_tag LOCUS_23620 17409 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 18344 17418 gene locus_tag LOCUS_23630 18344 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 19806 18361 gene locus_tag LOCUS_23640 gene gatA 19806 18361 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_23640 20082 19810 gene locus_tag LOCUS_23650 20082 19810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 20388 20107 gene locus_tag LOCUS_23660 20388 20107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 21090 20395 gene locus_tag LOCUS_23670 gene pssA 21090 20395 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869027.1 protein_id gnl|my_center|LOCUS_23670 22126 21110 gene locus_tag LOCUS_23680 22126 21110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 22633 22328 gene locus_tag LOCUS_23690 22633 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 23397 22639 gene locus_tag LOCUS_23700 gene truA 23397 22639 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_23700 24202 23402 gene locus_tag LOCUS_23710 24202 23402 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869898.1 protein_id gnl|my_center|LOCUS_23710 25171 24206 gene locus_tag LOCUS_23720 25171 24206 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922054.1 protein_id gnl|my_center|LOCUS_23720 26002 25220 gene locus_tag LOCUS_23730 26002 25220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121328.1 protein_id gnl|my_center|LOCUS_23730 26739 25999 gene locus_tag LOCUS_23740 26739 25999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence061 720 3308 gene locus_tag LOCUS_23750 720 3308 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957294.1 protein_id gnl|my_center|LOCUS_23750 4255 3362 gene locus_tag LOCUS_23760 4255 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 4421 4666 gene locus_tag LOCUS_23770 4421 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 4748 5023 gene locus_tag LOCUS_23780 4748 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23780 5084 5389 gene locus_tag LOCUS_23790 5084 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 5515 5778 gene locus_tag LOCUS_23800 5515 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 5811 7028 gene locus_tag LOCUS_23810 5811 7028 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922154.1 protein_id gnl|my_center|LOCUS_23810 7080 7241 gene locus_tag LOCUS_23820 7080 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 7306 7626 gene locus_tag LOCUS_23830 gene grxC 7306 7626 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_23830 7613 8248 gene locus_tag LOCUS_23840 7613 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 8302 9021 gene locus_tag LOCUS_23850 8302 9021 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249013.1 protein_id gnl|my_center|LOCUS_23850 9054 10163 gene locus_tag LOCUS_23860 9054 10163 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_23860 10335 10676 gene locus_tag LOCUS_23870 10335 10676 CDS product DUF2089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583104.1 protein_id gnl|my_center|LOCUS_23870 10676 10951 gene locus_tag LOCUS_23880 10676 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 10961 12037 gene locus_tag LOCUS_23890 10961 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 12068 12490 gene locus_tag LOCUS_23900 12068 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 12514 15255 gene locus_tag LOCUS_23910 12514 15255 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928590.1 protein_id gnl|my_center|LOCUS_23910 15292 16050 gene locus_tag LOCUS_23920 15292 16050 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930779.1 protein_id gnl|my_center|LOCUS_23920 16097 16585 gene locus_tag LOCUS_23930 16097 16585 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085194.1 protein_id gnl|my_center|LOCUS_23930 16698 17660 gene locus_tag LOCUS_23940 16698 17660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 17797 18639 gene locus_tag LOCUS_23950 17797 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 19718 18684 gene locus_tag LOCUS_23960 19718 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 20466 19735 gene locus_tag LOCUS_23970 20466 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 21262 20477 gene locus_tag LOCUS_23980 21262 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 22401 21325 gene locus_tag LOCUS_23990 22401 21325 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_23990 22606 23556 gene locus_tag LOCUS_24000 22606 23556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 24225 23557 gene locus_tag LOCUS_24010 24225 23557 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986838.1 protein_id gnl|my_center|LOCUS_24010 26485 24230 gene locus_tag LOCUS_24020 26485 24230 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence062 128 856 gene locus_tag LOCUS_24030 128 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 869 1900 gene locus_tag LOCUS_24040 869 1900 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067528.1 protein_id gnl|my_center|LOCUS_24040 2112 2387 gene locus_tag LOCUS_24050 2112 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3862 2447 gene locus_tag LOCUS_24060 3862 2447 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_24060 5244 3883 gene locus_tag LOCUS_24070 5244 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 6224 5268 gene locus_tag LOCUS_24080 6224 5268 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_24080 6737 6231 gene locus_tag LOCUS_24090 gene lspA 6737 6231 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_24090 7138 6734 gene locus_tag LOCUS_24100 7138 6734 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403235.1 protein_id gnl|my_center|LOCUS_24100 10326 7165 gene locus_tag LOCUS_24110 gene ileS 10326 7165 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_24110 10616 10323 gene locus_tag LOCUS_24120 10616 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 11325 10633 gene locus_tag LOCUS_24130 11325 10633 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_24130 12602 11391 gene locus_tag LOCUS_24140 12602 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 15153 12631 gene locus_tag LOCUS_24150 gene secDF 15153 12631 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_24150 16209 15172 gene locus_tag LOCUS_24160 16209 15172 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_24160 17190 16222 gene locus_tag LOCUS_24170 17190 16222 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_24170 17351 18535 gene locus_tag LOCUS_24180 gene dgoD 17351 18535 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_24180 19647 18532 gene locus_tag LOCUS_24190 gene glcE 19647 18532 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 protein_id gnl|my_center|LOCUS_24190 19906 19679 gene locus_tag LOCUS_24200 gene rpmB 19906 19679 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113840.1 protein_id gnl|my_center|LOCUS_24200 20108 23776 gene locus_tag LOCUS_24210 20108 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 23874 24923 gene locus_tag LOCUS_24220 23874 24923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence063 1957 1586 gene locus_tag LOCUS_24230 1957 1586 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_24230 2240 1950 gene locus_tag LOCUS_24240 2240 1950 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_24240 5142 2287 gene locus_tag LOCUS_24250 5142 2287 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_24250 6391 5357 gene locus_tag LOCUS_24260 6391 5357 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646211.1 protein_id gnl|my_center|LOCUS_24260 7404 6394 gene locus_tag LOCUS_24270 7404 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 7565 10771 gene locus_tag LOCUS_24280 7565 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 10768 14370 gene locus_tag LOCUS_24290 gene addA 10768 14370 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970609.1 protein_id gnl|my_center|LOCUS_24290 14579 14367 gene locus_tag LOCUS_24300 14579 14367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 14680 16374 gene locus_tag LOCUS_24310 14680 16374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 16371 17825 gene locus_tag LOCUS_24320 gene gnd 16371 17825 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649523.1 protein_id gnl|my_center|LOCUS_24320 18114 18530 gene locus_tag LOCUS_24330 18114 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 19422 18601 gene locus_tag LOCUS_24340 19422 18601 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_24340 21582 19426 gene locus_tag LOCUS_24350 21582 19426 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_24350 22246 21641 gene locus_tag LOCUS_24360 22246 21641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 23368 22247 gene locus_tag LOCUS_24370 23368 22247 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_24370 23508 25757 gene locus_tag LOCUS_24380 23508 25757 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence064 <1 1043 gene locus_tag LOCUS_24390 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161270140.1:RNA degradosome polyphosphate kinase 1140 2636 gene locus_tag LOCUS_24400 gene glmU 1140 2636 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467757.1 protein_id gnl|my_center|LOCUS_24400 3551 2631 gene locus_tag LOCUS_24410 3551 2631 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895776.1 protein_id gnl|my_center|LOCUS_24410 4510 3614 gene locus_tag LOCUS_24420 4510 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 5274 4507 gene locus_tag LOCUS_24430 5274 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5604 6371 gene locus_tag LOCUS_24440 5604 6371 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_24440 7179 6376 gene locus_tag LOCUS_24450 gene dapB 7179 6376 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_24450 8231 7194 gene locus_tag LOCUS_24460 gene dapA 8231 7194 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286879.1 protein_id gnl|my_center|LOCUS_24460 8353 9528 gene locus_tag LOCUS_24470 8353 9528 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965740.1 protein_id gnl|my_center|LOCUS_24470 9606 10718 gene locus_tag LOCUS_24480 9606 10718 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_24480 10715 11416 gene locus_tag LOCUS_24490 10715 11416 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_24490 11746 11489 gene locus_tag LOCUS_24500 11746 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 12005 12250 gene locus_tag LOCUS_24510 12005 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 12247 12552 gene locus_tag LOCUS_24520 12247 12552 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626476.1 protein_id gnl|my_center|LOCUS_24520 12625 12888 gene locus_tag LOCUS_24530 12625 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 13133 13297 gene locus_tag LOCUS_24540 13133 13297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 13388 13543 gene locus_tag LOCUS_24550 13388 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 13540 13878 gene locus_tag LOCUS_24560 13540 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 13949 14215 gene locus_tag LOCUS_24570 13949 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 14326 15654 gene locus_tag LOCUS_24580 14326 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 16395 15670 gene locus_tag LOCUS_24590 gene ureG 16395 15670 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117800.1 protein_id gnl|my_center|LOCUS_24590 17063 16410 gene locus_tag LOCUS_24600 17063 16410 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892459.1 protein_id gnl|my_center|LOCUS_24600 18767 17064 gene locus_tag LOCUS_24610 gene ureC 18767 17064 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055860.1 protein_id gnl|my_center|LOCUS_24610 19672 18914 gene locus_tag LOCUS_24620 19672 18914 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889578.1 protein_id gnl|my_center|LOCUS_24620 20393 19683 gene locus_tag LOCUS_24630 gene urtE 20393 19683 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_24630 21144 20380 gene locus_tag LOCUS_24640 gene urtD 21144 20380 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_24640 22336 21290 gene locus_tag LOCUS_24650 gene urtC 22336 21290 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_24650 24012 22333 gene locus_tag LOCUS_24660 gene urtB 24012 22333 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535962.1 protein_id gnl|my_center|LOCUS_24660 25030 24131 gene locus_tag LOCUS_24670 25030 24131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 <26054 25084 gene locus_tag LOCUS_24680 <26054 25084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105219.1:urea ABC transporter substrate-binding protein >Feature sequence065 1374 349 gene locus_tag LOCUS_24690 1374 349 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 protein_id gnl|my_center|LOCUS_24690 2914 1454 gene locus_tag LOCUS_24700 2914 1454 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389097.1 protein_id gnl|my_center|LOCUS_24700 3094 4056 gene locus_tag LOCUS_24710 gene selD 3094 4056 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_24710 4053 5159 gene locus_tag LOCUS_24720 4053 5159 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_24720 5165 6214 gene locus_tag LOCUS_24730 5165 6214 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086741.1 protein_id gnl|my_center|LOCUS_24730 6337 7215 gene locus_tag LOCUS_24740 6337 7215 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_24740 7222 8277 gene locus_tag LOCUS_24750 7222 8277 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445390.1 protein_id gnl|my_center|LOCUS_24750 9044 8274 gene locus_tag LOCUS_24760 9044 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 9003 10001 gene locus_tag LOCUS_24770 9003 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 10002 11765 gene locus_tag LOCUS_24780 10002 11765 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146756.1 protein_id gnl|my_center|LOCUS_24780 11812 12882 gene locus_tag LOCUS_24790 11812 12882 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_24790 12981 13715 gene locus_tag LOCUS_24800 12981 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 14004 15119 gene locus_tag LOCUS_24810 14004 15119 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_24810 15128 16531 gene locus_tag LOCUS_24820 15128 16531 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776859.1 protein_id gnl|my_center|LOCUS_24820 17555 16710 gene locus_tag LOCUS_24830 17555 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 19128 17557 gene locus_tag LOCUS_24840 19128 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 20285 19161 gene locus_tag LOCUS_24850 20285 19161 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_24850 21481 20318 gene locus_tag LOCUS_24860 21481 20318 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477066.1 protein_id gnl|my_center|LOCUS_24860 22573 21512 gene locus_tag LOCUS_24870 gene aroG 22573 21512 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705850.1 protein_id gnl|my_center|LOCUS_24870 23996 22770 gene locus_tag LOCUS_24880 23996 22770 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_24880 24101 25102 gene locus_tag LOCUS_24890 24101 25102 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066680.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence066 215 1489 gene locus_tag LOCUS_24900 215 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1499 1876 gene locus_tag LOCUS_24910 1499 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1911 2057 gene locus_tag LOCUS_24920 1911 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2411 4831 gene locus_tag LOCUS_24930 2411 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 4821 5174 gene locus_tag LOCUS_24940 4821 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 5179 5433 gene locus_tag LOCUS_24950 5179 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 5433 6023 gene locus_tag LOCUS_24960 5433 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 6246 7043 gene locus_tag LOCUS_24970 6246 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 7072 7956 gene locus_tag LOCUS_24980 7072 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 8012 8335 gene locus_tag LOCUS_24990 8012 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 8467 8955 gene locus_tag LOCUS_25000 8467 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 9118 9468 gene locus_tag LOCUS_25010 9118 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 9478 9960 gene locus_tag LOCUS_25020 9478 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 9970 10899 gene locus_tag LOCUS_25030 9970 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 10896 11312 gene locus_tag LOCUS_25040 10896 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 11309 11653 gene locus_tag LOCUS_25050 11309 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 11653 12060 gene locus_tag LOCUS_25060 11653 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 12039 12467 gene locus_tag LOCUS_25070 12039 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 12460 12876 gene locus_tag LOCUS_25080 12460 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 12883 13311 gene locus_tag LOCUS_25090 12883 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 13355 13795 gene locus_tag LOCUS_25100 13355 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 13816 14055 gene locus_tag LOCUS_25110 13816 14055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 14057 18532 gene locus_tag LOCUS_25120 14057 18532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 18624 19481 gene locus_tag LOCUS_25130 18624 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 19478 23677 gene locus_tag LOCUS_25140 19478 23677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 23686 24852 gene locus_tag LOCUS_25150 23686 24852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 24947 25192 gene locus_tag LOCUS_25160 24947 25192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 25354 25599 gene locus_tag LOCUS_25170 25354 25599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence067 <1 1234 gene locus_tag LOCUS_25180 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776786.1:sulfatase-like hydrolase/transferase 1398 1769 gene locus_tag LOCUS_25190 1398 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3970 1766 gene locus_tag LOCUS_25200 3970 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 4718 4104 gene locus_tag LOCUS_25210 4718 4104 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 protein_id gnl|my_center|LOCUS_25210 5791 4820 gene locus_tag LOCUS_25220 5791 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 7059 5842 gene locus_tag LOCUS_25230 7059 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 8211 7099 gene locus_tag LOCUS_25240 8211 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 11217 8242 gene locus_tag LOCUS_25250 11217 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 12348 11551 gene locus_tag LOCUS_25260 12348 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 14968 12752 gene locus_tag LOCUS_25270 14968 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 15218 15042 gene locus_tag LOCUS_25280 15218 15042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 16390 15272 gene locus_tag LOCUS_25290 16390 15272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 17783 16413 gene locus_tag LOCUS_25300 17783 16413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 19029 17902 gene locus_tag LOCUS_25310 19029 17902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 20408 19056 gene locus_tag LOCUS_25320 20408 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 24005 20871 gene locus_tag LOCUS_25330 24005 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 25054 24035 gene locus_tag LOCUS_25340 25054 24035 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence068 2548 1025 gene locus_tag LOCUS_25350 2548 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3761 2568 gene locus_tag LOCUS_25360 3761 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 4733 3771 gene locus_tag LOCUS_25370 4733 3771 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_25370 4821 5231 gene locus_tag LOCUS_25380 4821 5231 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_25380 5325 7085 gene locus_tag LOCUS_25390 5325 7085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_25390 7145 9028 gene locus_tag LOCUS_25400 7145 9028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 9176 10216 gene locus_tag LOCUS_25410 9176 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 10241 10891 gene locus_tag LOCUS_25420 10241 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 11228 10998 gene locus_tag LOCUS_25430 11228 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 11548 11225 gene locus_tag LOCUS_25440 11548 11225 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_25440 13768 11618 gene locus_tag LOCUS_25450 13768 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 13965 15215 gene locus_tag LOCUS_25460 13965 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 15224 16873 gene locus_tag LOCUS_25470 15224 16873 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435129.1 protein_id gnl|my_center|LOCUS_25470 17406 16870 gene locus_tag LOCUS_25480 17406 16870 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_25480 18437 17517 gene locus_tag LOCUS_25490 18437 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 20458 18467 gene locus_tag LOCUS_25500 20458 18467 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020515.1 protein_id gnl|my_center|LOCUS_25500 20577 22544 gene locus_tag LOCUS_25510 20577 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 23056 22682 gene locus_tag LOCUS_25520 23056 22682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 23227 23607 gene locus_tag LOCUS_25530 23227 23607 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence069 <1 1545 gene locus_tag LOCUS_25540 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768340.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 1548 2612 gene locus_tag LOCUS_25550 gene hisC 1548 2612 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_25550 3569 2601 gene locus_tag LOCUS_25560 3569 2601 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_25560 3752 5107 gene locus_tag LOCUS_25570 3752 5107 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_25570 5274 5948 gene locus_tag LOCUS_25580 5274 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 6125 6049 gene locus_tag LOCUS_t00250 6125 6049 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8358 6163 gene locus_tag LOCUS_25590 8358 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 8501 8425 gene locus_tag LOCUS_t00260 8501 8425 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10367 8541 gene locus_tag LOCUS_25600 gene dnaG 10367 8541 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403730.1 protein_id gnl|my_center|LOCUS_25600 10589 11254 gene locus_tag LOCUS_25610 10589 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 11309 11986 gene locus_tag LOCUS_25620 11309 11986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 12388 13662 gene locus_tag LOCUS_25630 gene rho 12388 13662 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_25630 13747 14007 gene locus_tag LOCUS_25640 13747 14007 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_25640 14085 15032 gene locus_tag LOCUS_25650 14085 15032 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_25650 15026 16093 gene locus_tag LOCUS_25660 gene prfA 15026 16093 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_25660 16090 16962 gene locus_tag LOCUS_25670 gene prmC 16090 16962 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_25670 16966 18339 gene locus_tag LOCUS_25680 gene radA 16966 18339 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_25680 18608 19690 gene locus_tag LOCUS_25690 gene recA 18608 19690 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_25690 19825 20082 gene locus_tag LOCUS_25700 19825 20082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 20193 20738 gene locus_tag LOCUS_25710 20193 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 20759 21577 gene locus_tag LOCUS_25720 gene azf 20759 21577 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_25720 21582 22136 gene locus_tag LOCUS_25730 21582 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 22153 23202 gene locus_tag LOCUS_25740 22153 23202 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 protein_id gnl|my_center|LOCUS_25740 24298 23324 gene locus_tag LOCUS_25750 24298 23324 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230995.1 protein_id gnl|my_center|LOCUS_25750 24462 24274 gene locus_tag LOCUS_25760 24462 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 24771 24499 gene locus_tag LOCUS_25770 24771 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence070 97 816 gene locus_tag LOCUS_25780 97 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 894 2831 gene locus_tag LOCUS_25790 894 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2828 4846 gene locus_tag LOCUS_25800 2828 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 4869 7319 gene locus_tag LOCUS_25810 4869 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 7354 7572 gene locus_tag LOCUS_25820 7354 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 7676 10309 gene locus_tag LOCUS_25830 7676 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 11632 10262 gene locus_tag LOCUS_25840 11632 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 13280 11649 gene locus_tag LOCUS_25850 13280 11649 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_25850 14485 13283 gene locus_tag LOCUS_25860 14485 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 14877 15203 gene locus_tag LOCUS_25870 14877 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 15379 15927 gene locus_tag LOCUS_25880 15379 15927 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_25880 16896 15934 gene locus_tag LOCUS_25890 16896 15934 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_25890 17201 17818 gene locus_tag LOCUS_25900 17201 17818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 17859 19145 gene locus_tag LOCUS_25910 17859 19145 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_25910 20380 19178 gene locus_tag LOCUS_25920 20380 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 21984 20377 gene locus_tag LOCUS_25930 21984 20377 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_25930 22216 22698 gene locus_tag LOCUS_25940 gene nrfH 22216 22698 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_25940 22702 24135 gene locus_tag LOCUS_25950 22702 24135 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence071 690 250 gene locus_tag LOCUS_25960 690 250 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707377.1 protein_id gnl|my_center|LOCUS_25960 1534 722 gene locus_tag LOCUS_25970 1534 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2761 1541 gene locus_tag LOCUS_25980 2761 1541 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_25980 3851 2859 gene locus_tag LOCUS_25990 3851 2859 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_25990 4119 5264 gene locus_tag LOCUS_26000 4119 5264 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_26000 5284 5925 gene locus_tag LOCUS_26010 5284 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 6024 7004 gene locus_tag LOCUS_26020 6024 7004 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259152.1 protein_id gnl|my_center|LOCUS_26020 7001 7804 gene locus_tag LOCUS_26030 7001 7804 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259153.1 protein_id gnl|my_center|LOCUS_26030 7801 8586 gene locus_tag LOCUS_26040 7801 8586 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259154.1 protein_id gnl|my_center|LOCUS_26040 8627 9643 gene locus_tag LOCUS_26050 8627 9643 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_26050 9661 10560 gene locus_tag LOCUS_26060 9661 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 11054 10620 gene locus_tag LOCUS_26070 11054 10620 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016387.1 protein_id gnl|my_center|LOCUS_26070 13419 11056 gene locus_tag LOCUS_26080 13419 11056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 14598 13474 gene locus_tag LOCUS_26090 14598 13474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 14741 16765 gene locus_tag LOCUS_26100 14741 16765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 16779 17366 gene locus_tag LOCUS_26110 16779 17366 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235045.1 protein_id gnl|my_center|LOCUS_26110 18441 17389 gene locus_tag LOCUS_26120 18441 17389 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_26120 18563 19651 gene locus_tag LOCUS_26130 18563 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 21018 19660 gene locus_tag LOCUS_26140 21018 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 22365 21043 gene locus_tag LOCUS_26150 22365 21043 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_26150 23206 22370 gene locus_tag LOCUS_26160 23206 22370 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_26160 24335 23196 gene locus_tag LOCUS_26170 24335 23196 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081251.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence072 1093 416 gene locus_tag LOCUS_26180 1093 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2241 1177 gene locus_tag LOCUS_26190 2241 1177 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_26190 4174 2276 gene locus_tag LOCUS_26200 4174 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_26200 6332 4386 gene locus_tag LOCUS_26210 6332 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 7284 6448 gene locus_tag LOCUS_26220 7284 6448 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339519.1 protein_id gnl|my_center|LOCUS_26220 8153 7281 gene locus_tag LOCUS_26230 8153 7281 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226190.1 protein_id gnl|my_center|LOCUS_26230 9327 8191 gene locus_tag LOCUS_26240 9327 8191 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_26240 9590 10657 gene locus_tag LOCUS_26250 9590 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 11804 10662 gene locus_tag LOCUS_26260 11804 10662 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_26260 11910 12737 gene locus_tag LOCUS_26270 11910 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 12839 14296 gene locus_tag LOCUS_26280 12839 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 18030 14437 gene locus_tag LOCUS_26290 18030 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 19288 18032 gene locus_tag LOCUS_26300 19288 18032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 22644 19480 gene locus_tag LOCUS_26310 22644 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 23802 22651 gene locus_tag LOCUS_26320 23802 22651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence073 296 105 gene locus_tag LOCUS_26330 296 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 283 1110 gene locus_tag LOCUS_26340 283 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 1901 1137 gene locus_tag LOCUS_26350 1901 1137 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899275.1 protein_id gnl|my_center|LOCUS_26350 3241 1916 gene locus_tag LOCUS_26360 gene hemL 3241 1916 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_26360 3385 4479 gene locus_tag LOCUS_26370 3385 4479 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090631.1 protein_id gnl|my_center|LOCUS_26370 4460 4825 gene locus_tag LOCUS_26380 4460 4825 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_26380 5988 5002 gene locus_tag LOCUS_26390 5988 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 7038 6004 gene locus_tag LOCUS_26400 7038 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 8378 7041 gene locus_tag LOCUS_26410 8378 7041 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209873.1 protein_id gnl|my_center|LOCUS_26410 8512 9018 gene locus_tag LOCUS_26420 8512 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 9169 10377 gene locus_tag LOCUS_26430 9169 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 10377 12734 gene locus_tag LOCUS_26440 10377 12734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 12718 15675 gene locus_tag LOCUS_26450 12718 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 15672 16598 gene locus_tag LOCUS_26460 15672 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 16643 17603 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acgccccggcctcattgaag 17920 17630 gene locus_tag LOCUS_26470 17920 17630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 18456 19247 gene locus_tag LOCUS_26480 18456 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 19247 20443 gene locus_tag LOCUS_26490 19247 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 20478 21263 gene locus_tag LOCUS_26500 20478 21263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 21447 22211 gene locus_tag LOCUS_26510 21447 22211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 22213 23064 gene locus_tag LOCUS_26520 22213 23064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 23091 23858 gene locus_tag LOCUS_26530 23091 23858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence074 1186 278 gene locus_tag LOCUS_26540 1186 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 1886 1200 gene locus_tag LOCUS_26550 1886 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2966 1926 gene locus_tag LOCUS_26560 2966 1926 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_26560 3321 4301 gene locus_tag LOCUS_26570 3321 4301 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_26570 4357 5100 gene locus_tag LOCUS_26580 4357 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 5278 6423 gene locus_tag LOCUS_26590 5278 6423 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383848.1 protein_id gnl|my_center|LOCUS_26590 9153 6433 gene locus_tag LOCUS_26600 9153 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 12298 9161 gene locus_tag LOCUS_26610 12298 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 12487 14451 gene locus_tag LOCUS_26620 12487 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 14444 15124 gene locus_tag LOCUS_26630 14444 15124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_26630 15250 17322 gene locus_tag LOCUS_26640 15250 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 17414 17800 gene locus_tag LOCUS_26650 17414 17800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 17945 18856 gene locus_tag LOCUS_26660 17945 18856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 19530 18916 gene locus_tag LOCUS_26670 19530 18916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 20351 20115 gene locus_tag LOCUS_26680 20351 20115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404912.1 protein_id gnl|my_center|LOCUS_26680 21171 20554 gene locus_tag LOCUS_26690 21171 20554 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087002.1 protein_id gnl|my_center|LOCUS_26690 22647 21172 gene locus_tag LOCUS_26700 22647 21172 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836208.1 protein_id gnl|my_center|LOCUS_26700 22776 23753 gene locus_tag LOCUS_26710 22776 23753 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963887.