>Feature sequence001 211 648 gene locus_tag LOCUS_00010 211 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 666 1829 gene locus_tag LOCUS_00020 666 1829 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356285.1 protein_id gnl|my_center|LOCUS_00020 2943 1915 gene locus_tag LOCUS_00030 2943 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3066 3899 gene locus_tag LOCUS_00040 3066 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3903 5111 gene locus_tag LOCUS_00050 3903 5111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5089 5805 gene locus_tag LOCUS_00060 5089 5805 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494826.1 protein_id gnl|my_center|LOCUS_00060 6369 5857 gene locus_tag LOCUS_00070 6369 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6591 6418 gene locus_tag LOCUS_00080 6591 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6967 7869 gene locus_tag LOCUS_00090 gene ftsY 6967 7869 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_00090 7908 8819 gene locus_tag LOCUS_00100 gene murB 7908 8819 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_00100 8820 10286 gene locus_tag LOCUS_00110 8820 10286 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048305.1 protein_id gnl|my_center|LOCUS_00110 10293 12107 gene locus_tag LOCUS_00120 10293 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12127 12618 gene locus_tag LOCUS_00130 gene ruvC 12127 12618 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_00130 12811 14217 gene locus_tag LOCUS_00140 12811 14217 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_00140 14253 15122 gene locus_tag LOCUS_00150 gene rfbD 14253 15122 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_00150 15122 15988 gene locus_tag LOCUS_00160 gene rfbA 15122 15988 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_00160 15990 16571 gene locus_tag LOCUS_00170 gene rfbC 15990 16571 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_00170 16591 17553 gene locus_tag LOCUS_00180 gene rfbB 16591 17553 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548761.1 protein_id gnl|my_center|LOCUS_00180 17665 18456 gene locus_tag LOCUS_00190 17665 18456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356900.1 protein_id gnl|my_center|LOCUS_00190 18473 19444 gene locus_tag LOCUS_00200 18473 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19463 20800 gene locus_tag LOCUS_00210 19463 20800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356901.1 protein_id gnl|my_center|LOCUS_00210 20802 21722 gene locus_tag LOCUS_00220 20802 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21746 23578 gene locus_tag LOCUS_00230 21746 23578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23562 25694 gene locus_tag LOCUS_00240 23562 25694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25710 27383 gene locus_tag LOCUS_00250 25710 27383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27437 29005 gene locus_tag LOCUS_00260 27437 29005 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_00260 29035 29781 gene locus_tag LOCUS_00270 29035 29781 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899987.1 protein_id gnl|my_center|LOCUS_00270 29785 30153 gene locus_tag LOCUS_00280 29785 30153 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050394.1 protein_id gnl|my_center|LOCUS_00280 30209 30562 gene locus_tag LOCUS_00290 30209 30562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356899.1 protein_id gnl|my_center|LOCUS_00290 30574 30954 gene locus_tag LOCUS_00300 30574 30954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356899.1 protein_id gnl|my_center|LOCUS_00300 30974 31882 gene locus_tag LOCUS_00310 30974 31882 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905118.1 protein_id gnl|my_center|LOCUS_00310 31898 32800 gene locus_tag LOCUS_00320 31898 32800 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 protein_id gnl|my_center|LOCUS_00320 32898 33899 gene locus_tag LOCUS_00330 gene galE 32898 33899 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694325.1 protein_id gnl|my_center|LOCUS_00330 34026 34160 gene locus_tag LOCUS_00340 34026 34160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34163 35893 gene locus_tag LOCUS_00350 34163 35893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 35894 36631 gene locus_tag LOCUS_00360 35894 36631 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_00360 36963 36721 gene locus_tag LOCUS_00370 36963 36721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37917 37051 gene locus_tag LOCUS_00380 37917 37051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38012 38203 gene locus_tag LOCUS_00390 38012 38203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 38261 39133 gene locus_tag LOCUS_00400 38261 39133 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_00400 39247 39399 gene locus_tag LOCUS_00410 39247 39399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39474 39704 gene locus_tag LOCUS_00420 39474 39704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 39792 41159 gene locus_tag LOCUS_00430 gene glmM 39792 41159 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_00430 41270 43516 gene locus_tag LOCUS_00440 gene priA 41270 43516 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_00440 43603 45225 gene locus_tag LOCUS_00450 43603 45225 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_00450 45303 46028 gene locus_tag LOCUS_00460 45303 46028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 46059 46430 gene locus_tag LOCUS_00470 46059 46430 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393652.1 protein_id gnl|my_center|LOCUS_00470 46462 48951 gene locus_tag LOCUS_00480 46462 48951 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393212.1 protein_id gnl|my_center|LOCUS_00480 49077 50102 gene locus_tag LOCUS_00490 49077 50102 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_00490 50123 51394 gene locus_tag LOCUS_00500 50123 51394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51394 52203 gene locus_tag LOCUS_00510 gene uppP 51394 52203 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_00510 52334 53359 gene locus_tag LOCUS_00520 52334 53359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 53546 55654 gene locus_tag LOCUS_00530 gene pnp 53546 55654 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_00530 55665 56486 gene locus_tag LOCUS_00540 55665 56486 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888021.1 protein_id gnl|my_center|LOCUS_00540 56557 57360 gene locus_tag LOCUS_00550 56557 57360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57372 58736 gene locus_tag LOCUS_00560 57372 58736 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_00560 58870 59727 gene locus_tag LOCUS_00570 gene cdaA 58870 59727 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_00570 59798 60676 gene locus_tag LOCUS_00580 59798 60676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 60749 61228 gene locus_tag LOCUS_00590 gene greA 60749 61228 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_00590 61273 62766 gene locus_tag LOCUS_00600 gene lysS 61273 62766 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098608.1 protein_id gnl|my_center|LOCUS_00600 63714 62833 gene locus_tag LOCUS_00610 63714 62833 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_00610 63828 64457 gene locus_tag LOCUS_00620 63828 64457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 64564 65055 gene locus_tag LOCUS_00630 gene trmL 64564 65055 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_00630 65150 65659 gene locus_tag LOCUS_00640 65150 65659 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_00640 65788 65712 gene locus_tag LOCUS_t00010 65788 65712 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 65910 66542 gene locus_tag LOCUS_00650 65910 66542 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889536.1 protein_id gnl|my_center|LOCUS_00650 66937 66545 gene locus_tag LOCUS_00660 66937 66545 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140785.1 protein_id gnl|my_center|LOCUS_00660 67802 66939 gene locus_tag LOCUS_00670 67802 66939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 67942 68511 gene locus_tag LOCUS_00680 67942 68511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 68677 69438 gene locus_tag LOCUS_00690 68677 69438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392149.1 protein_id gnl|my_center|LOCUS_00690 69601 69526 gene locus_tag LOCUS_t00020 69601 69526 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 69726 71927 gene locus_tag LOCUS_00700 69726 71927 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_00700 72062 72265 gene locus_tag LOCUS_00710 72062 72265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 72949 72605 gene locus_tag LOCUS_00720 72949 72605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 73088 75064 gene locus_tag LOCUS_00730 73088 75064 CDS product KAP family P-loop domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015265747.1 protein_id gnl|my_center|LOCUS_00730 75291 75836 gene locus_tag LOCUS_00740 gene spoVT 75291 75836 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_00740 76178 77725 gene locus_tag LOCUS_00750 gene rny 76178 77725 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_00750 78284 78162 gene locus_tag LOCUS_00760 78284 78162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 78978 79109 gene locus_tag LOCUS_00770 78978 79109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 79217 80188 gene locus_tag LOCUS_00780 79217 80188 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198966.1 protein_id gnl|my_center|LOCUS_00780 80181 81332 gene locus_tag LOCUS_00790 80181 81332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809841.1 protein_id gnl|my_center|LOCUS_00790 81322 82287 gene locus_tag LOCUS_00800 81322 82287 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809839.1 protein_id gnl|my_center|LOCUS_00800 82422 83174 gene locus_tag LOCUS_00810 82422 83174 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_00810 83195 83980 gene locus_tag LOCUS_00820 83195 83980 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_00820 84034 84567 gene locus_tag LOCUS_00830 gene cysE 84034 84567 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_00830 84834 84595 gene locus_tag LOCUS_00840 84834 84595 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_00840 85350 84862 gene locus_tag LOCUS_00850 gene rlmH 85350 84862 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048404.1 protein_id gnl|my_center|LOCUS_00850 86138 85347 gene locus_tag LOCUS_00860 86138 85347 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_00860 87420 86131 gene locus_tag LOCUS_00870 87420 86131 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_00870 87741 87523 gene locus_tag LOCUS_00880 87741 87523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 87956 88159 gene locus_tag LOCUS_00890 gene rpmE 87956 88159 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966172.1 protein_id gnl|my_center|LOCUS_00890 88215 89951 gene locus_tag LOCUS_00900 88215 89951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 89930 90670 gene locus_tag LOCUS_00910 gene whiA 89930 90670 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_00910 91458 90706 gene locus_tag LOCUS_00920 91458 90706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 92794 91511 gene locus_tag LOCUS_00930 92794 91511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 94374 92872 gene locus_tag LOCUS_00940 94374 92872 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225941989.1 protein_id gnl|my_center|LOCUS_00940 94732 95883 gene locus_tag LOCUS_00950 gene hemW 94732 95883 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_00950 96029 98785 gene locus_tag LOCUS_00960 gene polA 96029 98785 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_00960 98834 99397 gene locus_tag LOCUS_00970 98834 99397 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 protein_id gnl|my_center|LOCUS_00970 99411 100190 gene locus_tag LOCUS_00980 99411 100190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 100323 101048 gene locus_tag LOCUS_00990 100323 101048 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965592.1 protein_id gnl|my_center|LOCUS_00990 101159 101911 gene locus_tag LOCUS_01000 101159 101911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 102115 102414 gene locus_tag LOCUS_01010 102115 102414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 102427 103566 gene locus_tag LOCUS_01020 102427 103566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 103556 104095 gene locus_tag LOCUS_01030 103556 104095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 104132 104566 gene locus_tag LOCUS_01040 104132 104566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 104897 105847 gene locus_tag LOCUS_01050 104897 105847 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_01050 107209 105884 gene locus_tag LOCUS_01060 107209 105884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 107622 107314 gene locus_tag LOCUS_01070 107622 107314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 108343 107723 gene locus_tag LOCUS_01080 108343 107723 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357796.1 protein_id gnl|my_center|LOCUS_01080 108480 109619 gene locus_tag LOCUS_01090 108480 109619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 110943 109672 gene locus_tag LOCUS_01100 gene clpX 110943 109672 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_01100 111567 110947 gene locus_tag LOCUS_01110 gene clpP 111567 110947 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_01110 112872 111586 gene locus_tag LOCUS_01120 gene tig 112872 111586 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048204.1 protein_id gnl|my_center|LOCUS_01120 113774 113223 gene locus_tag LOCUS_01130 113774 113223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113969 114538 gene locus_tag LOCUS_01140 113969 114538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 116914 114863 gene locus_tag LOCUS_01150 116914 114863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 122522 116919 gene locus_tag LOCUS_01160 122522 116919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01160 123853 123692 gene locus_tag LOCUS_01170 123853 123692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 125817 124003 gene locus_tag LOCUS_01180 gene typA 125817 124003 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_01180 126583 125984 gene locus_tag LOCUS_01190 126583 125984 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873822.1 protein_id gnl|my_center|LOCUS_01190 127275 126586 gene locus_tag LOCUS_01200 gene cmk 127275 126586 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081716.1 protein_id gnl|my_center|LOCUS_01200 127435 127962 gene locus_tag LOCUS_01210 127435 127962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 128117 129409 gene locus_tag LOCUS_01220 gene serS 128117 129409 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_01220 129409 129984 gene locus_tag LOCUS_01230 gene yihA 129409 129984 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_01230 130122 131099 gene locus_tag LOCUS_01240 130122 131099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 131456 132208 gene locus_tag LOCUS_01250 131456 132208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 132336 133214 gene locus_tag LOCUS_01260 gene dapA 132336 133214 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_01260 133616 133236 gene locus_tag LOCUS_01270 133616 133236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 134257 133613 gene locus_tag LOCUS_01280 134257 133613 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_01280 134337 134705 gene locus_tag LOCUS_01290 134337 134705 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391740.1 protein_id gnl|my_center|LOCUS_01290 137067 134740 gene locus_tag LOCUS_01300 137067 134740 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_01300 137814 137086 gene locus_tag LOCUS_01310 gene rlmB 137814 137086 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_01310 139938 138130 gene locus_tag LOCUS_01320 gene lepA 139938 138130 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_01320 140201 140656 gene locus_tag LOCUS_01330 140201 140656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 140905 141267 gene locus_tag LOCUS_01340 140905 141267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 141586 141323 gene locus_tag LOCUS_01350 141586 141323 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_01350 142544 141600 gene locus_tag LOCUS_01360 gene fba 142544 141600 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_01360 144110 142689 gene locus_tag LOCUS_01370 144110 142689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 144934 144167 gene locus_tag LOCUS_01380 144934 144167 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_01380 145575 144952 gene locus_tag LOCUS_01390 145575 144952 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836976.1 protein_id gnl|my_center|LOCUS_01390 146443 145589 gene locus_tag LOCUS_01400 gene rsmI 146443 145589 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_01400 146832 146563 gene locus_tag LOCUS_01410 146832 146563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 147693 146935 gene locus_tag LOCUS_01420 147693 146935 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_01420 147796 148740 gene locus_tag LOCUS_01430 147796 148740 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_01430 150002 148971 gene locus_tag LOCUS_01440 150002 148971 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047968.1 protein_id gnl|my_center|LOCUS_01440 150681 150085 gene locus_tag LOCUS_01450 150681 150085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 151823 150708 gene locus_tag LOCUS_01460 gene prfB 151823 150708 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_01460 152540 151827 gene locus_tag LOCUS_01470 152540 151827 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_01470 152799 152596 gene locus_tag LOCUS_01480 152799 152596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 153030 153620 gene locus_tag LOCUS_01490 153030 153620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence002 773 255 gene locus_tag LOCUS_01500 773 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 2914 857 gene locus_tag LOCUS_01510 2914 857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986644.1 protein_id gnl|my_center|LOCUS_01510 3671 2904 gene locus_tag LOCUS_01520 3671 2904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_01520 4801 3782 gene locus_tag LOCUS_01530 4801 3782 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_01530 5460 4798 gene locus_tag LOCUS_01540 5460 4798 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_01540 6141 5623 gene locus_tag LOCUS_01550 6141 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8730 6307 gene locus_tag LOCUS_01560 gene clpC 8730 6307 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_01560 9727 8732 gene locus_tag LOCUS_01570 9727 8732 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_01570 10256 9744 gene locus_tag LOCUS_01580 10256 9744 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128399.1 protein_id gnl|my_center|LOCUS_01580 10713 10270 gene locus_tag LOCUS_01590 gene ctsR 10713 10270 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 protein_id gnl|my_center|LOCUS_01590 12325 10985 gene locus_tag LOCUS_01600 gene rpoD 12325 10985 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_01600 14136 12337 gene locus_tag LOCUS_01610 gene dnaG 14136 12337 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_01610 15385 14156 gene locus_tag LOCUS_01620 15385 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 16161 15430 gene locus_tag LOCUS_01630 16161 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 17239 16322 gene locus_tag LOCUS_01640 17239 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 17707 17474 gene locus_tag LOCUS_01650 17707 17474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 22151 17850 gene locus_tag LOCUS_01660 22151 17850 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966317.1 protein_id gnl|my_center|LOCUS_01660 22902 22414 gene locus_tag LOCUS_01670 gene cas4 22902 22414 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_01670 22983 23599 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttacattctaatatatttaaattaatac 24353 23817 gene locus_tag LOCUS_01680 24353 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 26007 24331 gene locus_tag LOCUS_01690 26007 24331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 26665 26018 gene locus_tag LOCUS_01700 gene cas5b 26665 26018 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_01700 27594 26683 gene locus_tag LOCUS_01710 gene cas7i 27594 26683 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_01710 29461 27596 gene locus_tag LOCUS_01720 gene cas8a1 29461 27596 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861771.1 protein_id gnl|my_center|LOCUS_01720 30185 29472 gene locus_tag LOCUS_01730 gene cas6 30185 29472 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861772.1 protein_id gnl|my_center|LOCUS_01730 30831 31187 gene locus_tag LOCUS_01740 30831 31187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 31200 31493 gene locus_tag LOCUS_01750 31200 31493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 32396 31542 gene locus_tag LOCUS_01760 32396 31542 CDS product TIGR02391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483178.1 protein_id gnl|my_center|LOCUS_01760 33763 32444 gene locus_tag LOCUS_01770 33763 32444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 34849 33794 gene locus_tag LOCUS_01780 34849 33794 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_01780 35640 34975 gene locus_tag LOCUS_01790 35640 34975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 35997 35644 gene locus_tag LOCUS_01800 35997 35644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 37054 36017 gene locus_tag LOCUS_01810 37054 36017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 38360 37038 gene locus_tag LOCUS_01820 38360 37038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 38643 38485 gene locus_tag LOCUS_01830 38643 38485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 40594 38636 gene locus_tag LOCUS_01840 40594 38636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 41026 40610 gene locus_tag LOCUS_01850 41026 40610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 41353 41039 gene locus_tag LOCUS_01860 41353 41039 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942008.1 protein_id gnl|my_center|LOCUS_01860 41660 41367 gene locus_tag LOCUS_01870 41660 41367 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795752.1 protein_id gnl|my_center|LOCUS_01870 42673 41660 gene locus_tag LOCUS_01880 42673 41660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 43053 42682 gene locus_tag LOCUS_01890 43053 42682 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966113.1 protein_id gnl|my_center|LOCUS_01890 44564 43161 gene locus_tag LOCUS_01900 44564 43161 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_01900 44746 44525 gene locus_tag LOCUS_01910 44746 44525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 45657 44839 gene locus_tag LOCUS_01920 45657 44839 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965236.1 protein_id gnl|my_center|LOCUS_01920 45811 45632 gene locus_tag LOCUS_01930 45811 45632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 46151 45831 gene locus_tag LOCUS_01940 46151 45831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 46378 46178 gene locus_tag LOCUS_01950 46378 46178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 46544 47773 gene locus_tag LOCUS_01960 46544 47773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 48071 47790 gene locus_tag LOCUS_01970 48071 47790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064810.1 protein_id gnl|my_center|LOCUS_01970 48586 48071 gene locus_tag LOCUS_01980 48586 48071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 49235 48588 gene locus_tag LOCUS_01990 49235 48588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 49483 50682 gene locus_tag LOCUS_02000 49483 50682 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_02000 51168 51356 gene locus_tag LOCUS_02010 51168 51356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 51442 51945 gene locus_tag LOCUS_02020 51442 51945 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259225.1 protein_id gnl|my_center|LOCUS_02020 51948 52700 gene locus_tag LOCUS_02030 51948 52700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 54263 53517 gene locus_tag LOCUS_02040 54263 53517 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021033.1 protein_id gnl|my_center|LOCUS_02040 55178 54735 gene locus_tag LOCUS_02050 55178 54735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 55768 55451 gene locus_tag LOCUS_02060 55768 55451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 56079 55819 gene locus_tag LOCUS_02070 56079 55819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 56652 56194 gene locus_tag LOCUS_02080 56652 56194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 57417 56899 gene locus_tag LOCUS_02090 57417 56899 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_02090 58362 57436 gene locus_tag LOCUS_02100 58362 57436 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_02100 60210 58561 gene locus_tag LOCUS_02110 60210 58561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459431.1 protein_id gnl|my_center|LOCUS_02110 60864 60550 gene locus_tag LOCUS_02120 gene trxA 60864 60550 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254147.1 protein_id gnl|my_center|LOCUS_02120 61321 60887 gene locus_tag LOCUS_02130 61321 60887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 64076 61398 gene locus_tag LOCUS_02140 64076 61398 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_02140 65367 64102 gene locus_tag LOCUS_02150 65367 64102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 66344 65535 gene locus_tag LOCUS_02160 66344 65535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 67453 66491 gene locus_tag LOCUS_02170 gene gpr 67453 66491 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430954.1 protein_id gnl|my_center|LOCUS_02170 68449 67532 gene locus_tag LOCUS_02180 gene holA 68449 67532 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282560.1 protein_id gnl|my_center|LOCUS_02180 69774 68458 gene locus_tag LOCUS_02190 gene trmFO 69774 68458 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016878.1 protein_id gnl|my_center|LOCUS_02190 70441 69878 gene locus_tag LOCUS_02200 70441 69878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 70621 70460 gene locus_tag LOCUS_02210 70621 70460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 72760 70775 gene locus_tag LOCUS_02220 gene topA 72760 70775 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357484.1 protein_id gnl|my_center|LOCUS_02220 74059 72839 gene locus_tag LOCUS_02230 74059 72839 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897656.1 protein_id gnl|my_center|LOCUS_02230 74538 74119 gene locus_tag LOCUS_02240 74538 74119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 75703 74627 gene locus_tag LOCUS_02250 gene mnmA 75703 74627 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_02250 77588 75996 gene locus_tag LOCUS_02260 gene metG 77588 75996 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021571.1 protein_id gnl|my_center|LOCUS_02260 78156 77773 gene locus_tag LOCUS_02270 78156 77773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 78308 78144 gene locus_tag LOCUS_02280 78308 78144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 79708 78569 gene locus_tag LOCUS_02290 gene nifS 79708 78569 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_02290 79858 80319 gene locus_tag LOCUS_02300 gene spoVAC 79858 80319 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_02300 80329 81351 gene locus_tag LOCUS_02310 gene spoVAD 80329 81351 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_02310 81352 81717 gene locus_tag LOCUS_02320 gene spoVAE 81352 81717 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_02320 81827 83266 gene locus_tag LOCUS_02330 81827 83266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 83333 84130 gene locus_tag LOCUS_02340 83333 84130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 84226 84408 gene locus_tag LOCUS_02350 84226 84408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 84421 84666 gene locus_tag LOCUS_02360 84421 84666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 85346 84837 gene locus_tag LOCUS_02370 85346 84837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 85754 85359 gene locus_tag LOCUS_02380 85754 85359 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_02380 85915 86148 gene locus_tag LOCUS_02390 85915 86148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 86179 86547 gene locus_tag LOCUS_02400 86179 86547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 88235 86607 gene locus_tag LOCUS_02410 gene groL 88235 86607 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_02410 88530 88249 gene locus_tag LOCUS_02420 88530 88249 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_02420 90734 88698 gene locus_tag LOCUS_02430 90734 88698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 91202 90918 gene locus_tag LOCUS_02440 91202 90918 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391605.1 protein_id gnl|my_center|LOCUS_02440 92596 91376 gene locus_tag LOCUS_02450 92596 91376 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080969.1 protein_id gnl|my_center|LOCUS_02450 92803 92976 gene locus_tag LOCUS_02460 92803 92976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 93114 93866 gene locus_tag LOCUS_02470 93114 93866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 94665 93961 gene locus_tag LOCUS_02480 94665 93961 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965156.1 protein_id gnl|my_center|LOCUS_02480 95683 94754 gene locus_tag LOCUS_02490 95683 94754 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_02490 96570 95692 gene locus_tag LOCUS_02500 gene hslO 96570 95692 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_02500 97128 96664 gene locus_tag LOCUS_02510 gene spoIIAB 97128 96664 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_02510 97433 97128 gene locus_tag LOCUS_02520 gene spoIIAA 97433 97128 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_02520 98839 97571 gene locus_tag LOCUS_02530 98839 97571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 99213 98992 gene locus_tag LOCUS_02540 99213 98992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 99349 99179 gene locus_tag LOCUS_02550 99349 99179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 100554 99820 gene locus_tag LOCUS_02560 gene srtB 100554 99820 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_02560 101504 100575 gene locus_tag LOCUS_02570 101504 100575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 102491 101604 gene locus_tag LOCUS_02580 gene xerD 102491 101604 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986427.1 protein_id gnl|my_center|LOCUS_02580 103220 102618 gene locus_tag LOCUS_02590 103220 102618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 103720 103274 gene locus_tag LOCUS_02600 gene rnhA 103720 103274 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_02600 103826 105016 gene locus_tag LOCUS_02610 103826 105016 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_02610 105825 105040 gene locus_tag LOCUS_02620 105825 105040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 106465 105941 gene locus_tag LOCUS_02630 gene rplQ 106465 105941 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723675.1 protein_id gnl|my_center|LOCUS_02630 107432 106485 gene locus_tag LOCUS_02640 107432 106485 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_02640 108126 107497 gene locus_tag LOCUS_02650 gene rpsD 108126 107497 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357283.1 protein_id gnl|my_center|LOCUS_02650 108537 108145 gene locus_tag LOCUS_02660 gene rpsK 108537 108145 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810114.1 protein_id gnl|my_center|LOCUS_02660 108915 108544 gene locus_tag LOCUS_02670 gene rpsM 108915 108544 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_02670 109413 109195 gene locus_tag LOCUS_02680 gene infA 109413 109195 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567521.1 protein_id gnl|my_center|LOCUS_02680 109592 109667 gene locus_tag LOCUS_t00030 109592 109667 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 109762 110040 gene locus_tag LOCUS_02690 109762 110040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 110245 112035 gene locus_tag LOCUS_02700 110245 112035 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861760.1 protein_id gnl|my_center|LOCUS_02700 112056 112412 gene locus_tag LOCUS_02710 112056 112412 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_02710 113424 112615 gene locus_tag LOCUS_02720 113424 112615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence003 520 152 gene locus_tag LOCUS_02730 520 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 726 559 gene locus_tag LOCUS_02740 726 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 1543 716 gene locus_tag LOCUS_02750 1543 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2076 1546 gene locus_tag LOCUS_02760 2076 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2344 2081 gene locus_tag LOCUS_02770 2344 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2528 2346 gene locus_tag LOCUS_02780 2528 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 3183 2719 gene locus_tag LOCUS_02790 3183 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5284 3356 gene locus_tag LOCUS_02800 5284 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 5669 5277 gene locus_tag LOCUS_02810 5669 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 5996 5673 gene locus_tag LOCUS_02820 5996 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 6192 6010 gene locus_tag LOCUS_02830 6192 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6481 6182 gene locus_tag LOCUS_02840 6481 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7582 6554 gene locus_tag LOCUS_02850 gene xerD 7582 6554 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_02850 8348 7656 gene locus_tag LOCUS_02860 8348 7656 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614886.1 protein_id gnl|my_center|LOCUS_02860 8704 8360 gene locus_tag LOCUS_02870 8704 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 8837 8676 gene locus_tag LOCUS_02880 8837 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 9175 8819 gene locus_tag LOCUS_02890 9175 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9828 9187 gene locus_tag LOCUS_02900 9828 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 10887 9850 gene locus_tag LOCUS_02910 10887 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 11537 11004 gene locus_tag LOCUS_02920 11537 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 12104 11838 gene locus_tag LOCUS_02930 12104 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 12276 12097 gene locus_tag LOCUS_02940 12276 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 12454 12296 gene locus_tag LOCUS_02950 12454 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 13019 12540 gene locus_tag LOCUS_02960 13019 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 13530 13006 gene locus_tag LOCUS_02970 13530 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13741 13517 gene locus_tag LOCUS_02980 13741 13517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 14132 13755 gene locus_tag LOCUS_02990 14132 13755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14496 14149 gene locus_tag LOCUS_03000 14496 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 14773 14513 gene locus_tag LOCUS_03010 14773 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 15083 14787 gene locus_tag LOCUS_03020 15083 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 15383 15111 gene locus_tag LOCUS_03030 15383 15111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 15687 15388 gene locus_tag LOCUS_03040 15687 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 16123 15701 gene locus_tag LOCUS_03050 16123 15701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 16662 16129 gene locus_tag LOCUS_03060 16662 16129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 17081 16737 gene locus_tag LOCUS_03070 17081 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 17539 17087 gene locus_tag LOCUS_03080 17539 17087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 17854 17543 gene locus_tag LOCUS_03090 17854 17543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 18084 17869 gene locus_tag LOCUS_03100 18084 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 18433 18086 gene locus_tag LOCUS_03110 18433 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 18651 18430 gene locus_tag LOCUS_03120 18651 18430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 18997 18803 gene locus_tag LOCUS_03130 18997 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 19239 19015 gene locus_tag LOCUS_03140 19239 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 19563 19291 gene locus_tag LOCUS_03150 19563 19291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 19774 19598 gene locus_tag LOCUS_03160 19774 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 19958 19794 gene locus_tag LOCUS_03170 19958 19794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 20814 20044 gene locus_tag LOCUS_03180 20814 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 21000 20839 gene locus_tag LOCUS_03190 21000 20839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 21214 21068 gene locus_tag LOCUS_03200 21214 21068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 21527 21276 gene locus_tag LOCUS_03210 21527 21276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 21788 21636 gene locus_tag LOCUS_03220 21788 21636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 22163 21822 gene locus_tag LOCUS_03230 22163 21822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 23482 23685 gene locus_tag LOCUS_03240 23482 23685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 23652 24224 gene locus_tag LOCUS_03250 23652 24224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 24217 25143 gene locus_tag LOCUS_03260 24217 25143 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_03260 25855 26205 gene locus_tag LOCUS_03270 25855 26205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 26209 26295 gene locus_tag LOCUS_t00040 26209 26295 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26317 26586 gene locus_tag LOCUS_03280 26317 26586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 26900 28648 gene locus_tag LOCUS_03290 26900 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 28658 29731 gene locus_tag LOCUS_03300 28658 29731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 29718 30461 gene locus_tag LOCUS_03310 29718 30461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 30601 30957 gene locus_tag LOCUS_03320 30601 30957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 31010 31807 gene locus_tag LOCUS_03330 31010 31807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 31942 32673 gene locus_tag LOCUS_03340 31942 32673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 32673 34418 gene locus_tag LOCUS_03350 32673 34418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 34434 36122 gene locus_tag LOCUS_03360 34434 36122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 36123 36647 gene locus_tag LOCUS_03370 36123 36647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 36649 36891 gene locus_tag LOCUS_03380 36649 36891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 36884 38809 gene locus_tag LOCUS_03390 36884 38809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 38824 39381 gene locus_tag LOCUS_03400 38824 39381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 39400 40527 gene locus_tag LOCUS_03410 39400 40527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 40662 41414 gene locus_tag LOCUS_03420 40662 41414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 41430 41876 gene locus_tag LOCUS_03430 41430 41876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 42189 43454 gene locus_tag LOCUS_03440 42189 43454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 43469 44572 gene locus_tag LOCUS_03450 43469 44572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 44572 45156 gene locus_tag LOCUS_03460 44572 45156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 45169 45996 gene locus_tag LOCUS_03470 45169 45996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 46078 47130 gene locus_tag LOCUS_03480 46078 47130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 47183 47389 gene locus_tag LOCUS_03490 47183 47389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 47423 47731 gene locus_tag LOCUS_03500 47423 47731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 47741 49471 gene locus_tag LOCUS_03510 47741 49471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 49500 50126 gene locus_tag LOCUS_03520 49500 50126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 50136 50636 gene locus_tag LOCUS_03530 50136 50636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 50655 53303 gene locus_tag LOCUS_03540 50655 53303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 53416 53709 gene locus_tag LOCUS_03550 53416 53709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 53827 55098 gene locus_tag LOCUS_03560 53827 55098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 55114 55641 gene locus_tag LOCUS_03570 55114 55641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 55645 56571 gene locus_tag LOCUS_03580 55645 56571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 56593 58920 gene locus_tag LOCUS_03590 56593 58920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 58947 59426 gene locus_tag LOCUS_03600 58947 59426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 59621 60286 gene locus_tag LOCUS_03610 59621 60286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 60321 62225 gene locus_tag LOCUS_03620 60321 62225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 62281 63561 gene locus_tag LOCUS_03630 62281 63561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 63572 64660 gene locus_tag LOCUS_03640 63572 64660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 64676 64903 gene locus_tag LOCUS_03650 64676 64903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 64891 65436 gene locus_tag LOCUS_03660 64891 65436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 65439 66797 gene locus_tag LOCUS_03670 65439 66797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 66819 67061 gene locus_tag LOCUS_03680 66819 67061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 67076 67822 gene locus_tag LOCUS_03690 67076 67822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 67889 68224 gene locus_tag LOCUS_03700 67889 68224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 68717 69181 gene locus_tag LOCUS_03710 68717 69181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 70345 69566 gene locus_tag LOCUS_03720 70345 69566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 70949 70335 gene locus_tag LOCUS_03730 70949 70335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 71263 70955 gene locus_tag LOCUS_03740 71263 70955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 71963 71247 gene locus_tag LOCUS_03750 71963 71247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 72115 71963 gene locus_tag LOCUS_03760 72115 71963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 72415 72116 gene locus_tag LOCUS_03770 72415 72116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 73354 72539 gene locus_tag LOCUS_03780 73354 72539 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310179.1 protein_id gnl|my_center|LOCUS_03780 73758 73351 gene locus_tag LOCUS_03790 73758 73351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 74026 73862 gene locus_tag LOCUS_03800 74026 73862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 74473 74081 gene locus_tag LOCUS_03810 74473 74081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 74708 74463 gene locus_tag LOCUS_03820 74708 74463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 75083 74718 gene locus_tag LOCUS_03830 75083 74718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 75336 75076 gene locus_tag LOCUS_03840 75336 75076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 75948 75337 gene locus_tag LOCUS_03850 75948 75337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 76390 75950 gene locus_tag LOCUS_03860 76390 75950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 76573 76394 gene locus_tag LOCUS_03870 76573 76394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 76878 76576 gene locus_tag LOCUS_03880 76878 76576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 77111 76875 gene locus_tag LOCUS_03890 77111 76875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 77679 77104 gene locus_tag LOCUS_03900 77679 77104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 78011 77703 gene locus_tag LOCUS_03910 78011 77703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 78249 78052 gene locus_tag LOCUS_03920 78249 78052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 78693 78289 gene locus_tag LOCUS_03930 78693 78289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 79025 78696 gene locus_tag LOCUS_03940 79025 78696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 79370 79056 gene locus_tag LOCUS_03950 79370 79056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 79908 79381 