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence075 9 947 gene locus_tag LOCUS_26720 9 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 944 2389 gene locus_tag LOCUS_26730 944 2389 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_26730 2440 3777 gene locus_tag LOCUS_26740 2440 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 3828 4937 gene locus_tag LOCUS_26750 gene rnd 3828 4937 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971431.1 protein_id gnl|my_center|LOCUS_26750 6080 4983 gene locus_tag LOCUS_26760 6080 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 6778 6131 gene locus_tag LOCUS_26770 6778 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 7037 7519 gene locus_tag LOCUS_26780 7037 7519 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405595.1 protein_id gnl|my_center|LOCUS_26780 7671 8243 gene locus_tag LOCUS_26790 7671 8243 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_26790 8282 9532 gene locus_tag LOCUS_26800 8282 9532 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_26800 9590 10090 gene locus_tag LOCUS_26810 9590 10090 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704974.1 protein_id gnl|my_center|LOCUS_26810 10104 11204 gene locus_tag LOCUS_26820 10104 11204 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_26820 11306 12313 gene locus_tag LOCUS_26830 11306 12313 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_26830 12760 12356 gene locus_tag LOCUS_26840 12760 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 13775 12810 gene locus_tag LOCUS_26850 13775 12810 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_26850 14382 13897 gene locus_tag LOCUS_26860 14382 13897 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_26860 15429 14431 gene locus_tag LOCUS_26870 gene gap 15429 14431 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_26870 15748 17160 gene locus_tag LOCUS_26880 15748 17160 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_26880 17194 18009 gene locus_tag LOCUS_26890 17194 18009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 18009 19067 gene locus_tag LOCUS_26900 18009 19067 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_26900 20213 19101 gene locus_tag LOCUS_26910 20213 19101 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072840.1 protein_id gnl|my_center|LOCUS_26910 20484 22412 gene locus_tag LOCUS_26920 20484 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 22575 24020 gene locus_tag LOCUS_26930 22575 24020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence076 1047 337 gene locus_tag LOCUS_26940 1047 337 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933740.1 protein_id gnl|my_center|LOCUS_26940 2065 1049 gene locus_tag LOCUS_26950 2065 1049 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257894.1 protein_id gnl|my_center|LOCUS_26950 2175 2462 gene locus_tag LOCUS_26960 2175 2462 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390829.1 protein_id gnl|my_center|LOCUS_26960 2472 2747 gene locus_tag LOCUS_26970 2472 2747 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994576.1 protein_id gnl|my_center|LOCUS_26970 2839 3720 gene locus_tag LOCUS_26980 2839 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 4535 3753 gene locus_tag LOCUS_26990 4535 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 5451 4561 gene locus_tag LOCUS_27000 5451 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 6382 5543 gene locus_tag LOCUS_27010 6382 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582849.1 protein_id gnl|my_center|LOCUS_27010 6479 7348 gene locus_tag LOCUS_27020 gene dapF 6479 7348 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_27020 7374 10148 gene locus_tag LOCUS_27030 7374 10148 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_27030 10153 11214 gene locus_tag LOCUS_27040 10153 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 11229 11657 gene locus_tag LOCUS_27050 11229 11657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 11654 12901 gene locus_tag LOCUS_27060 11654 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 12981 13949 gene locus_tag LOCUS_27070 12981 13949 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402820.1 protein_id gnl|my_center|LOCUS_27070 13957 14499 gene locus_tag LOCUS_27080 13957 14499 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_27080 14496 15689 gene locus_tag LOCUS_27090 gene coaBC 14496 15689 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175628128.1 protein_id gnl|my_center|LOCUS_27090 15714 16397 gene locus_tag LOCUS_27100 15714 16397 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_27100 16585 17880 gene locus_tag LOCUS_27110 gene dnaB 16585 17880 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_27110 17890 18897 gene locus_tag LOCUS_27120 gene obgE 17890 18897 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943831.1 protein_id gnl|my_center|LOCUS_27120 19814 18972 gene locus_tag LOCUS_27130 19814 18972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 19851 20792 gene locus_tag LOCUS_27140 gene thrB 19851 20792 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_27140 20800 21801 gene locus_tag LOCUS_27150 20800 21801 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_27150 21804 22712 gene locus_tag LOCUS_27160 21804 22712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 22760 23836 gene locus_tag LOCUS_27170 22760 23836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence077 <1 1901 gene locus_tag LOCUS_27180 <1 1901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941931.1:carbamoyl-phosphate synthase large subunit 1912 4533 gene locus_tag LOCUS_27190 1912 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4530 5342 gene locus_tag LOCUS_27200 4530 5342 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_27200 5330 6238 gene locus_tag LOCUS_27210 5330 6238 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_27210 6825 6271 gene locus_tag LOCUS_27220 6825 6271 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_27220 7521 6901 gene locus_tag LOCUS_27230 7521 6901 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_27230 8417 7518 gene locus_tag LOCUS_27240 8417 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 8517 9134 gene locus_tag LOCUS_27250 gene rplC 8517 9134 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222604.1 protein_id gnl|my_center|LOCUS_27250 9539 9192 gene locus_tag LOCUS_27260 9539 9192 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_27260 9570 10349 gene locus_tag LOCUS_27270 9570 10349 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_27270 12645 10354 gene locus_tag LOCUS_27280 12645 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 12732 13538 gene locus_tag LOCUS_27290 12732 13538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 15784 13535 gene locus_tag LOCUS_27300 15784 13535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 18425 15765 gene locus_tag LOCUS_27310 18425 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 21710 18450 gene locus_tag LOCUS_27320 21710 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 23392 21737 gene locus_tag LOCUS_27330 23392 21737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence078 1043 240 gene locus_tag LOCUS_27340 1043 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3286 1040 gene locus_tag LOCUS_27350 3286 1040 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143631.1 protein_id gnl|my_center|LOCUS_27350 5358 3283 gene locus_tag LOCUS_27360 5358 3283 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_27360 5839 5375 gene locus_tag LOCUS_27370 5839 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 7736 5892 gene locus_tag LOCUS_27380 7736 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 10096 7733 gene locus_tag LOCUS_27390 10096 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 11221 10100 gene locus_tag LOCUS_27400 11221 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 11619 11921 gene locus_tag LOCUS_27410 11619 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 11966 13081 gene locus_tag LOCUS_27420 11966 13081 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227270.1 protein_id gnl|my_center|LOCUS_27420 13087 13797 gene locus_tag LOCUS_27430 13087 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 13810 14805 gene locus_tag LOCUS_27440 13810 14805 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_27440 14823 15668 gene locus_tag LOCUS_27450 14823 15668 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_27450 15754 15999 gene locus_tag LOCUS_27460 15754 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 15996 16778 gene locus_tag LOCUS_27470 15996 16778 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_27470 17685 16903 gene locus_tag LOCUS_27480 17685 16903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 17961 18260 gene locus_tag LOCUS_27490 gene groES 17961 18260 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171493.1 protein_id gnl|my_center|LOCUS_27490 18277 19908 gene locus_tag LOCUS_27500 gene groL 18277 19908 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_27500 20021 21130 gene locus_tag LOCUS_27510 20021 21130 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_27510 21157 21462 gene locus_tag LOCUS_27520 21157 21462 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_27520 23715 21466 gene locus_tag LOCUS_27530 23715 21466 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence079 2156 1668 gene locus_tag LOCUS_27540 2156 1668 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_27540 2336 2623 gene locus_tag LOCUS_27550 gene gatC 2336 2623 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_27550 2690 4480 gene locus_tag LOCUS_27560 gene pyrG 2690 4480 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_27560 4563 6314 gene locus_tag LOCUS_27570 4563 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 6316 7047 gene locus_tag LOCUS_27580 gene lptB 6316 7047 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_27580 7159 8631 gene locus_tag LOCUS_27590 gene rpoN 7159 8631 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809045.1 protein_id gnl|my_center|LOCUS_27590 8776 8642 gene locus_tag LOCUS_27600 8776 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 8922 9374 gene locus_tag LOCUS_27610 8922 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 12203 9411 gene locus_tag LOCUS_27620 12203 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 12687 12433 gene locus_tag LOCUS_27630 12687 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 12952 12674 gene locus_tag LOCUS_27640 12952 12674 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_27640 15868 13109 gene locus_tag LOCUS_27650 15868 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 17144 15897 gene locus_tag LOCUS_27660 17144 15897 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_27660 17725 17156 gene locus_tag LOCUS_27670 17725 17156 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525158.1 protein_id gnl|my_center|LOCUS_27670 18221 17727 gene locus_tag LOCUS_27680 18221 17727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 19422 18226 gene locus_tag LOCUS_27690 19422 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 19513 20193 gene locus_tag LOCUS_27700 19513 20193 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_27700 20819 20190 gene locus_tag LOCUS_27710 20819 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 22672 20831 gene locus_tag LOCUS_27720 22672 20831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 23362 22742 gene locus_tag LOCUS_27730 23362 22742 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403906.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence080 734 114 gene locus_tag LOCUS_27740 734 114 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709765.1 protein_id gnl|my_center|LOCUS_27740 1371 778 gene locus_tag LOCUS_27750 1371 778 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087592.1 protein_id gnl|my_center|LOCUS_27750 1989 1510 gene locus_tag LOCUS_27760 1989 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 2501 2286 gene locus_tag LOCUS_27770 2501 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2867 2598 gene locus_tag LOCUS_27780 2867 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3009 2833 gene locus_tag LOCUS_27790 3009 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3483 3256 gene locus_tag LOCUS_27800 3483 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 4547 4041 gene locus_tag LOCUS_27810 4547 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 5410 4595 gene locus_tag LOCUS_27820 5410 4595 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577686.1 protein_id gnl|my_center|LOCUS_27820 6249 5458 gene locus_tag LOCUS_27830 6249 5458 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064761.1 protein_id gnl|my_center|LOCUS_27830 6685 6278 gene locus_tag LOCUS_27840 6685 6278 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_27840 7191 6832 gene locus_tag LOCUS_27850 7191 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 7237 7434 gene locus_tag LOCUS_27860 7237 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 7501 7878 gene locus_tag LOCUS_27870 7501 7878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 8851 8171 gene locus_tag LOCUS_27880 8851 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 10244 9105 gene locus_tag LOCUS_27890 10244 9105 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122559.1 protein_id gnl|my_center|LOCUS_27890 11373 10435 gene locus_tag LOCUS_27900 11373 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 11567 12361 gene locus_tag LOCUS_27910 11567 12361 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_27910 12673 13932 gene locus_tag LOCUS_27920 12673 13932 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291923.1 protein_id gnl|my_center|LOCUS_27920 13944 14609 gene locus_tag LOCUS_27930 13944 14609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_27930 14620 15906 gene locus_tag LOCUS_27940 14620 15906 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_27940 15906 17108 gene locus_tag LOCUS_27950 15906 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 17130 18392 gene locus_tag LOCUS_27960 17130 18392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022822805.1 protein_id gnl|my_center|LOCUS_27960 18389 19549 gene locus_tag LOCUS_27970 18389 19549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088060.1 protein_id gnl|my_center|LOCUS_27970 19618 20838 gene locus_tag LOCUS_27980 19618 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 20883 23348 gene locus_tag LOCUS_27990 20883 23348 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405549.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence081 1694 498 gene locus_tag LOCUS_28000 1694 498 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257809.1 protein_id gnl|my_center|LOCUS_28000 2598 1711 gene locus_tag LOCUS_28010 gene argB 2598 1711 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_28010 3050 2598 gene locus_tag LOCUS_28020 3050 2598 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_28020 3925 3155 gene locus_tag LOCUS_28030 gene cdaA 3925 3155 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_28030 4767 3919 gene locus_tag LOCUS_28040 gene folP 4767 3919 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_28040 6701 4764 gene locus_tag LOCUS_28050 gene ftsH 6701 4764 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938574.1 protein_id gnl|my_center|LOCUS_28050 8087 6717 gene locus_tag LOCUS_28060 gene tilS 8087 6717 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_28060 8249 8875 gene locus_tag LOCUS_28070 gene lexA 8249 8875 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_28070 8887 10215 gene locus_tag LOCUS_28080 8887 10215 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938066.1 protein_id gnl|my_center|LOCUS_28080 10295 11227 gene locus_tag LOCUS_28090 10295 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 11181 12107 gene locus_tag LOCUS_28100 gene era 11181 12107 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404809.1 protein_id gnl|my_center|LOCUS_28100 12127 13434 gene locus_tag LOCUS_28110 gene purD 12127 13434 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_28110 13445 13810 gene locus_tag LOCUS_28120 gene folB 13445 13810 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809748.1 protein_id gnl|my_center|LOCUS_28120 13803 14312 gene locus_tag LOCUS_28130 gene folK 13803 14312 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_28130 14309 15163 gene locus_tag LOCUS_28140 gene panC 14309 15163 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_28140 15196 15879 gene locus_tag LOCUS_28150 15196 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 17518 15935 gene locus_tag LOCUS_28160 17518 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 18123 17518 gene locus_tag LOCUS_28170 18123 17518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 19036 18128 gene locus_tag LOCUS_28180 19036 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 22346 19230 gene locus_tag LOCUS_28190 22346 19230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence082 398 162 gene locus_tag LOCUS_28200 398 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 331 777 gene locus_tag LOCUS_28210 331 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 782 1645 gene locus_tag LOCUS_28220 782 1645 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 protein_id gnl|my_center|LOCUS_28220 1702 2448 gene locus_tag LOCUS_28230 1702 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2495 3094 gene locus_tag LOCUS_28240 2495 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3186 3362 gene locus_tag LOCUS_28250 3186 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3456 3647 gene locus_tag LOCUS_28260 3456 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 3909 3577 gene locus_tag LOCUS_28270 3909 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3820 4029 gene locus_tag LOCUS_28280 3820 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 4274 4110 gene locus_tag LOCUS_28290 4274 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 4558 4343 gene locus_tag LOCUS_28300 4558 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 4642 5481 gene locus_tag LOCUS_28310 gene dapA 4642 5481 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317384.1 protein_id gnl|my_center|LOCUS_28310 5573 6238 gene locus_tag LOCUS_28320 5573 6238 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_28320 6385 6993 gene locus_tag LOCUS_28330 6385 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 8182 7019 gene locus_tag LOCUS_28340 8182 7019 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_28340 10083 8182 gene locus_tag LOCUS_28350 10083 8182 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_28350 10289 11569 gene locus_tag LOCUS_28360 10289 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 11657 13573 gene locus_tag LOCUS_28370 11657 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 13917 14282 gene locus_tag LOCUS_28380 13917 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 15120 15350 gene locus_tag LOCUS_28390 15120 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 15549 16079 gene locus_tag LOCUS_28400 15549 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 16302 16033 gene locus_tag LOCUS_28410 16302 16033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 17454 16327 gene locus_tag LOCUS_28420 17454 16327 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_28420 17901 17545 gene locus_tag LOCUS_28430 17901 17545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 19247 17910 gene locus_tag LOCUS_28440 gene hemL 19247 17910 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_28440 19394 19317 gene locus_tag LOCUS_t00270 19394 19317 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20258 19443 gene locus_tag LOCUS_28450 gene pyrF 20258 19443 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_28450 21375 20209 gene locus_tag LOCUS_28460 21375 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 22526 21807 gene locus_tag LOCUS_28470 22526 21807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404841.1 protein_id gnl|my_center|LOCUS_28470 <23500 22728 gene locus_tag LOCUS_28480 <23500 22728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430702.1:transketolase family protein >Feature sequence083 1521 766 gene locus_tag LOCUS_28490 1521 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 2377 1547 gene locus_tag LOCUS_28500 2377 1547 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_28500 4386 2389 gene locus_tag LOCUS_28510 4386 2389 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_28510 6052 4400 gene locus_tag LOCUS_28520 6052 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 6908 6141 gene locus_tag LOCUS_28530 6908 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 7359 6940 gene locus_tag LOCUS_28540 7359 6940 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206590.1 protein_id gnl|my_center|LOCUS_28540 7783 7364 gene locus_tag LOCUS_28550 7783 7364 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 protein_id gnl|my_center|LOCUS_28550 8476 7802 gene locus_tag LOCUS_28560 8476 7802 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_28560 11797 8525 gene locus_tag LOCUS_28570 11797 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 14733 11815 gene locus_tag LOCUS_28580 14733 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 15645 14785 gene locus_tag LOCUS_28590 15645 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 17287 15629 gene locus_tag LOCUS_28600 17287 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 17945 17289 gene locus_tag LOCUS_28610 17945 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 18725 17946 gene locus_tag LOCUS_28620 18725 17946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 21657 18727 gene locus_tag LOCUS_28630 21657 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 22804 21851 gene locus_tag LOCUS_28640 22804 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 23121 22912 gene locus_tag LOCUS_28650 23121 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence084 108 521 gene locus_tag LOCUS_28660 108 521 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_28660 597 1163 gene locus_tag LOCUS_28670 597 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1242 1616 gene locus_tag LOCUS_28680 1242 1616 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_28680 1627 2064 gene locus_tag LOCUS_28690 1627 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2191 2526 gene locus_tag LOCUS_28700 2191 2526 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_28700 3826 2573 gene locus_tag LOCUS_28710 3826 2573 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037862.1 protein_id gnl|my_center|LOCUS_28710 5939 3792 gene locus_tag LOCUS_28720 5939 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 7700 6012 gene locus_tag LOCUS_28730 7700 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 8661 7693 gene locus_tag LOCUS_28740 gene ilvA 8661 7693 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_28740 8756 9604 gene locus_tag LOCUS_28750 8756 9604 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039488.1 protein_id gnl|my_center|LOCUS_28750 9606 10178 gene locus_tag LOCUS_28760 9606 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 10200 11213 gene locus_tag LOCUS_28770 10200 11213 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967441.1 protein_id gnl|my_center|LOCUS_28770 11380 11601 gene locus_tag LOCUS_28780 11380 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 11591 11926 gene locus_tag LOCUS_28790 11591 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 12556 12062 gene locus_tag LOCUS_28800 gene resA 12556 12062 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_28800 12538 14115 gene locus_tag LOCUS_28810 12538 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 14867 14118 gene locus_tag LOCUS_28820 14867 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 15134 14952 gene locus_tag LOCUS_28830 15134 14952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 16006 15146 gene locus_tag LOCUS_28840 16006 15146 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_28840 16976 16053 gene locus_tag LOCUS_28850 16976 16053 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_28850 17087 17287 gene locus_tag LOCUS_28860 17087 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 17284 17826 gene locus_tag LOCUS_28870 gene msrA 17284 17826 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_28870 17832 18983 gene locus_tag LOCUS_28880 17832 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 21200 19338 gene locus_tag LOCUS_28890 21200 19338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 22543 21608 gene locus_tag LOCUS_28900 22543 21608 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_28900 22912 22547 gene locus_tag LOCUS_28910 22912 22547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence085 <1 806 gene locus_tag LOCUS_28920 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939622.1:alpha-glucan family phosphorylase 1702 818 gene locus_tag LOCUS_28930 gene folD 1702 818 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_28930 3063 1702 gene locus_tag LOCUS_28940 gene serS 3063 1702 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004562115.1 protein_id gnl|my_center|LOCUS_28940 4195 3881 gene locus_tag LOCUS_28950 4195 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 5180 4260 gene locus_tag LOCUS_28960 5180 4260 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_28960 6066 5191 gene locus_tag LOCUS_28970 6066 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 6859 6080 gene locus_tag LOCUS_28980 6859 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 6970 7764 gene locus_tag LOCUS_28990 6970 7764 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_28990 8027 8374 gene locus_tag LOCUS_29000 8027 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 8374 8640 gene locus_tag LOCUS_29010 8374 8640 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_29010 8640 8954 gene locus_tag LOCUS_29020 gene mnhG 8640 8954 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118366.1 protein_id gnl|my_center|LOCUS_29020 8951 9928 gene locus_tag LOCUS_29030 8951 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 9925 10281 gene locus_tag LOCUS_29040 9925 10281 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_29040 10278 11759 gene locus_tag LOCUS_29050 10278 11759 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389325.1 protein_id gnl|my_center|LOCUS_29050 11756 13210 gene locus_tag LOCUS_29060 11756 13210 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_29060 13215 13475 gene locus_tag LOCUS_29070 13215 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 13468 15156 gene locus_tag LOCUS_29080 13468 15156 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_29080 15660 15166 gene locus_tag LOCUS_29090 15660 15166 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_29090 16941 15718 gene locus_tag LOCUS_29100 16941 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 17211 18509 gene locus_tag LOCUS_29110 gene hflX 17211 18509 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_29110 18571 19380 gene locus_tag LOCUS_29120 18571 19380 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_29120 19411 20184 gene locus_tag LOCUS_29130 19411 20184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 20188 21921 gene locus_tag LOCUS_29140 20188 21921 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080060.1 protein_id gnl|my_center|LOCUS_29140 22466 21954 gene locus_tag LOCUS_29150 22466 21954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence086 <1 1991 gene locus_tag LOCUS_29160 <1 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931838.1:elongation factor G 2172 2930 gene locus_tag LOCUS_29170 2172 2930 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933329.1 protein_id gnl|my_center|LOCUS_29170 3188 2853 gene locus_tag LOCUS_29180 3188 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 3075 3482 gene locus_tag LOCUS_29190 3075 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3491 4081 gene locus_tag LOCUS_29200 gene ruvA 3491 4081 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772102.1 protein_id gnl|my_center|LOCUS_29200 4086 5117 gene locus_tag LOCUS_29210 gene ruvB 4086 5117 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_29210 5114 5812 gene locus_tag LOCUS_29220 gene tsaB 5114 5812 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_29220 5809 6264 gene locus_tag LOCUS_29230 gene rimI 5809 6264 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583327.1 protein_id gnl|my_center|LOCUS_29230 6336 7445 gene locus_tag LOCUS_29240 gene ugpC 6336 7445 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583259.1 protein_id gnl|my_center|LOCUS_29240 7454 8593 gene locus_tag LOCUS_29250 7454 8593 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 protein_id gnl|my_center|LOCUS_29250 8587 9414 gene locus_tag LOCUS_29260 gene rsmA 8587 9414 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814423.1 protein_id gnl|my_center|LOCUS_29260 9411 11378 gene locus_tag LOCUS_29270 9411 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 11457 12377 gene locus_tag LOCUS_29280 11457 12377 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_29280 12416 14251 gene locus_tag LOCUS_29290 12416 14251 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_29290 14664 14999 gene locus_tag LOCUS_29300 14664 14999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 14992 16770 gene locus_tag LOCUS_29310 14992 16770 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_29310 16774 17889 gene locus_tag LOCUS_29320 16774 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 17894 19135 gene locus_tag LOCUS_29330 17894 19135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 19145 19801 gene locus_tag LOCUS_29340 19145 19801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 19801 20628 gene locus_tag LOCUS_29350 19801 20628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 20637 21350 gene locus_tag LOCUS_29360 20637 21350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 >Feature sequence087 432 1544 gene locus_tag LOCUS_29370 432 1544 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_29370 2540 1560 gene locus_tag LOCUS_29380 2540 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769801.1 protein_id gnl|my_center|LOCUS_29380 3551 2559 gene locus_tag LOCUS_29390 3551 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 5329 3581 gene locus_tag LOCUS_29400 5329 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 5466 6809 gene locus_tag LOCUS_29410 5466 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 8284 6854 gene locus_tag LOCUS_29420 8284 6854 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_29420 8389 9648 gene locus_tag LOCUS_29430 8389 9648 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_29430 12207 9739 gene locus_tag LOCUS_29440 12207 9739 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_29440 13531 12440 gene locus_tag LOCUS_29450 13531 12440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479977.1 protein_id gnl|my_center|LOCUS_29450 13737 14984 gene locus_tag LOCUS_29460 gene tyrS 13737 14984 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_29460 15449 14985 gene locus_tag LOCUS_29470 15449 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393800.1 protein_id gnl|my_center|LOCUS_29470 15780 15442 gene locus_tag LOCUS_29480 15780 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 17602 15797 gene locus_tag LOCUS_29490 gene guaA 17602 15797 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_29490 18151 17606 gene locus_tag LOCUS_29500 18151 17606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 18285 19574 gene locus_tag LOCUS_29510 18285 19574 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957913.1 protein_id gnl|my_center|LOCUS_29510 19721 20320 gene locus_tag LOCUS_29520 19721 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 20330 21220 gene locus_tag LOCUS_29530 20330 21220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 21286 21861 gene locus_tag LOCUS_29540 21286 21861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 <22403 21847 gene locus_tag LOCUS_29550 <22403 21847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071550.1:L-aspartate oxidase >Feature sequence088 292 906 gene locus_tag LOCUS_29560 gene cysC 292 906 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643136.1 protein_id gnl|my_center|LOCUS_29560 989 2023 gene locus_tag LOCUS_29570 989 2023 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_29570 2845 2003 gene locus_tag LOCUS_29580 2845 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3556 2855 gene locus_tag LOCUS_29590 3556 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 4106 3558 gene locus_tag LOCUS_29600 4106 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 5640 4120 gene locus_tag LOCUS_29610 5640 4120 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_29610 7285 5633 gene locus_tag LOCUS_29620 7285 5633 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 protein_id gnl|my_center|LOCUS_29620 8020 7310 gene locus_tag LOCUS_29630 8020 7310 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930705.1 protein_id gnl|my_center|LOCUS_29630 8424 8032 gene locus_tag LOCUS_29640 8424 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 8765 8445 gene locus_tag LOCUS_29650 8765 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 12013 8807 gene locus_tag LOCUS_29660 12013 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 16413 12010 gene locus_tag LOCUS_29670 16413 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 18566 16410 gene locus_tag LOCUS_29680 18566 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 18622 19800 gene locus_tag LOCUS_29690 18622 19800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 <22272 19834 gene locus_tag LOCUS_29700 <22272 19834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence089 2146 680 gene locus_tag LOCUS_29710 2146 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 2335 2736 gene locus_tag LOCUS_29720 2335 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 