gene locus_tag LOCUS_03960 79908 79381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 80095 79901 gene locus_tag LOCUS_03970 80095 79901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 80303 80082 gene locus_tag LOCUS_03980 80303 80082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 80481 80296 gene locus_tag LOCUS_03990 80481 80296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 80975 80481 gene locus_tag LOCUS_04000 80975 80481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 81373 80978 gene locus_tag LOCUS_04010 81373 80978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 81828 81370 gene locus_tag LOCUS_04020 81828 81370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 82159 81830 gene locus_tag LOCUS_04030 82159 81830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 82436 82161 gene locus_tag LOCUS_04040 82436 82161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 82758 82426 gene locus_tag LOCUS_04050 82758 82426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 83291 82758 gene locus_tag LOCUS_04060 83291 82758 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 protein_id gnl|my_center|LOCUS_04060 83868 83275 gene locus_tag LOCUS_04070 83868 83275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 85169 83973 gene locus_tag LOCUS_04080 85169 83973 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916221.1 protein_id gnl|my_center|LOCUS_04080 85267 85192 gene locus_tag LOCUS_t00050 85267 85192 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 86959 85880 gene locus_tag LOCUS_04090 86959 85880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 87388 86996 gene locus_tag LOCUS_04100 87388 86996 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125933.1 protein_id gnl|my_center|LOCUS_04100 88132 87755 gene locus_tag LOCUS_04110 88132 87755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 88751 88119 gene locus_tag LOCUS_04120 88751 88119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 88968 88738 gene locus_tag LOCUS_04130 88968 88738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 89458 88958 gene locus_tag LOCUS_04140 89458 88958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 89676 89458 gene locus_tag LOCUS_04150 89676 89458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 90190 89666 gene locus_tag LOCUS_04160 90190 89666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 90674 90192 gene locus_tag LOCUS_04170 90674 90192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 91233 90667 gene locus_tag LOCUS_04180 91233 90667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence004 435 205 gene locus_tag LOCUS_04190 435 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 990 457 gene locus_tag LOCUS_04200 990 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 1834 1052 gene locus_tag LOCUS_04210 gene sigG 1834 1052 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_04210 2645 1935 gene locus_tag LOCUS_04220 gene sigE 2645 1935 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_04220 3454 2639 gene locus_tag LOCUS_04230 3454 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 4760 3618 gene locus_tag LOCUS_04240 gene ftsZ 4760 3618 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_04240 6055 4778 gene locus_tag LOCUS_04250 6055 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 6669 6178 gene locus_tag LOCUS_04260 6669 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 7899 6838 gene locus_tag LOCUS_04270 7899 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 8447 7983 gene locus_tag LOCUS_04280 8447 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 10053 8677 gene locus_tag LOCUS_04290 gene miaB 10053 8677 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_04290 10267 10728 gene locus_tag LOCUS_04300 10267 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 11622 10765 gene locus_tag LOCUS_04310 gene fieF 11622 10765 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482190.1 protein_id gnl|my_center|LOCUS_04310 11762 14155 gene locus_tag LOCUS_04320 11762 14155 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_04320 14220 14948 gene locus_tag LOCUS_04330 14220 14948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 15929 15045 gene locus_tag LOCUS_04340 15929 15045 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_04340 18565 15944 gene locus_tag LOCUS_04350 18565 15944 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_04350 18772 18578 gene locus_tag LOCUS_04360 18772 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 19298 19125 gene locus_tag LOCUS_04370 19298 19125 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_04370 20167 19337 gene locus_tag LOCUS_04380 20167 19337 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427637.1 protein_id gnl|my_center|LOCUS_04380 21013 20177 gene locus_tag LOCUS_04390 21013 20177 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_04390 21889 21029 gene locus_tag LOCUS_04400 21889 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 22269 22018 gene locus_tag LOCUS_04410 22269 22018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 24310 22367 gene locus_tag LOCUS_04420 gene metG 24310 22367 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_04420 24720 24316 gene locus_tag LOCUS_04430 gene acpS 24720 24316 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_04430 26088 24733 gene locus_tag LOCUS_04440 26088 24733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 26221 26296 gene locus_tag LOCUS_t00060 26221 26296 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26534 27439 gene locus_tag LOCUS_04450 26534 27439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 27652 28833 gene locus_tag LOCUS_04460 gene mobV 27652 28833 CDS product MobV family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122833.1 protein_id gnl|my_center|LOCUS_04460 28850 29203 gene locus_tag LOCUS_04470 28850 29203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 31123 29333 gene locus_tag LOCUS_04480 31123 29333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 31587 31135 gene locus_tag LOCUS_04490 31587 31135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 31723 31965 gene locus_tag LOCUS_04500 31723 31965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 33027 32104 gene locus_tag LOCUS_04510 33027 32104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 33866 33336 gene locus_tag LOCUS_04520 33866 33336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 34590 33859 gene locus_tag LOCUS_04530 34590 33859 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_04530 35733 34621 gene locus_tag LOCUS_04540 35733 34621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 35917 36114 gene locus_tag LOCUS_04550 35917 36114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 36260 36976 gene locus_tag LOCUS_04560 36260 36976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 37037 37564 gene locus_tag LOCUS_04570 37037 37564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 38087 38557 gene locus_tag LOCUS_04580 38087 38557 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003305140.1 protein_id gnl|my_center|LOCUS_04580 38836 39291 gene locus_tag LOCUS_04590 38836 39291 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202596.1 protein_id gnl|my_center|LOCUS_04590 40222 39587 gene locus_tag LOCUS_04600 40222 39587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 41108 40224 gene locus_tag LOCUS_04610 41108 40224 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_04610 41313 41639 gene locus_tag LOCUS_04620 41313 41639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 42427 41654 gene locus_tag LOCUS_04630 42427 41654 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_04630 43832 42441 gene locus_tag LOCUS_04640 43832 42441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 44593 43892 gene locus_tag LOCUS_04650 gene yycF 44593 43892 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 protein_id gnl|my_center|LOCUS_04650 45618 44848 gene locus_tag LOCUS_04660 gene murI 45618 44848 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229860.1 protein_id gnl|my_center|LOCUS_04660 46355 45762 gene locus_tag LOCUS_04670 gene recR 46355 45762 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_04670 46694 46365 gene locus_tag LOCUS_04680 46694 46365 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 protein_id gnl|my_center|LOCUS_04680 48323 46749 gene locus_tag LOCUS_04690 gene dnaX 48323 46749 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_04690 49188 48451 gene locus_tag LOCUS_04700 49188 48451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 49735 49556 gene locus_tag LOCUS_04710 49735 49556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 50255 49698 gene locus_tag LOCUS_04720 gene efp 50255 49698 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_04720 50618 50271 gene locus_tag LOCUS_04730 gene rplT 50618 50271 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720097.1 protein_id gnl|my_center|LOCUS_04730 50844 50647 gene locus_tag LOCUS_04740 gene rpmI 50844 50647 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939806.1 protein_id gnl|my_center|LOCUS_04740 51394 50867 gene locus_tag LOCUS_04750 gene infC 51394 50867 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048135.1 protein_id gnl|my_center|LOCUS_04750 53104 51587 gene locus_tag LOCUS_04760 53104 51587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 53276 53509 gene locus_tag LOCUS_04770 53276 53509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 55464 53548 gene locus_tag LOCUS_04780 gene gyrB 55464 53548 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_04780 56586 55513 gene locus_tag LOCUS_04790 gene recF 56586 55513 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_04790 57783 56665 gene locus_tag LOCUS_04800 gene dnaN 57783 56665 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_04800 59551 58139 gene locus_tag LOCUS_04810 gene dnaA 59551 58139 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_04810 60006 60140 gene locus_tag LOCUS_04820 gene rpmH 60006 60140 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 protein_id gnl|my_center|LOCUS_04820 60204 60563 gene locus_tag LOCUS_04830 gene rnpA 60204 60563 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081756.1 protein_id gnl|my_center|LOCUS_04830 60556 60807 gene locus_tag LOCUS_04840 gene yidD 60556 60807 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434233.1 protein_id gnl|my_center|LOCUS_04840 60822 61661 gene locus_tag LOCUS_04850 60822 61661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 61661 62317 gene locus_tag LOCUS_04860 61661 62317 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_04860 62364 63740 gene locus_tag LOCUS_04870 gene mnmE 62364 63740 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_04870 63749 65638 gene locus_tag LOCUS_04880 gene mnmG 63749 65638 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_04880 65668 66411 gene locus_tag LOCUS_04890 gene rsmG 65668 66411 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_04890 66513 67283 gene locus_tag LOCUS_04900 gene soj 66513 67283 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_04900 67286 68173 gene locus_tag LOCUS_04910 67286 68173 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288806.1 protein_id gnl|my_center|LOCUS_04910 68286 68374 gene locus_tag LOCUS_t00070 68286 68374 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 68392 68481 gene locus_tag LOCUS_t00080 68392 68481 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 68543 69103 gene locus_tag LOCUS_04920 gene gmk 68543 69103 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551230.1 protein_id gnl|my_center|LOCUS_04920 69187 69426 gene locus_tag LOCUS_04930 69187 69426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 69497 70747 gene locus_tag LOCUS_04940 69497 70747 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116793.1 protein_id gnl|my_center|LOCUS_04940 71332 70793 gene locus_tag LOCUS_04950 71332 70793 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723402.1 protein_id gnl|my_center|LOCUS_04950 71473 72195 gene locus_tag LOCUS_04960 71473 72195 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388218.1 protein_id gnl|my_center|LOCUS_04960 72276 72743 gene locus_tag LOCUS_04970 72276 72743 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832356.1 protein_id gnl|my_center|LOCUS_04970 72747 73232 gene locus_tag LOCUS_04980 gene rpiB 72747 73232 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_04980 73216 74316 gene locus_tag LOCUS_04990 73216 74316 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_04990 74376 74813 gene locus_tag LOCUS_05000 74376 74813 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_05000 74863 76116 gene locus_tag LOCUS_05010 74863 76116 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_05010 76109 77398 gene locus_tag LOCUS_05020 76109 77398 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_05020 77552 77743 gene locus_tag LOCUS_05030 77552 77743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 78179 77721 gene locus_tag LOCUS_05040 78179 77721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 78639 78172 gene locus_tag LOCUS_05050 78639 78172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 78820 78641 gene locus_tag LOCUS_05060 78820 78641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 79302 79505 gene locus_tag LOCUS_05070 79302 79505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 79505 81274 gene locus_tag LOCUS_05080 79505 81274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109621.1 protein_id gnl|my_center|LOCUS_05080 81261 82394 gene locus_tag LOCUS_05090 81261 82394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 82408 83133 gene locus_tag LOCUS_05100 82408 83133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 83221 84522 gene locus_tag LOCUS_05110 83221 84522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 84615 84953 gene locus_tag LOCUS_05120 84615 84953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence005 831 235 gene locus_tag LOCUS_05130 831 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1030 1242 gene locus_tag LOCUS_05140 1030 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1311 2849 gene locus_tag LOCUS_05150 1311 2849 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965545.1 protein_id gnl|my_center|LOCUS_05150 3046 3543 gene locus_tag LOCUS_05160 3046 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4236 3814 gene locus_tag LOCUS_05170 4236 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 5704 4229 gene locus_tag LOCUS_05180 5704 4229 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_05180 6610 5729 gene locus_tag LOCUS_05190 6610 5729 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_05190 8292 6667 gene locus_tag LOCUS_05200 gene recN 8292 6667 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_05200 8437 9135 gene locus_tag LOCUS_05210 8437 9135 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154460019.1 protein_id gnl|my_center|LOCUS_05210 9211 10389 gene locus_tag LOCUS_05220 9211 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10402 11097 gene locus_tag LOCUS_05230 10402 11097 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_05230 11681 11935 gene locus_tag LOCUS_05240 gene rpsT 11681 11935 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_05240 12463 11987 gene locus_tag LOCUS_05250 12463 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05250 12794 12498 gene locus_tag LOCUS_05260 12794 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 13227 12967 gene locus_tag LOCUS_05270 gene rpsR 13227 12967 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_05270 13685 13257 gene locus_tag LOCUS_05280 gene ssb 13685 13257 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_05280 14008 13724 gene locus_tag LOCUS_05290 gene rpsF 14008 13724 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869402.1 protein_id gnl|my_center|LOCUS_05290 14423 15046 gene locus_tag LOCUS_05300 14423 15046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 15448 15056 gene locus_tag LOCUS_05310 15448 15056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 16007 15459 gene locus_tag LOCUS_05320 16007 15459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 16426 17436 gene locus_tag LOCUS_05330 16426 17436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 18093 17467 gene locus_tag LOCUS_05340 18093 17467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 18704 18123 gene locus_tag LOCUS_05350 18704 18123 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583465.1 protein_id gnl|my_center|LOCUS_05350 18775 20022 gene locus_tag LOCUS_05360 18775 20022 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048018.1 protein_id gnl|my_center|LOCUS_05360 21102 20137 gene locus_tag LOCUS_05370 21102 20137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 22100 21129 gene locus_tag LOCUS_05380 22100 21129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 22746 22111 gene locus_tag LOCUS_05390 22746 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 24032 22764 gene locus_tag LOCUS_05400 24032 22764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 25269 24010 gene locus_tag LOCUS_05410 25269 24010 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_05410 26020 25421 gene locus_tag LOCUS_05420 26020 25421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 26173 26412 gene locus_tag LOCUS_05430 26173 26412 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109531.1 protein_id gnl|my_center|LOCUS_05430 27400 26492 gene locus_tag LOCUS_05440 27400 26492 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016289.1 protein_id gnl|my_center|LOCUS_05440 28213 27419 gene locus_tag LOCUS_05450 28213 27419 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_05450 29107 28223 gene locus_tag LOCUS_05460 29107 28223 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_05460 29612 29151 gene locus_tag LOCUS_05470 29612 29151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 30076 29612 gene locus_tag LOCUS_05480 30076 29612 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_05480 31140 30073 gene locus_tag LOCUS_05490 31140 30073 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016184.1 protein_id gnl|my_center|LOCUS_05490 31819 31121 gene locus_tag LOCUS_05500 gene rnc 31819 31121 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_05500 31976 32287 gene locus_tag LOCUS_05510 31976 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 32617 32375 gene locus_tag LOCUS_05520 gene acpP 32617 32375 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_05520 34014 32812 gene locus_tag LOCUS_05530 gene tuf 34014 32812 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_05530 36225 34141 gene locus_tag LOCUS_05540 gene fusA 36225 34141 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_05540 36723 36253 gene locus_tag LOCUS_05550 gene rpsG 36723 36253 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810168.1 protein_id gnl|my_center|LOCUS_05550 37259 36843 gene locus_tag LOCUS_05560 gene rpsL 37259 36843 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 protein_id gnl|my_center|LOCUS_05560 37772 38110 gene locus_tag LOCUS_05570 37772 38110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 38516 38890 gene locus_tag LOCUS_05580 38516 38890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 41544 39079 gene locus_tag LOCUS_05590 41544 39079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 42765 41554 gene locus_tag LOCUS_05600 42765 41554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 46548 42979 gene locus_tag LOCUS_05610 gene rpoC 46548 42979 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_05610 50252 46572 gene locus_tag LOCUS_05620 gene rpoB 50252 46572 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_05620 50853 50479 gene locus_tag LOCUS_05630 50853 50479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 51916 50855 gene locus_tag LOCUS_05640 gene prfA 51916 50855 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_05640 52479 52027 gene locus_tag LOCUS_05650 gene divIVA 52479 52027 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221468.1 protein_id gnl|my_center|LOCUS_05650 53053 52535 gene locus_tag LOCUS_05660 53053 52535 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965419.1 protein_id gnl|my_center|LOCUS_05660 54405 53182 gene locus_tag LOCUS_05670 54405 53182 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_05670 55656 54421 gene locus_tag LOCUS_05680 55656 54421 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_05680 56556 55666 gene locus_tag LOCUS_05690 gene ftsX 56556 55666 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_05690 57233 56559 gene locus_tag LOCUS_05700 gene ftsE 57233 56559 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768285.1 protein_id gnl|my_center|LOCUS_05700 57922 57326 gene locus_tag LOCUS_05710 gene ruvA 57922 57326 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_05710 58229 57969 gene locus_tag LOCUS_05720 58229 57969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 59021 58293 gene locus_tag LOCUS_05730 59021 58293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 59282 59094 gene locus_tag LOCUS_05740 59282 59094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 61290 59848 gene locus_tag LOCUS_05750 61290 59848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 61612 61283 gene locus_tag LOCUS_05760 61612 61283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 63127 61961 gene locus_tag LOCUS_05770 63127 61961 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_05770 64074 63178 gene locus_tag LOCUS_05780 64074 63178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 64443 64228 gene locus_tag LOCUS_05790 64443 64228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05790 64987 64481 gene locus_tag LOCUS_05800 64987 64481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05800 66198 65008 gene locus_tag LOCUS_05810 66198 65008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 66407 66255 gene locus_tag LOCUS_05820 66407 66255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 66912 67214 gene locus_tag LOCUS_05830 66912 67214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05830 67440 68189 gene locus_tag LOCUS_05840 67440 68189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05840 69005 68268 gene locus_tag LOCUS_05850 69005 68268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 70249 69107 gene locus_tag LOCUS_05860 70249 69107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 71435 70221 gene locus_tag LOCUS_05870 71435 70221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 72333 71437 gene locus_tag LOCUS_05880 72333 71437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 73282 72326 gene locus_tag LOCUS_05890 73282 72326 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_05890 74432 73272 gene locus_tag LOCUS_05900 gene pseC 74432 73272 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_05900 75698 74442 gene locus_tag LOCUS_05910 75698 74442 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_05910 75924 76448 gene locus_tag LOCUS_05920 75924 76448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05920 76449 76667 gene locus_tag LOCUS_05930 76449 76667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 76695 77171 gene locus_tag LOCUS_05940 76695 77171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 77634 78179 gene locus_tag LOCUS_05950 77634 78179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05950 78145 78729 gene locus_tag LOCUS_05960 78145 78729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05960 78861 79616 gene locus_tag LOCUS_05970 gene istB 78861 79616 CDS product IS21-like element ISMac3 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021079.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence006 1503 496 gene locus_tag LOCUS_05980 1503 496 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836428.1 protein_id gnl|my_center|LOCUS_05980 2195 1617 gene locus_tag LOCUS_05990 2195 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05990 3385 2378 gene locus_tag LOCUS_06000 3385 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4253 3714 gene locus_tag LOCUS_06010 gene cobC 4253 3714 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_06010 4749 4234 gene locus_tag LOCUS_06020 4749 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6311 4950 gene locus_tag LOCUS_06030 gene rlmD 6311 4950 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_06030 7250 6312 gene locus_tag LOCUS_06040 7250 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7420 7542 gene locus_tag LOCUS_06050 7420 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 10640 7806 gene locus_tag LOCUS_06060 gene uvrA 10640 7806 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_06060 11281 10727 gene locus_tag LOCUS_06070 11281 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 12492 11416 gene locus_tag LOCUS_06080 12492 11416 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_06080 13075 12554 gene locus_tag LOCUS_06090 13075 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 15234 13078 gene locus_tag LOCUS_06100 15234 13078 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_06100 16657 15983 gene locus_tag LOCUS_06110 16657 15983 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301793.1 protein_id gnl|my_center|LOCUS_06110 17044 16781 gene locus_tag LOCUS_06120 gene rpsO 17044 16781 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965113.1 protein_id gnl|my_center|LOCUS_06120 18179 17166 gene locus_tag LOCUS_06130 18179 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 18460 18912 gene locus_tag LOCUS_06140 18460 18912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 18924 19868 gene locus_tag LOCUS_06150 18924 19868 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964370.1 protein_id gnl|my_center|LOCUS_06150 20169 19927 gene locus_tag LOCUS_06160 20169 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 20887 20291 gene locus_tag LOCUS_06170 20887 20291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 24453 21001 gene locus_tag LOCUS_06180 24453 21001 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_06180 26355 25069 gene locus_tag LOCUS_06190 26355 25069 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_06190 26484 26909 gene locus_tag LOCUS_06200 26484 26909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 29318 26952 gene locus_tag LOCUS_06210 29318 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 30607 29462 gene locus_tag LOCUS_06220 30607 29462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 34134 30850 gene locus_tag LOCUS_06230 gene addB 34134 30850 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861078.1 protein_id gnl|my_center|LOCUS_06230 34711 34145 gene locus_tag LOCUS_06240 gene scpB 34711 34145 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_06240 35219 34869 gene locus_tag LOCUS_06250 35219 34869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 35845 38220 gene locus_tag LOCUS_06260 35845 38220 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_06260 38641 38255 gene locus_tag LOCUS_06270 38641 38255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 39303 38719 gene locus_tag LOCUS_06280 39303 38719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 41303 39354 gene locus_tag LOCUS_06290 41303 39354 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879844.1 protein_id gnl|my_center|LOCUS_06290 41607 41395 gene locus_tag LOCUS_06300 41607 41395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 42548 41700 gene locus_tag LOCUS_06310 gene pgeF 42548 41700 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109232.1 protein_id gnl|my_center|LOCUS_06310 46164 42550 gene locus_tag LOCUS_06320 gene addA 46164 42550 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_06320 48645 46183 gene locus_tag LOCUS_06330 48645 46183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 49029 49517 gene locus_tag LOCUS_06340 gene tsaE 49029 49517 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_06340 49519 50247 gene locus_tag LOCUS_06350 gene tsaB 49519 50247 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_06350 50234 50686 gene locus_tag LOCUS_06360 gene rimI 50234 50686 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925883.1 protein_id gnl|my_center|LOCUS_06360 50836 51942 gene locus_tag LOCUS_06370 50836 51942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 52259 54670 gene locus_tag LOCUS_06380 52259 54670 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_06380 56236 54698 gene locus_tag LOCUS_06390 56236 54698 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 protein_id gnl|my_center|LOCUS_06390 56700 56233 gene locus_tag LOCUS_06400 56700 56233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 57366 56827 gene locus_tag LOCUS_06410 57366 56827 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_06410 58570 57509 gene locus_tag LOCUS_06420 gene disA 58570 57509 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966464.1 protein_id gnl|my_center|LOCUS_06420 59961 58576 gene locus_tag LOCUS_06430 gene radA 59961 58576 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085195.1 protein_id gnl|my_center|LOCUS_06430 60600 59974 gene locus_tag LOCUS_06440 60600 59974 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_06440 61492 60821 gene locus_tag LOCUS_06450 61492 60821 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380173.1 protein_id gnl|my_center|LOCUS_06450 62961 61801 gene locus_tag LOCUS_06460 gene tyrS 62961 61801 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889364.1 protein_id gnl|my_center|LOCUS_06460 64200 63379 gene locus_tag LOCUS_06470 gene dinD 64200 63379 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_06470 65416 65061 gene locus_tag LOCUS_tm00010 65416 65061 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 66239 65481 gene locus_tag LOCUS_06480 66239 65481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 66726 66355 gene locus_tag LOCUS_06490 gene rplL 66726 66355 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931848.1 protein_id gnl|my_center|LOCUS_06490 67272 66769 gene locus_tag LOCUS_06500 gene rplJ 67272 66769 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832306.1 protein_id gnl|my_center|LOCUS_06500 68107 67424 gene locus_tag LOCUS_06510 gene rplA 68107 67424 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_06510 68581 68153 gene locus_tag LOCUS_06520 gene rplK 68581 68153 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 protein_id gnl|my_center|LOCUS_06520 69170 68640 gene locus_tag LOCUS_06530 gene nusG 69170 68640 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_06530 69402 69205 gene locus_tag LOCUS_06540 69402 69205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 69569 69420 gene locus_tag LOCUS_06550 gene rpmG 69569 69420 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_06550 69930 70877 gene locus_tag LOCUS_06560 69930 70877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 71937 71083 gene locus_tag LOCUS_06570 71937 71083 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_06570 72109 72945 gene locus_tag LOCUS_06580 72109 72945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 73530 74213 gene locus_tag LOCUS_06590 73530 74213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 74792 74520 gene locus_tag LOCUS_06600 74792 74520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence007 1641 169 gene locus_tag LOCUS_06610 1641 169 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_06610 2646 2383 gene locus_tag LOCUS_06620 2646 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 3463 2762 gene locus_tag LOCUS_06630 3463 2762 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_06630 5984 3474 gene locus_tag LOCUS_06640 5984 3474 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_06640 6298 5999 gene locus_tag LOCUS_06650 gene csoR 6298 5999 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723408.1 protein_id gnl|my_center|LOCUS_06650 7089 6400 gene locus_tag LOCUS_06660 gene yunB 7089 6400 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_06660 8632 7091 gene locus_tag LOCUS_06670 8632 7091 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_06670 10250 8853 gene locus_tag LOCUS_06680 10250 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 10713 10240 gene locus_tag LOCUS_06690 10713 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 12750 10792 gene locus_tag LOCUS_06700 12750 10792 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_06700 13706 12870 gene locus_tag LOCUS_06710 13706 12870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 14504 13944 gene locus_tag LOCUS_06720 14504 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 15478 14759 gene locus_tag LOCUS_06730 15478 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 16873 15656 gene locus_tag LOCUS_06740 16873 15656 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542382.1 protein_id gnl|my_center|LOCUS_06740 18153 16903 gene locus_tag LOCUS_06750 18153 16903 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_06750 19421 18150 gene locus_tag LOCUS_06760 19421 18150 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_06760 19730 19545 gene locus_tag LOCUS_06770 19730 19545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 20176 20334 gene locus_tag LOCUS_06780 20176 20334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 20752 20393 gene locus_tag LOCUS_06790 20752 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 21192 20779 gene locus_tag LOCUS_06800 gene ruvX 21192 20779 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_06800 21444 21199 gene locus_tag LOCUS_06810 21444 21199 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_06810 22575 21502 gene locus_tag LOCUS_06820 22575 21502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 24380 22605 gene locus_tag LOCUS_06830 24380 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 24753 24415 gene locus_tag LOCUS_06840 24753 24415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 26292 24976 gene locus_tag LOCUS_06850 26292 24976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 30102 26503 gene locus_tag LOCUS_06860 30102 26503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 31578 30118 gene locus_tag LOCUS_06870 31578 30118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 32841 31612 gene locus_tag LOCUS_06880 32841 31612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 34308 32857 gene locus_tag LOCUS_06890 34308 32857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 34828 34343 gene locus_tag LOCUS_06900 34828 34343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 35327 34851 gene locus_tag LOCUS_06910 35327 34851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 36149 35361 gene locus_tag LOCUS_06920 36149 35361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 36655 36167 gene locus_tag LOCUS_06930 36655 36167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 37209 36823 gene locus_tag LOCUS_06940 37209 36823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 39346 37286 gene locus_tag LOCUS_06950 39346 37286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 41249 39351 gene locus_tag LOCUS_06960 41249 39351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 42103 41288 gene locus_tag LOCUS_06970 42103 41288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 42819 42106 gene locus_tag LOCUS_06980 42819 42106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 43907 42870 gene locus_tag LOCUS_06990 43907 42870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 44934 44158 gene locus_tag LOCUS_07000 44934 44158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 46514 44985 gene locus_tag LOCUS_07010 gene tndX 46514 44985 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_07010 48099 46501 gene locus_tag LOCUS_07020 48099 46501 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775553.1 protein_id gnl|my_center|LOCUS_07020 49179 48304 gene locus_tag LOCUS_07030 49179 48304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 49450 50532 gene locus_tag LOCUS_07040 49450 50532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 51696 50569 gene locus_tag LOCUS_07050 51696 50569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 52369 51767 gene locus_tag LOCUS_07060 52369 51767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 52867 52382 gene locus_tag LOCUS_07070 52867 52382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 53217 52864 gene locus_tag LOCUS_07080 53217 52864 CDS product DUF3846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272736.1 protein_id gnl|my_center|LOCUS_07080 53642 53220 gene locus_tag LOCUS_07090 53642 53220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 54458 53643 gene locus_tag LOCUS_07100 54458 53643 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075141044.1 protein_id gnl|my_center|LOCUS_07100 54706 54554 gene locus_tag LOCUS_07110 54706 54554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 55007 54690 gene locus_tag LOCUS_07120 55007 54690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07120 55901 55275 gene locus_tag LOCUS_07130 55901 55275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 56262 56128 gene locus_tag LOCUS_07140 56262 56128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 56662 56276 gene locus_tag LOCUS_07150 56662 56276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 56976 56665 gene locus_tag LOCUS_07160 56976 56665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 60518 57087 gene locus_tag LOCUS_07170 60518 57087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 62051 60783 gene locus_tag LOCUS_07180 gene hflX 62051 60783 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391877.1 protein_id gnl|my_center|LOCUS_07180 62666 62130 gene locus_tag LOCUS_07190 62666 62130 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948555.1 protein_id gnl|my_center|LOCUS_07190 62911 62717 gene locus_tag LOCUS_07200 62911 62717 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_07200 64334 63021 gene locus_tag LOCUS_07210 64334 63021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 64926 64345 gene locus_tag LOCUS_07220 64926 64345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 66942 65329 gene locus_tag LOCUS_07230 66942 65329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426617.1 protein_id gnl|my_center|LOCUS_07230 68782 67022 gene locus_tag LOCUS_07240 68782 67022 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_07240 69331 69095 gene locus_tag LOCUS_07250 69331 69095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 71118 69400 gene locus_tag LOCUS_07260 71118 69400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_07260 71645 71247 gene locus_tag LOCUS_07270 71645 71247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 72552 71857 gene locus_tag LOCUS_07280 gene sigK 72552 71857 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_07280 72830 72618 gene locus_tag LOCUS_07290 72830 72618 CDS product DUF3006 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963615.1 protein_id gnl|my_center|LOCUS_07290 73781 72840 gene locus_tag LOCUS_07300 73781 72840 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_07300 74739 73765 gene locus_tag LOCUS_07310 74739 73765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence008 332 2431 gene locus_tag LOCUS_07320 332 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2431 2886 gene locus_tag LOCUS_07330 2431 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2948 4231 gene locus_tag LOCUS_07340 2948 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4340 5854 gene locus_tag LOCUS_07350 4340 5854 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_07350 5854 6081 gene locus_tag LOCUS_07360 5854 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 6094 7683 gene locus_tag LOCUS_07370 6094 7683 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_07370 7692 8711 gene locus_tag LOCUS_07380 7692 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8943 9254 gene locus_tag LOCUS_07390 8943 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 9254 10585 gene locus_tag LOCUS_07400 gene ffh 9254 10585 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_07400 10631 10873 gene locus_tag LOCUS_07410 gene rpsP 10631 10873 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_07410 10884 11126 gene locus_tag LOCUS_07420 10884 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 11128 11628 gene locus_tag LOCUS_07430 gene rimM 11128 11628 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_07430 11625 12338 gene locus_tag LOCUS_07440 gene trmD 11625 12338 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_07440 12357 12701 gene locus_tag LOCUS_07450 gene rplS 12357 12701 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_07450 13306 12761 gene locus_tag LOCUS_07460 13306 12761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 13647 13258 gene locus_tag LOCUS_07470 13647 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 13829 14089 gene locus_tag LOCUS_07480 13829 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07480 14191 14457 gene locus_tag LOCUS_07490 14191 14457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 14573 14827 gene locus_tag LOCUS_07500 14573 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 14846 16804 gene locus_tag LOCUS_07510 gene uvrB 14846 16804 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_07510 16921 17217 gene locus_tag LOCUS_07520 16921 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 17232 17654 gene locus_tag LOCUS_07530 17232 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 17733 18041 gene locus_tag LOCUS_07540 17733 18041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 18823 18071 gene locus_tag LOCUS_07550 18823 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 20810 18957 gene locus_tag LOCUS_07560 gene asnB 20810 18957 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_07560 21360 22739 gene locus_tag LOCUS_07570 21360 22739 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485262.1 protein_id gnl|my_center|LOCUS_07570 22751 23332 gene locus_tag LOCUS_07580 gene rsmD 22751 23332 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_07580 23337 23774 gene locus_tag LOCUS_07590 23337 23774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 23805 26321 gene locus_tag LOCUS_07600 23805 26321 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 protein_id gnl|my_center|LOCUS_07600 26339 26830 gene locus_tag LOCUS_07610 gene def 26339 26830 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142225.1 protein_id gnl|my_center|LOCUS_07610 26849 27883 gene locus_tag LOCUS_07620 26849 27883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 28069 28281 gene locus_tag LOCUS_07630 28069 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 28402 29412 gene locus_tag LOCUS_07640 gene ruvB 28402 29412 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_07640 29427 29672 gene locus_tag LOCUS_07650 29427 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 29674 30765 gene locus_tag LOCUS_07660 29674 30765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 30789 31325 gene locus_tag LOCUS_07670 30789 31325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 protein_id gnl|my_center|LOCUS_07670 31364 32302 gene locus_tag LOCUS_07680 gene ylqF 31364 32302 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829495.1 protein_id gnl|my_center|LOCUS_07680 32403 33092 gene locus_tag LOCUS_07690 32403 33092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 33228 34361 gene locus_tag LOCUS_07700 33228 34361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 34498 35382 gene locus_tag LOCUS_07710 34498 35382 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356507.1 protein_id gnl|my_center|LOCUS_07710 35406 36533 gene locus_tag LOCUS_07720 35406 36533 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_07720 36549 38963 gene locus_tag LOCUS_07730 gene leuS 36549 38963 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_07730 38989 40446 gene locus_tag LOCUS_07740 38989 40446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 40960 41505 gene locus_tag LOCUS_07750 40960 41505 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257130.1 protein_id gnl|my_center|LOCUS_07750 41582 42154 gene locus_tag LOCUS_07760 41582 42154 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824675.1 protein_id gnl|my_center|LOCUS_07760 42448 43476 gene locus_tag LOCUS_07770 gene pheS 42448 43476 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_07770 43489 45873 gene locus_tag LOCUS_07780 gene pheT 43489 45873 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_07780 46336 45968 gene locus_tag LOCUS_07790 46336 45968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 46985 47272 gene locus_tag LOCUS_07800 gene gatC 46985 47272 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_07800 47283 48743 gene locus_tag LOCUS_07810 gene gatA 47283 48743 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_07810 48756 50489 gene locus_tag LOCUS_07820 48756 50489 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_07820 50489 51925 gene locus_tag LOCUS_07830 gene gatB 50489 51925 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048223.1 protein_id gnl|my_center|LOCUS_07830 51943 52440 gene locus_tag LOCUS_07840 51943 52440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 52805 53359 gene locus_tag LOCUS_07850 52805 53359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 53466 55532 gene locus_tag LOCUS_07860 gene recG 53466 55532 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_07860 55659 56108 gene locus_tag LOCUS_07870 55659 56108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence009 2981 2661 gene locus_tag LOCUS_07880 2981 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 4230 3109 gene locus_tag LOCUS_07890 4230 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 5647 4301 gene locus_tag LOCUS_07900 5647 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5829 7556 gene locus_tag LOCUS_07910 5829 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 7699 8496 gene locus_tag LOCUS_07920 7699 8496 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986711.1 protein_id gnl|my_center|LOCUS_07920 9653 11563 gene locus_tag LOCUS_07930 9653 11563 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_07930 12981 11620 gene locus_tag LOCUS_07940 12981 11620 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948715.1 protein_id gnl|my_center|LOCUS_07940 13795 13121 gene locus_tag LOCUS_07950 13795 13121 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_07950 15722 14082 gene locus_tag LOCUS_07960 15722 14082 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963991.1 protein_id gnl|my_center|LOCUS_07960 16187 15819 gene locus_tag LOCUS_07970 16187 15819 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705325.1 protein_id gnl|my_center|LOCUS_07970 17007 16282 gene locus_tag LOCUS_07980 17007 16282 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419950.1 protein_id gnl|my_center|LOCUS_07980 17241 17077 gene locus_tag LOCUS_07990 17241 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 17762 17589 gene locus_tag LOCUS_08000 17762 17589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08000 18170 18097 gene locus_tag LOCUS_t00090 18170 18097 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 18334 18259 gene locus_tag LOCUS_t00100 18334 18259 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18410 18335 gene locus_tag LOCUS_t00110 18410 18335 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 18652 18576 gene locus_tag LOCUS_t00120 18652 18576 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 18739 18664 gene locus_tag LOCUS_t00130 18739 18664 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19804 19367 gene locus_tag LOCUS_08010 19804 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 19976 20596 gene locus_tag LOCUS_08020 gene spoIIR 19976 20596 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_08020 20890 20690 gene locus_tag LOCUS_08030 20890 20690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 22318 21527 gene locus_tag LOCUS_08040 22318 21527 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_08040 23559 22321 gene locus_tag LOCUS_08050 23559 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 26413 23552 gene locus_tag LOCUS_08060 gene mfd 26413 23552 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425912.