4012 2831 gene locus_tag LOCUS_29730 4012 2831 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_29730 4114 4314 gene locus_tag LOCUS_29740 4114 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 4321 4396 gene locus_tag LOCUS_t00280 4321 4396 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4512 6086 gene locus_tag LOCUS_29750 4512 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 6174 6485 gene locus_tag LOCUS_29760 6174 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 6865 8766 gene locus_tag LOCUS_29770 6865 8766 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_29770 8784 10589 gene locus_tag LOCUS_29780 8784 10589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338226.1 protein_id gnl|my_center|LOCUS_29780 11054 10656 gene locus_tag LOCUS_29790 gene higA 11054 10656 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_29790 11338 11051 gene locus_tag LOCUS_29800 11338 11051 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 protein_id gnl|my_center|LOCUS_29800 11530 12369 gene locus_tag LOCUS_29810 11530 12369 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_29810 13610 12462 gene locus_tag LOCUS_29820 13610 12462 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_29820 13775 15190 gene locus_tag LOCUS_29830 13775 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 15640 15200 gene locus_tag LOCUS_29840 15640 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 16238 15693 gene locus_tag LOCUS_29850 16238 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 17784 16609 gene locus_tag LOCUS_29860 17784 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 17968 18237 gene locus_tag LOCUS_29870 17968 18237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 19156 18326 gene locus_tag LOCUS_29880 19156 18326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 19482 19168 gene locus_tag LOCUS_29890 19482 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 21489 19513 gene locus_tag LOCUS_29900 21489 19513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_29900 >Feature sequence090 <1 2625 gene locus_tag LOCUS_29910 <1 2625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012166094.1:aminomethyl-transferring glycine dehydrogenase 2627 3625 gene locus_tag LOCUS_29920 gene gmd 2627 3625 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_29920 4341 3589 gene locus_tag LOCUS_29930 gene trmJ 4341 3589 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958024.1 protein_id gnl|my_center|LOCUS_29930 4382 5644 gene locus_tag LOCUS_29940 4382 5644 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_29940 5754 6935 gene locus_tag LOCUS_29950 5754 6935 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411976.1 protein_id gnl|my_center|LOCUS_29950 6935 7903 gene locus_tag LOCUS_29960 6935 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 7941 9227 gene locus_tag LOCUS_29970 gene hemL 7941 9227 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933753.1 protein_id gnl|my_center|LOCUS_29970 9254 9733 gene locus_tag LOCUS_29980 9254 9733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 9726 10136 gene locus_tag LOCUS_29990 9726 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 10133 10684 gene locus_tag LOCUS_30000 10133 10684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 11784 10681 gene locus_tag LOCUS_30010 11784 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 12064 11786 gene locus_tag LOCUS_30020 12064 11786 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404129.1 protein_id gnl|my_center|LOCUS_30020 13190 12093 gene locus_tag LOCUS_30030 13190 12093 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448968.1 protein_id gnl|my_center|LOCUS_30030 14131 13187 gene locus_tag LOCUS_30040 14131 13187 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_30040 15039 14113 gene locus_tag LOCUS_30050 gene murQ 15039 14113 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175617.1 protein_id gnl|my_center|LOCUS_30050 15178 17937 gene locus_tag LOCUS_30060 15178 17937 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_30060 17938 19608 gene locus_tag LOCUS_30070 17938 19608 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_30070 19625 20575 gene locus_tag LOCUS_30080 gene miaA 19625 20575 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_30080 20616 20690 gene locus_tag LOCUS_t00290 20616 20690 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 812 483 gene locus_tag LOCUS_30090 812 483 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073005.1 protein_id gnl|my_center|LOCUS_30090 3737 834 gene locus_tag LOCUS_30100 3737 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 4111 3740 gene locus_tag LOCUS_30110 4111 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 4971 4168 gene locus_tag LOCUS_30120 4971 4168 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_30120 5558 4989 gene locus_tag LOCUS_30130 gene nfuA 5558 4989 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553665.1 protein_id gnl|my_center|LOCUS_30130 8179 5630 gene locus_tag LOCUS_30140 8179 5630 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_30140 9590 8172 gene locus_tag LOCUS_30150 9590 8172 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_30150 11519 12529 gene locus_tag LOCUS_30160 11519 12529 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_30160 12638 13735 gene locus_tag LOCUS_30170 12638 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 14135 14440 gene locus_tag LOCUS_30180 14135 14440 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_30180 14451 15083 gene locus_tag LOCUS_30190 14451 15083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 15091 16041 gene locus_tag LOCUS_30200 15091 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 16081 16527 gene locus_tag LOCUS_30210 16081 16527 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_30210 17910 16561 gene locus_tag LOCUS_30220 17910 16561 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_30220 18151 18357 gene locus_tag LOCUS_30230 18151 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 18599 19378 gene locus_tag LOCUS_30240 18599 19378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 20114 19653 gene locus_tag LOCUS_30250 20114 19653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 20352 20101 gene locus_tag LOCUS_30260 20352 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 >Feature sequence092 396 1406 gene locus_tag LOCUS_30270 396 1406 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_30270 1412 2419 gene locus_tag LOCUS_30280 1412 2419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_30280 4044 2518 gene locus_tag LOCUS_30290 4044 2518 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_30290 4235 5152 gene locus_tag LOCUS_30300 4235 5152 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_30300 5336 6130 gene locus_tag LOCUS_30310 5336 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 6485 7243 gene locus_tag LOCUS_30320 6485 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 8350 7253 gene locus_tag LOCUS_30330 8350 7253 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_30330 8523 9521 gene locus_tag LOCUS_30340 8523 9521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 9521 11011 gene locus_tag LOCUS_30350 9521 11011 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085058.1 protein_id gnl|my_center|LOCUS_30350 11015 11983 gene locus_tag LOCUS_30360 11015 11983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_30360 11987 13117 gene locus_tag LOCUS_30370 11987 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 13131 13856 gene locus_tag LOCUS_30380 13131 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 13853 14566 gene locus_tag LOCUS_30390 13853 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 14718 15629 gene locus_tag LOCUS_30400 14718 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 15645 16457 gene locus_tag LOCUS_30410 15645 16457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 17704 16469 gene locus_tag LOCUS_30420 17704 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 18824 17760 gene locus_tag LOCUS_30430 18824 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 19200 18985 gene locus_tag LOCUS_30440 19200 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 19471 19193 gene locus_tag LOCUS_30450 19471 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 19683 19468 gene locus_tag LOCUS_30460 19683 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 >Feature sequence093 325 1179 gene locus_tag LOCUS_30470 gene accD 325 1179 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_30470 2489 1176 gene locus_tag LOCUS_30480 2489 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3330 2476 gene locus_tag LOCUS_30490 gene surE 3330 2476 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_30490 3457 3720 gene locus_tag LOCUS_30500 3457 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 3884 4081 gene locus_tag LOCUS_30510 gene rpmI 3884 4081 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125540.1 protein_id gnl|my_center|LOCUS_30510 4105 4458 gene locus_tag LOCUS_30520 gene rplT 4105 4458 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172639.1 protein_id gnl|my_center|LOCUS_30520 4528 5538 gene locus_tag LOCUS_30530 gene pheS 4528 5538 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_30530 5557 7935 gene locus_tag LOCUS_30540 gene pheT 5557 7935 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_30540 7968 8249 gene locus_tag LOCUS_30550 7968 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 8319 8633 gene locus_tag LOCUS_30560 8319 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 8713 10287 gene locus_tag LOCUS_30570 gene rny 8713 10287 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_30570 10284 11066 gene locus_tag LOCUS_30580 10284 11066 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_30580 11133 12377 gene locus_tag LOCUS_30590 gene xseA 11133 12377 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_30590 12370 12600 gene locus_tag LOCUS_30600 gene xseB 12370 12600 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 protein_id gnl|my_center|LOCUS_30600 12622 14313 gene locus_tag LOCUS_30610 gene recN 12622 14313 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403565.1 protein_id gnl|my_center|LOCUS_30610 14321 14845 gene locus_tag LOCUS_30620 14321 14845 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257076.1 protein_id gnl|my_center|LOCUS_30620 14998 14849 gene locus_tag LOCUS_30630 14998 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 18423 14995 gene locus_tag LOCUS_30640 18423 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 18535 19206 gene locus_tag LOCUS_30650 18535 19206 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_30650 21023 19203 gene locus_tag LOCUS_30660 21023 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence094 1342 884 gene locus_tag LOCUS_30670 1342 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 2646 2230 gene locus_tag LOCUS_30680 2646 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3301 2621 gene locus_tag LOCUS_30690 3301 2621 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010208432.1 protein_id gnl|my_center|LOCUS_30690 4294 3389 gene locus_tag LOCUS_30700 4294 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 5244 4315 gene locus_tag LOCUS_30710 5244 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 5934 5362 gene locus_tag LOCUS_30720 5934 5362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_30720 6173 5946 gene locus_tag LOCUS_30730 6173 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 6464 6177 gene locus_tag LOCUS_30740 6464 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 7134 6502 gene locus_tag LOCUS_30750 7134 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 7587 7138 gene locus_tag LOCUS_30760 7587 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 8866 7592 gene locus_tag LOCUS_30770 8866 7592 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_30770 9873 8974 gene locus_tag LOCUS_30780 gene yghX 9873 8974 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_30780 10669 9926 gene locus_tag LOCUS_30790 10669 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 12312 10681 gene locus_tag LOCUS_30800 12312 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 12962 12357 gene locus_tag LOCUS_30810 12962 12357 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477468.1 protein_id gnl|my_center|LOCUS_30810 14203 12959 gene locus_tag LOCUS_30820 14203 12959 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704465.1 protein_id gnl|my_center|LOCUS_30820 15206 14217 gene locus_tag LOCUS_30830 15206 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 15834 15322 gene locus_tag LOCUS_30840 15834 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 18184 15839 gene locus_tag LOCUS_30850 18184 15839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_30850 <20846 18368 gene locus_tag LOCUS_30860 <20846 18368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152945460.1:efflux RND transporter permease subunit >Feature sequence095 145 1203 gene locus_tag LOCUS_30870 145 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 1362 3521 gene locus_tag LOCUS_30880 1362 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 3635 5791 gene locus_tag LOCUS_30890 3635 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 7928 5919 gene locus_tag LOCUS_30900 7928 5919 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922636.1 protein_id gnl|my_center|LOCUS_30900 9684 7921 gene locus_tag LOCUS_30910 9684 7921 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_30910 12258 9745 gene locus_tag LOCUS_30920 12258 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 14827 12269 gene locus_tag LOCUS_30930 14827 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 12863 13087 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14897 15350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19859 17751 gene locus_tag LOCUS_30940 19859 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 20836 20018 gene locus_tag LOCUS_30950 20836 20018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence096 402 1097 gene locus_tag LOCUS_30960 402 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 1289 2434 gene locus_tag LOCUS_30970 1289 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 2523 3431 gene locus_tag LOCUS_30980 2523 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 3476 4303 gene locus_tag LOCUS_30990 3476 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 4422 5726 gene locus_tag LOCUS_31000 4422 5726 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529494.1 protein_id gnl|my_center|LOCUS_31000 5735 6631 gene locus_tag LOCUS_31010 5735 6631 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970661.1 protein_id gnl|my_center|LOCUS_31010 6628 7491 gene locus_tag LOCUS_31020 6628 7491 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086350.1 protein_id gnl|my_center|LOCUS_31020 7488 7652 gene locus_tag LOCUS_31030 7488 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 7649 8689 gene locus_tag LOCUS_31040 7649 8689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727033.1 protein_id gnl|my_center|LOCUS_31040 8691 9719 gene locus_tag LOCUS_31050 8691 9719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967710.1 protein_id gnl|my_center|LOCUS_31050 9731 11653 gene locus_tag LOCUS_31060 9731 11653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 11711 12811 gene locus_tag LOCUS_31070 11711 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 13111 14025 gene locus_tag LOCUS_31080 13111 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 14150 15895 gene locus_tag LOCUS_31090 14150 15895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 17734 18256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18702 20606 gene locus_tag LOCUS_31100 18702 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence097 <1 668 gene locus_tag LOCUS_31110 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223398.1:Gfo/Idh/MocA family oxidoreductase 672 1466 gene locus_tag LOCUS_31120 672 1466 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_31120 1508 2389 gene locus_tag LOCUS_31130 1508 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3146 2370 gene locus_tag LOCUS_31140 3146 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3285 3899 gene locus_tag LOCUS_31150 gene pnuC 3285 3899 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_31150 3915 4772 gene locus_tag LOCUS_31160 gene pheA 3915 4772 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_31160 4852 6009 gene locus_tag LOCUS_31170 gene yhcY 4852 6009 CDS product two-component system sensor histidine kinase YhcY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245750.1 protein_id gnl|my_center|LOCUS_31170 5996 6637 gene locus_tag LOCUS_31180 5996 6637 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_31180 7725 6772 gene locus_tag LOCUS_31190 gene rbsC 7725 6772 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_31190 9233 7722 gene locus_tag LOCUS_31200 gene rbsA 9233 7722 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 protein_id gnl|my_center|LOCUS_31200 10407 9235 gene locus_tag LOCUS_31210 10407 9235 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976071.1 protein_id gnl|my_center|LOCUS_31210 10666 11802 gene locus_tag LOCUS_31220 10666 11802 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_31220 11799 12587 gene locus_tag LOCUS_31230 gene suhB 11799 12587 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370312.1 protein_id gnl|my_center|LOCUS_31230 12604 13764 gene locus_tag LOCUS_31240 gene dgoD 12604 13764 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_31240 14958 13792 gene locus_tag LOCUS_31250 14958 13792 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_31250 15100 15336 gene locus_tag LOCUS_31260 15100 15336 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_31260 15333 15770 gene locus_tag LOCUS_31270 15333 15770 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_31270 16446 15796 gene locus_tag LOCUS_31280 16446 15796 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066430.1 protein_id gnl|my_center|LOCUS_31280 18431 16509 gene locus_tag LOCUS_31290 18431 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 19517 18444 gene locus_tag LOCUS_31300 gene pgl 19517 18444 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence098 165 500 gene locus_tag LOCUS_31310 165 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 593 1597 gene locus_tag LOCUS_31320 gene recA 593 1597 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189458.1 protein_id gnl|my_center|LOCUS_31320 1598 2086 gene locus_tag LOCUS_31330 gene recX 1598 2086 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 protein_id gnl|my_center|LOCUS_31330 2067 4685 gene locus_tag LOCUS_31340 gene alaS 2067 4685 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_31340 4698 5444 gene locus_tag LOCUS_31350 4698 5444 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_31350 5464 5736 gene locus_tag LOCUS_31360 5464 5736 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_31360 5733 7499 gene locus_tag LOCUS_31370 gene ptsP 5733 7499 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_31370 7519 8685 gene locus_tag LOCUS_31380 gene metK 7519 8685 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_31380 8758 10272 gene locus_tag LOCUS_31390 8758 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 10280 11722 gene locus_tag LOCUS_31400 10280 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 11881 14031 gene locus_tag LOCUS_31410 gene clpB 11881 14031 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_31410 14102 15505 gene locus_tag LOCUS_31420 gene degQ 14102 15505 CDS product Do family serine endopeptidase DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073684.1 protein_id gnl|my_center|LOCUS_31420 15508 17601 gene locus_tag LOCUS_31430 15508 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 17609 18259 gene locus_tag LOCUS_31440 17609 18259 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257634.1 protein_id gnl|my_center|LOCUS_31440 19373 18264 gene locus_tag LOCUS_31450 19373 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 <20086 19437 gene locus_tag LOCUS_31460 <20086 19437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527679.1:ferrochelatase >Feature sequence099 689 291 gene locus_tag LOCUS_31470 689 291 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_31470 925 686 gene locus_tag LOCUS_31480 925 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2314 1031 gene locus_tag LOCUS_31490 gene glcF 2314 1031 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971053.1 protein_id gnl|my_center|LOCUS_31490 2788 2318 gene locus_tag LOCUS_31500 2788 2318 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125362.1 protein_id gnl|my_center|LOCUS_31500 3028 4059 gene locus_tag LOCUS_31510 3028 4059 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_31510 4056 6593 gene locus_tag LOCUS_31520 4056 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 6928 7107 gene locus_tag LOCUS_31530 6928 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 7342 8232 gene locus_tag LOCUS_31540 7342 8232 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_31540 8234 10804 gene locus_tag LOCUS_31550 8234 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 10823 11074 gene locus_tag LOCUS_31560 10823 11074 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_31560 11138 12187 gene locus_tag LOCUS_31570 11138 12187 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_31570 12190 12825 gene locus_tag LOCUS_31580 12190 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 13820 12921 gene locus_tag LOCUS_31590 13820 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 15391 14117 gene locus_tag LOCUS_31600 15391 14117 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_31600 15500 15907 gene locus_tag LOCUS_31610 gene hisI 15500 15907 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_31610 16016 16543 gene locus_tag LOCUS_31620 16016 16543 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391792.1 protein_id gnl|my_center|LOCUS_31620 16543 17544 gene locus_tag LOCUS_31630 16543 17544 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_31630 17557 18684 gene locus_tag LOCUS_31640 17557 18684 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085398.1 protein_id gnl|my_center|LOCUS_31640 >Feature sequence100 999 154 gene locus_tag LOCUS_31650 999 154 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971611.1 protein_id gnl|my_center|LOCUS_31650 1167 2801 gene locus_tag LOCUS_31660 1167 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 2912 8479 gene locus_tag LOCUS_31670 2912 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 8610 11570 gene locus_tag LOCUS_31680 8610 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 11742 15179 gene locus_tag LOCUS_31690 11742 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 16040 15333 gene locus_tag LOCUS_31700 16040 15333 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405193.1 protein_id gnl|my_center|LOCUS_31700 17317 16043 gene locus_tag LOCUS_31710 17317 16043 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405190.1 protein_id gnl|my_center|LOCUS_31710 18545 17538 gene locus_tag LOCUS_31720 18545 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence101 3920 909 gene locus_tag LOCUS_31730 3920 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 4069 4794 gene locus_tag LOCUS_31740 4069 4794 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_31740 4836 6881 gene locus_tag LOCUS_31750 4836 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 7025 11383 gene locus_tag LOCUS_31760 7025 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 12196 11516 gene locus_tag LOCUS_31770 12196 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 12814 12545 gene locus_tag LOCUS_31780 12814 12545 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976577.1 protein_id gnl|my_center|LOCUS_31780 13109 12783 gene locus_tag LOCUS_31790 13109 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 13356 13111 gene locus_tag LOCUS_31800 13356 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 13803 16949 gene locus_tag LOCUS_31810 13803 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 19659 17608 gene locus_tag LOCUS_31820 19659 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence102 2905 1430 gene locus_tag LOCUS_31830 gene purF 2905 1430 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461475.1 protein_id gnl|my_center|LOCUS_31830 4348 2984 gene locus_tag LOCUS_31840 4348 2984 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259633.1 protein_id gnl|my_center|LOCUS_31840 5193 4444 gene locus_tag LOCUS_31850 gene fabG 5193 4444 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_31850 7349 5292 gene locus_tag LOCUS_31860 7349 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 9282 7423 gene locus_tag LOCUS_31870 9282 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 11165 9279 gene locus_tag LOCUS_31880 11165 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 12058 11162 gene locus_tag LOCUS_31890 12058 11162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118555.1 protein_id gnl|my_center|LOCUS_31890 12489 12070 gene locus_tag LOCUS_31900 12489 12070 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121968.1 protein_id gnl|my_center|LOCUS_31900 13018 12680 gene locus_tag LOCUS_31910 13018 12680 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_31910 13163 15124 gene locus_tag LOCUS_31920 13163 15124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584050.1 protein_id gnl|my_center|LOCUS_31920 15128 16111 gene locus_tag LOCUS_31930 15128 16111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970413.1 protein_id gnl|my_center|LOCUS_31930 16104 17210 gene locus_tag LOCUS_31940 16104 17210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_31940 17290 17493 gene locus_tag LOCUS_31950 17290 17493 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 protein_id gnl|my_center|LOCUS_31950 17490 17876 gene locus_tag LOCUS_31960 gene vapc11 17490 17876 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_31960 18160 18927 gene locus_tag LOCUS_31970 18160 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence103 1106 390 gene locus_tag LOCUS_31980 1106 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 2003 1143 gene locus_tag LOCUS_31990 2003 1143 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_31990 2605 2045 gene locus_tag LOCUS_32000 gene frr 2605 2045 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_32000 3222 2620 gene locus_tag LOCUS_32010 gene tsf 3222 2620 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_32010 4032 3253 gene locus_tag LOCUS_32020 gene rpsB 4032 3253 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680262.1 protein_id gnl|my_center|LOCUS_32020 4548 4156 gene locus_tag LOCUS_32030 gene rpsI 4548 4156 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549055.1 protein_id gnl|my_center|LOCUS_32030 5000 4566 gene locus_tag LOCUS_32040 gene rplM 5000 4566 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776324.1 protein_id gnl|my_center|LOCUS_32040 5661 5065 gene locus_tag LOCUS_32050 5661 5065 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421523.1 protein_id gnl|my_center|LOCUS_32050 6735 5665 gene locus_tag LOCUS_32060 6735 5665 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_32060 7864 6836 gene locus_tag LOCUS_32070 gene queA 7864 6836 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090135.1 protein_id gnl|my_center|LOCUS_32070 8586 7879 gene locus_tag LOCUS_32080 8586 7879 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_32080 9492 8614 gene locus_tag LOCUS_32090 9492 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 9600 11306 gene locus_tag LOCUS_32100 9600 11306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021751.1 protein_id gnl|my_center|LOCUS_32100 11299 12597 gene locus_tag LOCUS_32110 11299 12597 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_32110 13913 12594 gene locus_tag LOCUS_32120 13913 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 13991 14575 gene locus_tag LOCUS_32130 13991 14575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 15015 14563 gene locus_tag LOCUS_32140 gene aroQ 15015 14563 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_32140 15889 15008 gene locus_tag LOCUS_32150 15889 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 16655 15882 gene locus_tag LOCUS_32160 16655 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 17807 16668 gene locus_tag LOCUS_32170 gene dnaJ 17807 16668 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405069.1 protein_id gnl|my_center|LOCUS_32170 18430 17816 gene locus_tag LOCUS_32180 18430 17816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 19511 18477 gene locus_tag LOCUS_32190 gene hrcA 19511 18477 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933152.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence104 1836 2720 gene locus_tag LOCUS_32200 1836 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 3963 2722 gene locus_tag LOCUS_32210 3963 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 4128 10394 gene locus_tag LOCUS_32220 4128 10394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 10485 13157 gene locus_tag LOCUS_32230 10485 13157 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_32230 14685 13231 gene locus_tag LOCUS_32240 14685 13231 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067351.1 protein_id gnl|my_center|LOCUS_32240 15041 14760 gene locus_tag LOCUS_32250 15041 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 15232 17088 gene locus_tag LOCUS_32260 15232 17088 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_32260 17088 18731 gene locus_tag LOCUS_32270 17088 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence105 402 1850 gene locus_tag LOCUS_32280 402 1850 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 protein_id gnl|my_center|LOCUS_32280 2397 1825 gene locus_tag LOCUS_32290 2397 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 2551 2423 gene locus_tag LOCUS_32300 2551 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3219 2548 gene locus_tag LOCUS_32310 3219 2548 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_32310 3794 3267 gene locus_tag LOCUS_32320 3794 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32320 4342 3689 gene locus_tag LOCUS_32330 4342 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32330 5738 4389 gene locus_tag LOCUS_32340 5738 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 7756 6014 gene locus_tag LOCUS_32350 7756 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 7923 7756 gene locus_tag LOCUS_32360 7923 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 9913 7952 gene locus_tag LOCUS_32370 9913 7952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 10178 9927 gene locus_tag LOCUS_32380 10178 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 12142 10178 gene locus_tag LOCUS_32390 12142 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 12403 14928 gene locus_tag LOCUS_32400 12403 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 18023 15147 gene locus_tag LOCUS_32410 18023 15147 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267520.1 protein_id gnl|my_center|LOCUS_32410 18283 18020 gene locus_tag LOCUS_32420 18283 18020 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104014.1 protein_id gnl|my_center|LOCUS_32420 >Feature sequence106 <1 938 gene locus_tag LOCUS_32430 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584050.1:ABC transporter substrate-binding protein 1139 2089 gene locus_tag LOCUS_32440 1139 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 2209 4239 gene locus_tag LOCUS_32450 2209 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 4261 6834 gene locus_tag LOCUS_32460 4261 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 6860 9058 gene locus_tag LOCUS_32470 6860 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 9132 11924 gene locus_tag LOCUS_32480 9132 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 11942 14755 gene locus_tag LOCUS_32490 11942 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 14821 16527 gene locus_tag LOCUS_32500 14821 16527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 16643 16984 gene locus_tag LOCUS_32510 16643 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 16990 17388 gene locus_tag LOCUS_32520 16990 17388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 17458 18609 gene locus_tag LOCUS_32530 17458 18609 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence107 1020 49 gene locus_tag LOCUS_32540 1020 49 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024691572.1 protein_id gnl|my_center|LOCUS_32540 2967 1174 gene locus_tag LOCUS_32550 gene mutL 2967 1174 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_32550 3417 2974 gene locus_tag LOCUS_32560 3417 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3416 3643 gene locus_tag LOCUS_32570 3416 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 6450 3565 gene locus_tag LOCUS_32580 gene leuS 6450 3565 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_32580 7777 6470 gene locus_tag LOCUS_32590 gene asnS 7777 6470 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_32590 9913 7844 gene locus_tag LOCUS_32600 gene pnp 9913 7844 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_32600 10233 9967 gene locus_tag LOCUS_32610 gene rpsO 10233 9967 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597748.1 protein_id gnl|my_center|LOCUS_32610 10592 10236 gene locus_tag LOCUS_32620 10592 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 11552 10656 gene locus_tag LOCUS_32630 gene truB 11552 10656 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_32630 11871 11545 gene locus_tag LOCUS_32640 11871 11545 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547807.1 protein_id gnl|my_center|LOCUS_32640 12165 11905 gene locus_tag LOCUS_32650 12165 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 14560 12203 gene locus_tag LOCUS_32660 14560 12203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 15957 14575 gene locus_tag LOCUS_32670 gene nusA 15957 14575 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309913.1 protein_id gnl|my_center|LOCUS_32670 16305 15985 gene locus_tag LOCUS_32680 16305 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 16979 16557 gene locus_tag LOCUS_32690 16979 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 18331 16976 gene locus_tag LOCUS_32700 gene der 18331 16976 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_32700 <19073 18328 gene locus_tag LOCUS_32710 <19073 18328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392836.1:DUF512 domain-containing protein >Feature sequence108 1948 671 gene locus_tag LOCUS_32720 1948 671 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024225.1 protein_id gnl|my_center|LOCUS_32720 4115 1992 gene locus_tag LOCUS_32730 4115 1992 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_32730 5420 4914 gene locus_tag LOCUS_32740 5420 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 5871 5557 gene locus_tag LOCUS_32750 5871 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 5975 7228 gene locus_tag LOCUS_32760 5975 7228 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791323.1 protein_id gnl|my_center|LOCUS_32760 8315 7284 gene locus_tag LOCUS_32770 8315 7284 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444330.1 protein_id gnl|my_center|LOCUS_32770 8567 9439 gene locus_tag LOCUS_32780 8567 9439 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_32780 10450 9440 gene locus_tag LOCUS_32790 10450 9440 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_32790 10975 10544 gene locus_tag LOCUS_32800 10975 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 11220 11564 gene locus_tag LOCUS_32810 11220 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 11482 11742 gene locus_tag LOCUS_32820 11482 11742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 13139 11832 gene locus_tag LOCUS_32830 13139 11832 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_32830 13367 14503 gene locus_tag LOCUS_32840 13367 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 14500 15336 gene locus_tag LOCUS_32850 14500 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 15674 15387 gene locus_tag LOCUS_32860 15674 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 <19005 15692 gene locus_tag LOCUS_32870 <19005 15692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227656.1:indolepyruvate ferredoxin oxidoreductase family protein >Feature sequence109 1053 307 gene locus_tag LOCUS_32880 1053 307 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_32880 1161 1802 gene locus_tag LOCUS_32890 1161 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 1814 2848 gene locus_tag LOCUS_32900 1814 2848 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938010.1 protein_id gnl|my_center|LOCUS_32900 2862 3617 gene locus_tag LOCUS_32910 2862 3617 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_32910 3633 4286 gene locus_tag LOCUS_32920 3633 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 4283 4738 gene locus_tag LOCUS_32930 4283 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 4738 5496 gene locus_tag LOCUS_32940 4738 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 5517 7409 gene locus_tag LOCUS_32950 5517 7409 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_32950 7417 8970 gene locus_tag LOCUS_32960 7417 8970 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942559.1 protein_id gnl|my_center|LOCUS_32960 9103 9684 gene locus_tag LOCUS_32970 9103 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 9799 12039 gene locus_tag LOCUS_32980 9799 12039 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_32980 12238 13266 gene locus_tag LOCUS_32990 12238 13266 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392721.1 protein_id gnl|my_center|LOCUS_32990 13368 14285 gene locus_tag LOCUS_33000 13368 14285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 14300 15289 gene locus_tag LOCUS_33010 14300 15289 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582497.1 protein_id gnl|my_center|LOCUS_33010 15286 15567 gene locus_tag LOCUS_33020 15286 15567 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_33020 15564 17447 gene locus_tag LOCUS_33030 gene mnmG 15564 17447 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_33030 18219 17521 gene locus_tag LOCUS_33040 18219 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 <18946 18297 gene locus_tag LOCUS_33050 <18946 18297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001013377.1:DNA repair protein RadC >Feature sequence110 117 2513 gene locus_tag LOCUS_33060 117 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 2516 3790 gene locus_tag LOCUS_33070 2516 3790 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268608.1 protein_id gnl|my_center|LOCUS_33070 3986 6388 gene locus_tag LOCUS_33080 gene nagB 3986 6388 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074422.1 protein_id gnl|my_center|LOCUS_33080 6403 6906 gene locus_tag LOCUS_33090 6403 6906 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_33090 7837 6953 gene locus_tag LOCUS_33100 7837 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 8097 7834 gene locus_tag LOCUS_33110 8097 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 8219 9109 gene locus_tag LOCUS_33120 8219 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 10041 9127 gene locus_tag LOCUS_33130 10041 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 12298 10052 gene locus_tag LOCUS_33140 12298 10052 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_33140 13396 12341 gene locus_tag LOCUS_33150 13396 12341 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_33150 14181 13393 gene locus_tag LOCUS_33160 14181 13393 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_33160 15474 14188 gene locus_tag LOCUS_33170 15474 14188 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_33170 16213 15443 gene locus_tag LOCUS_33180 16213 15443 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 protein_id gnl|my_center|LOCUS_33180 17505 16243 gene locus_tag LOCUS_33190 17505 16243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_33190 18467 17502 gene locus_tag LOCUS_33200 18467 17502 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence111 165 761 gene locus_tag LOCUS_33210 165 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 868 1005 gene locus_tag LOCUS_33220 868 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 1085 1315 gene locus_tag LOCUS_33230 1085 1315 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171671.1 protein_id gnl|my_center|LOCUS_33230 1395 1637 gene locus_tag LOCUS_33240 1395 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1725 2786 gene locus_tag LOCUS_33250 1725 2786 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_33250 2890 3900 gene locus_tag LOCUS_33260 gene rfbB 2890 3900 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989656.1 protein_id gnl|my_center|LOCUS_33260 3915 5897 gene locus_tag LOCUS_33270 gene yagF 3915 5897 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_33270 5894 6514 gene locus_tag LOCUS_33280 5894 6514 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391642.1 protein_id gnl|my_center|LOCUS_33280 7956 6517 gene locus_tag LOCUS_33290 gene rsmF 7956 6517 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989184.1 protein_id gnl|my_center|LOCUS_33290 8024 8698 gene locus_tag LOCUS_33300 8024 8698 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091510.1 protein_id gnl|my_center|LOCUS_33300 8691 10883 gene locus_tag LOCUS_33310 8691 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 11890 10880 gene locus_tag LOCUS_33320 11890 10880 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_33320 12678 11887 gene locus_tag LOCUS_33330 12678 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 12761 13606 gene locus_tag LOCUS_33340 12761 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 13759 14529 gene locus_tag LOCUS_33350 13759 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 14526 16292 gene locus_tag LOCUS_33360 14526 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 16337 16825 gene locus_tag LOCUS_33370 16337 16825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 18378 16897 gene locus_tag LOCUS_33380 18378 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence112 595 104 gene locus_tag LOCUS_33390 595 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405426.1 protein_id gnl|my_center|LOCUS_33390 1206 592 gene locus_tag LOCUS_33400 1206 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 1445 4135 gene locus_tag LOCUS_33410 1445 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 4372 5190 gene locus_tag LOCUS_33420 4372 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 5225 6469 gene locus_tag LOCUS_33430 gene mgtE 5225 6469 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33430 6451 6603 gene locus_tag LOCUS_33440 6451 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33440 6815 7777 gene locus_tag LOCUS_33450 6815 7777 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_33450 7755 9002 gene locus_tag LOCUS_33460 7755 9002 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868702.1 protein_id gnl|my_center|LOCUS_33460 10432 11337 gene locus_tag LOCUS_33470 10432 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 11738 11454 gene locus_tag LOCUS_33480 11738 11454 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_33480 11941 12624 gene locus_tag LOCUS_33490 11941 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 12667 13812 gene locus_tag LOCUS_33500 12667 13812 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967366.1 protein_id gnl|my_center|LOCUS_33500 13844 14746 gene locus_tag LOCUS_33510 13844 14746 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_33510 15521 14805 gene locus_tag LOCUS_33520 15521 14805 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259604.1 protein_id gnl|my_center|LOCUS_33520 15860 15534 gene locus_tag LOCUS_33530 15860 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 17610 15886 gene locus_tag LOCUS_33540 17610 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 <18217 17630 gene locus_tag LOCUS_33550 <18217 17630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259605.1:fatty acid--CoA ligase family protein >Feature sequence113 365 1645 gene locus_tag LOCUS_33560 365 1645 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463605.1 protein_id gnl|my_center|LOCUS_33560 1675 2538 gene locus_tag LOCUS_33570 1675 2538 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_33570 3735 2542 gene locus_tag LOCUS_33580 3735 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 3856 5109 gene locus_tag LOCUS_33590 3856 5109 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_33590 5121 6041 gene locus_tag LOCUS_33600 5121 6041 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_33600 6043 6858 gene locus_tag LOCUS_33610 6043 6858 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_33610 6964 7287 gene locus_tag LOCUS_33620 6964 7287 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403362.1 protein_id gnl|my_center|LOCUS_33620 7274 7705 gene locus_tag LOCUS_33630 7274 7705 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403363.1 protein_id gnl|my_center|LOCUS_33630 7996 8541 gene locus_tag LOCUS_33640 7996 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 8810 10120 gene locus_tag LOCUS_33650 8810 10120 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141489.1 protein_id gnl|my_center|LOCUS_33650 10113 10694 gene locus_tag LOCUS_33660 10113 10694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 10799 11971 gene locus_tag LOCUS_33670 10799 11971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 protein_id gnl|my_center|LOCUS_33670 12060 13070 gene locus_tag LOCUS_33680 12060 13070 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_33680 14539 13067 gene locus_tag LOCUS_33690 14539 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 14624 16573 gene locus_tag LOCUS_33700 14624 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence114 744 193 gene locus_tag LOCUS_33710 744 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 1662 838 gene locus_tag LOCUS_33720 1662 838 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133938067.1 protein_id gnl|my_center|LOCUS_33720 2272 1649 gene locus_tag LOCUS_33730 2272 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 2546 2364 gene locus_tag LOCUS_33740 2546 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2935 2546 gene locus_tag LOCUS_33750 2935 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 4487 3246 gene locus_tag LOCUS_33760 4487 3246 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285867.1 protein_id gnl|my_center|LOCUS_33760 4608 6506 gene locus_tag LOCUS_33770 gene htpG 4608 6506 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051156.1 protein_id gnl|my_center|LOCUS_33770 6509 7822 gene locus_tag LOCUS_33780 6509 7822 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_33780 7824 8180 gene locus_tag LOCUS_33790 7824 8180 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_33790 8202 9383 gene locus_tag LOCUS_33800 8202 9383 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615753.1 protein_id gnl|my_center|LOCUS_33800 10402 9380 gene locus_tag LOCUS_33810 10402 9380 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532953.1 protein_id gnl|my_center|LOCUS_33810 10635 11465 gene locus_tag LOCUS_33820 10635 11465 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_33820 11471 12439 gene locus_tag LOCUS_33830 11471 12439 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_33830 14513 12417 gene locus_tag LOCUS_33840 14513 12417 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038090.1 protein_id gnl|my_center|LOCUS_33840 14571 15020 gene locus_tag LOCUS_33850 14571 15020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 15824 15027 gene locus_tag LOCUS_33860 gene fabG 15824 15027 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_33860 15904 16614 gene locus_tag LOCUS_33870 15904 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 17536 16583 gene locus_tag LOCUS_33880 17536 16583 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence115 896 318 gene locus_tag LOCUS_33890 896 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 3179 903 gene locus_tag LOCUS_33900 3179 903 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_33900 4074 3217 gene locus_tag LOCUS_33910 gene galU 4074 3217 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522195.1 protein_id gnl|my_center|LOCUS_33910 4177 5592 gene locus_tag LOCUS_33920 4177 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 5599 6735 gene locus_tag LOCUS_33930 5599 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 6740 7039 gene locus_tag LOCUS_33940 6740 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 7149 9230 gene locus_tag LOCUS_33950 7149 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 9257 11926 gene locus_tag LOCUS_33960 9257 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 12089 12961 gene locus_tag LOCUS_33970 12089 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 13077 14927 gene locus_tag LOCUS_33980 13077 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 14984 16678 gene locus_tag LOCUS_33990 14984 16678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence116 1066 191 gene locus_tag LOCUS_34000 1066 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 1959 1189 gene locus_tag LOCUS_34010 1959 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3511 2111 gene locus_tag LOCUS_34020 3511 2111 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728383.1 protein_id gnl|my_center|LOCUS_34020 4497 3508 gene locus_tag LOCUS_34030 4497 3508 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_34030 5525 4584 gene locus_tag LOCUS_34040 5525 4584 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085601.1 protein_id gnl|my_center|LOCUS_34040 5760 6638 gene locus_tag LOCUS_34050 5760 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 6649 7827 gene locus_tag LOCUS_34060 6649 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 8712 7864 gene locus_tag LOCUS_34070 8712 7864 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_34070 8841 9647 gene locus_tag LOCUS_34080 8841 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 10922 9678 gene locus_tag LOCUS_34090 10922 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 11135 11950 gene locus_tag LOCUS_34100 11135 11950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 11947 12519 gene locus_tag LOCUS_34110 11947 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 12936 12535 gene locus_tag LOCUS_34120 12936 12535 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_34120 13283 12933 gene locus_tag LOCUS_34130 13283 12933 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_34130 14098 13280 gene locus_tag LOCUS_34140 14098 13280 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_34140 14834 14100 gene locus_tag LOCUS_34150 14834 14100 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_34150 16393 14831 gene locus_tag LOCUS_34160 16393 14831 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence117 2515 932 gene locus_tag LOCUS_34170 2515 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 3190 2519 gene locus_tag LOCUS_34180 gene queC 3190 2519 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_34180 4356 3187 gene locus_tag LOCUS_34190 4356 3187 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_34190 7282 4517 gene locus_tag LOCUS_34200 gene uvrA 7282 4517 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228683.1 protein_id gnl|my_center|LOCUS_34200 7501 8865 gene locus_tag LOCUS_34210 7501 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 8852 10129 gene locus_tag LOCUS_34220 8852 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 10126 10755 gene locus_tag LOCUS_34230 10126 10755 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840193.1 protein_id gnl|my_center|LOCUS_34230 10765 13158 gene locus_tag LOCUS_34240 10765 13158 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_34240 13163 14320 gene locus_tag LOCUS_34250 gene solA 13163 14320 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_34250 14470 14395 gene locus_tag LOCUS_t00300 14470 14395 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence118 <1 2495 gene locus_tag LOCUS_34260 <1 2495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838071.1:DPP IV N-terminal domain-containing protein 2492 3181 gene locus_tag LOCUS_34270 2492 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 3949 3242 gene locus_tag LOCUS_34280 3949 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 5353 4034 gene locus_tag LOCUS_34290 5353 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 6078 5350 gene locus_tag LOCUS_34300 6078 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 6557 6102 gene locus_tag LOCUS_34310 6557 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 8122 6563 gene locus_tag LOCUS_34320 8122 6563 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_34320 9820 8204 gene locus_tag LOCUS_34330 9820 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 10502 10050 gene locus_tag LOCUS_34340 10502 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 11771 10596 gene locus_tag LOCUS_34350 11771 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 12733 11786 gene locus_tag LOCUS_34360 12733 11786 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901998.1 protein_id gnl|my_center|LOCUS_34360 12916 14400 gene locus_tag LOCUS_34370 gene zwf 12916 14400 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_34370 14397 15371 gene locus_tag LOCUS_34380 gene glk 14397 15371 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_34380 16575 15376 gene locus_tag LOCUS_34390 16575 15376 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence119 91 1836 gene locus_tag LOCUS_34400 91 1836 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922636.1 protein_id gnl|my_center|LOCUS_34400 1847 3835 gene locus_tag LOCUS_34410 1847 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 4050 4526 gene locus_tag LOCUS_34420 4050 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 5451 4606 gene locus_tag LOCUS_34430 5451 4606 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_34430 5560 5850 gene locus_tag LOCUS_34440 5560 5850 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_34440 5852 8686 gene locus_tag LOCUS_34450 5852 8686 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918711.1 protein_id gnl|my_center|LOCUS_34450 10348 8708 gene locus_tag LOCUS_34460 10348 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 11943 10480 gene locus_tag LOCUS_34470 11943 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 12184 14169 gene locus_tag LOCUS_34480 12184 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 14219 15001 gene locus_tag LOCUS_34490 14219 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 15004 16107 gene locus_tag LOCUS_34500 15004 16107 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence120 <1 560 gene locus_tag LOCUS_34510 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403994.1:rhodanese-like domain-containing protein 647 892 gene locus_tag LOCUS_34520 647 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 882 1259 gene locus_tag LOCUS_34530 882 1259 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770889.1 protein_id gnl|my_center|LOCUS_34530 1295 2671 gene locus_tag LOCUS_34540 1295 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 2684 3568 gene locus_tag LOCUS_34550 2684 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 5356 3575 gene locus_tag LOCUS_34560 5356 3575 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_34560 5488 5799 gene locus_tag LOCUS_34570 5488 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 5803 6057 gene locus_tag LOCUS_34580 5803 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 8897 6033 gene locus_tag LOCUS_34590 8897 6033 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_34590 9742 8996 gene locus_tag LOCUS_34600 9742 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 10967 9879 gene locus_tag LOCUS_34610 10967 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 11587 10964 gene locus_tag LOCUS_34620 11587 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 12292 11591 gene locus_tag LOCUS_34630 12292 11591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 13670 12492 gene locus_tag LOCUS_34640 13670 12492 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_34640 15090 13762 gene locus_tag LOCUS_34650 15090 13762 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705296.1 protein_id gnl|my_center|LOCUS_34650 15085 15894 gene locus_tag LOCUS_34660 15085 15894 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_34660 >Feature sequence121 331 738 gene locus_tag LOCUS_34670 331 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 699 860 gene locus_tag LOCUS_34680 699 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 957 1415 gene locus_tag LOCUS_34690 957 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 1431 1823 gene locus_tag LOCUS_34700 1431 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 2023 2370 gene locus_tag LOCUS_34710 2023 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 3707 4129 gene locus_tag LOCUS_34720 3707 4129 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772547.1 protein_id gnl|my_center|LOCUS_34720 4417 5805 gene locus_tag LOCUS_34730 4417 5805 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968142.1 protein_id gnl|my_center|LOCUS_34730 5999 7180 gene locus_tag LOCUS_34740 5999 7180 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925262.1 protein_id gnl|my_center|LOCUS_34740 7296 8114 gene locus_tag LOCUS_34750 7296 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 8362 9024 gene locus_tag LOCUS_34760 8362 9024 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909235.1 protein_id gnl|my_center|LOCUS_34760 9035 9415 gene locus_tag LOCUS_34770 9035 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 9478 9972 gene locus_tag LOCUS_34780 9478 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 10190 11743 gene locus_tag LOCUS_34790 10190 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 12137 12700 gene locus_tag LOCUS_34800 12137 12700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 12781 13266 gene locus_tag LOCUS_34810 12781 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 13621 13391 gene locus_tag LOCUS_34820 13621 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 14453 13647 gene locus_tag LOCUS_34830 14453 13647 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_34830 15163 14456 gene locus_tag LOCUS_34840 15163 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477484.1 protein_id gnl|my_center|LOCUS_34840 16263 15169 gene locus_tag LOCUS_34850 16263 15169 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459778.1 protein_id gnl|my_center|LOCUS_34850 >Feature sequence122 <1 1059 gene locus_tag LOCUS_34860 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118669.1:aconitate hydratase AcnA 1078 2319 gene locus_tag LOCUS_34870 1078 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2621 2412 gene locus_tag LOCUS_34880 2621 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3032 2694 gene locus_tag LOCUS_34890 3032 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 3731 3192 gene locus_tag LOCUS_34900 3731 3192 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457944.1 protein_id gnl|my_center|LOCUS_34900 4876 3731 gene locus_tag LOCUS_34910 4876 3731 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_34910 6261 4888 gene locus_tag LOCUS_34920 6261 4888 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_34920 6391 8925 gene locus_tag LOCUS_34930 6391 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 8918 10411 gene locus_tag LOCUS_34940 8918 10411 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_34940 11088 10408 gene locus_tag LOCUS_34950 11088 10408 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_34950 12263 11169 gene locus_tag LOCUS_34960 gene modC 12263 11169 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_34960 12910 12266 gene locus_tag LOCUS_34970 gene modB 12910 12266 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604026.1 protein_id gnl|my_center|LOCUS_34970 13610 12927 gene locus_tag LOCUS_34980 gene modA 13610 12927 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101994.1 protein_id gnl|my_center|LOCUS_34980 16184 13809 gene locus_tag LOCUS_34990 16184 13809 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_34990 >Feature sequence123 1124 321 gene locus_tag LOCUS_35000 1124 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 4341 1825 gene locus_tag LOCUS_35010 4341 1825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_35010 4838 5002 gene locus_tag LOCUS_35020 4838 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 6354 5482 gene locus_tag LOCUS_35030 6354 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 7723 6362 gene locus_tag LOCUS_35040 7723 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 10193 7791 gene locus_tag LOCUS_35050 10193 7791 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_35050 10888 10214 gene locus_tag LOCUS_35060 10888 10214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794222.1 protein_id gnl|my_center|LOCUS_35060 12367 11081 gene locus_tag LOCUS_35070 12367 11081 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839416.1 protein_id gnl|my_center|LOCUS_35070 14775 12406 gene locus_tag LOCUS_35080 14775 12406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_35080 16093 14795 gene locus_tag LOCUS_35090 16093 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence124 736 3087 gene locus_tag LOCUS_35100 736 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 3091 4221 gene locus_tag LOCUS_35110 3091 4221 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528753.1 protein_id gnl|my_center|LOCUS_35110 4257 5156 gene locus_tag LOCUS_35120 4257 5156 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_35120 5153 5761 gene locus_tag LOCUS_35130 5153 5761 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_35130 6632 5730 gene locus_tag LOCUS_35140 6632 5730 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_35140 6796 9843 gene locus_tag LOCUS_35150 6796 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 9997 12573 gene locus_tag LOCUS_35160 9997 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 12685 15045 gene locus_tag LOCUS_35170 12685 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence125 308 2089 gene locus_tag LOCUS_35180 308 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 2105 2332 gene locus_tag LOCUS_35190 2105 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 2431 4338 gene locus_tag LOCUS_35200 2431 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 5639 4350 gene locus_tag LOCUS_35210 5639 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 8468 5691 gene locus_tag LOCUS_35220 8468 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 11356 8558 gene locus_tag LOCUS_35230 11356 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 13620 11416 gene locus_tag LOCUS_35240 13620 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 15542 13653 gene locus_tag LOCUS_35250 15542 13653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence126 39 863 gene locus_tag LOCUS_35260 39 863 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 protein_id gnl|my_center|LOCUS_35260 878 1906 gene locus_tag LOCUS_35270 878 1906 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_35270 1950 2870 gene locus_tag LOCUS_35280 1950 2870 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_35280 2916 4091 gene locus_tag LOCUS_35290 2916 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 6003 4108 gene locus_tag LOCUS_35300 6003 4108 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_35300 6339 6019 gene locus_tag LOCUS_35310 6339 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 8395 6485 gene locus_tag LOCUS_35320 8395 6485 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_35320 9981 8422 gene locus_tag LOCUS_35330 9981 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 11308 10082 gene locus_tag LOCUS_35340 11308 10082 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_35340 12305 11313 gene locus_tag LOCUS_35350 12305 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 12384 13271 gene locus_tag LOCUS_35360 12384 13271 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_35360 14059 13268 gene locus_tag LOCUS_35370 14059 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 14131 14886 gene locus_tag LOCUS_35380 14131 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 14906 15655 gene locus_tag LOCUS_35390 14906 15655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 >Feature sequence127 <1 1724 gene locus_tag LOCUS_35400 <1 1724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000193501.1:uracil-xanthine permease family protein 2641 1736 gene locus_tag LOCUS_35410 2641 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 3354 2638 gene locus_tag LOCUS_35420 3354 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 3709 3470 gene locus_tag LOCUS_35430 3709 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 12891 3787 gene locus_tag LOCUS_35440 12891 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 14218 15456 gene locus_tag LOCUS_35450 14218 15456 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence128 224 979 gene locus_tag LOCUS_35460 224 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 1002 2129 gene locus_tag LOCUS_35470 1002 2129 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037244312.1 protein_id gnl|my_center|LOCUS_35470 2176 3345 gene locus_tag LOCUS_35480 2176 3345 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_35480 3342 3764 gene locus_tag LOCUS_35490 3342 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 3908 4930 gene locus_tag LOCUS_35500 3908 4930 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_35500 4927 7173 gene locus_tag LOCUS_35510 4927 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 7503 7174 gene locus_tag LOCUS_35520 7503 7174 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_35520 8934 7549 gene locus_tag LOCUS_35530 8934 7549 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_35530 10920 9175 gene locus_tag LOCUS_35540 10920 9175 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257769.1 protein_id gnl|my_center|LOCUS_35540 11793 10996 gene locus_tag LOCUS_35550 11793 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 12487 11804 gene locus_tag LOCUS_35560 12487 11804 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_35560 13280 12519 gene locus_tag LOCUS_35570 13280 12519 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_35570 13386 14618 gene locus_tag LOCUS_35580 13386 14618 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257534.1 protein_id gnl|my_center|LOCUS_35580 14637 15110 gene locus_tag LOCUS_35590 14637 15110 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257236.