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08060 26966 26481 gene locus_tag LOCUS_08070 26966 26481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 29012 26997 gene locus_tag LOCUS_08080 gene ligA 29012 26997 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_08080 29717 29118 gene locus_tag LOCUS_08090 gene pgsA 29717 29118 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_08090 29982 30389 gene locus_tag LOCUS_08100 29982 30389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 31284 30436 gene locus_tag LOCUS_08110 gene folD 31284 30436 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226732.1 protein_id gnl|my_center|LOCUS_08110 32092 31289 gene locus_tag LOCUS_08120 gene dpsA 32092 31289 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_08120 32284 33426 gene locus_tag LOCUS_08130 32284 33426 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166240.1 protein_id gnl|my_center|LOCUS_08130 35189 33636 gene locus_tag LOCUS_08140 gene cls 35189 33636 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_08140 36369 35245 gene locus_tag LOCUS_08150 gene tgt 36369 35245 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_08150 36734 36384 gene locus_tag LOCUS_08160 36734 36384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 37829 36804 gene locus_tag LOCUS_08170 gene queA 37829 36804 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_08170 38100 37927 gene locus_tag LOCUS_08180 38100 37927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 38966 38097 gene locus_tag LOCUS_08190 38966 38097 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028237.1 protein_id gnl|my_center|LOCUS_08190 40313 39432 gene locus_tag LOCUS_08200 40313 39432 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_08200 40900 40577 gene locus_tag LOCUS_08210 40900 40577 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994766.1 protein_id gnl|my_center|LOCUS_08210 41164 40916 gene locus_tag LOCUS_08220 41164 40916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 41937 41386 gene locus_tag LOCUS_08230 41937 41386 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444959.1 protein_id gnl|my_center|LOCUS_08230 42726 42064 gene locus_tag LOCUS_08240 42726 42064 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_08240 43403 42735 gene locus_tag LOCUS_08250 43403 42735 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_08250 45574 43418 gene locus_tag LOCUS_08260 45574 43418 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_08260 46213 45605 gene locus_tag LOCUS_08270 gene rdgB 46213 45605 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828653.1 protein_id gnl|my_center|LOCUS_08270 47903 46224 gene locus_tag LOCUS_08280 47903 46224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 48338 48490 gene locus_tag LOCUS_08290 48338 48490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence010 246 440 gene locus_tag LOCUS_08300 246 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 698 2047 gene locus_tag LOCUS_08310 698 2047 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249626.1 protein_id gnl|my_center|LOCUS_08310 2034 2201 gene locus_tag LOCUS_08320 2034 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2786 2238 gene locus_tag LOCUS_08330 2786 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3072 3221 gene locus_tag LOCUS_08340 3072 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3331 4896 gene locus_tag LOCUS_08350 3331 4896 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_08350 4900 6417 gene locus_tag LOCUS_08360 gene tndX 4900 6417 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_08360 6483 7034 gene locus_tag LOCUS_08370 6483 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7095 7547 gene locus_tag LOCUS_08380 gene tadA 7095 7547 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434328.1 protein_id gnl|my_center|LOCUS_08380 7656 7580 gene locus_tag LOCUS_t00140 7656 7580 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7758 7834 gene locus_tag LOCUS_t00150 7758 7834 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8078 8527 gene locus_tag LOCUS_08390 8078 8527 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047979.1 protein_id gnl|my_center|LOCUS_08390 8542 8859 gene locus_tag LOCUS_08400 8542 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 8923 9255 gene locus_tag LOCUS_08410 8923 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 9446 9252 gene locus_tag LOCUS_08420 9446 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 9490 9721 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttatattctaatatacttaaattaaaact 10043 10594 gene locus_tag LOCUS_08430 10043 10594 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_08430 10603 11127 gene locus_tag LOCUS_08440 10603 11127 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_08440 11255 11941 gene locus_tag LOCUS_08450 11255 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 12065 14662 gene locus_tag LOCUS_08460 gene mutS 12065 14662 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_08460 14676 15308 gene locus_tag LOCUS_08470 14676 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 15318 17273 gene locus_tag LOCUS_08480 gene mutL 15318 17273 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_08480 17275 18222 gene locus_tag LOCUS_08490 gene miaA 17275 18222 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_08490 18233 19465 gene locus_tag LOCUS_08500 18233 19465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 20052 19468 gene locus_tag LOCUS_08510 20052 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 20345 21412 gene locus_tag LOCUS_08520 20345 21412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 21475 22329 gene locus_tag LOCUS_08530 gene rsmA 21475 22329 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_08530 22981 22906 gene locus_tag LOCUS_t00160 22981 22906 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23069 22995 gene locus_tag LOCUS_t00170 23069 22995 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 23156 23081 gene locus_tag LOCUS_t00180 23156 23081 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23614 25206 gene locus_tag LOCUS_08540 23614 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 25193 25528 gene locus_tag LOCUS_08550 25193 25528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 25528 26370 gene locus_tag LOCUS_08560 25528 26370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 26379 26708 gene locus_tag LOCUS_08570 26379 26708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 26822 27388 gene locus_tag LOCUS_08580 26822 27388 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_08580 27514 28476 gene locus_tag LOCUS_08590 27514 28476 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429260.1 protein_id gnl|my_center|LOCUS_08590 28488 29501 gene locus_tag LOCUS_08600 28488 29501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_08600 29651 30469 gene locus_tag LOCUS_08610 29651 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 31430 30489 gene locus_tag LOCUS_08620 31430 30489 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459679.1 protein_id gnl|my_center|LOCUS_08620 31559 34015 gene locus_tag LOCUS_08630 gene gyrA 31559 34015 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_08630 34549 35247 gene locus_tag LOCUS_08640 34549 35247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 35305 37029 gene locus_tag LOCUS_08650 35305 37029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 37184 37714 gene locus_tag LOCUS_08660 37184 37714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 37782 38099 gene locus_tag LOCUS_08670 37782 38099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 38128 38619 gene locus_tag LOCUS_08680 38128 38619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 38597 40096 gene locus_tag LOCUS_08690 38597 40096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 40373 47203 gene locus_tag LOCUS_08700 40373 47203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence011 1487 426 gene locus_tag LOCUS_08710 gene mscY 1487 426 CDS product small-conductance mechanosensitive channel protein MscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245529.1 protein_id gnl|my_center|LOCUS_08710 2026 1502 gene locus_tag LOCUS_08720 2026 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2166 3551 gene locus_tag LOCUS_08730 gene cysS 2166 3551 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_08730 3560 4621 gene locus_tag LOCUS_08740 3560 4621 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993638.1 protein_id gnl|my_center|LOCUS_08740 4682 5287 gene locus_tag LOCUS_08750 4682 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 5303 5863 gene locus_tag LOCUS_08760 5303 5863 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_08760 6179 6616 gene locus_tag LOCUS_08770 6179 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 9475 6980 gene locus_tag LOCUS_08780 9475 6980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 9617 10147 gene locus_tag LOCUS_08790 gene pth 9617 10147 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_08790 10252 10698 gene locus_tag LOCUS_08800 10252 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 10741 11007 gene locus_tag LOCUS_08810 gene rpmA 10741 11007 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_08810 11136 11378 gene locus_tag LOCUS_08820 11136 11378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 11395 11589 gene locus_tag LOCUS_08830 11395 11589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08830 12416 11682 gene locus_tag LOCUS_08840 12416 11682 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_08840 12561 13448 gene locus_tag LOCUS_08850 12561 13448 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905118.1 protein_id gnl|my_center|LOCUS_08850 13465 14322 gene locus_tag LOCUS_08860 13465 14322 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_08860 15204 14410 gene locus_tag LOCUS_08870 gene pdaA 15204 14410 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_08870 15316 15939 gene locus_tag LOCUS_08880 15316 15939 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_08880 16036 16479 gene locus_tag LOCUS_08890 16036 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 16533 17033 gene locus_tag LOCUS_08900 16533 17033 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003305140.1 protein_id gnl|my_center|LOCUS_08900 17138 19135 gene locus_tag LOCUS_08910 17138 19135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 19327 20553 gene locus_tag LOCUS_08920 19327 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 20858 20613 gene locus_tag LOCUS_08930 20858 20613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 21103 21639 gene locus_tag LOCUS_08940 21103 21639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 21650 22240 gene locus_tag LOCUS_08950 21650 22240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 22296 24053 gene locus_tag LOCUS_08960 22296 24053 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_08960 24069 24416 gene locus_tag LOCUS_08970 24069 24416 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_08970 24584 25021 gene locus_tag LOCUS_08980 24584 25021 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965385.1 protein_id gnl|my_center|LOCUS_08980 25077 25613 gene locus_tag LOCUS_08990 25077 25613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 25626 25889 gene locus_tag LOCUS_09000 25626 25889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 25898 26302 gene locus_tag LOCUS_09010 gene nusB 25898 26302 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965384.1 protein_id gnl|my_center|LOCUS_09010 26317 27507 gene locus_tag LOCUS_09020 gene xseA 26317 27507 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_09020 27520 27747 gene locus_tag LOCUS_09030 27520 27747 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_09030 27799 27969 gene locus_tag LOCUS_09040 27799 27969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 28465 27971 gene locus_tag LOCUS_09050 28465 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 28577 29671 gene locus_tag LOCUS_09060 gene ychF 28577 29671 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_09060 30380 30036 gene locus_tag LOCUS_09070 30380 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 30659 30573 gene locus_tag LOCUS_t00190 30659 30573 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 31878 30739 gene locus_tag LOCUS_09080 31878 30739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 32041 33447 gene locus_tag LOCUS_09090 gene murC 32041 33447 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_09090 33564 33640 gene locus_tag LOCUS_t00200 33564 33640 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 33659 33744 gene locus_tag LOCUS_t00210 33659 33744 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 33852 34334 gene locus_tag LOCUS_09100 33852 34334 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398494.1 protein_id gnl|my_center|LOCUS_09100 34415 35041 gene locus_tag LOCUS_09110 34415 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 35628 35701 gene locus_tag LOCUS_t00220 35628 35701 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 35800 36072 gene locus_tag LOCUS_09120 35800 36072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 36205 38043 gene locus_tag LOCUS_09130 36205 38043 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186602.1 protein_id gnl|my_center|LOCUS_09130 38047 38409 gene locus_tag LOCUS_09140 38047 38409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 38517 38888 gene locus_tag LOCUS_09150 38517 38888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 39988 38885 gene locus_tag LOCUS_09160 39988 38885 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587069.1 protein_id gnl|my_center|LOCUS_09160 40770 40006 gene locus_tag LOCUS_09170 40770 40006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 41267 41425 gene locus_tag LOCUS_09180 41267 41425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 41533 42417 gene locus_tag LOCUS_09190 41533 42417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 42422 43396 gene locus_tag LOCUS_09200 42422 43396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence012 2230 3300 gene locus_tag LOCUS_09210 2230 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 3484 4509 gene locus_tag LOCUS_09220 3484 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4676 5683 gene locus_tag LOCUS_09230 gene gap 4676 5683 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_09230 5745 6926 gene locus_tag LOCUS_09240 5745 6926 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_09240 6938 7432 gene locus_tag LOCUS_09250 6938 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 7817 8566 gene locus_tag LOCUS_09260 gene tpiA 7817 8566 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_09260 8610 10148 gene locus_tag LOCUS_09270 gene gpmI 8610 10148 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_09270 10180 11064 gene locus_tag LOCUS_09280 10180 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 11086 11925 gene locus_tag LOCUS_09290 11086 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 11999 13312 gene locus_tag LOCUS_09300 gene eno 11999 13312 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_09300 13488 14420 gene locus_tag LOCUS_09310 13488 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 14485 15732 gene locus_tag LOCUS_09320 14485 15732 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_09320 16056 16895 gene locus_tag LOCUS_09330 16056 16895 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_09330 16976 17545 gene locus_tag LOCUS_09340 16976 17545 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129492.1 protein_id gnl|my_center|LOCUS_09340 17744 19666 gene locus_tag LOCUS_09350 17744 19666 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_09350 19685 21373 gene locus_tag LOCUS_09360 19685 21373 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_09360 21948 22160 gene locus_tag LOCUS_09370 21948 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 22572 22748 gene locus_tag LOCUS_09380 22572 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 23121 24308 gene locus_tag LOCUS_09390 23121 24308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 24322 24498 gene locus_tag LOCUS_09400 24322 24498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 24511 25101 gene locus_tag LOCUS_09410 24511 25101 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813668.1 protein_id gnl|my_center|LOCUS_09410 25216 26514 gene locus_tag LOCUS_09420 25216 26514 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_09420 26531 26800 gene locus_tag LOCUS_09430 26531 26800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 26925 27272 gene locus_tag LOCUS_09440 26925 27272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 27724 30507 gene locus_tag LOCUS_09450 gene ileS 27724 30507 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_09450 30603 31541 gene locus_tag LOCUS_09460 30603 31541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015509966.1 protein_id gnl|my_center|LOCUS_09460 31542 32723 gene locus_tag LOCUS_09470 31542 32723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 protein_id gnl|my_center|LOCUS_09470 32710 33855 gene locus_tag LOCUS_09480 32710 33855 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681920.1 protein_id gnl|my_center|LOCUS_09480 34411 33971 gene locus_tag LOCUS_09490 gene dut 34411 33971 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_09490 34576 36276 gene locus_tag LOCUS_09500 34576 36276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 36363 37103 gene locus_tag LOCUS_09510 36363 37103 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_09510 37181 38362 gene locus_tag LOCUS_09520 gene nifS 37181 38362 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_09520 38449 39063 gene locus_tag LOCUS_09530 38449 39063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence013 389 246 gene locus_tag LOCUS_09540 389 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 604 531 gene locus_tag LOCUS_t00230 604 531 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1366 662 gene locus_tag LOCUS_09550 1366 662 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_09550 1905 1387 gene locus_tag LOCUS_09560 1905 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2925 1924 gene locus_tag LOCUS_09570 gene tsaD 2925 1924 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_09570 3595 2942 gene locus_tag LOCUS_09580 3595 2942 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_09580 3958 3713 gene locus_tag LOCUS_09590 3958 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4031 5005 gene locus_tag LOCUS_09600 4031 5005 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102964529.1 protein_id gnl|my_center|LOCUS_09600 5388 5125 gene locus_tag LOCUS_09610 5388 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6970 5357 gene locus_tag LOCUS_09620 6970 5357 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_09620 7157 7747 gene locus_tag LOCUS_09630 7157 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 7874 9355 gene locus_tag LOCUS_09640 gene spoIVA 7874 9355 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_09640 9583 9395 gene locus_tag LOCUS_09650 9583 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 10127 11599 gene locus_tag LOCUS_09660 gene pyk 10127 11599 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_09660 11945 11766 gene locus_tag LOCUS_09670 11945 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 12323 11979 gene locus_tag LOCUS_09680 12323 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 12532 12410 gene locus_tag LOCUS_09690 12532 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 12891 13079 gene locus_tag LOCUS_09700 gene rpmB 12891 13079 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_09700 14771 13605 gene locus_tag LOCUS_09710 14771 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 15343 15558 gene locus_tag LOCUS_09720 15343 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 15567 16211 gene locus_tag LOCUS_09730 15567 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 16801 16223 gene locus_tag LOCUS_09740 16801 16223 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582751.1 protein_id gnl|my_center|LOCUS_09740 18676 16928 gene locus_tag LOCUS_09750 18676 16928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 22986 18688 gene locus_tag LOCUS_09760 22986 18688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 23273 23357 gene locus_tag LOCUS_t00240 23273 23357 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23469 24629 gene locus_tag LOCUS_09770 23469 24629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 24888 26114 gene locus_tag LOCUS_09780 gene rmuC 24888 26114 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_09780 26249 27616 gene locus_tag LOCUS_09790 gene glmU 26249 27616 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898727.1 protein_id gnl|my_center|LOCUS_09790 27915 29633 gene locus_tag LOCUS_09800 27915 29633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 30100 29684 gene locus_tag LOCUS_09810 30100 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 30491 30051 gene locus_tag LOCUS_09820 30491 30051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 31187 30588 gene locus_tag LOCUS_09830 31187 30588 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964993.1 protein_id gnl|my_center|LOCUS_09830 32155 31187 gene locus_tag LOCUS_09840 32155 31187 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_09840 33948 32176 gene locus_tag LOCUS_09850 gene aspS 33948 32176 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_09850 35200 33941 gene locus_tag LOCUS_09860 gene hisS 35200 33941 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_09860 35528 35337 gene locus_tag LOCUS_09870 35528 35337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 36160 35621 gene locus_tag LOCUS_09880 36160 35621 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_09880 36558 36178 gene locus_tag LOCUS_09890 36558 36178 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_09890 37364 36855 gene locus_tag LOCUS_09900 37364 36855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence014 613 170 gene locus_tag LOCUS_09910 613 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1739 618 gene locus_tag LOCUS_09920 gene scfB 1739 618 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048084.1 protein_id gnl|my_center|LOCUS_09920 2173 1946 gene locus_tag LOCUS_09930 2173 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2325 2567 gene locus_tag LOCUS_09940 2325 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3061 2606 gene locus_tag LOCUS_09950 3061 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3396 3707 gene locus_tag LOCUS_09960 3396 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3759 4847 gene locus_tag LOCUS_09970 3759 4847 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_09970 4969 6048 gene locus_tag LOCUS_09980 4969 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 6119 6346 gene locus_tag LOCUS_09990 6119 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6408 7730 gene locus_tag LOCUS_10000 gene der 6408 7730 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_10000 7761 8360 gene locus_tag LOCUS_10010 gene plsY 7761 8360 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258978.1 protein_id gnl|my_center|LOCUS_10010 8380 8658 gene locus_tag LOCUS_10020 8380 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 8679 9599 gene locus_tag LOCUS_10030 8679 9599 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226902.1 protein_id gnl|my_center|LOCUS_10030 9656 9991 gene locus_tag LOCUS_10040 9656 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 10080 10391 gene locus_tag LOCUS_10050 10080 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10678 13158 gene locus_tag LOCUS_10060 10678 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 13198 13467 gene locus_tag LOCUS_10070 13198 13467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 13476 13997 gene locus_tag LOCUS_10080 gene nrdG 13476 13997 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_10080 14013 14462 gene locus_tag LOCUS_10090 gene nrdR 14013 14462 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_10090 14989 16773 gene locus_tag LOCUS_10100 gene thrS 14989 16773 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 protein_id gnl|my_center|LOCUS_10100 17137 18411 gene locus_tag LOCUS_10110 17137 18411 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_10110 18702 18965 gene locus_tag LOCUS_10120 gene spoVS 18702 18965 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459952.1 protein_id gnl|my_center|LOCUS_10120 19072 20805 gene locus_tag LOCUS_10130 19072 20805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 20815 21816 gene locus_tag LOCUS_10140 gene pta 20815 21816 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_10140 21851 23056 gene locus_tag LOCUS_10150 gene ackA 21851 23056 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_10150 23058 24275 gene locus_tag LOCUS_10160 23058 24275 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_10160 24361 25746 gene locus_tag LOCUS_10170 24361 25746 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667252.1 protein_id gnl|my_center|LOCUS_10170 25770 26885 gene locus_tag LOCUS_10180 gene rodA 25770 26885 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_10180 27555 29810 gene locus_tag LOCUS_10190 27555 29810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_10190 29800 31644 gene locus_tag LOCUS_10200 29800 31644 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence015 578 886 gene locus_tag LOCUS_10210 578 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 920 1600 gene locus_tag LOCUS_10220 920 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1651 1833 gene locus_tag LOCUS_10230 1651 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2210 2671 gene locus_tag LOCUS_10240 2210 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2682 3434 gene locus_tag LOCUS_10250 gene sufC 2682 3434 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_10250 3434 4834 gene locus_tag LOCUS_10260 gene sufB 3434 4834 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_10260 4834 5898 gene locus_tag LOCUS_10270 4834 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5912 7135 gene locus_tag LOCUS_10280 5912 7135 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_10280 7147 7611 gene locus_tag LOCUS_10290 7147 7611 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_10290 9372 7750 gene locus_tag LOCUS_10300 9372 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 9611 10624 gene locus_tag LOCUS_10310 gene trpS 9611 10624 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_10310 10638 11906 gene locus_tag LOCUS_10320 gene obgE 10638 11906 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_10320 12773 12102 gene locus_tag LOCUS_10330 12773 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 12901 13602 gene locus_tag LOCUS_10340 12901 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 13544 14014 gene locus_tag LOCUS_10350 gene ytfJ 13544 14014 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460223.1 protein_id gnl|my_center|LOCUS_10350 14468 16192 gene locus_tag LOCUS_10360 14468 16192 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_10360 16292 16367 gene locus_tag LOCUS_t00250 16292 16367 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16617 18047 gene locus_tag LOCUS_10370 16617 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 19214 18174 gene locus_tag LOCUS_10380 19214 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 19485 20054 gene locus_tag LOCUS_10390 19485 20054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 20442 20074 gene locus_tag LOCUS_10400 20442 20074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 20670 20494 gene locus_tag LOCUS_10410 20670 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 21118 20609 gene locus_tag LOCUS_10420 21118 20609 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_10420 21264 22508 gene locus_tag LOCUS_10430 21264 22508 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_10430 22519 23826 gene locus_tag LOCUS_10440 22519 23826 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_10440 23852 24370 gene locus_tag LOCUS_10450 23852 24370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 24453 25439 gene locus_tag LOCUS_10460 24453 25439 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422061.1 protein_id gnl|my_center|LOCUS_10460 25876 25481 gene locus_tag LOCUS_10470 25876 25481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 26635 25982 gene locus_tag LOCUS_10480 26635 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 26760 27224 gene locus_tag LOCUS_10490 26760 27224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 27881 27267 gene locus_tag LOCUS_10500 27881 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 28786 27878 gene locus_tag LOCUS_10510 28786 27878 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166934.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence016 307 1311 gene locus_tag LOCUS_10520 307 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1314 1652 gene locus_tag LOCUS_10530 1314 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1686 2066 gene locus_tag LOCUS_10540 1686 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10540 2318 2716 gene locus_tag LOCUS_10550 2318 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2950 3369 gene locus_tag LOCUS_10560 2950 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3384 4709 gene locus_tag LOCUS_10570 gene pepC 3384 4709 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549077.1 protein_id gnl|my_center|LOCUS_10570 4998 4925 gene locus_tag LOCUS_t00260 4998 4925 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5220 5789 gene locus_tag LOCUS_10580 gene yqeK 5220 5789 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360010.1 protein_id gnl|my_center|LOCUS_10580 6349 7491 gene locus_tag LOCUS_10590 6349 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 7542 7949 gene locus_tag LOCUS_10600 7542 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 8178 10097 gene locus_tag LOCUS_10610 8178 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 10125 11867 gene locus_tag LOCUS_10620 10125 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 11864 12235 gene locus_tag LOCUS_10630 11864 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 12247 13260 gene locus_tag LOCUS_10640 12247 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13757 13368 gene locus_tag LOCUS_10650 13757 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 13861 15726 gene locus_tag LOCUS_10660 13861 15726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 15789 16172 gene locus_tag LOCUS_10670 15789 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 16560 17309 gene locus_tag LOCUS_10680 16560 17309 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638727.1 protein_id gnl|my_center|LOCUS_10680 17323 18108 gene locus_tag LOCUS_10690 17323 18108 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963514.1 protein_id gnl|my_center|LOCUS_10690 19405 18209 gene locus_tag LOCUS_10700 19405 18209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 19598 20074 gene locus_tag LOCUS_10710 19598 20074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 20363 20629 gene locus_tag LOCUS_10720 20363 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 20714 21235 gene locus_tag LOCUS_10730 20714 21235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 21379 21654 gene locus_tag LOCUS_10740 21379 21654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 21843 22010 gene locus_tag LOCUS_10750 21843 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 22340 23371 gene locus_tag LOCUS_10760 22340 23371 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_10760 23412 23549 gene locus_tag LOCUS_10770 23412 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 23585 23809 gene locus_tag LOCUS_10780 23585 23809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 24055 24855 gene locus_tag LOCUS_10790 24055 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 26478 25102 gene locus_tag LOCUS_10800 26478 25102 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_10800 26973 26785 gene locus_tag LOCUS_10810 26973 26785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 27400 26957 gene locus_tag LOCUS_10820 27400 26957 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202596.1 protein_id gnl|my_center|LOCUS_10820 27633 27920 gene locus_tag LOCUS_10830 27633 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 28111 28287 gene locus_tag LOCUS_10840 28111 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence017 392 892 gene locus_tag LOCUS_10850 392 892 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015988.1 protein_id gnl|my_center|LOCUS_10850 910 1974 gene locus_tag LOCUS_10860 gene nusA 910 1974 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_10860 1989 2252 gene locus_tag LOCUS_10870 1989 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2255 5095 gene locus_tag LOCUS_10880 2255 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5099 5455 gene locus_tag LOCUS_10890 gene rbfA 5099 5455 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_10890 5472 6443 gene locus_tag LOCUS_10900 5472 6443 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_10900 6427 7302 gene locus_tag LOCUS_10910 gene truB 6427 7302 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_10910 7353 8492 gene locus_tag LOCUS_10920 7353 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 9090 10244 gene locus_tag LOCUS_10930 9090 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 10260 11927 gene locus_tag LOCUS_10940 10260 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 11941 12969 gene locus_tag LOCUS_10950 11941 12969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 13085 14341 gene locus_tag LOCUS_10960 13085 14341 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386376.1 protein_id gnl|my_center|LOCUS_10960 14791 15081 gene locus_tag LOCUS_10970 14791 15081 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_10970 15085 16941 gene locus_tag LOCUS_10980 15085 16941 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146750.1 protein_id gnl|my_center|LOCUS_10980 17659 16988 gene locus_tag LOCUS_10990 17659 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 17845 18144 gene locus_tag LOCUS_11000 17845 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 18215 19615 gene locus_tag LOCUS_11010 18215 19615 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_11010 20948 19812 gene locus_tag LOCUS_11020 20948 19812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 21389 21069 gene locus_tag LOCUS_11030 21389 21069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 21571 21726 gene locus_tag LOCUS_11040 21571 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 22542 23198 gene locus_tag LOCUS_11050 22542 23198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 23407 24069 gene locus_tag LOCUS_11060 23407 24069 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_11060 24637 24125 gene locus_tag LOCUS_11070 24637 24125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 26356 24884 gene locus_tag LOCUS_11080 26356 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 26531 26911 gene locus_tag LOCUS_11090 26531 26911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence018 233 997 gene locus_tag LOCUS_11100 233 997 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_11100 1023 1184 gene locus_tag LOCUS_11110 1023 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1138 1737 gene locus_tag LOCUS_11120 1138 1737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964843.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11120 1738 4269 gene locus_tag LOCUS_11130 1738 4269 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964842.1 protein_id gnl|my_center|LOCUS_11130 4280 4510 gene locus_tag LOCUS_11140 4280 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 4455 5048 gene locus_tag LOCUS_11150 4455 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11150 5061 5606 gene locus_tag LOCUS_11160 5061 5606 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_11160 6507 5719 gene locus_tag LOCUS_11170 6507 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 6630 7580 gene locus_tag LOCUS_11180 gene fmt 6630 7580 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_11180 9015 7726 gene locus_tag LOCUS_11190 9015 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 9281 10327 gene locus_tag LOCUS_11200 gene rlmN 9281 10327 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_11200 10375 11109 gene locus_tag LOCUS_11210 10375 11109 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564704.1 protein_id gnl|my_center|LOCUS_11210 11127 13157 gene locus_tag LOCUS_11220 gene pknB 11127 13157 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_11220 13236 14117 gene locus_tag LOCUS_11230 gene rsgA 13236 14117 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865389.1 protein_id gnl|my_center|LOCUS_11230 14131 15588 gene locus_tag LOCUS_11240 14131 15588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 15585 16268 gene locus_tag LOCUS_11250 15585 16268 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_11250 16265 17341 gene locus_tag LOCUS_11260 16265 17341 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_11260 17438 18043 gene locus_tag LOCUS_11270 gene lexA 17438 18043 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_11270 18091 18675 gene locus_tag LOCUS_11280 18091 18675 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_11280 19137 18832 gene locus_tag LOCUS_11290 19137 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 19651 20961 gene locus_tag LOCUS_11300 gene rimO 19651 20961 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_11300 20974 22290 gene locus_tag LOCUS_11310 gene rho 20974 22290 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393879.1 protein_id gnl|my_center|LOCUS_11310 22359 24005 gene locus_tag LOCUS_11320 22359 24005 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_11320 24085 24396 gene locus_tag LOCUS_11330 24085 24396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 24405 26120 gene locus_tag LOCUS_11340 gene argS 24405 26120 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948742.1 protein_id gnl|my_center|LOCUS_11340 26411 26121 gene locus_tag LOCUS_11350 26411 26121 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221875345.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence019 <1 2857 gene locus_tag LOCUS_11360 <1 2857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein 3076 3474 gene locus_tag LOCUS_11370 3076 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3824 4141 gene locus_tag LOCUS_11380 gene rpsJ 3824 4141 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_11380 4264 4890 gene locus_tag LOCUS_11390 gene rplC 4264 4890 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_11390 4919 5539 gene locus_tag LOCUS_11400 gene rplD 4919 5539 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_11400 5539 5904 gene locus_tag LOCUS_11410 gene rplW 5539 5904 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549026.1 protein_id gnl|my_center|LOCUS_11410 5918 6751 gene locus_tag LOCUS_11420 gene rplB 5918 6751 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357299.1 protein_id gnl|my_center|LOCUS_11420 6766 7044 gene locus_tag LOCUS_11430 gene rpsS 6766 7044 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_11430 7075 7431 gene locus_tag LOCUS_11440 gene rplV 7075 7431 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638065.1 protein_id gnl|my_center|LOCUS_11440 7453 8109 gene locus_tag LOCUS_11450 gene rpsC 7453 8109 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_11450 8112 8543 gene locus_tag LOCUS_11460 gene rplP 8112 8543 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_11460 8544 8747 gene locus_tag LOCUS_11470 gene rpmC 8544 8747 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879935.1 protein_id gnl|my_center|LOCUS_11470 8765 9019 gene locus_tag LOCUS_11480 gene rpsQ 8765 9019 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_11480 9058 9426 gene locus_tag LOCUS_11490 gene rplN 9058 9426 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_11490 9445 9765 gene locus_tag LOCUS_11500 gene rplX 9445 9765 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_11500 9781 10326 gene locus_tag LOCUS_11510 gene rplE 9781 10326 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_11510 10339 10524 gene locus_tag LOCUS_11520 10339 10524 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_11520 10543 10938 gene locus_tag LOCUS_11530 gene rpsH 10543 10938 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_11530 10972 11508 gene locus_tag LOCUS_11540 gene rplF 10972 11508 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_11540 11545 11904 gene locus_tag LOCUS_11550 gene rplR 11545 11904 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_11550 11923 12462 gene locus_tag LOCUS_11560 gene rpsE 11923 12462 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_11560 12499 12939 gene locus_tag LOCUS_11570 gene rplO 12499 12939 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_11570 12943 14253 gene locus_tag LOCUS_11580 gene secY 12943 14253 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_11580 14773 14522 gene locus_tag LOCUS_11590 14773 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 15090 14881 gene locus_tag LOCUS_11600 15090 14881 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_11600 15229 15486 gene locus_tag LOCUS_11610 15229 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 15473 16837 gene locus_tag LOCUS_11620 15473 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 17084 16896 gene locus_tag LOCUS_11630 17084 16896 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_11630 17330 18142 gene locus_tag LOCUS_11640 gene spo0A 17330 18142 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_11640 18721 20700 gene locus_tag LOCUS_11650 18721 20700 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_11650 20735 21181 gene locus_tag LOCUS_11660 gene rplI 20735 21181 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_11660 21190 22533 gene locus_tag LOCUS_11670 gene dnaB 21190 22533 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_11670 22530 23558 gene locus_tag LOCUS_11680 22530 23558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 23576 25396 gene locus_tag LOCUS_11690 gene ftsH 23576 25396 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_11690 25564 25637 gene locus_tag LOCUS_t00270 25564 25637 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 322 531 gene locus_tag LOCUS_11700 322 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 660 941 gene locus_tag LOCUS_11710 660 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1102 1962 gene locus_tag LOCUS_11720 gene rpsB 1102 1962 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_11720 1975 2625 gene locus_tag LOCUS_11730 