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence129 3521 2031 gene locus_tag LOCUS_35600 3521 2031 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108631.1 protein_id gnl|my_center|LOCUS_35600 4013 3546 gene locus_tag LOCUS_35610 4013 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 5414 4017 gene locus_tag LOCUS_35620 5414 4017 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_35620 6770 5523 gene locus_tag LOCUS_35630 6770 5523 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_35630 6960 8093 gene locus_tag LOCUS_35640 6960 8093 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_35640 8100 8600 gene locus_tag LOCUS_35650 8100 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 8835 10046 gene locus_tag LOCUS_35660 8835 10046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 10102 11049 gene locus_tag LOCUS_35670 10102 11049 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_35670 12696 11062 gene locus_tag LOCUS_35680 12696 11062 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_35680 13764 12715 gene locus_tag LOCUS_35690 13764 12715 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_35690 15230 13770 gene locus_tag LOCUS_35700 15230 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence130 1019 75 gene locus_tag LOCUS_35710 1019 75 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941713.1 protein_id gnl|my_center|LOCUS_35710 1141 4272 gene locus_tag LOCUS_35720 1141 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 4526 5509 gene locus_tag LOCUS_35730 4526 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 5542 6486 gene locus_tag LOCUS_35740 5542 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 6813 9932 gene locus_tag LOCUS_35750 6813 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 10240 11934 gene locus_tag LOCUS_35760 10240 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 11973 14051 gene locus_tag LOCUS_35770 11973 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence131 921 121 gene locus_tag LOCUS_35780 921 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1859 918 gene locus_tag LOCUS_35790 gene hprK 1859 918 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_35790 2772 1852 gene locus_tag LOCUS_35800 gene rsgA 2772 1852 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_35800 3495 2773 gene locus_tag LOCUS_35810 3495 2773 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_35810 4431 3508 gene locus_tag LOCUS_35820 4431 3508 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966497.1 protein_id gnl|my_center|LOCUS_35820 5111 4443 gene locus_tag LOCUS_35830 5111 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 5660 5148 gene locus_tag LOCUS_35840 5660 5148 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142741.1 protein_id gnl|my_center|LOCUS_35840 5846 5685 gene locus_tag LOCUS_35850 5846 5685 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_35850 6800 5850 gene locus_tag LOCUS_35860 6800 5850 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173675.1 protein_id gnl|my_center|LOCUS_35860 6928 7185 gene locus_tag LOCUS_35870 6928 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 7182 7610 gene locus_tag LOCUS_35880 7182 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 8802 7615 gene locus_tag LOCUS_35890 8802 7615 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_35890 10180 8816 gene locus_tag LOCUS_35900 gene thrC 10180 8816 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257816.1 protein_id gnl|my_center|LOCUS_35900 10686 10216 gene locus_tag LOCUS_35910 10686 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 11850 10852 gene locus_tag LOCUS_35920 11850 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 12595 11873 gene locus_tag LOCUS_35930 12595 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 13422 12592 gene locus_tag LOCUS_35940 13422 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 13703 13416 gene locus_tag LOCUS_35950 13703 13416 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357513.1 protein_id gnl|my_center|LOCUS_35950 14941 13850 gene locus_tag LOCUS_35960 gene ychF 14941 13850 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence132 480 722 gene locus_tag LOCUS_35970 480 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 719 1114 gene locus_tag LOCUS_35980 719 1114 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_35980 1168 2232 gene locus_tag LOCUS_35990 1168 2232 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083752.1 protein_id gnl|my_center|LOCUS_35990 2263 3084 gene locus_tag LOCUS_36000 2263 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 3162 4007 gene locus_tag LOCUS_36010 3162 4007 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064422.1 protein_id gnl|my_center|LOCUS_36010 5505 4042 gene locus_tag LOCUS_36020 5505 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 5738 8341 gene locus_tag LOCUS_36030 5738 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 8353 10269 gene locus_tag LOCUS_36040 8353 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 10332 11333 gene locus_tag LOCUS_36050 10332 11333 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_36050 12408 11341 gene locus_tag LOCUS_36060 12408 11341 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970647.1 protein_id gnl|my_center|LOCUS_36060 12595 13410 gene locus_tag LOCUS_36070 12595 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 13518 14282 gene locus_tag LOCUS_36080 13518 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 14880 14347 gene locus_tag LOCUS_36090 14880 14347 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_36090 >Feature sequence133 470 3616 gene locus_tag LOCUS_36100 470 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 3783 3574 gene locus_tag LOCUS_36110 3783 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 3938 6025 gene locus_tag LOCUS_36120 3938 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 6084 8219 gene locus_tag LOCUS_36130 6084 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 8260 11169 gene locus_tag LOCUS_36140 8260 11169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 11316 12434 gene locus_tag LOCUS_36150 11316 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 12450 13940 gene locus_tag LOCUS_36160 12450 13940 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_36160 <14601 13961 gene locus_tag LOCUS_36170 <14601 13961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080612.1:DUF5605 domain-containing protein >Feature sequence134 328 1341 gene locus_tag LOCUS_36180 328 1341 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_36180 2160 1348 gene locus_tag LOCUS_36190 2160 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3128 2172 gene locus_tag LOCUS_36200 3128 2172 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390262.1 protein_id gnl|my_center|LOCUS_36200 3254 3178 gene locus_tag LOCUS_t00310 3254 3178 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3824 3291 gene locus_tag LOCUS_36210 gene def 3824 3291 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_36210 4870 3821 gene locus_tag LOCUS_36220 gene larE 4870 3821 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_36220 6324 4876 gene locus_tag LOCUS_36230 6324 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 6456 7286 gene locus_tag LOCUS_36240 6456 7286 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 protein_id gnl|my_center|LOCUS_36240 7287 8306 gene locus_tag LOCUS_36250 7287 8306 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_36250 8545 8796 gene locus_tag LOCUS_36260 8545 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 10778 8859 gene locus_tag LOCUS_36270 10778 8859 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049755666.1 protein_id gnl|my_center|LOCUS_36270 10983 12362 gene locus_tag LOCUS_36280 gene selA 10983 12362 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_36280 12377 12775 gene locus_tag LOCUS_36290 12377 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 12952 13947 gene locus_tag LOCUS_36300 12952 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 <14596 14006 gene locus_tag LOCUS_36310 <14596 14006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143323.1:LptF/LptG family permease >Feature sequence135 98 3343 gene locus_tag LOCUS_36320 98 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 3388 4041 gene locus_tag LOCUS_36330 3388 4041 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_36330 4071 4478 gene locus_tag LOCUS_36340 4071 4478 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_36340 4516 5892 gene locus_tag LOCUS_36350 4516 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 7278 5989 gene locus_tag LOCUS_36360 gene aroA 7278 5989 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 protein_id gnl|my_center|LOCUS_36360 7438 8334 gene locus_tag LOCUS_36370 7438 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 10578 8407 gene locus_tag LOCUS_36380 10578 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 11676 10588 gene locus_tag LOCUS_36390 11676 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 11764 13323 gene locus_tag LOCUS_36400 11764 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 13527 13988 gene locus_tag LOCUS_36410 13527 13988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 >Feature sequence136 <1 562 gene locus_tag LOCUS_36420 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173442597.1:CRTAC1 family protein 1192 1422 gene locus_tag LOCUS_36430 1192 1422 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_36430 1439 1828 gene locus_tag LOCUS_36440 1439 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 1815 2066 gene locus_tag LOCUS_36450 1815 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 4283 1998 gene locus_tag LOCUS_36460 4283 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 6123 4486 gene locus_tag LOCUS_36470 6123 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 6754 7674 gene locus_tag LOCUS_36480 6754 7674 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_36480 9463 7802 gene locus_tag LOCUS_36490 9463 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 12204 9496 gene locus_tag LOCUS_36500 12204 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 13973 12258 gene locus_tag LOCUS_36510 13973 12258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 >Feature sequence137 <1 740 gene locus_tag LOCUS_36520 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000198886.1:acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta 967 2037 gene locus_tag LOCUS_36530 967 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 2079 3398 gene locus_tag LOCUS_36540 2079 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3997 4227 gene locus_tag LOCUS_36550 3997 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 4227 4637 gene locus_tag LOCUS_36560 4227 4637 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_36560 4649 6484 gene locus_tag LOCUS_36570 4649 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 6514 8820 gene locus_tag LOCUS_36580 6514 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 9663 8914 gene locus_tag LOCUS_36590 9663 8914 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_36590 11746 9752 gene locus_tag LOCUS_36600 gene uvrB 11746 9752 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379127.1 protein_id gnl|my_center|LOCUS_36600 11979 11749 gene locus_tag LOCUS_36610 11979 11749 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404666.1 protein_id gnl|my_center|LOCUS_36610 12383 12583 gene locus_tag LOCUS_36620 12383 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 12593 13045 gene locus_tag LOCUS_36630 12593 13045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 13090 13353 gene locus_tag LOCUS_36640 13090 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 13549 13761 gene locus_tag LOCUS_36650 13549 13761 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_36650 >Feature sequence138 1499 618 gene locus_tag LOCUS_36660 1499 618 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940707.1 protein_id gnl|my_center|LOCUS_36660 1532 3025 gene locus_tag LOCUS_36670 1532 3025 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_36670 4351 3092 gene locus_tag LOCUS_36680 4351 3092 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812305.1 protein_id gnl|my_center|LOCUS_36680 5705 4524 gene locus_tag LOCUS_36690 gene dgoD 5705 4524 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_36690 5889 6764 gene locus_tag LOCUS_36700 5889 6764 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920800.1 protein_id gnl|my_center|LOCUS_36700 6797 7852 gene locus_tag LOCUS_36710 6797 7852 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_36710 7931 8290 gene locus_tag LOCUS_36720 7931 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 8290 9162 gene locus_tag LOCUS_36730 8290 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 10200 9199 gene locus_tag LOCUS_36740 10200 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 11187 10222 gene locus_tag LOCUS_36750 11187 10222 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209809385.1 protein_id gnl|my_center|LOCUS_36750 11831 11223 gene locus_tag LOCUS_36760 11831 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 12904 11837 gene locus_tag LOCUS_36770 12904 11837 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776452.1 protein_id gnl|my_center|LOCUS_36770 13751 12969 gene locus_tag LOCUS_36780 13751 12969 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065132.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence139 821 1078 gene locus_tag LOCUS_36790 821 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 1201 3843 gene locus_tag LOCUS_36800 1201 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 3840 6002 gene locus_tag LOCUS_36810 3840 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 6201 5989 gene locus_tag LOCUS_36820 6201 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 6190 7341 gene locus_tag LOCUS_36830 6190 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 7338 8273 gene locus_tag LOCUS_36840 7338 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 8388 8606 gene locus_tag LOCUS_36850 gene infA 8388 8606 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937325.1 protein_id gnl|my_center|LOCUS_36850 8665 10239 gene locus_tag LOCUS_36860 8665 10239 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_36860 10313 11248 gene locus_tag LOCUS_36870 10313 11248 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_36870 11462 11839 gene locus_tag LOCUS_36880 gene ytrA 11462 11839 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_36880 11853 12911 gene locus_tag LOCUS_36890 11853 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 13277 12966 gene locus_tag LOCUS_36900 13277 12966 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404092.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence140 <1 995 gene locus_tag LOCUS_36910 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918896.1:GDP-perosamine synthase 992 1768 gene locus_tag LOCUS_36920 992 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 1765 2769 gene locus_tag LOCUS_36930 1765 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 2937 4070 gene locus_tag LOCUS_36940 2937 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 4317 4760 gene locus_tag LOCUS_36950 4317 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 7267 4772 gene locus_tag LOCUS_36960 7267 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 7646 8695 gene locus_tag LOCUS_36970 gene dcm 7646 8695 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057142.1 protein_id gnl|my_center|LOCUS_36970 8749 10056 gene locus_tag LOCUS_36980 8749 10056 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602456.1 protein_id gnl|my_center|LOCUS_36980 11193 10102 gene locus_tag LOCUS_36990 11193 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 11990 11217 gene locus_tag LOCUS_37000 11990 11217 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_37000 12546 11998 gene locus_tag LOCUS_37010 12546 11998 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003157550.1 protein_id gnl|my_center|LOCUS_37010 12913 12572 gene locus_tag LOCUS_37020 12913 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 13352 13062 gene locus_tag LOCUS_37030 gene nadS 13352 13062 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670672.1 protein_id gnl|my_center|LOCUS_37030 >Feature sequence141 <1 946 gene locus_tag LOCUS_37040 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002382304.1:dipeptide epimerase 946 1731 gene locus_tag LOCUS_37050 946 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 2120 1794 gene locus_tag LOCUS_37060 2120 1794 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_37060 2515 2192 gene locus_tag LOCUS_37070 2515 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 2911 2516 gene locus_tag LOCUS_37080 2911 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 3894 3079 gene locus_tag LOCUS_37090 3894 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 5083 4883 gene locus_tag LOCUS_37100 5083 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 5713 5225 gene locus_tag LOCUS_37110 5713 5225 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_37110 5960 5694 gene locus_tag LOCUS_37120 5960 5694 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_37120 6117 5938 gene locus_tag LOCUS_37130 6117 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 7638 6226 gene locus_tag LOCUS_37140 7638 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37140 10208 7584 gene locus_tag LOCUS_37150 10208 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 11561 10224 gene locus_tag LOCUS_37160 11561 10224 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_37160 11852 12739 gene locus_tag LOCUS_37170 11852 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 >Feature sequence142 <1 743 gene locus_tag LOCUS_37180 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002921786.1:dipeptide ABC transporter permease DppB 3222 832 gene locus_tag LOCUS_37190 3222 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 4445 3309 gene locus_tag LOCUS_37200 4445 3309 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243283.1 protein_id gnl|my_center|LOCUS_37200 7079 4527 gene locus_tag LOCUS_37210 7079 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 7902 7123 gene locus_tag LOCUS_37220 7902 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 9806 7902 gene locus_tag LOCUS_37230 9806 7902 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_37230 10429 9806 gene locus_tag LOCUS_37240 10429 9806 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_37240 11670 10426 gene locus_tag LOCUS_37250 11670 10426 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_37250 12540 11695 gene locus_tag LOCUS_37260 12540 11695 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_37260 >Feature sequence143 645 136 gene locus_tag LOCUS_37270 645 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 868 638 gene locus_tag LOCUS_37280 868 638 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112903271.1 protein_id gnl|my_center|LOCUS_37280 1031 843 gene locus_tag LOCUS_37290 1031 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1798 1094 gene locus_tag LOCUS_37300 1798 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 3209 2556 gene locus_tag LOCUS_37310 3209 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 3766 4599 gene locus_tag LOCUS_37320 3766 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 4613 5377 gene locus_tag LOCUS_37330 4613 5377 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_37330 5427 5843 gene locus_tag LOCUS_37340 5427 5843 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287076.1 protein_id gnl|my_center|LOCUS_37340 5840 6976 gene locus_tag LOCUS_37350 5840 6976 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_37350 7004 7771 gene locus_tag LOCUS_37360 7004 7771 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083016.1 protein_id gnl|my_center|LOCUS_37360 11865 7798 gene locus_tag LOCUS_37370 11865 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 >Feature sequence144 1357 119 gene locus_tag LOCUS_37380 gene nqrF 1357 119 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_37380 1985 1374 gene locus_tag LOCUS_37390 gene nqrE 1985 1374 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_37390 2615 1992 gene locus_tag LOCUS_37400 2615 1992 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328967.1 protein_id gnl|my_center|LOCUS_37400 3407 2616 gene locus_tag LOCUS_37410 3407 2616 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_37410 4639 3422 gene locus_tag LOCUS_37420 4639 3422 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337389.1 protein_id gnl|my_center|LOCUS_37420 5965 4649 gene locus_tag LOCUS_37430 5965 4649 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689268.1 protein_id gnl|my_center|LOCUS_37430 6316 7320 gene locus_tag LOCUS_37440 gene bioB 6316 7320 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_37440 8556 7273 gene locus_tag LOCUS_37450 gene bioA 8556 7273 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_37450 9172 8549 gene locus_tag LOCUS_37460 9172 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37460 9968 9162 gene locus_tag LOCUS_37470 9968 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37470 10627 9965 gene locus_tag LOCUS_37480 10627 9965 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930771.1 protein_id gnl|my_center|LOCUS_37480 11780 10614 gene locus_tag LOCUS_37490 gene bioF 11780 10614 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449714.1 protein_id gnl|my_center|LOCUS_37490 >Feature sequence145 443 2281 gene locus_tag LOCUS_37500 443 2281 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_37500 2291 3394 gene locus_tag LOCUS_37510 2291 3394 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552742.1 protein_id gnl|my_center|LOCUS_37510 3391 4479 gene locus_tag LOCUS_37520 3391 4479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_37520 4476 6095 gene locus_tag LOCUS_37530 4476 6095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390917.1 protein_id gnl|my_center|LOCUS_37530 6166 8217 gene locus_tag LOCUS_37540 6166 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 8224 10578 gene locus_tag LOCUS_37550 8224 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 10710 11882 gene locus_tag LOCUS_37560 10710 11882 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_37560 >Feature sequence146 2112 259 gene locus_tag LOCUS_37570 2112 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 2256 3515 gene locus_tag LOCUS_37580 2256 3515 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144244.1 protein_id gnl|my_center|LOCUS_37580 3780 4748 gene locus_tag LOCUS_37590 3780 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 4867 5814 gene locus_tag LOCUS_37600 gene pstS 4867 5814 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_37600 5827 8031 gene locus_tag LOCUS_37610 5827 8031 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071862.1 protein_id gnl|my_center|LOCUS_37610 8031 9623 gene locus_tag LOCUS_37620 gene pstA 8031 9623 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193383857.1 protein_id gnl|my_center|LOCUS_37620 9632 10414 gene locus_tag LOCUS_37630 gene pstB 9632 10414 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401255.1 protein_id gnl|my_center|LOCUS_37630 10429 11118 gene locus_tag LOCUS_37640 gene phoU 10429 11118 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_37640 11115 11807 gene locus_tag LOCUS_37650 11115 11807 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence147 427 1377 gene locus_tag LOCUS_37660 427 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 1367 2986 gene locus_tag LOCUS_37670 1367 2986 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_37670 2988 3683 gene locus_tag LOCUS_37680 2988 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 3710 5935 gene locus_tag LOCUS_37690 3710 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 7358 5967 gene locus_tag LOCUS_37700 7358 5967 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_37700 8619 7516 gene locus_tag LOCUS_37710 8619 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 9764 8634 gene locus_tag LOCUS_37720 9764 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_37720 >Feature sequence148 1641 778 gene locus_tag LOCUS_37730 1641 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 1803 2603 gene locus_tag LOCUS_37740 1803 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 2584 4071 gene locus_tag LOCUS_37750 2584 4071 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973724.1 protein_id gnl|my_center|LOCUS_37750 4068 5003 gene locus_tag LOCUS_37760 4068 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 5005 6687 gene locus_tag LOCUS_37770 gene ettA 5005 6687 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_37770 8104 6704 gene locus_tag LOCUS_37780 gene hemL 8104 6704 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045315.1 protein_id gnl|my_center|LOCUS_37780 8391 8720 gene locus_tag LOCUS_37790 8391 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 8717 8920 gene locus_tag LOCUS_37800 8717 8920 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_37800 9013 9561 gene locus_tag LOCUS_37810 9013 9561 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_37810 9583 9789 gene locus_tag LOCUS_37820 9583 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 10696 9881 gene locus_tag LOCUS_37830 10696 9881 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_37830 <12266 10711 gene locus_tag LOCUS_37840 <12266 10711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388721.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence149 371 2692 gene locus_tag LOCUS_37850 371 2692 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_37850 2689 4719 gene locus_tag LOCUS_37860 2689 4719 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839249.1 protein_id gnl|my_center|LOCUS_37860 4763 6214 gene locus_tag LOCUS_37870 4763 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 6245 8599 gene locus_tag LOCUS_37880 6245 8599 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037676.1 protein_id gnl|my_center|LOCUS_37880 10025 8619 gene locus_tag LOCUS_37890 10025 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119166.1 protein_id gnl|my_center|LOCUS_37890 11525 10059 gene locus_tag LOCUS_37900 gene pap 11525 10059 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_37900 >Feature sequence150 1080 109 gene locus_tag LOCUS_37910 1080 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 1348 1112 gene locus_tag LOCUS_37920 1348 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 1712 1359 gene locus_tag LOCUS_37930 1712 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 1784 2872 gene locus_tag LOCUS_37940 1784 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 2907 3734 gene locus_tag LOCUS_37950 2907 3734 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_37950 3746 5707 gene locus_tag LOCUS_37960 3746 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 6056 7549 gene locus_tag LOCUS_37970 6056 7549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_37970 7628 8614 gene locus_tag LOCUS_37980 7628 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 10903 8639 gene locus_tag LOCUS_37990 10903 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 10785 11009 gene locus_tag LOCUS_38000 10785 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 >Feature sequence151 1959 346 gene locus_tag LOCUS_38010 1959 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 2106 3986 gene locus_tag LOCUS_38020 2106 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 6610 4043 gene locus_tag LOCUS_38030 6610 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 9198 6607 gene locus_tag LOCUS_38040 9198 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 11193 9199 gene locus_tag LOCUS_38050 11193 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence152 <1 644 gene locus_tag LOCUS_38060 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 793 2223 gene locus_tag LOCUS_38070 793 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 2237 3076 gene locus_tag LOCUS_38080 2237 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 3091 3687 gene locus_tag LOCUS_38090 3091 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 3705 4262 gene locus_tag LOCUS_38100 3705 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 5231 4329 gene locus_tag LOCUS_38110 5231 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 5403 6026 gene locus_tag LOCUS_38120 5403 6026 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919957.1 protein_id gnl|my_center|LOCUS_38120 6847 6023 gene locus_tag LOCUS_38130 6847 6023 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 protein_id gnl|my_center|LOCUS_38130 8063 6840 gene locus_tag LOCUS_38140 8063 6840 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_38140 8795 8073 gene locus_tag LOCUS_38150 8795 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 9704 8943 gene locus_tag LOCUS_38160 9704 8943 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_38160 10276 9806 gene locus_tag LOCUS_38170 10276 9806 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571271.1 protein_id gnl|my_center|LOCUS_38170 11010 10327 gene locus_tag LOCUS_38180 11010 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 11849 11331 gene locus_tag LOCUS_38190 11849 11331 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886773.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence153 201 950 gene locus_tag LOCUS_38200 gene aztA 201 950 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383759.1 protein_id gnl|my_center|LOCUS_38200 943 1821 gene locus_tag LOCUS_38210 943 1821 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_38210 1834 2715 gene locus_tag LOCUS_38220 1834 2715 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966160.1 protein_id gnl|my_center|LOCUS_38220 2768 3148 gene locus_tag LOCUS_38230 2768 3148 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_38230 3473 4600 gene locus_tag LOCUS_38240 3473 4600 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_38240 4594 4821 gene locus_tag LOCUS_38250 4594 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 4883 5584 gene locus_tag LOCUS_38260 4883 5584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_38260 5587 6999 gene locus_tag LOCUS_38270 5587 6999 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141303.1 protein_id gnl|my_center|LOCUS_38270 6996 8438 gene locus_tag LOCUS_38280 6996 8438 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928739.1 protein_id gnl|my_center|LOCUS_38280 8435 10816 gene locus_tag LOCUS_38290 8435 10816 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928501.1 protein_id gnl|my_center|LOCUS_38290 >Feature sequence154 1123 134 gene locus_tag LOCUS_38300 1123 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1574 1227 gene locus_tag LOCUS_38310 1574 1227 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_38310 1807 1574 gene locus_tag LOCUS_38320 1807 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1969 3192 gene locus_tag LOCUS_38330 1969 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 3300 4319 gene locus_tag LOCUS_38340 3300 4319 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192388.1 protein_id gnl|my_center|LOCUS_38340 4342 5331 gene locus_tag LOCUS_38350 4342 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 6221 5367 gene locus_tag LOCUS_38360 6221 5367 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_38360 6864 6361 gene locus_tag LOCUS_38370 6864 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 7560 6895 gene locus_tag LOCUS_38380 gene kynB 7560 6895 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810518.1 protein_id gnl|my_center|LOCUS_38380 8339 7557 gene locus_tag LOCUS_38390 8339 7557 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723840.1 protein_id gnl|my_center|LOCUS_38390 9484 8396 gene locus_tag LOCUS_38400 9484 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 10369 9485 gene locus_tag LOCUS_38410 10369 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 11586 10540 gene locus_tag LOCUS_38420 11586 10540 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461131.1 protein_id gnl|my_center|LOCUS_38420 >Feature sequence155 1443 934 gene locus_tag LOCUS_38430 1443 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 1629 2684 gene locus_tag LOCUS_38440 1629 2684 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_38440 2681 3463 gene locus_tag LOCUS_38450 2681 3463 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_38450 4315 3527 gene locus_tag LOCUS_38460 4315 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 5299 4328 gene locus_tag LOCUS_38470 5299 4328 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_38470 5443 5727 gene locus_tag LOCUS_38480 5443 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 5720 6499 gene locus_tag LOCUS_38490 5720 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 6528 7205 gene locus_tag LOCUS_38500 6528 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 7221 8339 gene locus_tag LOCUS_38510 7221 8339 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_38510 8378 8776 gene locus_tag LOCUS_38520 8378 8776 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030951.1 protein_id gnl|my_center|LOCUS_38520 10501 8777 gene locus_tag LOCUS_38530 10501 8777 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532968.1 protein_id gnl|my_center|LOCUS_38530 10860 10555 gene locus_tag LOCUS_38540 10860 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38540 11561 10938 gene locus_tag LOCUS_38550 11561 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38550 >Feature sequence156 1663 341 gene locus_tag LOCUS_38560 gene ahcY 1663 341 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117570.1 protein_id gnl|my_center|LOCUS_38560 3289 1712 gene locus_tag LOCUS_38570 gene pckA 3289 1712 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_38570 3525 4091 gene locus_tag LOCUS_38580 3525 4091 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479987.1 protein_id gnl|my_center|LOCUS_38580 4133 5083 gene locus_tag LOCUS_38590 4133 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 5167 5724 gene locus_tag LOCUS_38600 5167 5724 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_38600 5741 6322 gene locus_tag LOCUS_38610 5741 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 6332 7510 gene locus_tag LOCUS_38620 6332 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 7520 8554 gene locus_tag LOCUS_38630 gene pdhA 7520 8554 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_38630 8554 9531 gene locus_tag LOCUS_38640 8554 9531 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380904.1 protein_id gnl|my_center|LOCUS_38640 9542 10630 gene locus_tag LOCUS_38650 9542 10630 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943295.1 protein_id gnl|my_center|LOCUS_38650 <11748 10640 gene locus_tag LOCUS_38660 <11748 10640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942301.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence157 5640 2491 gene locus_tag LOCUS_38670 5640 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 6710 5673 gene locus_tag LOCUS_38680 gene purM 6710 5673 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222409.1 protein_id gnl|my_center|LOCUS_38680 7879 6707 gene locus_tag LOCUS_38690 7879 6707 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162708822.1 protein_id gnl|my_center|LOCUS_38690 8143 8865 gene locus_tag LOCUS_38700 gene mqnB 8143 8865 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_38700 8856 9683 gene locus_tag LOCUS_38710 8856 9683 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_38710 9760 10782 gene locus_tag LOCUS_38720 9760 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 <11665 10771 gene locus_tag LOCUS_38730 <11665 10771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114636.1:choline-sulfatase >Feature sequence158 <1 2057 gene locus_tag LOCUS_38740 <1 2057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813559.1:ABC transporter ATP-binding protein 2061 4271 gene locus_tag LOCUS_38750 2061 4271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_38750 4285 4815 gene locus_tag LOCUS_38760 4285 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 5268 6257 gene locus_tag LOCUS_38770 5268 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 6371 7060 gene locus_tag LOCUS_38780 6371 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 7062 8363 gene locus_tag LOCUS_38790 7062 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 8421 8618 gene locus_tag LOCUS_38800 8421 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 8618 8830 gene locus_tag LOCUS_38810 8618 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 8858 10087 gene locus_tag LOCUS_38820 8858 10087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_38820 10084 11307 gene locus_tag LOCUS_38830 10084 11307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_38830 >Feature sequence159 2781 982 gene locus_tag LOCUS_38840 2781 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 3792 2881 gene locus_tag LOCUS_38850 3792 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 6362 4017 gene locus_tag LOCUS_38860 6362 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 6557 7468 gene locus_tag LOCUS_38870 6557 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 7461 9071 gene locus_tag LOCUS_38880 7461 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 9077 9553 gene locus_tag LOCUS_38890 9077 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 11204 9567 gene locus_tag LOCUS_38900 11204 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 >Feature sequence160 716 531 gene locus_tag LOCUS_38910 716 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 654 977 gene locus_tag LOCUS_38920 654 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 2540 984 gene locus_tag LOCUS_38930 2540 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 2694 4757 gene locus_tag LOCUS_38940 2694 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 4773 7100 gene locus_tag LOCUS_38950 4773 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 7262 9931 gene locus_tag LOCUS_38960 7262 9931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence161 1489 380 gene locus_tag LOCUS_38970 gene gcvT 1489 380 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_38970 2099 1479 gene locus_tag LOCUS_38980 gene coaE 2099 1479 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_38980 2338 2943 gene locus_tag LOCUS_38990 gene clpP 2338 2943 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_38990 4139 2940 gene locus_tag LOCUS_39000 gene epmA 4139 2940 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968468.1 protein_id gnl|my_center|LOCUS_39000 5538 4312 gene locus_tag LOCUS_39010 gene clpX 5538 4312 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_39010 6192 5545 gene locus_tag LOCUS_39020 6192 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 7677 6295 gene locus_tag LOCUS_39030 7677 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 8147 7674 gene locus_tag LOCUS_39040 8147 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 8632 8306 gene locus_tag LOCUS_39050 gene trxA 8632 8306 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_39050 9748 8729 gene locus_tag LOCUS_39060 gene holA 9748 8729 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_39060 9935 9741 gene locus_tag LOCUS_39070 9935 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 10490 10035 gene locus_tag LOCUS_39080 10490 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 <11064 10535 gene locus_tag LOCUS_39090 <11064 10535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268643.1:YihY/virulence factor BrkB family protein >Feature sequence162 2967 1948 gene locus_tag LOCUS_39100 2967 1948 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_39100 3234 6107 gene locus_tag LOCUS_39110 3234 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 6736 6158 gene locus_tag LOCUS_39120 gene ilvN 6736 6158 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_39120 8454 6736 gene locus_tag LOCUS_39130 gene ilvB 8454 6736 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228519.1 protein_id gnl|my_center|LOCUS_39130 9705 8617 gene locus_tag LOCUS_39140 9705 8617 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_39140 10903 9767 gene locus_tag LOCUS_39150 10903 9767 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_39150 >Feature sequence163 622 1200 gene locus_tag LOCUS_39160 622 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 2727 1210 gene locus_tag LOCUS_39170 2727 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3773 2760 gene locus_tag LOCUS_39180 3773 2760 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_39180 6077 3786 gene locus_tag LOCUS_39190 6077 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_39190 6931 6074 gene locus_tag LOCUS_39200 6931 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 8462 6945 gene locus_tag LOCUS_39210 8462 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 9972 8485 gene locus_tag LOCUS_39220 9972 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 <10848 9959 gene locus_tag LOCUS_39230 <10848 9959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530504.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence164 1153 1890 gene locus_tag LOCUS_39240 1153 1890 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885954.1 protein_id gnl|my_center|LOCUS_39240 1958 2371 gene locus_tag LOCUS_39250 1958 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 2368 5013 gene locus_tag LOCUS_39260 2368 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 5088 5510 gene locus_tag LOCUS_39270 5088 5510 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016138.1 protein_id gnl|my_center|LOCUS_39270 5522 6184 gene locus_tag LOCUS_39280 5522 6184 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_39280 6494 7108 gene locus_tag LOCUS_39290 6494 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 7105 8469 gene locus_tag LOCUS_39300 7105 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 protein_id gnl|my_center|LOCUS_39300 8585 9364 gene locus_tag LOCUS_39310 8585 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 9405 10028 gene locus_tag LOCUS_39320 9405 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 <10764 10025 gene locus_tag LOCUS_39330 <10764 10025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258742.1:D-2-hydroxyacid dehydrogenase >Feature sequence165 879 1901 gene locus_tag LOCUS_39340 gene porV 879 1901 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_39340 2034 2972 gene locus_tag LOCUS_39350 2034 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 2991 4286 gene locus_tag LOCUS_39360 2991 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 4287 5330 gene locus_tag LOCUS_39370 4287 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 6578 5307 gene locus_tag LOCUS_39380 6578 5307 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190627.1 protein_id gnl|my_center|LOCUS_39380 6671 8494 gene locus_tag LOCUS_39390 6671 8494 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_39390 8487 8912 gene locus_tag LOCUS_39400 8487 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 9040 9477 gene locus_tag LOCUS_39410 9040 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 9483 9572 gene locus_tag LOCUS_t00320 9483 9572 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9594 9684 gene locus_tag LOCUS_t00330 9594 9684 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9699 9774 gene locus_tag LOCUS_t00340 9699 9774 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence166 <1 568 gene locus_tag LOCUS_39420 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256010.1:metal-dependent transcriptional regulator 1218 565 gene locus_tag LOCUS_39430 1218 565 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466787.1 protein_id gnl|my_center|LOCUS_39430 1394 2983 gene locus_tag LOCUS_39440 1394 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 2992 3297 gene locus_tag LOCUS_39450 2992 3297 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_39450 3328 3555 gene locus_tag LOCUS_39460 3328 3555 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142023.1 protein_id gnl|my_center|LOCUS_39460 3552 3938 gene locus_tag LOCUS_39470 3552 3938 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_39470 3979 4281 gene locus_tag LOCUS_39480 3979 4281 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545366.1 protein_id gnl|my_center|LOCUS_39480 5219 4278 gene locus_tag LOCUS_39490 5219 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 6326 5253 gene locus_tag LOCUS_39500 gene thiO 6326 5253 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266588.1 protein_id gnl|my_center|LOCUS_39500 7508 6327 gene locus_tag LOCUS_39510 7508 6327 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_39510 8671 7523 gene locus_tag LOCUS_39520 8671 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39520 9248 8664 gene locus_tag LOCUS_39530 9248 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 9704 9252 gene locus_tag LOCUS_39540 9704 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 9972 9709 gene locus_tag LOCUS_39550 gene eutM 9972 9709 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387713.1 protein_id gnl|my_center|LOCUS_39550 <10544 9985 gene locus_tag LOCUS_39560 <10544 9985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048869675.1:BMC domain-containing protein note possible pseudo, internal stop codon >Feature sequence167 2160 1378 gene locus_tag LOCUS_39570 2160 1378 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_39570 3094 2162 gene locus_tag LOCUS_39580 3094 2162 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_39580 3982 3107 gene locus_tag LOCUS_39590 3982 3107 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_39590 5000 4002 gene locus_tag LOCUS_39600 5000 4002 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_39600 5602 5111 gene locus_tag LOCUS_39610 5602 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 5925 5638 gene locus_tag LOCUS_39620 5925 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 7863 6010 gene locus_tag LOCUS_39630 7863 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 8002 9507 gene locus_tag LOCUS_39640 8002 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 <10498 9504 gene locus_tag LOCUS_39650 <10498 9504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002675346.1:sigma-54 dependent transcriptional regulator >Feature sequence168 4969 2342 gene locus_tag LOCUS_39660 4969 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 7420 5018 gene locus_tag LOCUS_39670 7420 5018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_39670 9852 7477 gene locus_tag LOCUS_39680 9852 7477 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_39680 >Feature sequence169 1867 485 gene locus_tag LOCUS_39690 1867 485 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_39690 2048 2422 gene locus_tag LOCUS_39700 2048 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 2539 3264 gene locus_tag LOCUS_39710 2539 3264 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618766.1 protein_id gnl|my_center|LOCUS_39710 4071 3280 gene locus_tag LOCUS_39720 4071 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4513 4154 gene locus_tag LOCUS_39730 4513 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 5606 4503 gene locus_tag LOCUS_39740 5606 4503 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_39740 6834 5707 gene locus_tag LOCUS_39750 6834 5707 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195471.1 protein_id gnl|my_center|LOCUS_39750 6998 7867 gene locus_tag LOCUS_39760 6998 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 7954 9000 gene locus_tag LOCUS_39770 7954 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 9067 10053 gene locus_tag LOCUS_39780 9067 10053 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_39780 >Feature sequence170 805 1785 gene locus_tag LOCUS_39790 805 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 1936 4167 gene locus_tag LOCUS_39800 1936 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 4381 5781 gene locus_tag LOCUS_39810 4381 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 5905 7473 gene locus_tag LOCUS_39820 5905 7473 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_39820 7883 8665 gene locus_tag LOCUS_39830 7883 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 >Feature sequence171 45 1625 gene locus_tag LOCUS_39840 45 1625 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_39840 2208 1654 gene locus_tag LOCUS_39850 2208 1654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287055.1 protein_id gnl|my_center|LOCUS_39850 2287 2934 gene locus_tag LOCUS_39860 2287 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 2943 3581 gene locus_tag LOCUS_39870 2943 3581 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950922.1 protein_id gnl|my_center|LOCUS_39870 3618 4520 gene locus_tag LOCUS_39880 3618 4520 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731602.1 protein_id gnl|my_center|LOCUS_39880 5325 4525 gene locus_tag LOCUS_39890 5325 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 6146 5322 gene locus_tag LOCUS_39900 6146 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 6346 6612 gene locus_tag LOCUS_39910 6346 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 6609 6872 gene locus_tag LOCUS_39920 6609 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_39920 8238 6889 gene locus_tag LOCUS_39930 8238 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 8537 10309 gene locus_tag LOCUS_39940 8537 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 >Feature sequence172 1 240 gene locus_tag LOCUS_39950 1 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 265 1500 gene locus_tag LOCUS_39960 265 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 1711 2604 gene locus_tag LOCUS_39970 1711 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 2604 4802 gene locus_tag LOCUS_39980 2604 4802 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_39980 4808 7714 gene locus_tag LOCUS_39990 4808 7714 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_39990 7900 8022 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8052 8327 gene locus_tag LOCUS_40000 8052 8327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 9879 8467 gene locus_tag LOCUS_40010 9879 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 10303 9956 gene locus_tag LOCUS_40020 10303 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence173 <1 1121 gene locus_tag LOCUS_40030 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804244.1:arylsulfatase 2737 1148 gene locus_tag LOCUS_40040 2737 1148 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_40040 4340 2997 gene locus_tag LOCUS_40050 4340 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 4493 4810 gene locus_tag LOCUS_40060 4493 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 4929 6677 gene locus_tag LOCUS_40070 4929 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 6707 7699 gene locus_tag LOCUS_40080 6707 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 7718 8698 gene locus_tag LOCUS_40090 7718 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769801.1 protein_id gnl|my_center|LOCUS_40090 9826 8714 gene locus_tag LOCUS_40100 9826 8714 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973053.1 protein_id gnl|my_center|LOCUS_40100 >Feature sequence174 431 2218 gene locus_tag LOCUS_40110 431 2218 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582628.1 protein_id gnl|my_center|LOCUS_40110 2236 3222 gene locus_tag LOCUS_40120 2236 3222 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729460.1 protein_id gnl|my_center|LOCUS_40120 3219 4715 gene locus_tag LOCUS_40130 3219 4715 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582804.1 protein_id gnl|my_center|LOCUS_40130 4708 5661 gene locus_tag LOCUS_40140 gene rbsC 4708 5661 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001891150.1 protein_id gnl|my_center|LOCUS_40140 7087 5705 gene locus_tag LOCUS_40150 7087 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 7440 7231 gene locus_tag LOCUS_40160 7440 7231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 7668 7919 gene locus_tag LOCUS_40170 7668 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 7813 7822 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8113 7916 gene locus_tag LOCUS_40180 8113 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 8162 9697 gene locus_tag LOCUS_40190 8162 9697 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941565.1 protein_id gnl|my_center|LOCUS_40190 10005 9826 gene locus_tag LOCUS_40200 10005 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 >Feature sequence175 <1 794 gene locus_tag LOCUS_40210 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144334.1:NB-ARC domain-containing protein 1937 798 gene locus_tag LOCUS_40220 1937 798 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_40220 3017 1941 gene locus_tag LOCUS_40230 3017 1941 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119268.1 protein_id gnl|my_center|LOCUS_40230 3902 3066 gene locus_tag LOCUS_40240 3902 3066 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205539.1 protein_id gnl|my_center|LOCUS_40240 4143 5036 gene locus_tag LOCUS_40250 4143 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 5076 6647 gene locus_tag LOCUS_40260 5076 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 7896 6655 gene locus_tag LOCUS_40270 7896 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 <10064 7933 gene locus_tag LOCUS_40280 <10064 7933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478455.1:multidrug efflux RND transporter permease subunit VmeV >Feature sequence176 298 996 gene locus_tag LOCUS_40290 298 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 1438 1187 gene locus_tag LOCUS_40300 1438 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 2086 2346 gene locus_tag LOCUS_40310 2086 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 2352 2816 gene locus_tag LOCUS_40320 2352 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 2806 3249 gene locus_tag LOCUS_40330 2806 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 4533 3451 gene locus_tag LOCUS_40340 4533 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 4749 5579 gene locus_tag LOCUS_40350 4749 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 5668 6486 gene locus_tag LOCUS_40360 5668 6486 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582612.1 protein_id gnl|my_center|LOCUS_40360 6515 8188 gene locus_tag LOCUS_40370 6515 8188 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529948.1 protein_id gnl|my_center|LOCUS_40370 8229 9593 gene locus_tag LOCUS_40380 8229 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence177 607 1371 gene locus_tag LOCUS_40390 607 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 1375 3753 gene locus_tag LOCUS_40400 1375 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 5150 3771 gene locus_tag LOCUS_40410 5150 3771 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970647.1 protein_id gnl|my_center|LOCUS_40410 5350 5706 gene locus_tag LOCUS_40420 5350 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 5718 6758 gene locus_tag LOCUS_40430 5718 6758 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_40430 6755 7921 gene locus_tag LOCUS_40440 6755 7921 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_40440 8037 8726 gene locus_tag LOCUS_40450 8037 8726 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030549.1 protein_id gnl|my_center|LOCUS_40450 >Feature sequence178 424 924 gene locus_tag LOCUS_40460 424 924 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728798.1 protein_id gnl|my_center|LOCUS_40460 1393 1025 gene locus_tag LOCUS_40470 1393 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 1873 2778 gene locus_tag LOCUS_40480 1873 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 2864 4015 gene locus_tag LOCUS_40490 2864 4015 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119340.1 protein_id gnl|my_center|LOCUS_40490 4026 5285 gene locus_tag LOCUS_40500 4026 5285 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_40500 5254 5748 gene locus_tag LOCUS_40510 5254 5748 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095920.1 protein_id gnl|my_center|LOCUS_40510 5768 6625 gene locus_tag LOCUS_40520 5768 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 6719 7813 gene locus_tag LOCUS_40530 6719 7813 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_40530 8828 7872 gene locus_tag LOCUS_40540 8828 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 9183 8887 gene locus_tag LOCUS_40550 9183 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 <9899 9218 gene locus_tag LOCUS_40560 <9899 9218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence179 1217 36 gene locus_tag LOCUS_40570 1217 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 2459 1266 gene locus_tag LOCUS_40580 2459 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 2605 3852 gene locus_tag LOCUS_40590 2605 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 4827 3856 gene locus_tag LOCUS_40600 4827 3856 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_40600 6078 4990 gene locus_tag LOCUS_40610 6078 4990 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_40610 7688 6102 gene locus_tag LOCUS_40620 7688 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 9799 7814 gene locus_tag LOCUS_40630 9799 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence180 3 452 gene locus_tag LOCUS_40640 3 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 457 1884 gene locus_tag LOCUS_40650 457 1884 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982271.1 protein_id gnl|my_center|LOCUS_40650 1881 3317 gene locus_tag LOCUS_40660 1881 3317 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968366.1 protein_id gnl|my_center|LOCUS_40660 3332 3634 gene locus_tag LOCUS_40670 3332 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 5646 3631 gene locus_tag LOCUS_40680 gene ligA 5646 3631 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_40680 5752 6612 gene locus_tag LOCUS_40690 gene cyoE 5752 6612 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_40690 7182 6574 gene locus_tag LOCUS_40700 7182 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 7943 7179 gene locus_tag LOCUS_40710 gene larB 7943 7179 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392116.1 protein_id gnl|my_center|LOCUS_40710 9351 7960 gene locus_tag LOCUS_40720 9351 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 9590 9348 gene locus_tag LOCUS_40730 9590 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence181 30 2198 gene locus_tag LOCUS_40740 30 2198 CDS product large subunit of N,N-dimethylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727394.1 protein_id gnl|my_center|LOCUS_40740 2200 3009 gene locus_tag LOCUS_40750 2200 3009 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809725.1 protein_id gnl|my_center|LOCUS_40750 2999 4036 gene locus_tag LOCUS_40760 2999 4036 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_40760 4042 5112 gene locus_tag LOCUS_40770 4042 5112 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_40770 5244 6083 gene locus_tag LOCUS_40780 5244 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 7628 6102 gene locus_tag LOCUS_40790 7628 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 7754 8635 gene locus_tag LOCUS_40800 7754 8635 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807737.1 protein_id gnl|my_center|LOCUS_40800 8680 9570 gene locus_tag LOCUS_40810 8680 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 >Feature sequence182 1303 50 gene locus_tag LOCUS_40820 1303 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 1623 1303 gene locus_tag LOCUS_40830 1623 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 1885 2241 gene locus_tag LOCUS_40840 1885 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 3571 2279 gene locus_tag LOCUS_40850 3571 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 3651 4079 gene locus_tag LOCUS_40860 3651 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 4153 5592 gene locus_tag LOCUS_40870 gene betC 4153 5592 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_40870 5605 6873 gene locus_tag LOCUS_40880 5605 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 6888 7889 gene locus_tag LOCUS_40890 6888 7889 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_40890 8968 7886 gene locus_tag LOCUS_40900 8968 7886 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_40900 <9613 8980 gene locus_tag LOCUS_40910 <9613 8980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085891.1:thiamine pyrophosphate-requiring protein >Feature sequence183 1005 79 gene locus_tag LOCUS_40920 gene xerD 1005 79 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447733.1 protein_id gnl|my_center|LOCUS_40920 2860 980 gene locus_tag LOCUS_40930 gene uvrC 2860 980 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_40930 3786 2950 gene locus_tag LOCUS_40940 3786 2950 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_40940 4408 3962 gene locus_tag LOCUS_40950 4408 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 5865 4657 gene locus_tag LOCUS_40960 gene rlmI 5865 4657 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116288.1 protein_id gnl|my_center|LOCUS_40960 6015 7640 gene locus_tag LOCUS_40970 6015 7640 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_40970 8430 7705 gene locus_tag LOCUS_40980 8430 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 9230 8427 gene locus_tag LOCUS_40990 9230 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 >Feature sequence184 <1 536 gene locus_tag LOCUS_41000 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921846.1:FAD-dependent oxidoreductase 546 2021 gene locus_tag LOCUS_41010 gene xylB 546 2021 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_41010 3231 2008 gene locus_tag LOCUS_41020 3231 2008 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731603.1 protein_id gnl|my_center|LOCUS_41020 3361 4647 gene locus_tag LOCUS_41030 3361 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_41030 4673 5992 gene locus_tag LOCUS_41040 4673 5992 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_41040 5989 7149 gene locus_tag LOCUS_41050 5989 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 7199 8269 gene locus_tag LOCUS_41060 7199 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 9335 8310 gene locus_tag LOCUS_41070 9335 8310 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 protein_id gnl|my_center|LOCUS_41070 >Feature sequence185 47 820 gene locus_tag LOCUS_41080 47 820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206826.1 protein_id gnl|my_center|LOCUS_41080 1903 827 gene locus_tag LOCUS_41090 1903 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 3054 1918 gene locus_tag LOCUS_41100 3054 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 3428 3332 gene locus_tag LOCUS_t00350 3428 3332 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4902 4663 gene locus_tag LOCUS_41110 4902 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 4862 5059 gene locus_tag LOCUS_41120 4862 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 5056 5373 gene locus_tag LOCUS_41130 5056 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 6967 5474 gene locus_tag LOCUS_41140 6967 5474 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_41140 <9351 6983 gene locus_tag LOCUS_41150 <9351 6983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926853.1:glutamate synthase large subunit >Feature sequence186 828 181 gene locus_tag LOCUS_41160 828 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932664.1 protein_id gnl|my_center|LOCUS_41160 1235 897 gene locus_tag LOCUS_41170 1235 897 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225869.1 protein_id gnl|my_center|LOCUS_41170 2635 1253 gene locus_tag LOCUS_41180 2635 1253 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124450.1 protein_id gnl|my_center|LOCUS_41180 4380 2836 gene locus_tag LOCUS_41190 4380 2836 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_41190 4733 5494 gene locus_tag LOCUS_41200 4733 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 6451 5579 gene locus_tag LOCUS_41210 6451 5579 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_41210 8320 6956 gene locus_tag LOCUS_41220 8320 6956 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_41220 8413 9093 gene locus_tag LOCUS_41230 gene ubiE 8413 9093 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403588.1 protein_id gnl|my_center|LOCUS_41230 >Feature sequence187 1815 3263 gene locus_tag LOCUS_41240 1815 3263 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696793.1 protein_id gnl|my_center|LOCUS_41240 3302 4462 gene locus_tag LOCUS_41250 3302 4462 CDS product mandelate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010210634.1 protein_id gnl|my_center|LOCUS_41250 4581 4883 gene locus_tag LOCUS_41260 4581 4883 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530736.1 protein_id gnl|my_center|LOCUS_41260 4880 5293 gene locus_tag LOCUS_41270 4880 5293 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_41270 5430 8246 gene locus_tag LOCUS_41280 5430 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 8259 9113 gene locus_tag LOCUS_41290 8259 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 >Feature sequence188 1499 906 gene locus_tag LOCUS_41300 gene yihA 1499 906 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_41300 2766 1516 gene locus_tag LOCUS_41310 gene clpX 2766 1516 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_41310 3384 2776 gene locus_tag LOCUS_41320 gene clpP 3384 2776 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_41320 4743 3388 gene locus_tag LOCUS_41330 gene tig 4743 3388 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_41330 4786 4700 gene locus_tag LOCUS_t00360 4786 4700 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6253 4880 gene locus_tag LOCUS_41340 6253 4880 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_41340 7049 6270 gene locus_tag LOCUS_41350 gene recO 7049 6270 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403930.1 protein_id gnl|my_center|LOCUS_41350 7335 7054 gene locus_tag LOCUS_41360 7335 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 8488 7343 gene locus_tag LOCUS_41370 gene proB 8488 7343 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_41370 <9222 8485 gene locus_tag LOCUS_41380 <9222 8485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106334.1:imidazole glycerol phosphate synthase subunit HisF >Feature sequence189 1122 142 gene locus_tag LOCUS_41390 1122 142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932339.1 protein_id gnl|my_center|LOCUS_41390 1892 1119 gene locus_tag LOCUS_41400 1892 1119 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_41400 2650 1892 gene locus_tag LOCUS_41410 gene rnc 2650 1892 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_41410 3976 2717 gene locus_tag LOCUS_41420 gene fabF 3976 2717 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_41420 4212 3973 gene locus_tag LOCUS_41430 gene acpP 4212 3973 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_41430 5072 4326 gene locus_tag LOCUS_41440 gene fabG 5072 4326 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_41440 6003 5074 gene locus_tag LOCUS_41450 gene fabD 6003 5074 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060542.1 protein_id gnl|my_center|LOCUS_41450 7009 6005 gene locus_tag LOCUS_41460 7009 6005 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933768.1 protein_id gnl|my_center|LOCUS_41460 7766 7227 gene locus_tag LOCUS_41470 7766 7227 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056944.1 protein_id gnl|my_center|LOCUS_41470 8176 7775 gene locus_tag LOCUS_41480 gene ndk 8176 7775 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_41480 >Feature sequence190 76 936 gene locus_tag LOCUS_41490 76 936 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_41490 962 1948 gene locus_tag LOCUS_41500 962 1948 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393452.1 protein_id gnl|my_center|LOCUS_41500 1953 3083 gene locus_tag LOCUS_41510 gene dgoD 1953 3083 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_41510 3696 3950 gene locus_tag LOCUS_41520 3696 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 4046 4264 gene locus_tag LOCUS_41530 4046 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 5287 5018 gene locus_tag LOCUS_41540 5287 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 5655 5362 gene locus_tag LOCUS_41550 5655 5362 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_41550 5950 5672 gene locus_tag LOCUS_41560 5950 5672 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_41560 6899 6201 gene locus_tag LOCUS_41570 6899 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41570 7380 6889 gene locus_tag LOCUS_41580 7380 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41580 8035 7733 gene locus_tag LOCUS_41590 8035 7733 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015205689.1 protein_id gnl|my_center|LOCUS_41590 8306 8016 gene locus_tag LOCUS_41600 8306 8016 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_41600 >Feature sequence191 1543 704 gene locus_tag LOCUS_41610 1543 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 2602 1619 gene locus_tag LOCUS_41620 2602 1619 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256295.1 protein_id gnl|my_center|LOCUS_41620 3976 2630 gene locus_tag LOCUS_41630 gene hisS 3976 2630 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_41630 4176 5198 gene locus_tag LOCUS_41640 4176 5198 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_41640 6371 5238 gene locus_tag LOCUS_41650 gene dgoD 6371 5238 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267367.1 protein_id gnl|my_center|LOCUS_41650 7260 6412 gene locus_tag LOCUS_41660 7260 6412 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_41660 <8757 7301 gene locus_tag LOCUS_41670 <8757 7301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:tetratricopeptide repeat protein >Feature sequence192 2496 391 gene locus_tag LOCUS_41680 2496 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 2967 3929 gene locus_tag LOCUS_41690 2967 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 5720 4038 gene locus_tag LOCUS_41700 5720 4038 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083020.1 protein_id gnl|my_center|LOCUS_41700 5674 5841 gene locus_tag LOCUS_41710 5674 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 6933 6049 gene locus_tag LOCUS_41720 6933 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41720 7451 7278 gene locus_tag LOCUS_41730 7451 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 8541 7483 gene locus_tag LOCUS_41740 8541 7483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250707.1 protein_id gnl|my_center|LOCUS_41740 >Feature sequence193 1207 440 gene locus_tag LOCUS_41750 1207 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 1358 2011 gene locus_tag LOCUS_41760 1358 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086844.1 protein_id gnl|my_center|LOCUS_41760 2026 2478 gene locus_tag LOCUS_41770 gene hemJ 2026 2478 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_41770 2552 3529 gene locus_tag LOCUS_41780 2552 3529 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_41780 3591 4697 gene locus_tag LOCUS_41790 3591 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 6171 4804 gene locus_tag LOCUS_41800 6171 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 >Feature sequence194 2074 1238 gene locus_tag LOCUS_41810 2074 1238 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404459.1 protein_id gnl|my_center|LOCUS_41810 2870 2064 gene locus_tag LOCUS_41820 2870 2064 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_41820 3025 3663 gene locus_tag LOCUS_41830 3025 3663 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_41830 3660 3974 gene locus_tag LOCUS_41840 3660 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 3974 4969 gene locus_tag LOCUS_41850 gene dusB 3974 4969 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_41850 5132 6445 gene locus_tag LOCUS_41860 5132 6445 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_41860 <8599 6414 gene locus_tag LOCUS_41870 <8599 6414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001251535.1:DNA-binding transcriptional regulator HyfR >Feature sequence195 573 2393 gene locus_tag LOCUS_41880 573 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 6245 2400 gene locus_tag LOCUS_41890 6245 2400 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_41890 8090 6255 gene locus_tag LOCUS_41900 8090 6255 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_41900 >Feature sequence196 2039 510 gene locus_tag LOCUS_41910 2039 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 2438 2043 gene locus_tag LOCUS_41920 2438 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 3868 2444 gene locus_tag LOCUS_41930 3868 2444 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528108.1 protein_id gnl|my_center|LOCUS_41930 5266 3878 gene locus_tag LOCUS_41940 5266 3878 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177563.1 protein_id gnl|my_center|LOCUS_41940 7239 5263 gene locus_tag LOCUS_41950 7239 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 <8378 7270 gene locus_tag LOCUS_41960 <8378 7270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123734.1:tetratricopeptide repeat protein >Feature sequence197 294 2246 gene locus_tag LOCUS_41970 294 2246 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_41970 2410 3690 gene locus_tag LOCUS_41980 2410 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 3687 4505 gene locus_tag LOCUS_41990 3687 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 4614 5789 gene locus_tag LOCUS_42000 4614 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 6224 5793 gene locus_tag LOCUS_42010 6224 5793 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_42010 6564 6250 gene locus_tag LOCUS_42020 6564 6250 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528325.1 protein_id gnl|my_center|LOCUS_42020 6643 7206 gene locus_tag LOCUS_42030 6643 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 >Feature sequence198 3955 4749 gene locus_tag LOCUS_42040 3955 4749 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_42040 6644 4740 gene locus_tag LOCUS_42050 6644 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 6724 7896 gene locus_tag LOCUS_42060 6724 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42060 >Feature sequence199 176 1546 gene locus_tag LOCUS_42070 176 1546 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_42070 1543 2844 gene locus_tag LOCUS_42080 1543 2844 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_42080 4954 2897 gene locus_tag LOCUS_42090 4954 2897 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922636.1 protein_id gnl|my_center|LOCUS_42090 6018 5116 gene locus_tag LOCUS_42100 6018 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 >Feature sequence200 2094 157 gene locus_tag LOCUS_42110 2094 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_42110 2267 2713 gene locus_tag LOCUS_42120 2267 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 3795 2740 gene locus_tag LOCUS_42130 3795 2740 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_42130 4603 3851 gene locus_tag LOCUS_42140 4603 3851 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_42140 6375 4600 gene locus_tag LOCUS_42150 6375 4600 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_42150 7145 6372 gene locus_tag LOCUS_42160 7145 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 8170 7145 gene locus_tag LOCUS_42170 8170 7145 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_42170 >Feature sequence201 2814 820 gene locus_tag LOCUS_42180 2814 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 3033 2845 gene locus_tag LOCUS_42190 3033 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 3071 6256 gene locus_tag LOCUS_42200 3071 6256 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921030.1 protein_id gnl|my_center|LOCUS_42200 7246 6356 gene locus_tag LOCUS_42210 7246 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 7997 7302 gene locus_tag LOCUS_42220 7997 7302 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552063.1 protein_id gnl|my_center|LOCUS_42220 >Feature sequence202 488 2326 gene locus_tag LOCUS_42230 488 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 3413 2337 gene locus_tag LOCUS_42240 3413 2337 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_42240 4179 3415 gene locus_tag LOCUS_42250 4179 3415 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707810.1 protein_id gnl|my_center|LOCUS_42250 4811 4260 gene locus_tag LOCUS_42260 4811 4260 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_42260 4953 6221 gene locus_tag LOCUS_42270 4953 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 6226 7026 gene locus_tag LOCUS_42280 6226 7026 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941846.1 protein_id gnl|my_center|LOCUS_42280 7035 7694 gene locus_tag LOCUS_42290 7035 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 >Feature sequence203 1001 3388 gene locus_tag LOCUS_42300 1001 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 5191 3395 gene locus_tag LOCUS_42310 5191 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 5351 6289 gene locus_tag LOCUS_42320 5351 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 6336 7169 gene locus_tag LOCUS_42330 6336 7169 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_42330 7792 7166 gene locus_tag LOCUS_42340 7792 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 >Feature sequence204 1840 482 gene locus_tag LOCUS_42350 gene glmM 1840 482 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839748.1 protein_id gnl|my_center|LOCUS_42350 2658 1855 gene locus_tag LOCUS_42360 2658 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 2803 3813 gene locus_tag LOCUS_42370 2803 3813 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_42370 4130 3810 gene locus_tag LOCUS_42380 4130 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 4268 5002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5066 5686 gene locus_tag LOCUS_42390 5066 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 5683 7158 gene locus_tag LOCUS_42400 5683 7158 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202887107.1 protein_id gnl|my_center|LOCUS_42400 >Feature sequence205 1675 446 gene locus_tag LOCUS_42410 1675 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 1869 3368 gene locus_tag LOCUS_42420 1869 3368 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_42420 4380 3358 gene locus_tag LOCUS_42430 4380 3358 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_42430 5591 4455 gene locus_tag LOCUS_42440 5591 4455 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_42440 6704 5718 gene locus_tag LOCUS_42450 6704 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 <8130 6701 gene locus_tag LOCUS_42460 <8130 6701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259178.1:leucyl aminopeptidase >Feature sequence206 <1 834 gene locus_tag LOCUS_42470 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480716.1:MMPL family transporter 831 1640 gene locus_tag LOCUS_42480 831 1640 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_42480 1640 2881 gene locus_tag LOCUS_42490 1640 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_42490 2982 3734 gene locus_tag LOCUS_42500 2982 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 3731 4618 gene locus_tag LOCUS_42510 3731 4618 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815464.1 protein_id gnl|my_center|LOCUS_42510 4615 6237 gene locus_tag LOCUS_42520 4615 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 6613 6287 gene locus_tag LOCUS_42530 6613 6287 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085147429.1 protein_id gnl|my_center|LOCUS_42530 8117 6681 gene locus_tag LOCUS_42540 8117 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 >Feature sequence207 1939 989 gene locus_tag LOCUS_42550 1939 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 2828 1998 gene locus_tag LOCUS_42560 2828 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 4339 2852 gene locus_tag LOCUS_42570 4339 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 5348 4365 gene locus_tag LOCUS_42580 5348 4365 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397899.1 protein_id gnl|my_center|LOCUS_42580 6157 5420 gene locus_tag LOCUS_42590 6157 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 >Feature sequence208 67 807 gene locus_tag LOCUS_42600 gene trmD 67 807 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140891.1 protein_id gnl|my_center|LOCUS_42600 824 1177 gene locus_tag LOCUS_42610 gene rplS 824 1177 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640385.1 protein_id gnl|my_center|LOCUS_42610 1192 1425 gene locus_tag LOCUS_42620 1192 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 1422 2270 gene locus_tag LOCUS_42630 1422 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 2332 3522 gene locus_tag LOCUS_42640 2332 3522 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141151.1 protein_id gnl|my_center|LOCUS_42640 3519 4130 gene locus_tag LOCUS_42650 3519 4130 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141152.1 protein_id gnl|my_center|LOCUS_42650 6795 5248 gene locus_tag LOCUS_42660 6795 5248 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195435952.1 protein_id gnl|my_center|LOCUS_42660 7772 6921 gene locus_tag LOCUS_42670 7772 6921 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065652.1 protein_id gnl|my_center|LOCUS_42670 >Feature sequence209 3 491 gene locus_tag LOCUS_42680 3 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 562 3225 gene locus_tag LOCUS_42690 562 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 3314 5503 gene locus_tag LOCUS_42700 3314 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 7686 5596 gene locus_tag LOCUS_42710 7686 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 >Feature sequence210 2328 436 gene locus_tag LOCUS_42720 2328 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 4730 2637 gene locus_tag LOCUS_42730 4730 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 4626 4841 gene locus_tag LOCUS_42740 4626 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 5097 6800 gene locus_tag LOCUS_42750 5097 6800 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_42750 7213 6827 gene locus_tag LOCUS_42760 7213 6827 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921021.1 protein_id gnl|my_center|LOCUS_42760 >Feature sequence211 790 1608 gene locus_tag LOCUS_42770 790 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 1610 3289 gene locus_tag LOCUS_42780 1610 3289 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_42780 4480 3293 gene locus_tag LOCUS_42790 4480 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 5027 4575 gene locus_tag LOCUS_42800 5027 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 5152 7419 gene locus_tag LOCUS_42810 5152 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 >Feature sequence212 1597 2391 gene locus_tag LOCUS_42820 1597 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 3479 2397 gene locus_tag LOCUS_42830 3479 2397 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 protein_id gnl|my_center|LOCUS_42830 4866 3532 gene locus_tag LOCUS_42840 4866 3532 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205874.1 protein_id gnl|my_center|LOCUS_42840 5061 7199 gene locus_tag LOCUS_42850 5061 7199 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_42850 >Feature sequence213 5802 3835 gene locus_tag LOCUS_42860 5802 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 6359 5838 gene locus_tag LOCUS_42870 6359 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 6748 6359 gene locus_tag LOCUS_42880 6748 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 >Feature sequence214 1190 177 gene locus_tag LOCUS_42890 1190 177 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974020.1 protein_id gnl|my_center|LOCUS_42890 2108 1203 gene locus_tag LOCUS_42900 2108 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 2987 2136 gene locus_tag LOCUS_42910 2987 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 4139 3000 gene locus_tag LOCUS_42920 4139 3000 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050532079.1 protein_id gnl|my_center|LOCUS_42920 4213 5346 gene locus_tag LOCUS_42930 4213 5346 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_42930 5352 6272 gene locus_tag LOCUS_42940 5352 6272 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766711.1 protein_id gnl|my_center|LOCUS_42940 6288 6863 gene locus_tag LOCUS_42950 6288 6863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 >Feature sequence215 113 2452 gene locus_tag LOCUS_42960 113 2452 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202903.1 protein_id gnl|my_center|LOCUS_42960 2461 4467 gene locus_tag LOCUS_42970 2461 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 4469 5158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5234 6049 gene locus_tag LOCUS_42980 5234 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 6049 6858 gene locus_tag LOCUS_42990 6049 6858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_42990 >Feature sequence216 1426 1656 gene locus_tag LOCUS_43000 1426 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 1683 2429 gene locus_tag LOCUS_43010 1683 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 2469 3395 gene locus_tag LOCUS_43020 2469 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_43020 3464 4666 gene locus_tag LOCUS_43030 3464 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 4756 6168 gene locus_tag LOCUS_43040 4756 6168 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531815.1 protein_id gnl|my_center|LOCUS_43040 6170 6676 gene locus_tag LOCUS_43050 6170 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 6692 7255 gene locus_tag LOCUS_43060 6692 7255 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_43060 >Feature sequence217 844 1770 gene locus_tag LOCUS_43070 844 1770 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_43070 1781 3451 gene locus_tag LOCUS_43080 1781 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 5179 3461 gene locus_tag LOCUS_43090 5179 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 5577 6467 gene locus_tag LOCUS_43100 5577 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 >Feature sequence218 1950 544 gene locus_tag LOCUS_43110 1950 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 4350 2086 gene locus_tag LOCUS_43120 4350 2086 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_43120 4827 4660 gene locus_tag LOCUS_43130 4827 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 6787 4820 gene locus_tag LOCUS_43140 6787 4820 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_43140 >Feature sequence219 638 1738 gene locus_tag LOCUS_43150 638 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 1754 2452 gene locus_tag LOCUS_43160 1754 2452 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_43160 3753 2449 gene locus_tag LOCUS_43170 3753 2449 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_43170 4263 3754 gene locus_tag LOCUS_43180 4263 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 5128 4274 gene locus_tag LOCUS_43190 5128 4274 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272323.1 protein_id gnl|my_center|LOCUS_43190 5292 7013 gene locus_tag LOCUS_43200 gene araD 5292 7013 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 protein_id gnl|my_center|LOCUS_43200 >Feature sequence220 2306 933 gene locus_tag LOCUS_43210 2306 933 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_43210 3792 2413 gene locus_tag LOCUS_43220 3792 2413 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_43220 4084 5007 gene locus_tag LOCUS_43230 4084 5007 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_43230 5226 6962 gene locus_tag LOCUS_43240 5226 6962 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_43240 >Feature sequence221 64 1110 gene locus_tag LOCUS_43250 gene rlmN 64 1110 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546659.1 protein_id gnl|my_center|LOCUS_43250 1121 1642 gene locus_tag LOCUS_43260 1121 1642 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938305.1 protein_id gnl|my_center|LOCUS_43260 2029 1649 gene locus_tag LOCUS_43270 2029 1649 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020395.1 protein_id gnl|my_center|LOCUS_43270 2706 2056 gene locus_tag LOCUS_43280 2706 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 3004 4794 gene locus_tag LOCUS_43290 3004 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 6987 4798 gene locus_tag LOCUS_43300 6987 4798 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583490.1 protein_id gnl|my_center|LOCUS_43300 >Feature sequence222 1737 625 gene locus_tag LOCUS_43310 gene menC 1737 625 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_43310 2877 1738 gene locus_tag LOCUS_43320 2877 1738 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143938.1 protein_id gnl|my_center|LOCUS_43320 4164 2902 gene locus_tag LOCUS_43330 4164 2902 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_43330 4271 5077 gene locus_tag LOCUS_43340 4271 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 5810 5088 gene locus_tag LOCUS_43350 5810 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 6647 5844 gene locus_tag LOCUS_43360 6647 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 7048 6737 gene locus_tag LOCUS_43370 7048 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 >Feature sequence223 215 379 gene locus_tag LOCUS_43380 215 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 376 1416 gene locus_tag LOCUS_43390 376 1416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727033.1 protein_id gnl|my_center|LOCUS_43390 1971 3527 gene locus_tag LOCUS_43400 1971 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 3771 4790 gene locus_tag LOCUS_43410 3771 4790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967710.1 protein_id gnl|my_center|LOCUS_43410 4802 6724 gene locus_tag LOCUS_43420 4802 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 >Feature sequence224 595 329 gene locus_tag LOCUS_43430 595 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 897 1448 gene locus_tag LOCUS_43440 897 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 2058 1837 gene locus_tag LOCUS_43450 2058 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 2218 2508 gene locus_tag LOCUS_43460 2218 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 4048 5508 gene locus_tag LOCUS_43470 4048 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 5708 5929 gene locus_tag LOCUS_43480 5708 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 >Feature sequence225 1495 185 gene locus_tag LOCUS_43490 1495 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 2814 1570 gene locus_tag LOCUS_43500 2814 1570 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_43500 4177 2819 gene locus_tag LOCUS_43510 gene glnT 4177 2819 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_43510 5519 4170 gene locus_tag LOCUS_43520 5519 4170 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 protein_id gnl|my_center|LOCUS_43520 6219 5527 gene locus_tag LOCUS_43530 6219 5527 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_43530 >Feature sequence226 2080 3000 gene locus_tag LOCUS_43540 2080 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 3108 5030 gene locus_tag LOCUS_43550 3108 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 >Feature sequence227 575 1750 gene locus_tag LOCUS_43560 575 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 1959 2198 gene locus_tag LOCUS_43570 1959 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 2198 3658 gene locus_tag LOCUS_43580 2198 3658 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_43580 3669 4733 gene locus_tag LOCUS_43590 3669 4733 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_43590 4730 5836 gene locus_tag LOCUS_43600 4730 5836 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_43600 5910 6437 gene locus_tag LOCUS_43610 5910 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 >Feature sequence228 2617 677 gene locus_tag LOCUS_43620 2617 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 2562 2741 gene locus_tag LOCUS_43630 2562 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 2745 3896 gene locus_tag LOCUS_43640 2745 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 5350 3899 gene locus_tag LOCUS_43650 5350 3899 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_43650 >Feature sequence229 <1 647 gene locus_tag LOCUS_43660 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459825.1:D-glycerate dehydrogenase 801 1736 gene locus_tag LOCUS_43670 gene trxB 801 1736 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_43670 1740 2543 gene locus_tag LOCUS_43680 1740 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 3948 2503 gene locus_tag LOCUS_43690 3948 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 5009 3960 gene locus_tag LOCUS_43700 5009 3960 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258014.1 protein_id gnl|my_center|LOCUS_43700 5993 5019 gene locus_tag LOCUS_43710 5993 5019 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_43710 >Feature sequence230 134 2209 gene locus_tag LOCUS_43720 134 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 2833 2225 gene locus_tag LOCUS_43730 2833 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 3121 2903 gene locus_tag LOCUS_43740 3121 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 3191 4837 gene locus_tag LOCUS_43750 3191 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 >Feature sequence231 452 1051 gene locus_tag LOCUS_43760 452 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 2404 1076 gene locus_tag LOCUS_43770 2404 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086332.1 protein_id gnl|my_center|LOCUS_43770 4242 2404 gene locus_tag LOCUS_43780 4242 2404 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_43780 4364 4615 gene locus_tag LOCUS_43790 4364 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 4563 5735 gene locus_tag LOCUS_43800 4563 5735 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_43800 >Feature sequence232 171 1610 gene locus_tag LOCUS_43810 171 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 1653 2471 gene locus_tag LOCUS_43820 1653 2471 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_43820 2544 2912 gene locus_tag LOCUS_43830 2544 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 2920 4797 gene locus_tag LOCUS_43840 2920 4797 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172451083.1 protein_id gnl|my_center|LOCUS_43840 >Feature sequence233 1536 841 gene locus_tag LOCUS_43850 1536 841 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038679.1 protein_id gnl|my_center|LOCUS_43850 2168 1536 gene locus_tag LOCUS_43860 2168 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 3261 2155 gene locus_tag LOCUS_43870 3261 2155 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940269.1 protein_id gnl|my_center|LOCUS_43870 3404 4651 gene locus_tag LOCUS_43880 gene ispG 3404 4651 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_43880 4888 5106 gene locus_tag LOCUS_43890 4888 5106 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_43890 5124 5330 gene locus_tag LOCUS_43900 5124 5330 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_43900 >Feature sequence234 2979 1429 gene locus_tag LOCUS_43910 2979 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 >Feature sequence235 3067 2054 gene locus_tag LOCUS_43920 3067 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 5491 3329 gene locus_tag LOCUS_43930 5491 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 >Feature sequence236 3342 1267 gene locus_tag LOCUS_43940 3342 1267 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_43940 4994 3339 gene locus_tag LOCUS_43950 4994 3339 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_43950 5108 5683 gene locus_tag LOCUS_43960 5108 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 >Feature sequence237 398 1258 gene locus_tag LOCUS_43970 398 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 1255 1617 gene locus_tag LOCUS_43980 1255 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 1734 2711 gene locus_tag LOCUS_43990 1734 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 4177 2723 gene locus_tag LOCUS_44000 4177 2723 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_44000 5324 4185 gene locus_tag LOCUS_44010 5324 4185 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_44010 <6001 5445 gene locus_tag LOCUS_44020 <6001 5445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048106.1:glycosyltransferase family 4 protein >Feature sequence238 1398 3398 gene locus_tag LOCUS_44030 1398 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 4200 3409 gene locus_tag LOCUS_44040 4200 3409 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_44040 5279 4230 gene locus_tag LOCUS_44050 5279 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 <5957 5293 gene locus_tag LOCUS_44060 <5957 5293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815464.1:MBL fold metallo-hydrolase >Feature sequence239 3563 2907 gene locus_tag LOCUS_44070 3563 2907 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256517.1 protein_id gnl|my_center|LOCUS_44070 3730 3803 gene locus_tag LOCUS_t00370 3730 3803 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3909 5381 gene locus_tag LOCUS_44080 3909 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 5731 5354 gene locus_tag LOCUS_44090 gene gloA 5731 5354 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017084654.1 protein_id gnl|my_center|LOCUS_44090 >Feature sequence240 156 1436 gene locus_tag LOCUS_44100 156 1436 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_44100 4749 1477 gene locus_tag LOCUS_44110 4749 1477 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_44110 5411 4734 gene locus_tag LOCUS_44120 gene lolD 5411 4734 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_44120 >Feature sequence241 <1 777 gene locus_tag LOCUS_44130 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403744.1:prolipoprotein diacylglyceryl transferase 1913 816 gene locus_tag LOCUS_44140 1913 816 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_44140 2184 1936 gene locus_tag LOCUS_44150 2184 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 2281 2512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3773 2532 gene locus_tag LOCUS_44160 3773 2532 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_44160 4480 3770 gene locus_tag LOCUS_44170 4480 3770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_44170 5359 4493 gene locus_tag LOCUS_44180 5359 4493 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559203.1 protein_id gnl|my_center|LOCUS_44180 >Feature sequence242 2021 4666 gene locus_tag LOCUS_44190 2021 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 >Feature sequence243 3027 244 gene locus_tag LOCUS_44200 3027 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 5247 3088 gene locus_tag LOCUS_44210 5247 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 >Feature sequence244 202 1083 gene locus_tag LOCUS_44220 202 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 1124 2344 gene locus_tag LOCUS_44230 1124 2344 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_44230 3579 2443 gene locus_tag LOCUS_44240 3579 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 3890 5350 gene locus_tag LOCUS_44250 3890 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 >Feature sequence245 <1 1103 gene locus_tag LOCUS_44260 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942268.1:FAD-linked oxidase C-terminal domain-containing protein 1100 2422 gene locus_tag LOCUS_44270 1100 2422 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_44270 2422 2766 gene locus_tag LOCUS_44280 2422 2766 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764989.1 protein_id gnl|my_center|LOCUS_44280 2773 3084 gene locus_tag LOCUS_44290 2773 3084 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_44290 3071 3430 gene locus_tag LOCUS_44300 3071 3430 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_44300 3434 4195 gene locus_tag LOCUS_44310 3434 4195 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_44310 4391 5350 gene locus_tag LOCUS_44320 4391 5350 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_44320 >Feature sequence246 2092 221 gene locus_tag LOCUS_44330 2092 221 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403544.1 protein_id gnl|my_center|LOCUS_44330 2914 2165 gene locus_tag LOCUS_44340 2914 2165 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869867.1 protein_id gnl|my_center|LOCUS_44340 3050 4084 gene locus_tag LOCUS_44350 3050 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 4160 4690 gene locus_tag LOCUS_44360 4160 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 4668 5168 gene locus_tag LOCUS_44370 4668 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 >Feature sequence247 1324 410 gene locus_tag LOCUS_44380 1324 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 1438 2169 gene locus_tag LOCUS_44390 1438 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 3152 2250 gene locus_tag LOCUS_44400 3152 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 >Feature sequence248 1507 74 gene locus_tag LOCUS_44410 1507 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 1606 3012 gene locus_tag LOCUS_44420 1606 3012 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814037.1 protein_id gnl|my_center|LOCUS_44420 3039 4487 gene locus_tag LOCUS_44430 gene purB 3039 4487 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_44430 4493 5227 gene locus_tag LOCUS_44440 gene pyrH 4493 5227 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248055.1 protein_id gnl|my_center|LOCUS_44440 >Feature sequence249 <1 551 gene locus_tag LOCUS_44450 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121414.1:phytanoyl-CoA dioxygenase family protein 766 548 gene locus_tag LOCUS_44460 766 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 740 1366 gene locus_tag LOCUS_44470 740 1366 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908611.1 protein_id gnl|my_center|LOCUS_44470 1363 2151 gene locus_tag LOCUS_44480 1363 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 2178 2921 gene locus_tag LOCUS_44490 2178 2921 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225189.1 protein_id gnl|my_center|LOCUS_44490 4741 2981 gene locus_tag LOCUS_44500 4741 2981 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141672.1 protein_id gnl|my_center|LOCUS_44500 >Feature sequence250 <1 722 gene locus_tag LOCUS_44510 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087473.1:nucleoside hydrolase 1173 673 gene locus_tag LOCUS_44520 1173 673 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_44520 1660 1166 gene locus_tag LOCUS_44530 1660 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 1751 4234 gene locus_tag LOCUS_44540 1751 4234 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786535.1 protein_id gnl|my_center|LOCUS_44540 4209 4814 gene locus_tag LOCUS_44550 4209 4814 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_44550 >Feature sequence251 756 1 gene locus_tag LOCUS_44560 756 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 1796 753 gene locus_tag LOCUS_44570 1796 753 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090310.1 protein_id gnl|my_center|LOCUS_44570 3470 1872 gene locus_tag LOCUS_44580 3470 1872 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_44580 3689 3943 gene locus_tag LOCUS_44590 3689 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 3982 4539 gene locus_tag LOCUS_44600 3982 4539 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929177.1 protein_id gnl|my_center|LOCUS_44600 5052 4588 gene locus_tag LOCUS_44610 5052 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 >Feature sequence252 372 641 gene locus_tag LOCUS_44620 372 641 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301196.1 protein_id gnl|my_center|LOCUS_44620 653 955 gene locus_tag LOCUS_44630 653 955 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259549.1 protein_id gnl|my_center|LOCUS_44630 1016 1465 gene locus_tag LOCUS_44640 1016 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 2125 1472 gene locus_tag LOCUS_44650 2125 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 2284 3060 gene locus_tag LOCUS_44660 2284 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 3088 4182 gene locus_tag LOCUS_44670 3088 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 >Feature sequence253 1796 225 gene locus_tag LOCUS_44680 1796 225 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_44680 2709 1915 gene locus_tag LOCUS_44690 2709 1915 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_44690 4401 2851 gene locus_tag LOCUS_44700 4401 2851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_44700 <5090 4459 gene locus_tag LOCUS_44710 <5090 4459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021352.1:NAD(P)-dependent oxidoreductase >Feature sequence254 104 2407 gene locus_tag LOCUS_44720 104 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 2531 4294 gene locus_tag LOCUS_44730 2531 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 <5085 4402 gene locus_tag LOCUS_44740 <5085 4402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068541.1:DUF4143 domain-containing protein >Feature sequence255 994 557 gene locus_tag LOCUS_44750 994 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 1909 1160 gene locus_tag LOCUS_44760 1909 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085649.1 protein_id gnl|my_center|LOCUS_44760 3714 2287 gene locus_tag LOCUS_44770 3714 2287 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_44770 4953 4087 gene locus_tag LOCUS_44780 4953 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 >Feature sequence256 1554 544 gene locus_tag LOCUS_44790 1554 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 2097 1630 gene locus_tag LOCUS_44800 2097 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 2377 3687 gene locus_tag LOCUS_44810 2377 3687 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_44810 >Feature sequence257 318 1163 gene locus_tag LOCUS_44820 318 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 1461 1093 gene locus_tag LOCUS_44830 1461 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 1615 1899 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1978 2154 gene locus_tag LOCUS_44840 1978 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 2151 2627 gene locus_tag LOCUS_44850 2151 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 2624 3877 gene locus_tag LOCUS_44860 2624 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 <5054 3904 gene locus_tag LOCUS_44870 <5054 3904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804187.1:McrBC 5-methylcytosine restriction system component >Feature sequence258 1100 27 gene locus_tag LOCUS_44880 1100 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 2397 1171 gene locus_tag LOCUS_44890 2397 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 4771 2432 gene locus_tag LOCUS_44900 4771 2432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_44900 >Feature sequence259 604 161 gene locus_tag LOCUS_44910 604 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 1230 748 gene locus_tag LOCUS_44920 1230 748 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_44920 1913 1320 gene locus_tag LOCUS_44930 1913 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 2846 2343 gene locus_tag LOCUS_44940 2846 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 3781 2909 gene locus_tag LOCUS_44950 3781 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 4728 4096 gene locus_tag LOCUS_44960 4728 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 >Feature sequence260 3 590 gene locus_tag LOCUS_44970 3 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 744 1541 gene locus_tag LOCUS_44980 744 1541 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929880.1 protein_id gnl|my_center|LOCUS_44980 1538 2695 gene locus_tag LOCUS_44990 1538 2695 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056527.1 protein_id gnl|my_center|LOCUS_44990 2750 3508 gene locus_tag LOCUS_45000 2750 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 4648 3569 gene locus_tag LOCUS_45010 4648 3569 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_45010 >Feature sequence261 2338 1601 gene locus_tag LOCUS_45020 2338 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 3333 2425 gene locus_tag LOCUS_45030 3333 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 >Feature sequence262 <1 1918 gene locus_tag LOCUS_45040 <1 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010884100.1:KAP family P-loop domain protein 1919 2770 gene locus_tag LOCUS_45050 1919 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 2767 4038 gene locus_tag LOCUS_45060 2767 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_45060 4035 4763 gene locus_tag LOCUS_45070 4035 4763 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_45070 >Feature sequence263 494 2773 gene locus_tag LOCUS_45080 494 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 >Feature sequence264 921 1736 gene locus_tag LOCUS_45090 921 1736 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085046.1 protein_id gnl|my_center|LOCUS_45090 2464 1733 gene locus_tag LOCUS_45100 2464 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 2706 2479 gene locus_tag LOCUS_45110 2706 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 >Feature sequence265 108 341 gene locus_tag LOCUS_45120 108 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 414 1067 gene locus_tag LOCUS_45130 414 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 2559 1156 gene locus_tag LOCUS_45140 2559 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 3415 2573 gene locus_tag LOCUS_45150 3415 2573 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_45150 3595 4359 gene locus_tag LOCUS_45160 3595 4359 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809261.1 protein_id gnl|my_center|LOCUS_45160 >Feature sequence266 492 1679 gene locus_tag LOCUS_45170 492 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 1676 3310 gene locus_tag LOCUS_45180 1676 3310 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_45180 3625 4056 gene locus_tag LOCUS_45190 gene hicB 3625 4056 CDS product type II toxin-antitoxin system antitoxin HicB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077627724.1 protein_id gnl|my_center|LOCUS_45190 4125 4472 gene locus_tag LOCUS_45200 4125 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 >Feature sequence267 <1 965 gene locus_tag LOCUS_45210 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227641.1:polyprenyl synthetase family protein 2017 962 gene locus_tag LOCUS_45220 2017 962 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088971.1 protein_id gnl|my_center|LOCUS_45220 2714 2106 gene locus_tag LOCUS_45230 2714 2106 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_45230 2977 3582 gene locus_tag LOCUS_45240 2977 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 3584 4126 gene locus_tag LOCUS_45250 gene rfbC 3584 4126 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_45250 4166 4681 gene locus_tag LOCUS_45260 gene pyrE 4166 4681 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_45260 >Feature sequence268 <1 1119 gene locus_tag LOCUS_45270 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255994.1:glycosyltransferase family 1 protein 2182 1151 gene locus_tag LOCUS_45280 2182 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45280 3513 2173 gene locus_tag LOCUS_45290 3513 2173 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892321.1 protein_id gnl|my_center|LOCUS_45290 4169 3588 gene locus_tag LOCUS_45300 4169 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 4576 4181 gene locus_tag LOCUS_45310 4576 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 >Feature sequence269 1397 162 gene locus_tag LOCUS_45320 1397 162 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_45320 1470 2018 gene locus_tag LOCUS_45330 1470 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 3089 2046 gene locus_tag LOCUS_45340 3089 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 4471 3359 gene locus_tag LOCUS_45350 gene citA 4471 3359 CDS product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 protein_id gnl|my_center|LOCUS_45350 >Feature sequence270 1283 894 gene locus_tag LOCUS_45360 1283 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 >Feature sequence271 524 1354 gene locus_tag LOCUS_45370 524 1354 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525325.1 protein_id gnl|my_center|LOCUS_45370 1416 3398 gene locus_tag LOCUS_45380 1416 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 >Feature sequence272 <1 1876 gene locus_tag LOCUS_45390 <1 1876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:PKD domain-containing protein 2030 2320 gene locus_tag LOCUS_45400 2030 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 2317 3564 gene locus_tag LOCUS_45410 2317 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 >Feature sequence273 52 936 gene locus_tag LOCUS_45420 52 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 2097 2772 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence274 2224 965 gene locus_tag LOCUS_45430 2224 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 3601 2237 gene locus_tag LOCUS_45440 3601 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 4124 3636 gene locus_tag LOCUS_45450 4124 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393800.1 protein_id gnl|my_center|LOCUS_45450 >Feature sequence275 21 2186 gene locus_tag LOCUS_45460 21 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 2296 4461 gene locus_tag LOCUS_45470 2296 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 >Feature sequence276 <1 882 gene locus_tag LOCUS_45480 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837931.1:Ig-like domain-containing protein 1326 883 gene locus_tag LOCUS_45490 1326 883 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_45490 1459 1752 gene locus_tag LOCUS_45500 1459 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 1835 3466 gene locus_tag LOCUS_45510 1835 3466 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227162.1 protein_id gnl|my_center|LOCUS_45510 >Feature sequence277 <1 1586 gene locus_tag LOCUS_45520 <1 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089344.1:glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase 2450 1602 gene locus_tag LOCUS_45530 2450 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 3542 2499 gene locus_tag LOCUS_45540 3542 2499 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_45540 3662 3970 gene locus_tag LOCUS_45550 3662 3970 CDS product chorismate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241439.1 protein_id gnl|my_center|LOCUS_45550 >Feature sequence278 3173 1920 gene locus_tag LOCUS_45560 3173 1920 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229037.1 protein_id gnl|my_center|LOCUS_45560 >Feature sequence279 2002 989 gene locus_tag LOCUS_45570 2002 989 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_45570 3528 1999 gene locus_tag LOCUS_45580 gene cobA 3528 1999 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_45580 <4366 3528 gene locus_tag LOCUS_45590 <4366 3528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000141022.1:hydroxymethylbilane synthase >Feature sequence280 2069 786 gene locus_tag LOCUS_45600 2069 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 2485 2333 gene locus_tag LOCUS_45610 2485 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 2806 2486 gene locus_tag LOCUS_45620 2806 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 3204 2809 gene locus_tag LOCUS_45630 3204 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 >Feature sequence281 253 879 gene locus_tag LOCUS_45640 gene rpsD 253 879 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_45640 923 1939 gene locus_tag LOCUS_45650 923 1939 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_45650 1942 2367 gene locus_tag LOCUS_45660 1942 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 2446 3804 gene locus_tag LOCUS_45670 gene rlmD 2446 3804 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_45670 >Feature sequence282 <1 1031 gene locus_tag LOCUS_45680 <1 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942668.1:3-dehydroquinate synthase 1033 2352 gene locus_tag LOCUS_45690 gene rimO 1033 2352 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_45690 2349 2666 gene locus_tag LOCUS_45700 2349 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 >Feature sequence283 374 1300 gene locus_tag LOCUS_45710 374 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 2783 3313 gene locus_tag LOCUS_45720 2783 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45720 3324 3485 gene locus_tag LOCUS_45730 3324 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 >Feature sequence284 3838 1979 gene locus_tag LOCUS_45740 3838 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 >Feature sequence285 370 1701 gene locus_tag LOCUS_45750 370 1701 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_45750 1698 2429 gene locus_tag LOCUS_45760 1698 2429 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931863.1 protein_id gnl|my_center|LOCUS_45760 2804 2457 gene locus_tag LOCUS_45770 2804 2457 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_45770 <4180 2829 gene locus_tag LOCUS_45780 <4180 2829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403170.1:TonB-dependent receptor >Feature sequence286 1618 1241 gene locus_tag LOCUS_45790 1618 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 1772 2908 gene locus_tag LOCUS_45800 1772 2908 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837907.1 protein_id gnl|my_center|LOCUS_45800 >Feature sequence287 2160 1390 gene locus_tag LOCUS_45810 2160 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 2262 2778 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence288 <1 737 gene locus_tag LOCUS_45820 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938513.1:MATE family efflux transporter 1727 741 gene locus_tag LOCUS_45830 1727 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 1841 3181 gene locus_tag LOCUS_45840 1841 3181 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_45840 3879 3178 gene locus_tag LOCUS_45850 3879 3178 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975034.1 protein_id gnl|my_center|LOCUS_45850 >Feature sequence289 1655 1218 gene locus_tag LOCUS_45860 1655 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 1731 2226 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence290 294 1286 gene locus_tag LOCUS_45870 gene msrP 294 1286 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_45870 1307 1969 gene locus_tag LOCUS_45880 1307 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 2136 3371 gene locus_tag LOCUS_45890 2136 3371 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_45890 >Feature sequence291 <1 1019 gene locus_tag LOCUS_45900 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967152.1:glycosyltransferase family 41 protein 2331 1030 gene locus_tag LOCUS_45910 2331 1030 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_45910 3698 2328 gene locus_tag LOCUS_45920 3698 2328 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_45920 >Feature sequence292 520 395 gene locus_tag LOCUS_45930 520 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 >Feature sequence293 582 1439 gene locus_tag LOCUS_45940 582 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 1436 2899 gene locus_tag LOCUS_45950 1436 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 2896 3750 gene locus_tag LOCUS_45960 2896 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 >Feature sequence294 416 3082 gene locus_tag LOCUS_45970 416 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 >Feature sequence295 2092 266 gene locus_tag LOCUS_45980 2092 266 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922207.1 protein_id gnl|my_center|LOCUS_45980 2264 3286 gene locus_tag LOCUS_45990 2264 3286 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_45990 >Feature sequence296 <1 512 gene locus_tag LOCUS_46000 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016769.1:gamma-glutamyltransferase 513 1661 gene locus_tag LOCUS_46010 513 1661 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 protein_id gnl|my_center|LOCUS_46010 1654 2886 gene locus_tag LOCUS_46020 1654 2886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_46020 2886 3701 gene locus_tag LOCUS_46030 2886 3701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_46030 >Feature sequence297 1049 720 gene locus_tag LOCUS_46040 1049 720 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_46040 >Feature sequence298 508 2034 gene locus_tag LOCUS_46050 508 2034 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_46050 2139 3068 gene locus_tag LOCUS_46060 2139 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 3184 3459 gene locus_tag LOCUS_46070 3184 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 3456 3671 gene locus_tag LOCUS_46080 3456 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 >Feature sequence299 131 883 gene locus_tag LOCUS_46090 131 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 1734 1108 gene locus_tag LOCUS_46100 1734 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 1867 2652 gene locus_tag LOCUS_46110 1867 2652 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170039298.1 protein_id gnl|my_center|LOCUS_46110 >Feature sequence300 <1 621 gene locus_tag LOCUS_46120 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583893.1:nickel pincer cofactor biosynthesis protein LarC 621 1382 gene locus_tag LOCUS_46130 621 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 1458 2447 gene locus_tag LOCUS_46140 1458 2447 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_46140 >Feature sequence301 850 410 gene locus_tag LOCUS_46150 850 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 1259 2164 gene locus_tag LOCUS_46160 1259 2164 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_46160 2158 3036 gene locus_tag LOCUS_46170 2158 3036 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_46170 <3673 3099 gene locus_tag LOCUS_46180 <3673 3099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384442.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence302 2080 353 gene locus_tag LOCUS_46190 2080 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 >Feature sequence303 372 229 gene locus_tag LOCUS_46200 372 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 1061 345 gene locus_tag LOCUS_46210 1061 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 3013 1076 gene locus_tag LOCUS_46220 3013 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_46220 >Feature sequence304 <1 1093 gene locus_tag LOCUS_46230 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202162.1:TonB-dependent receptor 1254 2552 gene locus_tag LOCUS_46240 1254 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 3035 2652 gene locus_tag LOCUS_46250 3035 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 3255 3025 gene locus_tag LOCUS_46260 3255 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 >Feature sequence305 1413 580 gene locus_tag LOCUS_46270 1413 580 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_46270 1651 1496 gene locus_tag LOCUS_46280 1651 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 2563 1703 gene locus_tag LOCUS_46290 2563 1703 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_46290 3401 2688 gene locus_tag LOCUS_46300 gene rph 3401 2688 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_46300 >Feature sequence306 921 2540 gene locus_tag LOCUS_46310 921 2540 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_46310 <3576 2543 gene locus_tag LOCUS_46320 <3576 2543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929319.1:tetratricopeptide repeat protein >Feature sequence307 <1 3416 gene locus_tag LOCUS_46330 <1 3416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC >Feature sequence308 >Feature sequence309 <1 1016 gene locus_tag LOCUS_46340 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814129.1:catalase/peroxidase HPI 2112 1141 gene locus_tag LOCUS_46350 2112 1141 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531039.1 protein_id gnl|my_center|LOCUS_46350 2323 3282 gene locus_tag LOCUS_46360 2323 3282 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 protein_id gnl|my_center|LOCUS_46360 >Feature sequence310 189 1442 gene locus_tag LOCUS_46370 189 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 1439 1705 gene locus_tag LOCUS_46380 1439 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 1966 1778 gene locus_tag LOCUS_46390 1966 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 2366 1980 gene locus_tag LOCUS_46400 2366 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 3343 2363 gene locus_tag LOCUS_46410 3343 2363 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_46410 >Feature sequence311 452 54 gene locus_tag LOCUS_46420 452 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 1305 712 gene locus_tag LOCUS_46430 1305 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 1420 3393 gene locus_tag LOCUS_46440 1420 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 >Feature sequence312 1529 675 gene locus_tag LOCUS_46450 gene atpG 1529 675 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_46450 3065 1533 gene locus_tag LOCUS_46460 gene atpA 3065 1533 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_46460 >Feature sequence313 1322 486 gene locus_tag LOCUS_46470 1322 486 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_46470 1804 2124 gene locus_tag LOCUS_46480 1804 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 >Feature sequence314 728 54 gene locus_tag LOCUS_46490 gene rpiA 728 54 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049992.1 protein_id gnl|my_center|LOCUS_46490 1208 741 gene locus_tag LOCUS_46500 1208 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 <3243 1214 gene locus_tag LOCUS_46510 <3243 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064921.1:indolepyruvate ferredoxin oxidoreductase family protein >Feature sequence315 1555 764 gene locus_tag LOCUS_46520 1555 764 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_46520 1995 1600 gene locus_tag LOCUS_46530 1995 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 >Feature sequence316 1 1812 gene locus_tag LOCUS_46540 1 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 1837 2817 gene locus_tag LOCUS_46550 1837 2817 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_46550 >Feature sequence317 1146 379 gene locus_tag LOCUS_46560 1146 379 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_46560 1876 1139 gene locus_tag LOCUS_46570 1876 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 2295 1888 gene locus_tag LOCUS_46580 2295 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 >Feature sequence318 701 1792 gene locus_tag LOCUS_46590 701 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 <3126 1789 gene locus_tag LOCUS_46600 <3126 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405097.1:AMP-dependent synthetase/ligase >Feature sequence319 1999 1088 gene locus_tag LOCUS_46610 1999 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 >Feature sequence320 1236 124 gene locus_tag LOCUS_46620 1236 124 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_46620 2866 1238 gene locus_tag LOCUS_46630 2866 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 >Feature sequence321 >Feature sequence322 1775 936 gene locus_tag LOCUS_46640 1775 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 <3013 1853 gene locus_tag LOCUS_46650 <3013 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002675346.1:sigma-54 dependent transcriptional regulator >Feature sequence323 3 623 gene locus_tag LOCUS_46660 3 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 >Feature sequence324 708 121 gene locus_tag LOCUS_46670 708 121 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_46670 2187 724 gene locus_tag LOCUS_46680 2187 724 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530716.1 protein_id gnl|my_center|LOCUS_46680 >Feature sequence325 104 1660 gene locus_tag LOCUS_46690 gene xylB 104 1660 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 protein_id gnl|my_center|LOCUS_46690 1782 2693 gene locus_tag LOCUS_46700 gene dapA 1782 2693 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691466.1 protein_id gnl|my_center|LOCUS_46700 2952 2725 gene locus_tag LOCUS_46710 2952 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 >Feature sequence326 1605 604 gene locus_tag LOCUS_46720 1605 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 2434 1625 gene locus_tag LOCUS_46730 2434 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 <2954 2431 gene locus_tag LOCUS_46740 <2954 2431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940530.1:tetratricopeptide repeat protein >Feature sequence327 170 2398 gene locus_tag LOCUS_46750 170 2398 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_46750 >Feature sequence328 993 226 gene locus_tag LOCUS_46760 993 226 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933511.1 protein_id gnl|my_center|LOCUS_46760 <2891 1003 gene locus_tag LOCUS_46770 <2891 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941243.1:pyruvate, phosphate dikinase >Feature sequence329 1545 2582 gene locus_tag LOCUS_46780 1545 2582 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704793.1 protein_id gnl|my_center|LOCUS_46780 >Feature sequence330 652 957 gene locus_tag LOCUS_46790 652 957 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_46790 >Feature sequence331 >Feature sequence332 784 860 gene locus_tag LOCUS_t00380 784 860 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 878 953 gene locus_tag LOCUS_t00390 878 953 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence333 384 2189 gene locus_tag LOCUS_46800 384 2189 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695320.1 protein_id gnl|my_center|LOCUS_46800 >Feature sequence334 1625 738 gene locus_tag LOCUS_46810 gene lipA 1625 738 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258693.1 protein_id gnl|my_center|LOCUS_46810 >Feature sequence335 <1 716 gene locus_tag LOCUS_46820 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776891.1:sugar phosphate isomerase/epimerase 718 2469 gene locus_tag LOCUS_46830 718 2469 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_46830 >Feature sequence336 <1 1895 gene locus_tag LOCUS_46840 <1 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398682.1:ABC transporter permease YtrF 2726 1899 gene locus_tag LOCUS_46850 2726 1899 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_46850 >Feature sequence337 877 2142 gene locus_tag LOCUS_46860 877 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 >Feature sequence338 557 339 gene locus_tag LOCUS_46870 557 339 CDS product SWIB complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871818.1 protein_id gnl|my_center|LOCUS_46870 583 921 gene locus_tag LOCUS_46880 583 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 1218 1997 gene locus_tag LOCUS_46890 gene proC 1218 1997 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_46890 1994 2596 gene locus_tag LOCUS_46900 gene hisH 1994 2596 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817212.1 protein_id gnl|my_center|LOCUS_46900 >Feature sequence339 >Feature sequence340 1201 314 gene locus_tag LOCUS_46910 gene ubiA 1201 314 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_46910 2011 1214 gene locus_tag LOCUS_46920 2011 1214 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_46920 <2684 2008 gene locus_tag LOCUS_46930 <2684 2008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921709.1:cyclic dehypoxanthinyl futalosine synthase >Feature sequence341 >Feature sequence342 365 24 gene locus_tag LOCUS_46940 365 24 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404129.1 protein_id gnl|my_center|LOCUS_46940 1248 472 gene locus_tag LOCUS_46950 gene mreC 1248 472 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_46950 2274 1255 gene locus_tag LOCUS_46960 2274 1255 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404386.1 protein_id gnl|my_center|LOCUS_46960 >Feature sequence343 >Feature sequence344 3 197 gene locus_tag LOCUS_46970 3 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 239 2455 gene locus_tag LOCUS_46980 239 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 >Feature sequence345 1613 36 gene locus_tag LOCUS_46990 1613 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46990 >Feature sequence346 <1 858 gene locus_tag LOCUS_47000 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792562.1:hemolysin family protein 938 2020 gene locus_tag LOCUS_47010 gene carA 938 2020 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_47010 >Feature sequence347 614 1324 gene locus_tag LOCUS_47020 614 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 1334 2146 gene locus_tag LOCUS_47030 1334 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 2139 2462 gene locus_tag LOCUS_47040 2139 2462 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_47040 >Feature sequence348 1537 197 gene locus_tag LOCUS_47050 1537 197 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255954.1 protein_id gnl|my_center|LOCUS_47050 >Feature sequence349 2183 873 gene locus_tag LOCUS_47060 2183 873 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_47060 2565 2191 gene locus_tag LOCUS_47070 2565 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 >Feature sequence350 1 651 gene locus_tag LOCUS_47080 1 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 829 1068 gene locus_tag LOCUS_47090 829 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 1065 1484 gene locus_tag LOCUS_47100 1065 1484 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_47100 >Feature sequence351 <1 1142 gene locus_tag LOCUS_47110 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924857.1:tetratricopeptide repeat protein >Feature sequence352 >Feature sequence353 1648 209 gene locus_tag LOCUS_47120 1648 209 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_47120 >Feature sequence354 878 456 gene locus_tag LOCUS_47130 878 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 2052 985 gene locus_tag LOCUS_47140 2052 985 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_47140 >Feature sequence355 >Feature sequence356 <1 2322 gene locus_tag LOCUS_47150 <1 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000735285.1:outer membrane channel protein TolC >Feature sequence357 1854 922 gene locus_tag LOCUS_47160 1854 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 >Feature sequence358 1641 1075 gene locus_tag LOCUS_47170 1641 1075 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_47170 2291 1638 gene locus_tag LOCUS_47180 2291 1638 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037712.1 protein_id gnl|my_center|LOCUS_47180 >Feature sequence359 <1 611 gene locus_tag LOCUS_47190 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932061.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence360 1152 148 gene locus_tag LOCUS_47200 1152 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 1289 2263 gene locus_tag LOCUS_47210 1289 2263 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615657.1 protein_id gnl|my_center|LOCUS_47210 >Feature sequence361 <1 992 gene locus_tag LOCUS_47220 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_030865419.1:ATP-binding cassette domain-containing protein 1545 1144 gene locus_tag LOCUS_47230 1545 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 <2354 1549 gene locus_tag LOCUS_47240 <2354 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393855.1:F0F1 ATP synthase subunit beta >Feature sequence362 684 1499 gene locus_tag LOCUS_47250 684 1499 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_47250 >Feature sequence363 1561 335 gene locus_tag LOCUS_47260 1561 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 >Feature sequence364 >Feature sequence365 144 1277 gene locus_tag LOCUS_47270 144 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 1335 1952 gene locus_tag LOCUS_47280 1335 1952 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_47280 >Feature sequence366 1267 419 gene locus_tag LOCUS_47290 1267 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 1404 1994 gene locus_tag LOCUS_47300 1404 1994 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_47300 >Feature sequence367 >Feature sequence368 1753 149 gene locus_tag LOCUS_47310 1753 149 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_47310 >Feature sequence369 1222 437 gene locus_tag LOCUS_47320 1222 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 >Feature sequence370 1475 561 gene locus_tag LOCUS_47330 1475 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 >Feature sequence371 <2221 910 gene locus_tag LOCUS_47340 <2221 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037293.1:efflux RND transporter permease subunit >Feature sequence372 1767 58 gene locus_tag LOCUS_47350 1767 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 >Feature sequence373 <1 1763 gene locus_tag LOCUS_47360 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837966.1:TonB-dependent receptor >Feature sequence374 134 1507 gene locus_tag LOCUS_47370 gene nrfD 134 1507 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_47370 1520 2065 gene locus_tag LOCUS_47380 1520 2065 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_47380 >Feature sequence375 454 1620 gene locus_tag LOCUS_47390 454 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 1917 1630 gene locus_tag LOCUS_47400 1917 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_47400 >Feature sequence376 >Feature sequence377 <1 2007 gene locus_tag LOCUS_47410 <1 2007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929192.1:TonB-dependent receptor >Feature sequence378 >Feature sequence379 163 903 gene locus_tag LOCUS_47420 163 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 1457 1281 gene locus_tag LOCUS_47430 1457 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 >Feature sequence380 832 1704 gene locus_tag LOCUS_47440 832 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 >Feature sequence381 722 1567 gene locus_tag LOCUS_47450 722 1567 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173962.1 protein_id gnl|my_center|LOCUS_47450 >Feature sequence382 <1 930 gene locus_tag LOCUS_47460 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048141058.1:PKD domain-containing protein >Feature sequence383 >Feature sequence384 1018 179 gene locus_tag LOCUS_47470 1018 179 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_47470 >Feature sequence385 530 1744 gene locus_tag LOCUS_47480 530 1744 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207603.1 protein_id gnl|my_center|LOCUS_47480 >Feature sequence386 1097 462 gene locus_tag LOCUS_47490 1097 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 1898 1104 gene locus_tag LOCUS_47500 1898 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 >Feature sequence387 <1 1892 gene locus_tag LOCUS_47510 <1 1892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein >Feature sequence388 <1 1068 gene locus_tag LOCUS_47520 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232020.1:signal recognition particle protein 1094 1561 gene locus_tag LOCUS_47530 1094 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 >Feature sequence389 997 524 gene locus_tag LOCUS_47540 997 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 >Feature sequence390 >Feature sequence391 <1 1026 gene locus_tag LOCUS_47550 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein 1049 1963 gene locus_tag LOCUS_47560 1049 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 >Feature sequence392 >Feature sequence393 155 610 gene locus_tag LOCUS_47570 155 610 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_47570 >Feature sequence394 1808 981 gene locus_tag LOCUS_47580 1808 981 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_47580 >Feature sequence395 203 1612 gene locus_tag LOCUS_47590 203 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 >Feature sequence396 1621 779 gene locus_tag LOCUS_47600 1621 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 >Feature sequence397 1590 1432 gene locus_tag LOCUS_47610 1590 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610