gene tsf 1975 2625 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_11730 2730 2873 gene locus_tag LOCUS_11740 2730 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2887 3597 gene locus_tag LOCUS_11750 gene pyrH 2887 3597 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_11750 3610 4368 gene locus_tag LOCUS_11760 3610 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4637 5938 gene locus_tag LOCUS_11770 4637 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5940 6854 gene locus_tag LOCUS_11780 gene secF 5940 6854 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_11780 7159 7247 gene locus_tag LOCUS_t00280 7159 7247 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7702 8037 gene locus_tag LOCUS_11790 7702 8037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 8165 8752 gene locus_tag LOCUS_11800 8165 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 9145 9504 gene locus_tag LOCUS_11810 9145 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9513 10055 gene locus_tag LOCUS_11820 9513 10055 CDS product CDP-archaeol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964114.1 protein_id gnl|my_center|LOCUS_11820 10065 10676 gene locus_tag LOCUS_11830 10065 10676 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_11830 10677 11507 gene locus_tag LOCUS_11840 10677 11507 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_11840 11501 12400 gene locus_tag LOCUS_11850 11501 12400 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906717.1 protein_id gnl|my_center|LOCUS_11850 12413 14665 gene locus_tag LOCUS_11860 12413 14665 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 protein_id gnl|my_center|LOCUS_11860 14649 16079 gene locus_tag LOCUS_11870 14649 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 16094 17152 gene locus_tag LOCUS_11880 16094 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964120.1 protein_id gnl|my_center|LOCUS_11880 17366 18445 gene locus_tag LOCUS_11890 17366 18445 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966166.1 protein_id gnl|my_center|LOCUS_11890 18637 19329 gene locus_tag LOCUS_11900 18637 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 19442 20059 gene locus_tag LOCUS_11910 19442 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 20165 20785 gene locus_tag LOCUS_11920 20165 20785 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_11920 20804 21574 gene locus_tag LOCUS_11930 gene map 20804 21574 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_11930 24253 21647 gene locus_tag LOCUS_11940 gene mgtA 24253 21647 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047937.1 protein_id gnl|my_center|LOCUS_11940 24429 24632 gene locus_tag LOCUS_11950 24429 24632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 24635 25357 gene locus_tag LOCUS_11960 24635 25357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836790.1 protein_id gnl|my_center|LOCUS_11960 25357 25530 gene locus_tag LOCUS_11970 25357 25530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence021 197 2497 gene locus_tag LOCUS_11980 gene pcrA 197 2497 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_11980 2544 3248 gene locus_tag LOCUS_11990 2544 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3325 4725 gene locus_tag LOCUS_12000 3325 4725 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_12000 4735 5769 gene locus_tag LOCUS_12010 4735 5769 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_12010 6846 5806 gene locus_tag LOCUS_12020 6846 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 7387 8529 gene locus_tag LOCUS_12030 gene galE 7387 8529 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775237.1 protein_id gnl|my_center|LOCUS_12030 8589 8810 gene locus_tag LOCUS_12040 8589 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 9034 10671 gene locus_tag LOCUS_12050 9034 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 10746 11753 gene locus_tag LOCUS_12060 10746 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 11871 15152 gene locus_tag LOCUS_12070 11871 15152 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_12070 15883 16002 gene locus_tag LOCUS_12080 15883 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 16288 17520 gene locus_tag LOCUS_12090 16288 17520 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_12090 17540 17929 gene locus_tag LOCUS_12100 17540 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 18327 19241 gene locus_tag LOCUS_12110 gene spoIIIAA 18327 19241 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_12110 19238 19756 gene locus_tag LOCUS_12120 19238 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 19773 19967 gene locus_tag LOCUS_12130 gene spoIIIAC 19773 19967 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_12130 19976 20359 gene locus_tag LOCUS_12140 gene spoIIIAD 19976 20359 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_12140 20363 21601 gene locus_tag LOCUS_12150 gene spoIIIAE 20363 21601 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_12150 21624 22160 gene locus_tag LOCUS_12160 21624 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 22153 22725 gene locus_tag LOCUS_12170 22153 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 22734 23312 gene locus_tag LOCUS_12180 22734 23312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 23697 23449 gene locus_tag LOCUS_12190 23697 23449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence022 1165 170 gene locus_tag LOCUS_12200 1165 170 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_12200 1306 2568 gene locus_tag LOCUS_12210 1306 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7193 2736 gene locus_tag LOCUS_12220 gene polC 7193 2736 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_12220 8889 7873 gene locus_tag LOCUS_12230 8889 7873 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_12230 9357 9097 gene locus_tag LOCUS_12240 gene spoIIID 9357 9097 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_12240 10348 9440 gene locus_tag LOCUS_12250 10348 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 11620 10589 gene locus_tag LOCUS_12260 gene spoIID 11620 10589 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947990.1 protein_id gnl|my_center|LOCUS_12260 14636 11760 gene locus_tag LOCUS_12270 gene ileS 14636 11760 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081557.1 protein_id gnl|my_center|LOCUS_12270 15451 14753 gene locus_tag LOCUS_12280 15451 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 15901 15497 gene locus_tag LOCUS_12290 gene cdd 15901 15497 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583680.1 protein_id gnl|my_center|LOCUS_12290 16784 15936 gene locus_tag LOCUS_12300 16784 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 17303 16785 gene locus_tag LOCUS_12310 gene ybeY 17303 16785 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_12310 18490 17303 gene locus_tag LOCUS_12320 18490 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 18839 18501 gene locus_tag LOCUS_12330 18839 18501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 19008 19682 gene locus_tag LOCUS_12340 19008 19682 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948826.1 protein_id gnl|my_center|LOCUS_12340 20114 19707 gene locus_tag LOCUS_12350 20114 19707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 20249 20115 gene locus_tag LOCUS_12360 20249 20115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 20371 21042 gene locus_tag LOCUS_12370 20371 21042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 22075 21434 gene locus_tag LOCUS_12380 22075 21434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 22273 22452 gene locus_tag LOCUS_12390 22273 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence023 1309 134 gene locus_tag LOCUS_12400 gene dnaJ 1309 134 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964595.1 protein_id gnl|my_center|LOCUS_12400 3235 1385 gene locus_tag LOCUS_12410 gene dnaK 3235 1385 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_12410 3859 3317 gene locus_tag LOCUS_12420 gene grpE 3859 3317 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048003.1 protein_id gnl|my_center|LOCUS_12420 4893 3865 gene locus_tag LOCUS_12430 gene hrcA 4893 3865 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_12430 6521 5106 gene locus_tag LOCUS_12440 gene murD 6521 5106 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_12440 6867 6643 gene locus_tag LOCUS_12450 6867 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 8536 6926 gene locus_tag LOCUS_12460 gene uvrC 8536 6926 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_12460 8857 8594 gene locus_tag LOCUS_12470 gene spoVG 8857 8594 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_12470 9668 8991 gene locus_tag LOCUS_12480 9668 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 10225 9689 gene locus_tag LOCUS_12490 10225 9689 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832140.1 protein_id gnl|my_center|LOCUS_12490 11662 10454 gene locus_tag LOCUS_12500 11662 10454 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108952.1 protein_id gnl|my_center|LOCUS_12500 11791 12726 gene locus_tag LOCUS_12510 11791 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 13607 12723 gene locus_tag LOCUS_12520 13607 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 14784 13846 gene locus_tag LOCUS_12530 14784 13846 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378890.1 protein_id gnl|my_center|LOCUS_12530 16882 14807 gene locus_tag LOCUS_12540 16882 14807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 17470 16952 gene locus_tag LOCUS_12550 17470 16952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 18329 17484 gene locus_tag LOCUS_12560 gene mreC 18329 17484 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_12560 19355 18342 gene locus_tag LOCUS_12570 19355 18342 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_12570 20026 19388 gene locus_tag LOCUS_12580 gene radC 20026 19388 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_12580 20331 20071 gene locus_tag LOCUS_12590 20331 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 21942 20935 gene locus_tag LOCUS_12600 21942 20935 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence024 1214 2923 gene locus_tag LOCUS_12610 1214 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3169 4737 gene locus_tag LOCUS_12620 3169 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 4734 5465 gene locus_tag LOCUS_12630 4734 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 5482 5898 gene locus_tag LOCUS_12640 5482 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 5950 6510 gene locus_tag LOCUS_12650 5950 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 6647 7435 gene locus_tag LOCUS_12660 6647 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7428 7901 gene locus_tag LOCUS_12670 7428 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 7898 8098 gene locus_tag LOCUS_12680 7898 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 8120 9757 gene locus_tag LOCUS_12690 gene pilB 8120 9757 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_12690 9774 10871 gene locus_tag LOCUS_12700 9774 10871 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_12700 10892 12235 gene locus_tag LOCUS_12710 10892 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 12783 12283 gene locus_tag LOCUS_12720 12783 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 12967 15726 gene locus_tag LOCUS_12730 gene secA 12967 15726 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_12730 15818 16729 gene locus_tag LOCUS_12740 15818 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence025 325 1926 gene locus_tag LOCUS_12750 325 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1985 3136 gene locus_tag LOCUS_12760 1985 3136 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808849.1 protein_id gnl|my_center|LOCUS_12760 3655 4671 gene locus_tag LOCUS_12770 3655 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4694 5557 gene locus_tag LOCUS_12780 4694 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5641 7158 gene locus_tag LOCUS_12790 5641 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 7169 8602 gene locus_tag LOCUS_12800 7169 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 8627 9085 gene locus_tag LOCUS_12810 gene smpB 8627 9085 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_12810 9333 9121 gene locus_tag LOCUS_12820 9333 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 9627 9343 gene locus_tag LOCUS_12830 9627 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9971 9642 gene locus_tag LOCUS_12840 9971 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 10118 10720 gene locus_tag LOCUS_12850 10118 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 11169 12083 gene locus_tag LOCUS_12860 gene era 11169 12083 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_12860 12165 12329 gene locus_tag LOCUS_12870 12165 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 12295 13011 gene locus_tag LOCUS_12880 gene recO 12295 13011 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_12880 13028 13882 gene locus_tag LOCUS_12890 13028 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 15753 13930 gene locus_tag LOCUS_12900 gene glmS 15753 13930 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432446.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence026 52 687 gene locus_tag LOCUS_12910 52 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 665 1720 gene locus_tag LOCUS_12920 665 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1933 2517 gene locus_tag LOCUS_12930 1933 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459317.1 protein_id gnl|my_center|LOCUS_12930 2532 3680 gene locus_tag LOCUS_12940 2532 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3915 4121 gene locus_tag LOCUS_12950 3915 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4127 4729 gene locus_tag LOCUS_12960 4127 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 6393 5695 gene locus_tag LOCUS_12970 6393 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6944 6804 gene locus_tag LOCUS_12980 6944 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7199 8959 gene locus_tag LOCUS_12990 7199 8959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_12990 8952 10655 gene locus_tag LOCUS_13000 8952 10655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_13000 11428 11120 gene locus_tag LOCUS_13010 11428 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 12195 12743 gene locus_tag LOCUS_13020 12195 12743 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963812.1 protein_id gnl|my_center|LOCUS_13020 12759 15236 gene locus_tag LOCUS_13030 12759 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence027 812 417 gene locus_tag LOCUS_13040 gene rpsI 812 417 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 protein_id gnl|my_center|LOCUS_13040 1262 828 gene locus_tag LOCUS_13050 gene rplM 1262 828 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_13050 1502 3103 gene locus_tag LOCUS_13060 1502 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3194 4237 gene locus_tag LOCUS_13070 gene recA 3194 4237 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428218.1 protein_id gnl|my_center|LOCUS_13070 4240 4665 gene locus_tag LOCUS_13080 4240 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4655 5404 gene locus_tag LOCUS_13090 gene deoD 4655 5404 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231176.1 protein_id gnl|my_center|LOCUS_13090 5414 6211 gene locus_tag LOCUS_13100 gene scpA 5414 6211 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_13100 6372 6920 gene locus_tag LOCUS_13110 gene frr 6372 6920 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_13110 6939 7757 gene locus_tag LOCUS_13120 6939 7757 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_13120 7773 9026 gene locus_tag LOCUS_13130 gene rseP 7773 9026 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_13130 9414 9070 gene locus_tag LOCUS_13140 9414 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 9592 10032 gene locus_tag LOCUS_13150 9592 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 10126 10377 gene locus_tag LOCUS_13160 10126 10377 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359493.1 protein_id gnl|my_center|LOCUS_13160 10445 11008 gene locus_tag LOCUS_13170 10445 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 11005 12384 gene locus_tag LOCUS_13180 gene ypeB 11005 12384 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966179.1 protein_id gnl|my_center|LOCUS_13180 12481 13422 gene locus_tag LOCUS_13190 12481 13422 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932394.1 protein_id gnl|my_center|LOCUS_13190 13608 14009 gene locus_tag LOCUS_13200 13608 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 14312 14701 gene locus_tag LOCUS_13210 14312 14701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 14733 15434 gene locus_tag LOCUS_13220 14733 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence028 1328 714 gene locus_tag LOCUS_13230 1328 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 2349 1444 gene locus_tag LOCUS_13240 2349 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3298 2342 gene locus_tag LOCUS_13250 3298 2342 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498063.1 protein_id gnl|my_center|LOCUS_13250 4178 3291 gene locus_tag LOCUS_13260 4178 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 5579 4191 gene locus_tag LOCUS_13270 5579 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 5774 5580 gene locus_tag LOCUS_13280 5774 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6295 5792 gene locus_tag LOCUS_13290 6295 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 6686 6297 gene locus_tag LOCUS_13300 6686 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 7730 6687 gene locus_tag LOCUS_13310 7730 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 8065 7736 gene locus_tag LOCUS_13320 8065 7736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 8405 8052 gene locus_tag LOCUS_13330 8405 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 8809 8423 gene locus_tag LOCUS_13340 8809 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 9487 8813 gene locus_tag LOCUS_13350 9487 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 10981 9515 gene locus_tag LOCUS_13360 10981 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 11363 10983 gene locus_tag LOCUS_13370 11363 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 <13121 11375 gene locus_tag LOCUS_13380 <13121 11375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948254.1:SH3 domain-containing protein >Feature sequence029 728 2320 gene locus_tag LOCUS_13390 728 2320 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_13390 2398 2474 gene locus_tag LOCUS_t00290 2398 2474 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2655 3068 gene locus_tag LOCUS_13400 2655 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3872 3432 gene locus_tag LOCUS_13410 3872 3432 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159173.1 protein_id gnl|my_center|LOCUS_13410 4879 7221 gene locus_tag LOCUS_13420 4879 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 7322 7558 gene locus_tag LOCUS_13430 7322 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 7569 9719 gene locus_tag LOCUS_13440 gene rnr 7569 9719 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_13440 9737 10543 gene locus_tag LOCUS_13450 9737 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 10552 11184 gene locus_tag LOCUS_13460 gene trmB 10552 11184 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644279.1 protein_id gnl|my_center|LOCUS_13460 11314 11390 gene locus_tag LOCUS_t00300 11314 11390 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 11411 11485 gene locus_tag LOCUS_t00310 11411 11485 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11548 11733 gene locus_tag LOCUS_13470 11548 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 11870 12496 gene locus_tag LOCUS_13480 11870 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence030 19 594 gene locus_tag LOCUS_13490 19 594 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_13490 591 872 gene locus_tag LOCUS_13500 gene porD 591 872 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_13500 876 2060 gene locus_tag LOCUS_13510 876 2060 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_13510 2061 3011 gene locus_tag LOCUS_13520 2061 3011 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_13520 4003 3122 gene locus_tag LOCUS_13530 4003 3122 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948434.1 protein_id gnl|my_center|LOCUS_13530 4492 4124 gene locus_tag LOCUS_13540 4492 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 8130 4570 gene locus_tag LOCUS_13550 gene smc 8130 4570 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965058.1 protein_id gnl|my_center|LOCUS_13550 10186 8231 gene locus_tag LOCUS_13560 10186 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 11688 10210 gene locus_tag LOCUS_13570 11688 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 12192 11908 gene locus_tag LOCUS_13580 12192 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence031 524 1006 gene locus_tag LOCUS_13590 524 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1040 1687 gene locus_tag LOCUS_13600 1040 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1896 2063 gene locus_tag LOCUS_13610 1896 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2065 3621 gene locus_tag LOCUS_13620 2065 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3642 5657 gene locus_tag LOCUS_13630 3642 5657 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168194.1 protein_id gnl|my_center|LOCUS_13630 5688 7433 gene locus_tag LOCUS_13640 5688 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 7450 8535 gene locus_tag LOCUS_13650 7450 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 8607 9158 gene locus_tag LOCUS_13660 8607 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 9171 10019 gene locus_tag LOCUS_13670 9171 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence032 <1 2224 gene locus_tag LOCUS_13680 <1 2224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722637.1:peptidoglycan DD-metalloendopeptidase family protein 2257 3126 gene locus_tag LOCUS_13690 2257 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3138 3950 gene locus_tag LOCUS_13700 3138 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3960 5033 gene locus_tag LOCUS_13710 3960 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5071 8199 gene locus_tag LOCUS_13720 5071 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8506 9087 gene locus_tag LOCUS_13730 8506 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9098 9940 gene locus_tag LOCUS_13740 9098 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence033 595 158 gene locus_tag LOCUS_13750 595 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1390 608 gene locus_tag LOCUS_13760 1390 608 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393732.1 protein_id gnl|my_center|LOCUS_13760 2264 1407 gene locus_tag LOCUS_13770 2264 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3398 2274 gene locus_tag LOCUS_13780 gene murG 3398 2274 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_13780 4591 3419 gene locus_tag LOCUS_13790 gene spoVE 4591 3419 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_13790 5556 4603 gene locus_tag LOCUS_13800 gene mraY 5556 4603 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_13800 7057 5582 gene locus_tag LOCUS_13810 7057 5582 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_13810 9324 7144 gene locus_tag LOCUS_13820 9324 7144 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_13820 9928 9434 gene locus_tag LOCUS_13830 9928 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 10880 9948 gene locus_tag LOCUS_13840 gene rsmH 10880 9948 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_13840 11444 11013 gene locus_tag LOCUS_13850 gene mraZ 11444 11013 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence034 2072 876 gene locus_tag LOCUS_13860 2072 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3291 2062 gene locus_tag LOCUS_13870 3291 2062 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787114.1 protein_id gnl|my_center|LOCUS_13870 3836 4312 gene locus_tag LOCUS_13880 3836 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4496 4299 gene locus_tag LOCUS_13890 4496 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 5278 4496 gene locus_tag LOCUS_13900 5278 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 6300 5275 gene locus_tag LOCUS_13910 6300 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8062 6287 gene locus_tag LOCUS_13920 8062 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9645 8059 gene locus_tag LOCUS_13930 9645 8059 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence035 345 2630 gene locus_tag LOCUS_13940 345 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2959 3549 gene locus_tag LOCUS_13950 2959 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3562 3990 gene locus_tag LOCUS_13960 3562 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4213 5196 gene locus_tag LOCUS_13970 gene dusB 4213 5196 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_13970 6194 5994 gene locus_tag LOCUS_13980 6194 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6371 7180 gene locus_tag LOCUS_13990 6371 7180 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_13990 7194 8510 gene locus_tag LOCUS_14000 gene mtaB 7194 8510 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_14000 8444 9670 gene locus_tag LOCUS_14010 8444 9670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 10518 10676 gene locus_tag LOCUS_14020 10518 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence036 <9866 331 gene locus_tag LOCUS_14030 <9866 331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein >Feature sequence037 664 341 gene locus_tag LOCUS_14040 664 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2665 689 gene locus_tag LOCUS_14050 2665 689 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_14050 3875 2655 gene locus_tag LOCUS_14060 3875 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 7061 3879 gene locus_tag LOCUS_14070 7061 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 8006 7128 gene locus_tag LOCUS_14080 8006 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 8100 7969 gene locus_tag LOCUS_14090 8100 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence038 221 847 gene locus_tag LOCUS_14100 221 847 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861651.1 protein_id gnl|my_center|LOCUS_14100 1263 901 gene locus_tag LOCUS_14110 1263 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2556 1300 gene locus_tag LOCUS_14120 2556 1300 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_14120 2756 2992 gene locus_tag LOCUS_14130 2756 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2989 3201 gene locus_tag LOCUS_14140 2989 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4032 3304 gene locus_tag LOCUS_14150 4032 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4775 4032 gene locus_tag LOCUS_14160 4775 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5311 4775 gene locus_tag LOCUS_14170 5311 4775 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765314.1 protein_id gnl|my_center|LOCUS_14170 5481 6725 gene locus_tag LOCUS_14180 gene tyrS 5481 6725 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_14180 8109 6748 gene locus_tag LOCUS_14190 8109 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 8559 8485 gene locus_tag LOCUS_t00320 8559 8485 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 840 274 gene locus_tag LOCUS_14200 gene farR 840 274 CDS product fatty acid efflux pump transcriptional regulator FarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665238.1 protein_id gnl|my_center|LOCUS_14200 1006 3003 gene locus_tag LOCUS_14210 1006 3003 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676329.1 protein_id gnl|my_center|LOCUS_14210 4327 3086 gene locus_tag LOCUS_14220 4327 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5029 4427 gene locus_tag LOCUS_14230 5029 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5556 5026 gene locus_tag LOCUS_14240 5556 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 5686 6129 gene locus_tag LOCUS_14250 5686 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 7256 6342 gene locus_tag LOCUS_14260 7256 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7419 7249 gene locus_tag LOCUS_14270 7419 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 8051 7647 gene locus_tag LOCUS_14280 8051 7647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8255 8133 gene locus_tag LOCUS_14290 8255 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence040 2724 1384 gene locus_tag LOCUS_14300 2724 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3433 2717 gene locus_tag LOCUS_14310 gene rgaR 3433 2717 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_14310 4752 3874 gene locus_tag LOCUS_14320 4752 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 5144 4845 gene locus_tag LOCUS_14330 5144 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6097 5183 gene locus_tag LOCUS_14340 6097 5183 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_14340 6571 6125 gene locus_tag LOCUS_14350 6571 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 7470 6583 gene locus_tag LOCUS_14360 7470 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 8031 7555 gene locus_tag LOCUS_14370 8031 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence041 1549 2052 gene locus_tag LOCUS_14380 1549 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2566 2730 gene locus_tag LOCUS_14390 2566 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2953 3849 gene locus_tag LOCUS_14400 2953 3849 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679543.1 protein_id gnl|my_center|LOCUS_14400 3892 4431 gene locus_tag LOCUS_14410 3892 4431 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_14410 4428 4970 gene locus_tag LOCUS_14420 4428 4970 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_14420 4980 5543 gene locus_tag LOCUS_14430 4980 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 5585 6259 gene locus_tag LOCUS_14440 5585 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence042 <1 949 gene locus_tag LOCUS_14450 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211477941.1:SpaA isopeptide-forming pilin-related protein 1721 1119 gene locus_tag LOCUS_14460 1721 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1877 2587 gene locus_tag LOCUS_14470 1877 2587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_14470 2587 4986 gene locus_tag LOCUS_14480 2587 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 5014 5790 gene locus_tag LOCUS_14490 5014 5790 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_14490 5806 6498 gene locus_tag LOCUS_14500 gene gpmA 5806 6498 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301554.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence043 297 1172 gene locus_tag LOCUS_14510 297 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 1402 3774 gene locus_tag LOCUS_14520 1402 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3809 5113 gene locus_tag LOCUS_14530 3809 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence044 79 906 gene locus_tag LOCUS_14540 gene srtB 79 906 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_14540 1347 1108 gene locus_tag LOCUS_14550 1347 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2373 1387 gene locus_tag LOCUS_14560 2373 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2899 2429 gene locus_tag LOCUS_14570 2899 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 3123 2902 gene locus_tag LOCUS_14580 3123 2902 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880829.1 protein_id gnl|my_center|LOCUS_14580 3742 3131 gene locus_tag LOCUS_14590 3742 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4127 3759 gene locus_tag LOCUS_14600 4127 3759 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637688.1 protein_id gnl|my_center|LOCUS_14600 4380 4117 gene locus_tag LOCUS_14610 4380 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4634 4431 gene locus_tag LOCUS_14620 4634 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5051 4734 gene locus_tag LOCUS_14630 5051 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 5380 5754 gene locus_tag LOCUS_14640 5380 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <6530 5783 gene locus_tag LOCUS_14650 <6530 5783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861119.1:DUF6017 domain-containing protein >Feature sequence045 1265 399 gene locus_tag LOCUS_14660 1265 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2362 1340 gene locus_tag LOCUS_14670 2362 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2753 3388 gene locus_tag LOCUS_14680 gene vraR 2753 3388 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830439.1 protein_id gnl|my_center|LOCUS_14680 4553 3411 gene locus_tag LOCUS_14690 4553 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6066 4558 gene locus_tag LOCUS_14700 6066 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6440 6216 gene locus_tag LOCUS_14710 6440 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence046 42 251 gene locus_tag LOCUS_14720 42 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 256 516 gene locus_tag LOCUS_14730 256 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 516 725 gene locus_tag LOCUS_14740 516 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1334 741 gene locus_tag LOCUS_14750 1334 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1431 2120 gene locus_tag LOCUS_14760 1431 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2117 4177 gene locus_tag LOCUS_14770 2117 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4181 4351 gene locus_tag LOCUS_14780 4181 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4393 4605 gene locus_tag LOCUS_14790 4393 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4787 5164 gene locus_tag LOCUS_14800 4787 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5168 6193 gene locus_tag LOCUS_14810 5168 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence047 3101 3490 gene locus_tag LOCUS_14820 3101 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence048 1312 119 gene locus_tag LOCUS_14830 1312 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1587 1324 gene locus_tag LOCUS_14840 1587 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2253 1600 gene locus_tag LOCUS_14850 2253 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3181 2246 gene locus_tag LOCUS_14860 3181 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4484 3174 gene locus_tag LOCUS_14870 4484 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 5615 4500 gene locus_tag LOCUS_14880 5615 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence049 254 1072 gene locus_tag LOCUS_14890 254 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1202 1831 gene locus_tag LOCUS_14900 1202 1831 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055744452.1 protein_id gnl|my_center|LOCUS_14900 1888 2841 gene locus_tag LOCUS_14910 1888 2841 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_14910 2888 2962 gene locus_tag LOCUS_t00330 2888 2962 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3066 3335 gene locus_tag LOCUS_14920 3066 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3557 5485 gene locus_tag LOCUS_14930 3557 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence050 332 1201 gene locus_tag LOCUS_14940 332 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1297 2583 gene locus_tag LOCUS_14950 1297 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3542 2637 gene locus_tag LOCUS_14960 3542 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3966 3640 gene locus_tag LOCUS_14970 3966 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence051 29 160 gene locus_tag LOCUS_14980 29 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1890 556 gene locus_tag LOCUS_14990 1890 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3046 1883 gene locus_tag LOCUS_15000 3046 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 4565 3033 gene locus_tag LOCUS_15010 4565 3033 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence052 1391 1687 gene locus_tag LOCUS_15020 1391 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2188 1736 gene locus_tag LOCUS_15030 2188 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2625 2927 gene locus_tag LOCUS_15040 2625 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3342 4679 gene locus_tag LOCUS_15050 3342 4679 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence053 197 781 gene locus_tag LOCUS_15060 197 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence054 599 2023 gene locus_tag LOCUS_15070 599 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2028 2165 gene locus_tag LOCUS_15080 2028 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence055 275 1879 gene locus_tag LOCUS_15090 275 1879 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_15090 1951 2229 gene locus_tag LOCUS_15100 1951 2229 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359333.1 protein_id gnl|my_center|LOCUS_15100 2858 2301 gene locus_tag LOCUS_15110 gene mscL 2858 2301 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_15110 2995 3186 gene locus_tag LOCUS_15120 2995 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence056 <1 1283 gene locus_tag LOCUS_15130 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109314215.1:ATP-binding domain-containing protein 2992 1400 gene locus_tag LOCUS_15140 2992 1400 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_15140 3434 3087 gene locus_tag LOCUS_15150 gene tnpB 3434 3087 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_15150 3727 3431 gene locus_tag LOCUS_15160 3727 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence057 2526 112 gene locus_tag LOCUS_15170 2526 112 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_15170 3079 2495 gene locus_tag LOCUS_15180 3079 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence058 1643 291 gene locus_tag LOCUS_15190 1643 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence059 956 540 gene locus_tag LOCUS_15200 956 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1017 2549 gene locus_tag LOCUS_15210 1017 2549 CDS product IS1182-like element ISMac20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755940.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence060 533 84 gene locus_tag LOCUS_15220 533 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1505 537 gene locus_tag LOCUS_15230 1505 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1718 3118 gene locus_tag LOCUS_15240 1718 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence061 1021 575 gene locus_tag LOCUS_15250 1021 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1284 1571 gene locus_tag LOCUS_15260 1284 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1709 2254 gene locus_tag LOCUS_15270 1709 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2264 2428 gene locus_tag LOCUS_15280 2264 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2441 2764 gene locus_tag LOCUS_15290 2441 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2761 3072 gene locus_tag LOCUS_15300 2761 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence062 1479 136 gene locus_tag LOCUS_15310 1479 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3050 1722 gene locus_tag LOCUS_15320 3050 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence063 >Feature sequence064 2068 233 gene locus_tag LOCUS_15330 2068 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2548 2276 gene locus_tag LOCUS_15340 2548 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence065 1398 22 gene locus_tag LOCUS_15350 1398 22 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298085.1 protein_id gnl|my_center|LOCUS_15350 2054 1410 gene locus_tag LOCUS_15360 2054 1410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_15360 <3088 2065 gene locus_tag LOCUS_15370 <3088 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009889836.1:ABC transporter permease >Feature sequence066 348 707 gene locus_tag LOCUS_15380 348 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 709 1791 gene locus_tag LOCUS_15390 gene spoIVB 709 1791 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_15390 2111 2410 gene locus_tag LOCUS_15400 2111 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2600 2923 gene locus_tag LOCUS_15410 2600 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15410 >Feature sequence067 2275 1202 gene locus_tag LOCUS_15420 2275 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence068 1327 794 gene locus_tag LOCUS_15430 gene bph 1327 794 CDS product biofilm phosphatase Bph inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355538.1 protein_id gnl|my_center|LOCUS_15430 2619 1453 gene locus_tag LOCUS_15440 2619 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence069 >Feature sequence070 1753 551 gene locus_tag LOCUS_15450 1753 551 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674962.1 protein_id gnl|my_center|LOCUS_15450 2143 2451 gene locus_tag LOCUS_15460 2143 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 >Feature sequence071 >Feature sequence072 <1 1765 gene locus_tag LOCUS_15470 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001178115.1:SpaA isopeptide-forming pilin-related protein >Feature sequence073 901 1047 gene locus_tag LOCUS_15480 901 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence074 >Feature sequence075 205 1605 gene locus_tag LOCUS_15490 205 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence076 540 214 gene locus_tag LOCUS_15500 540 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15500 1162 443 gene locus_tag LOCUS_15510 1162 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence077 1746 145 gene locus_tag LOCUS_15520 1746 145 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence078 >Feature sequence079 25 315 gene locus_tag LOCUS_15530 25 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 528 1457 gene locus_tag LOCUS_15540 528 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence080 852 256 gene locus_tag LOCUS_15550 852 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1084 1647 gene locus_tag LOCUS_15560 1084 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence081 1599 241 gene locus_tag LOCUS_15570 1599 241 CDS product IS30-like element ISSag9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160532.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence082 1476 154 gene locus_tag LOCUS_15580 1476 154 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963981.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence083 127 1641 gene locus_tag LOCUS_15590 127 1641 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649719.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence084 >Feature sequence085 1227 199 gene locus_tag LOCUS_15600 1227 199 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence086 >Feature sequence087 1542 217 gene locus_tag LOCUS_15610 1542 217 CDS product ISNCY-like element ISTde1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679811.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence088 1283 87 gene locus_tag LOCUS_15620 1283 87 CDS product IS30-like element ISSmi1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163007.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence089 >Feature sequence090 1422 52 gene locus_tag LOCUS_15630 1422 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence091 894 169 gene locus_tag LOCUS_15640 894 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15640 1446 970 gene locus_tag LOCUS_15650 1446 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence092 120 911 gene locus_tag LOCUS_15660 120 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence093 1278 52 gene locus_tag LOCUS_15670 1278 52 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence094 101 541 gene locus_tag LOCUS_15680 101 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15680 742 1422 gene locus_tag LOCUS_15690 742 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15690 >Feature sequence095 119 1387 gene locus_tag LOCUS_15700 119 1387 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627060.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence096 54 560 gene locus_tag LOCUS_15710 54 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15710 593 1414 gene locus_tag LOCUS_15720 593 1414 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148335055.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence097 >Feature sequence098 177 1286 gene locus_tag LOCUS_15730 177 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence099 679 1074 gene locus_tag LOCUS_15740 679 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence100 1148 132 gene locus_tag LOCUS_15750 1148 132 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192459600.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence101 <1199 451 gene locus_tag LOCUS_15760 <1199 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956797.1:ABC transporter permease >Feature sequence102 >Feature sequence103 >Feature sequence104 120 1085 gene locus_tag LOCUS_15770 120 1085 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102964529.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence105 >Feature sequence106 >Feature sequence107 856 62 gene locus_tag LOCUS_15780 856 62 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822608.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence108 >Feature sequence109 >Feature sequence110 194 691 gene locus_tag LOCUS_15790 194 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence111