>Feature sequence01 <1 1016 gene locus_tag LOCUS_0010 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528163.1:sugar ABC transporter substrate-binding protein 1169 2434 gene locus_tag LOCUS_0020 1169 2434 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_0020 3083 2418 gene locus_tag LOCUS_0030 3083 2418 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_0030 3590 3087 gene locus_tag LOCUS_0040 3590 3087 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527976.1 protein_id gnl|my_center|LOCUS_0040 3589 5889 gene locus_tag LOCUS_0050 3589 5889 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 protein_id gnl|my_center|LOCUS_0050 5882 7174 gene locus_tag LOCUS_0060 5882 7174 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531483.1 protein_id gnl|my_center|LOCUS_0060 8161 7199 gene locus_tag LOCUS_0070 8161 7199 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132772.1 protein_id gnl|my_center|LOCUS_0070 9761 8196 gene locus_tag LOCUS_0080 gene purH 9761 8196 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_0080 10348 9758 gene locus_tag LOCUS_0090 gene purN 10348 9758 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 protein_id gnl|my_center|LOCUS_0090 11089 10391 gene locus_tag LOCUS_0100 11089 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 12258 11089 gene locus_tag LOCUS_0110 12258 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 13276 12518 gene locus_tag LOCUS_0120 13276 12518 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803785.1 protein_id gnl|my_center|LOCUS_0120 14177 13308 gene locus_tag LOCUS_0130 gene sucD 14177 13308 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_0130 15376 14189 gene locus_tag LOCUS_0140 gene sucC 15376 14189 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222715.1 protein_id gnl|my_center|LOCUS_0140 15807 15391 gene locus_tag LOCUS_0150 15807 15391 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_0150 16050 16658 gene locus_tag LOCUS_0160 16050 16658 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742094.1 protein_id gnl|my_center|LOCUS_0160 16705 18081 gene locus_tag LOCUS_0170 16705 18081 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804449.1 protein_id gnl|my_center|LOCUS_0170 20339 18105 gene locus_tag LOCUS_0180 gene pcrA 20339 18105 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_0180 21845 20424 gene locus_tag LOCUS_0190 21845 20424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 22022 22744 gene locus_tag LOCUS_0200 22022 22744 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_0200 23199 22759 gene locus_tag LOCUS_0210 23199 22759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 protein_id gnl|my_center|LOCUS_0210 23346 23594 gene locus_tag LOCUS_0220 23346 23594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 23604 24476 gene locus_tag LOCUS_0230 23604 24476 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_0230 24463 25608 gene locus_tag LOCUS_0240 24463 25608 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_0240 25610 25906 gene locus_tag LOCUS_0250 25610 25906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 25903 26331 gene locus_tag LOCUS_0260 25903 26331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 26757 26395 gene locus_tag LOCUS_0270 26757 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 27029 26754 gene locus_tag LOCUS_0280 27029 26754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 27285 27031 gene locus_tag LOCUS_0290 27285 27031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 27521 27294 gene locus_tag LOCUS_0300 27521 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 27784 27530 gene locus_tag LOCUS_0310 27784 27530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 28385 27795 gene locus_tag LOCUS_0320 28385 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 29350 28379 gene locus_tag LOCUS_0330 29350 28379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 31730 29352 gene locus_tag LOCUS_0340 31730 29352 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 protein_id gnl|my_center|LOCUS_0340 32263 31730 gene locus_tag LOCUS_0350 32263 31730 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_0350 33140 32265 gene locus_tag LOCUS_0360 33140 32265 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_0360 33458 33228 gene locus_tag LOCUS_0370 33458 33228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 34448 33555 gene locus_tag LOCUS_0380 34448 33555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 36165 34579 gene locus_tag LOCUS_0390 gene guaA 36165 34579 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080654.1 protein_id gnl|my_center|LOCUS_0390 36457 36176 gene locus_tag LOCUS_0400 36457 36176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 36497 36643 gene locus_tag LOCUS_0410 36497 36643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 38476 36749 gene locus_tag LOCUS_0420 38476 36749 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_0420 40008 38485 gene locus_tag LOCUS_0430 40008 38485 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_0430 41129 40017 gene locus_tag LOCUS_0440 41129 40017 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_0440 42628 41132 gene locus_tag LOCUS_0450 gene guaB 42628 41132 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222684.1 protein_id gnl|my_center|LOCUS_0450 43448 42642 gene locus_tag LOCUS_0460 43448 42642 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978674.1 protein_id gnl|my_center|LOCUS_0460 43822 44118 gene locus_tag LOCUS_0470 43822 44118 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222678.1 protein_id gnl|my_center|LOCUS_0470 45829 44204 gene locus_tag LOCUS_0480 gene groL 45829 44204 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804492.1 protein_id gnl|my_center|LOCUS_0480 46307 46008 gene locus_tag LOCUS_0490 gene groES 46307 46008 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056050.1 protein_id gnl|my_center|LOCUS_0490 46465 47730 gene locus_tag LOCUS_0500 46465 47730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 48785 47745 gene locus_tag LOCUS_0510 gene tsaD 48785 47745 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_0510 49243 48782 gene locus_tag LOCUS_0520 gene rimI 49243 48782 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_0520 49977 49243 gene locus_tag LOCUS_0530 gene tsaB 49977 49243 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222662.1 protein_id gnl|my_center|LOCUS_0530 50459 49974 gene locus_tag LOCUS_0540 gene tsaE 50459 49974 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_0540 51529 50456 gene locus_tag LOCUS_0550 51529 50456 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_0550 52704 51559 gene locus_tag LOCUS_0560 gene alr 52704 51559 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_0560 54203 52701 gene locus_tag LOCUS_0570 54203 52701 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_0570 56053 54203 gene locus_tag LOCUS_0580 gene glmS 56053 54203 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_0580 57496 56147 gene locus_tag LOCUS_0590 gene glmM 57496 56147 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_0590 57999 57505 gene locus_tag LOCUS_0600 gene rpsI 57999 57505 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_0600 58470 58027 gene locus_tag LOCUS_0610 gene rplM 58470 58027 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004560141.1 protein_id gnl|my_center|LOCUS_0610 58993 58661 gene locus_tag LOCUS_0620 58993 58661 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234816983.1 protein_id gnl|my_center|LOCUS_0620 59862 59029 gene locus_tag LOCUS_0630 gene truA 59862 59029 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_0630 60459 59914 gene locus_tag LOCUS_0640 gene rplQ 60459 59914 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974243.1 protein_id gnl|my_center|LOCUS_0640 61566 60511 gene locus_tag LOCUS_0650 61566 60511 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_0650 62276 61650 gene locus_tag LOCUS_0660 gene rpsD 62276 61650 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_0660 62706 62308 gene locus_tag LOCUS_0670 gene rpsK 62706 62308 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_0670 63139 62768 gene locus_tag LOCUS_0680 gene rpsM 63139 62768 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 protein_id gnl|my_center|LOCUS_0680 63756 63475 gene locus_tag LOCUS_0690 gene infA 63756 63475 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_0690 64471 63896 gene locus_tag LOCUS_0700 64471 63896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 65588 64806 gene locus_tag LOCUS_0710 gene map 65588 64806 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_0710 66154 65588 gene locus_tag LOCUS_0720 66154 65588 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776356.1 protein_id gnl|my_center|LOCUS_0720 67461 66163 gene locus_tag LOCUS_0730 gene secY 67461 66163 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_0730 68012 67572 gene locus_tag LOCUS_0740 gene rplO 68012 67572 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055720.1 protein_id gnl|my_center|LOCUS_0740 68196 68014 gene locus_tag LOCUS_0750 gene rpmD 68196 68014 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_0750 68780 68196 gene locus_tag LOCUS_0760 gene rpsE 68780 68196 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_0760 69196 68807 gene locus_tag LOCUS_0770 gene rplR 69196 68807 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_0770 69735 69199 gene locus_tag LOCUS_0780 gene rplF 69735 69199 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_0780 70145 69747 gene locus_tag LOCUS_0790 gene rpsH 70145 69747 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_0790 70390 70205 gene locus_tag LOCUS_0800 70390 70205 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892855.1 protein_id gnl|my_center|LOCUS_0800 70951 70394 gene locus_tag LOCUS_0810 gene rplE 70951 70394 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_0810 71313 70951 gene locus_tag LOCUS_0820 gene rplX 71313 70951 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403654.1 protein_id gnl|my_center|LOCUS_0820 71684 71316 gene locus_tag LOCUS_0830 gene rplN 71684 71316 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004558867.1 protein_id gnl|my_center|LOCUS_0830 72036 71764 gene locus_tag LOCUS_0840 gene rpsQ 72036 71764 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_0840 72293 72033 gene locus_tag LOCUS_0850 gene rpmC 72293 72033 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_0850 72715 72293 gene locus_tag LOCUS_0860 gene rplP 72715 72293 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_0860 73545 72718 gene locus_tag LOCUS_0870 gene rpsC 73545 72718 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776371.1 protein_id gnl|my_center|LOCUS_0870 74231 73548 gene locus_tag LOCUS_0880 74231 73548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 74568 74287 gene locus_tag LOCUS_0890 gene rpsS 74568 74287 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_0890 75416 74580 gene locus_tag LOCUS_0900 gene rplB 75416 74580 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102084.1 protein_id gnl|my_center|LOCUS_0900 75754 75455 gene locus_tag LOCUS_0910 75754 75455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 76425 75751 gene locus_tag LOCUS_0920 gene rplD 76425 75751 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_0920 77084 76422 gene locus_tag LOCUS_0930 gene rplC 77084 76422 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_0930 77403 77095 gene locus_tag LOCUS_0940 gene rpsJ 77403 77095 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_0940 78733 77537 gene locus_tag LOCUS_0950 gene tuf 78733 77537 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_0950 80917 78818 gene locus_tag LOCUS_0960 gene fusA 80917 78818 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_0960 81424 80954 gene locus_tag LOCUS_0970 gene rpsG 81424 80954 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102106.1 protein_id gnl|my_center|LOCUS_0970 >Feature sequence02 762 259 gene locus_tag LOCUS_0980 762 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 934 1125 gene locus_tag LOCUS_0990 934 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 1287 1883 gene locus_tag LOCUS_1000 1287 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 2362 2276 gene locus_tag LOCUS_t0010 2362 2276 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2428 3762 gene locus_tag LOCUS_1010 2428 3762 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_1010 3966 3769 gene locus_tag LOCUS_1020 3966 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 4976 3996 gene locus_tag LOCUS_1030 4976 3996 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_1030 5034 6083 gene locus_tag LOCUS_1040 5034 6083 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226472.1 protein_id gnl|my_center|LOCUS_1040 6083 6916 gene locus_tag LOCUS_1050 6083 6916 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226473.1 protein_id gnl|my_center|LOCUS_1050 6979 7662 gene locus_tag LOCUS_1060 6979 7662 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_1060 7655 8224 gene locus_tag LOCUS_1070 7655 8224 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_1070 8221 9063 gene locus_tag LOCUS_1080 8221 9063 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_1080 9223 10335 gene locus_tag LOCUS_1090 gene mshC 9223 10335 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_1090 10366 12024 gene locus_tag LOCUS_1100 gene pgi 10366 12024 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013928.1 protein_id gnl|my_center|LOCUS_1100 12903 12058 gene locus_tag LOCUS_1110 gene parJ 12903 12058 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_1110 13850 12900 gene locus_tag LOCUS_1120 13850 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 14243 14572 gene locus_tag LOCUS_1130 14243 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 15502 14615 gene locus_tag LOCUS_1140 15502 14615 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_1140 15648 16514 gene locus_tag LOCUS_1150 15648 16514 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_1150 16547 18214 gene locus_tag LOCUS_1160 gene arc 16547 18214 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_1160 18260 19780 gene locus_tag LOCUS_1170 gene dop 18260 19780 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_1170 19798 19998 gene locus_tag LOCUS_1180 19798 19998 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_1180 19995 20843 gene locus_tag LOCUS_1190 gene prcB 19995 20843 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_1190 20840 21535 gene locus_tag LOCUS_1200 gene prcA 20840 21535 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_1200 21575 22939 gene locus_tag LOCUS_1210 gene pafA 21575 22939 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_1210 22961 23539 gene locus_tag LOCUS_1220 22961 23539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 23572 23934 gene locus_tag LOCUS_1230 23572 23934 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897079.1 protein_id gnl|my_center|LOCUS_1230 23924 24904 gene locus_tag LOCUS_1240 23924 24904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 24901 25857 gene locus_tag LOCUS_1250 24901 25857 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080095.1 protein_id gnl|my_center|LOCUS_1250 25906 26217 gene locus_tag LOCUS_1260 25906 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 26265 27062 gene locus_tag LOCUS_1270 gene tatC 26265 27062 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_1270 27059 28006 gene locus_tag LOCUS_1280 27059 28006 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_1280 28017 30770 gene locus_tag LOCUS_1290 28017 30770 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_1290 31690 30752 gene locus_tag LOCUS_1300 31690 30752 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_1300 31759 32841 gene locus_tag LOCUS_1310 31759 32841 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_1310 32838 34463 gene locus_tag LOCUS_1320 32838 34463 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_1320 34456 35988 gene locus_tag LOCUS_1330 gene lnt 34456 35988 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_1330 36041 36817 gene locus_tag LOCUS_1340 36041 36817 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_1340 36823 37356 gene locus_tag LOCUS_1350 36823 37356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 37432 37791 gene locus_tag LOCUS_1360 37432 37791 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805194.1 protein_id gnl|my_center|LOCUS_1360 38141 37854 gene locus_tag LOCUS_1370 38141 37854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 39601 38165 gene locus_tag LOCUS_1380 gene argG 39601 38165 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_1380 42646 39809 gene locus_tag LOCUS_1390 gene gcvP 42646 39809 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_1390 43498 42914 gene locus_tag LOCUS_1400 43498 42914 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_1400 44192 43662 gene locus_tag LOCUS_1410 44192 43662 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_1410 45006 44299 gene locus_tag LOCUS_1420 45006 44299 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_1420 45482 45003 gene locus_tag LOCUS_1430 45482 45003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 45924 45529 gene locus_tag LOCUS_1440 gene gcvH 45924 45529 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899040.1 protein_id gnl|my_center|LOCUS_1440 46630 46007 gene locus_tag LOCUS_1450 46630 46007 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908707.1 protein_id gnl|my_center|LOCUS_1450 47493 46726 gene locus_tag LOCUS_1460 47493 46726 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222221.1 protein_id gnl|my_center|LOCUS_1460 48989 47493 gene locus_tag LOCUS_1470 48989 47493 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_1470 49771 48986 gene locus_tag LOCUS_1480 49771 48986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_1480 49844 51094 gene locus_tag LOCUS_1490 gene serB 49844 51094 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_1490 51890 51123 gene locus_tag LOCUS_1500 gene fabI 51890 51123 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_1500 52616 51900 gene locus_tag LOCUS_1510 gene fabG 52616 51900 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_1510 >Feature sequence03 <1 513 gene locus_tag LOCUS_1520 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289079.1:ABC transporter ATP-binding protein 559 1716 gene locus_tag LOCUS_1530 559 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 1713 3506 gene locus_tag LOCUS_1540 1713 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 3503 4315 gene locus_tag LOCUS_1550 3503 4315 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_1550 4315 5175 gene locus_tag LOCUS_1560 4315 5175 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_1560 6661 5228 gene locus_tag LOCUS_1570 6661 5228 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518416.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_1570 7069 8856 gene locus_tag LOCUS_1580 7069 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 9539 8853 gene locus_tag LOCUS_1590 9539 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 9572 10666 gene locus_tag LOCUS_1600 9572 10666 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_1600 12049 10676 gene locus_tag LOCUS_1610 12049 10676 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_1610 13389 12046 gene locus_tag LOCUS_1620 13389 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_1620 13384 13608 gene locus_tag LOCUS_1630 13384 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 14071 13559 gene locus_tag LOCUS_1640 14071 13559 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457918.1 protein_id gnl|my_center|LOCUS_1640 15111 14083 gene locus_tag LOCUS_1650 gene cofD 15111 14083 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222933.1 protein_id gnl|my_center|LOCUS_1650 15339 15614 gene locus_tag LOCUS_1660 15339 15614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 15646 19071 gene locus_tag LOCUS_1670 15646 19071 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_1670 19068 20591 gene locus_tag LOCUS_1680 19068 20591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 20678 21295 gene locus_tag LOCUS_1690 20678 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 21358 22758 gene locus_tag LOCUS_1700 21358 22758 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_1700 22755 22976 gene locus_tag LOCUS_1710 22755 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 22973 24094 gene locus_tag LOCUS_1720 gene manA 22973 24094 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_1720 24257 25711 gene locus_tag LOCUS_1730 gene ahcY 24257 25711 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_1730 26741 25806 gene locus_tag LOCUS_1740 26741 25806 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027120.1 protein_id gnl|my_center|LOCUS_1740 27403 26738 gene locus_tag LOCUS_1750 27403 26738 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104243.1 protein_id gnl|my_center|LOCUS_1750 28203 27430 gene locus_tag LOCUS_1760 28203 27430 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869459.1 protein_id gnl|my_center|LOCUS_1760 28631 28227 gene locus_tag LOCUS_1770 28631 28227 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_1770 29328 28633 gene locus_tag LOCUS_1780 29328 28633 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_1780 29839 30660 gene locus_tag LOCUS_1790 29839 30660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 30665 31378 gene locus_tag LOCUS_1800 gene mtrA 30665 31378 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_1800 31380 33107 gene locus_tag LOCUS_1810 31380 33107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 33104 34822 gene locus_tag LOCUS_1820 gene lpqB 33104 34822 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727973.1 protein_id gnl|my_center|LOCUS_1820 35120 34830 gene locus_tag LOCUS_1830 35120 34830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 36266 35604 gene locus_tag LOCUS_1840 36266 35604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 36405 39239 gene locus_tag LOCUS_1850 gene secA 36405 39239 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_1850 >Feature sequence04 1546 806 gene locus_tag LOCUS_1860 1546 806 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_1860 2207 1527 gene locus_tag LOCUS_1870 2207 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 3727 2279 gene locus_tag LOCUS_1880 3727 2279 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384638.1 protein_id gnl|my_center|LOCUS_1880 5506 3857 gene locus_tag LOCUS_1890 5506 3857 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_1890 6546 5509 gene locus_tag LOCUS_1900 6546 5509 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974942.1 protein_id gnl|my_center|LOCUS_1900 7637 6660 gene locus_tag LOCUS_1910 7637 6660 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896811.1 protein_id gnl|my_center|LOCUS_1910 8145 7630 gene locus_tag LOCUS_1920 8145 7630 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_1920 8577 8155 gene locus_tag LOCUS_1930 gene divIC 8577 8155 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 protein_id gnl|my_center|LOCUS_1930 10148 8730 gene locus_tag LOCUS_1940 gene eno 10148 8730 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896814.1 protein_id gnl|my_center|LOCUS_1940 10069 10584 gene locus_tag LOCUS_1950 10069 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 10879 10586 gene locus_tag LOCUS_1960 10879 10586 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_1960 11002 11232 gene locus_tag LOCUS_1970 11002 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 13907 11115 gene locus_tag LOCUS_1980 gene fdhF 13907 11115 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_1980 15447 13909 gene locus_tag LOCUS_1990 15447 13909 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726708.1 protein_id gnl|my_center|LOCUS_1990 15932 15444 gene locus_tag LOCUS_2000 15932 15444 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726707.1 protein_id gnl|my_center|LOCUS_2000 16843 15929 gene locus_tag LOCUS_2010 gene fdhD 16843 15929 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084892.1 protein_id gnl|my_center|LOCUS_2010 18534 16846 gene locus_tag LOCUS_2020 18534 16846 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 protein_id gnl|my_center|LOCUS_2020 19509 18547 gene locus_tag LOCUS_2030 19509 18547 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_2030 20264 19506 gene locus_tag LOCUS_2040 20264 19506 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214510.1 protein_id gnl|my_center|LOCUS_2040 22792 20264 gene locus_tag LOCUS_2050 22792 20264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775989.1 protein_id gnl|my_center|LOCUS_2050 23485 22835 gene locus_tag LOCUS_2060 23485 22835 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_2060 24123 23536 gene locus_tag LOCUS_2070 24123 23536 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_2070 26090 24138 gene locus_tag LOCUS_2080 26090 24138 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_2080 26956 26087 gene locus_tag LOCUS_2090 26956 26087 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_2090 27297 26980 gene locus_tag LOCUS_2100 27297 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 27671 27297 gene locus_tag LOCUS_2110 27671 27297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 28330 27674 gene locus_tag LOCUS_2120 28330 27674 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_2120 29205 28327 gene locus_tag LOCUS_2130 29205 28327 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623951.1 protein_id gnl|my_center|LOCUS_2130 29260 30699 gene locus_tag LOCUS_2140 29260 30699 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_2140 30812 32356 gene locus_tag LOCUS_2150 30812 32356 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029620.1 protein_id gnl|my_center|LOCUS_2150 32502 33689 gene locus_tag LOCUS_2160 32502 33689 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_2160 33789 34628 gene locus_tag LOCUS_2170 33789 34628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 34625 34972 gene locus_tag LOCUS_2180 34625 34972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 36432 35227 gene locus_tag LOCUS_2190 36432 35227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_2190 37121 36429 gene locus_tag LOCUS_2200 37121 36429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_2200 38878 37118 gene locus_tag LOCUS_2210 38878 37118 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257054.1 protein_id gnl|my_center|LOCUS_2210 <40054 38963 gene locus_tag LOCUS_2220 <40054 38963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037762.1:DUF885 domain-containing protein >Feature sequence05 2 721 gene locus_tag LOCUS_2230 2 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 731 1627 gene locus_tag LOCUS_2240 gene argB 731 1627 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_2240 1624 2790 gene locus_tag LOCUS_2250 1624 2790 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_2250 2787 3281 gene locus_tag LOCUS_2260 2787 3281 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_2260 3285 4697 gene locus_tag LOCUS_2270 gene argH 3285 4697 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227831.1 protein_id gnl|my_center|LOCUS_2270 4702 5061 gene locus_tag LOCUS_2280 4702 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 5666 5115 gene locus_tag LOCUS_2290 5666 5115 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_2290 5563 5766 gene locus_tag LOCUS_2300 5563 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 5763 7094 gene locus_tag LOCUS_2310 gene tyrS 5763 7094 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_2310 7444 8964 gene locus_tag LOCUS_r0010 7444 8964 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 9318 12422 gene locus_tag LOCUS_r0020 9318 12422 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 12496 12606 gene locus_tag LOCUS_r0030 12496 12606 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 12679 13482 gene locus_tag LOCUS_2320 12679 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408379.1 protein_id gnl|my_center|LOCUS_2320 14504 13533 gene locus_tag LOCUS_2330 14504 13533 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_2330 14619 15104 gene locus_tag LOCUS_2340 14619 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 15110 16087 gene locus_tag LOCUS_2350 15110 16087 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804972.1 protein_id gnl|my_center|LOCUS_2350 16166 16570 gene locus_tag LOCUS_2360 16166 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 16567 16893 gene locus_tag LOCUS_2370 16567 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 16903 17769 gene locus_tag LOCUS_2380 16903 17769 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_2380 17766 18686 gene locus_tag LOCUS_2390 17766 18686 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227821.1 protein_id gnl|my_center|LOCUS_2390 18697 20436 gene locus_tag LOCUS_2400 gene recN 18697 20436 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_2400 20460 22151 gene locus_tag LOCUS_2410 20460 22151 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_2410 22158 22850 gene locus_tag LOCUS_2420 22158 22850 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_2420 22913 24028 gene locus_tag LOCUS_2430 gene ald 22913 24028 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_2430 24044 24994 gene locus_tag LOCUS_2440 gene xerD 24044 24994 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_2440 25021 25863 gene locus_tag LOCUS_2450 25021 25863 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_2450 25860 26774 gene locus_tag LOCUS_2460 25860 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 26771 27433 gene locus_tag LOCUS_2470 gene scpB 26771 27433 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_2470 27426 28208 gene locus_tag LOCUS_2480 27426 28208 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_2480 28252 28623 gene locus_tag LOCUS_2490 gene aroH 28252 28623 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_2490 28620 29708 gene locus_tag LOCUS_2500 28620 29708 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_2500 29713 30429 gene locus_tag LOCUS_2510 gene cmk 29713 30429 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_2510 30433 31005 gene locus_tag LOCUS_2520 30433 31005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 31002 32531 gene locus_tag LOCUS_2530 gene der 31002 32531 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_2530 32868 32548 gene locus_tag LOCUS_2540 32868 32548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 33016 33453 gene locus_tag LOCUS_2550 33016 33453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 >Feature sequence06 403 242 gene locus_tag LOCUS_2560 403 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 661 416 gene locus_tag LOCUS_2570 661 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 1198 2520 gene locus_tag LOCUS_2580 1198 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 2672 3451 gene locus_tag LOCUS_2590 gene gluQRS 2672 3451 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406656.1 protein_id gnl|my_center|LOCUS_2590 3659 3399 gene locus_tag LOCUS_2600 3659 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 3785 4597 gene locus_tag LOCUS_2610 3785 4597 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224992.1 protein_id gnl|my_center|LOCUS_2610 5130 4594 gene locus_tag LOCUS_2620 5130 4594 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_2620 5316 5774 gene locus_tag LOCUS_2630 gene msrB 5316 5774 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_2630 5866 6459 gene locus_tag LOCUS_2640 5866 6459 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_2640 6456 7727 gene locus_tag LOCUS_2650 6456 7727 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_2650 7778 8968 gene locus_tag LOCUS_2660 7778 8968 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224501.1 protein_id gnl|my_center|LOCUS_2660 8965 11049 gene locus_tag LOCUS_2670 8965 11049 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224500.1 protein_id gnl|my_center|LOCUS_2670 12949 11000 gene locus_tag LOCUS_2680 gene dxs 12949 11000 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_2680 15700 13031 gene locus_tag LOCUS_2690 gene acnA 15700 13031 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_2690 17096 15729 gene locus_tag LOCUS_2700 17096 15729 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728572.1 protein_id gnl|my_center|LOCUS_2700 17099 17752 gene locus_tag LOCUS_2710 17099 17752 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_2710 17759 18415 gene locus_tag LOCUS_2720 17759 18415 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_2720 19163 18438 gene locus_tag LOCUS_2730 19163 18438 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111515.1 protein_id gnl|my_center|LOCUS_2730 19617 19171 gene locus_tag LOCUS_2740 19617 19171 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057265.1 protein_id gnl|my_center|LOCUS_2740 20384 19617 gene locus_tag LOCUS_2750 20384 19617 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805053.1 protein_id gnl|my_center|LOCUS_2750 20873 20433 gene locus_tag LOCUS_2760 gene dut 20873 20433 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_2760 20968 21450 gene locus_tag LOCUS_2770 20968 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 21542 21898 gene locus_tag LOCUS_2780 21542 21898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 22207 21911 gene locus_tag LOCUS_2790 22207 21911 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_2790 22325 22843 gene locus_tag LOCUS_2800 22325 22843 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223643.1 protein_id gnl|my_center|LOCUS_2800 23734 22868 gene locus_tag LOCUS_2810 23734 22868 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_2810 23802 25076 gene locus_tag LOCUS_2820 23802 25076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_2820 25189 25920 gene locus_tag LOCUS_2830 25189 25920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2830 26595 25939 gene locus_tag LOCUS_2840 26595 25939 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_2840 27689 26628 gene locus_tag LOCUS_2850 27689 26628 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 protein_id gnl|my_center|LOCUS_2850 28288 27704 gene locus_tag LOCUS_2860 28288 27704 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_2860 28396 29244 gene locus_tag LOCUS_2870 28396 29244 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_2870 29273 30277 gene locus_tag LOCUS_2880 29273 30277 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_2880 30455 32980 gene locus_tag LOCUS_2890 30455 32980 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929932.1 protein_id gnl|my_center|LOCUS_2890 >Feature sequence07 1629 343 gene locus_tag LOCUS_2900 gene clpX 1629 343 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_2900 2427 1801 gene locus_tag LOCUS_2910 2427 1801 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930165.1 protein_id gnl|my_center|LOCUS_2910 3047 2424 gene locus_tag LOCUS_2920 3047 2424 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412275.1 protein_id gnl|my_center|LOCUS_2920 4481 3135 gene locus_tag LOCUS_2930 gene tig 4481 3135 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_2930 4594 4519 gene locus_tag LOCUS_t0020 4594 4519 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4742 4933 gene locus_tag LOCUS_2940 4742 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 5376 4930 gene locus_tag LOCUS_2950 5376 4930 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_2950 5501 5572 gene locus_tag LOCUS_t0030 5501 5572 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6837 5650 gene locus_tag LOCUS_2960 6837 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 6971 7777 gene locus_tag LOCUS_2970 6971 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 7749 8378 gene locus_tag LOCUS_2980 7749 8378 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391990.1 protein_id gnl|my_center|LOCUS_2980 8959 8375 gene locus_tag LOCUS_2990 8959 8375 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_2990 10170 8956 gene locus_tag LOCUS_3000 10170 8956 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_3000 10970 10167 gene locus_tag LOCUS_3010 10970 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 11177 11752 gene locus_tag LOCUS_3020 11177 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 12412 12029 gene locus_tag LOCUS_3030 12412 12029 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897694.1 protein_id gnl|my_center|LOCUS_3030 12519 12719 gene locus_tag LOCUS_3040 12519 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 12759 13070 gene locus_tag LOCUS_3050 12759 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 13886 13083 gene locus_tag LOCUS_3060 13886 13083 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_3060 14937 13879 gene locus_tag LOCUS_3070 14937 13879 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_3070 15065 17641 gene locus_tag LOCUS_3080 gene pepN 15065 17641 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_3080 18117 17722 gene locus_tag LOCUS_3090 18117 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 18436 20514 gene locus_tag LOCUS_3100 18436 20514 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922509.1 protein_id gnl|my_center|LOCUS_3100 20551 21573 gene locus_tag LOCUS_3110 20551 21573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 21610 23124 gene locus_tag LOCUS_3120 21610 23124 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_3120 23121 23552 gene locus_tag LOCUS_3130 23121 23552 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_3130 24297 23611 gene locus_tag LOCUS_3140 24297 23611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 24711 24313 gene locus_tag LOCUS_3150 24711 24313 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228953.1 protein_id gnl|my_center|LOCUS_3150 26408 24711 gene locus_tag LOCUS_3160 gene ettA 26408 24711 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_3160 27022 26543 gene locus_tag LOCUS_3170 27022 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 27178 28482 gene locus_tag LOCUS_3180 27178 28482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223123.1 protein_id gnl|my_center|LOCUS_3180 28514 29071 gene locus_tag LOCUS_3190 28514 29071 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814370.1 protein_id gnl|my_center|LOCUS_3190 29071 30819 gene locus_tag LOCUS_3200 29071 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 30831 31565 gene locus_tag LOCUS_3210 30831 31565 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528671.1 protein_id gnl|my_center|LOCUS_3210 31638 31711 gene locus_tag LOCUS_t0040 31638 31711 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32474 31788 gene locus_tag LOCUS_3220 32474 31788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 >Feature sequence08 1614 796 gene locus_tag LOCUS_3230 1614 796 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_3230 2207 1611 gene locus_tag LOCUS_3240 2207 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 3181 2324 gene locus_tag LOCUS_3250 gene rfbD 3181 2324 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_3250 4195 3197 gene locus_tag LOCUS_3260 gene rfbB 4195 3197 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_3260 5136 4195 gene locus_tag LOCUS_3270 gene pheA 5136 4195 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_3270 5519 5133 gene locus_tag LOCUS_3280 5519 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 5412 5657 gene locus_tag LOCUS_3290 5412 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 6625 5654 gene locus_tag LOCUS_3300 6625 5654 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_3300 7234 6647 gene locus_tag LOCUS_3310 7234 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 7139 7393 gene locus_tag LOCUS_3320 7139 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 7466 8125 gene locus_tag LOCUS_3330 7466 8125 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_3330 9324 8140 gene locus_tag LOCUS_3340 9324 8140 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219112755.1 protein_id gnl|my_center|LOCUS_3340 9600 10187 gene locus_tag LOCUS_3350 9600 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 10700 11359 gene locus_tag LOCUS_3360 10700 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 11375 11560 gene locus_tag LOCUS_3370 11375 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 12458 11646 gene locus_tag LOCUS_3380 12458 11646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 12658 13023 gene locus_tag LOCUS_3390 12658 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 13309 15000 gene locus_tag LOCUS_3400 13309 15000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 15129 16562 gene locus_tag LOCUS_3410 15129 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 16559 18790 gene locus_tag LOCUS_3420 16559 18790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 18909 20153 gene locus_tag LOCUS_3430 18909 20153 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_3430 21205 20156 gene locus_tag LOCUS_3440 21205 20156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 23331 21343 gene locus_tag LOCUS_3450 23331 21343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 23405 25213 gene locus_tag LOCUS_3460 23405 25213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 25197 25790 gene locus_tag LOCUS_3470 25197 25790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 26872 25769 gene locus_tag LOCUS_3480 26872 25769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 27105 27797 gene locus_tag LOCUS_3490 27105 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 29192 27753 gene locus_tag LOCUS_3500 29192 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 29249 30079 gene locus_tag LOCUS_3510 29249 30079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 30776 30054 gene locus_tag LOCUS_3520 30776 30054 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419147.1 protein_id gnl|my_center|LOCUS_3520 >Feature sequence09 <1 2288 gene locus_tag LOCUS_3530 <1 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109508967.1:ATP-dependent helicase 2275 3075 gene locus_tag LOCUS_3540 2275 3075 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_3540 3425 3111 gene locus_tag LOCUS_3550 3425 3111 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_3550 4057 3578 gene locus_tag LOCUS_3560 4057 3578 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228067.1 protein_id gnl|my_center|LOCUS_3560 4646 4077 gene locus_tag LOCUS_3570 gene pgsA 4646 4077 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894077.1 protein_id gnl|my_center|LOCUS_3570 6034 4631 gene locus_tag LOCUS_3580 gene rimO 6034 4631 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_3580 6379 6158 gene locus_tag LOCUS_3590 6379 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 8730 6514 gene locus_tag LOCUS_3600 8730 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 8657 8845 gene locus_tag LOCUS_3610 8657 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 9153 9377 gene locus_tag LOCUS_3620 9153 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 11187 9502 gene locus_tag LOCUS_3630 11187 9502 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_3630 12056 11190 gene locus_tag LOCUS_3640 gene dapA 12056 11190 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_3640 12884 12126 gene locus_tag LOCUS_3650 gene thyX 12884 12126 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_3650 12917 13492 gene locus_tag LOCUS_3660 12917 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 15319 13682 gene locus_tag LOCUS_3670 15319 13682 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_3670 15399 17033 gene locus_tag LOCUS_3680 15399 17033 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230146.1 protein_id gnl|my_center|LOCUS_3680 17126 17722 gene locus_tag LOCUS_3690 17126 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 17719 18030 gene locus_tag LOCUS_3700 17719 18030 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_3700 18477 18019 gene locus_tag LOCUS_3710 18477 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973287.1 protein_id gnl|my_center|LOCUS_3710 19242 18490 gene locus_tag LOCUS_3720 gene dapB 19242 18490 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414099.1 protein_id gnl|my_center|LOCUS_3720 20301 19324 gene locus_tag LOCUS_3730 20301 19324 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727630.1 protein_id gnl|my_center|LOCUS_3730 21397 20282 gene locus_tag LOCUS_3740 21397 20282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727629.1 protein_id gnl|my_center|LOCUS_3740 22149 21394 gene locus_tag LOCUS_3750 22149 21394 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892760.1 protein_id gnl|my_center|LOCUS_3750 23069 22164 gene locus_tag LOCUS_3760 gene yihT 23069 22164 CDS product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046464.1 protein_id gnl|my_center|LOCUS_3760 24466 23066 gene locus_tag LOCUS_3770 24466 23066 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727632.1 protein_id gnl|my_center|LOCUS_3770 25494 24463 gene locus_tag LOCUS_3780 25494 24463 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892757.1 protein_id gnl|my_center|LOCUS_3780 26495 25491 gene locus_tag LOCUS_3790 26495 25491 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258521.1 protein_id gnl|my_center|LOCUS_3790 27130 26600 gene locus_tag LOCUS_3800 27130 26600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 27219 28319 gene locus_tag LOCUS_3810 27219 28319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085836300.1 protein_id gnl|my_center|LOCUS_3810 29637 28324 gene locus_tag LOCUS_3820 29637 28324 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_3820 <30283 29641 gene locus_tag LOCUS_3830 <30283 29641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973290.1:polyribonucleotide nucleotidyltransferase >Feature sequence10 291 1031 gene locus_tag LOCUS_3840 291 1031 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974854.1 protein_id gnl|my_center|LOCUS_3840 1062 2138 gene locus_tag LOCUS_3850 1062 2138 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384656.1 protein_id gnl|my_center|LOCUS_3850 3051 2152 gene locus_tag LOCUS_3860 gene folP 3051 2152 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 protein_id gnl|my_center|LOCUS_3860 3177 3092 gene locus_tag LOCUS_t0050 3177 3092 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3868 3221 gene locus_tag LOCUS_3870 3868 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 3995 4486 gene locus_tag LOCUS_3880 3995 4486 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727465.1 protein_id gnl|my_center|LOCUS_3880 4811 4473 gene locus_tag LOCUS_3890 4811 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3890 5271 4804 gene locus_tag LOCUS_3900 5271 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 5687 5268 gene locus_tag LOCUS_3910 5687 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 5840 7714 gene locus_tag LOCUS_3920 5840 7714 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_3920 7711 8769 gene locus_tag LOCUS_3930 7711 8769 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_3930 8754 9719 gene locus_tag LOCUS_3940 gene rarD 8754 9719 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_3940 10761 9763 gene locus_tag LOCUS_3950 10761 9763 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_3950 12306 10774 gene locus_tag LOCUS_3960 gene nuoN 12306 10774 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_3960 13850 12303 gene locus_tag LOCUS_3970 13850 12303 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_3970 15742 13847 gene locus_tag LOCUS_3980 gene nuoL 15742 13847 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_3980 16065 15766 gene locus_tag LOCUS_3990 gene nuoK 16065 15766 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061219.1 protein_id gnl|my_center|LOCUS_3990 16856 16062 gene locus_tag LOCUS_4000 16856 16062 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_4000 17386 16853 gene locus_tag LOCUS_4010 gene nuoI 17386 16853 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899938.1 protein_id gnl|my_center|LOCUS_4010 18722 17379 gene locus_tag LOCUS_4020 gene nuoH 18722 17379 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_4020 21106 18719 gene locus_tag LOCUS_4030 21106 18719 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_4030 22413 21103 gene locus_tag LOCUS_4040 gene nuoF 22413 21103 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_4040 23051 22413 gene locus_tag LOCUS_4050 23051 22413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 24430 23075 gene locus_tag LOCUS_4060 24430 23075 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_4060 25134 24430 gene locus_tag LOCUS_4070 25134 24430 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_4070 25685 25131 gene locus_tag LOCUS_4080 25685 25131 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893431.1 protein_id gnl|my_center|LOCUS_4080 26046 25687 gene locus_tag LOCUS_4090 26046 25687 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_4090 26945 26220 gene locus_tag LOCUS_4100 26945 26220 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_4100 26925 28244 gene locus_tag LOCUS_4110 26925 28244 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_4110 <28810 28256 gene locus_tag LOCUS_4120 <28810 28256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014466562.1:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase >Feature sequence11 437 652 gene locus_tag LOCUS_4130 437 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4130 776 1198 gene locus_tag LOCUS_4140 776 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 1298 3085 gene locus_tag LOCUS_4150 1298 3085 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_4150 4200 3082 gene locus_tag LOCUS_4160 gene trpD 4200 3082 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224077.1 protein_id gnl|my_center|LOCUS_4160 4717 4235 gene locus_tag LOCUS_4170 4717 4235 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_4170 4902 5426 gene locus_tag LOCUS_4180 4902 5426 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_4180 5586 6248 gene locus_tag LOCUS_4190 5586 6248 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_4190 6245 7327 gene locus_tag LOCUS_4200 6245 7327 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_4200 7324 9081 gene locus_tag LOCUS_4210 7324 9081 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_4210 9180 11414 gene locus_tag LOCUS_4220 9180 11414 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_4220 12632 12261 gene locus_tag LOCUS_4230 12632 12261 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 protein_id gnl|my_center|LOCUS_4230 13136 12819 gene locus_tag LOCUS_4240 13136 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 14270 13407 gene locus_tag LOCUS_4250 14270 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_4250 16338 14359 gene locus_tag LOCUS_4260 16338 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 16874 16479 gene locus_tag LOCUS_4270 16874 16479 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_4270 18598 16871 gene locus_tag LOCUS_4280 gene ctaD 18598 16871 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_4280 19464 18595 gene locus_tag LOCUS_4290 gene coxB 19464 18595 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_4290 19617 20804 gene locus_tag LOCUS_4300 19617 20804 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_4300 21508 20801 gene locus_tag LOCUS_4310 gene aat 21508 20801 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_4310 22532 21540 gene locus_tag LOCUS_4320 22532 21540 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_4320 23006 22653 gene locus_tag LOCUS_4330 23006 22653 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_4330 23154 24344 gene locus_tag LOCUS_4340 gene nadA 23154 24344 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_4340 24934 24359 gene locus_tag LOCUS_4350 24934 24359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_4350 25853 24948 gene locus_tag LOCUS_4360 gene htpX 25853 24948 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_4360 26643 25915 gene locus_tag LOCUS_4370 26643 25915 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_4370 26767 27411 gene locus_tag LOCUS_4380 26767 27411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 >Feature sequence12 1126 386 gene locus_tag LOCUS_4390 1126 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 1319 1852 gene locus_tag LOCUS_4400 1319 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 1855 2808 gene locus_tag LOCUS_4410 1855 2808 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112688.1 protein_id gnl|my_center|LOCUS_4410 3269 6256 gene locus_tag LOCUS_4420 3269 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 6256 8781 gene locus_tag LOCUS_4430 6256 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 8783 9655 gene locus_tag LOCUS_4440 8783 9655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 9652 12708 gene locus_tag LOCUS_4450 9652 12708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 12695 13396 gene locus_tag LOCUS_4460 12695 13396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 13389 17768 gene locus_tag LOCUS_4470 13389 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 17765 18295 gene locus_tag LOCUS_4480 17765 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 18292 20481 gene locus_tag LOCUS_4490 18292 20481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 20465 20725 gene locus_tag LOCUS_4500 20465 20725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 20944 21366 gene locus_tag LOCUS_4510 20944 21366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 22220 21525 gene locus_tag LOCUS_4520 22220 21525 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080406.1 protein_id gnl|my_center|LOCUS_4520 >Feature sequence13 93 989 gene locus_tag LOCUS_4530 gene galU 93 989 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_4530 992 1606 gene locus_tag LOCUS_4540 992 1606 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_4540 1710 2588 gene locus_tag LOCUS_4550 1710 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 2616 2691 gene locus_tag LOCUS_t0060 2616 2691 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4360 2813 gene locus_tag LOCUS_4560 4360 2813 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_4560 4401 5273 gene locus_tag LOCUS_4570 gene rsmI 4401 5273 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_4570 5283 6911 gene locus_tag LOCUS_4580 gene metG 5283 6911 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_4580 6914 7774 gene locus_tag LOCUS_4590 6914 7774 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_4590 7820 8665 gene locus_tag LOCUS_4600 gene rsmA 7820 8665 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229977.1 protein_id gnl|my_center|LOCUS_4600 8682 9587 gene locus_tag LOCUS_4610 8682 9587 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405199.1 protein_id gnl|my_center|LOCUS_4610 10062 9571 gene locus_tag LOCUS_4620 gene tamR 10062 9571 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_4620 10900 10109 gene locus_tag LOCUS_4630 10900 10109 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_4630 11904 10897 gene locus_tag LOCUS_4640 11904 10897 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_4640 12064 12136 gene locus_tag LOCUS_t0070 12064 12136 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13255 12149 gene locus_tag LOCUS_4650 13255 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 13422 14873 gene locus_tag LOCUS_4660 gene glmU 13422 14873 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_4660 14874 15872 gene locus_tag LOCUS_4670 14874 15872 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_4670 16054 16644 gene locus_tag LOCUS_4680 16054 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 16691 17317 gene locus_tag LOCUS_4690 gene pth 16691 17317 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_4690 17314 18132 gene locus_tag LOCUS_4700 17314 18132 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_4700 >Feature sequence14 1865 1125 gene locus_tag LOCUS_4710 1865 1125 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742174.1 protein_id gnl|my_center|LOCUS_4710 1965 3002 gene locus_tag LOCUS_4720 1965 3002 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_4720 3970 3026 gene locus_tag LOCUS_4730 3970 3026 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805128.1 protein_id gnl|my_center|LOCUS_4730 4122 6200 gene locus_tag LOCUS_4740 gene tkt 4122 6200 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_4740 6197 7300 gene locus_tag LOCUS_4750 gene tal 6197 7300 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111302.1 protein_id gnl|my_center|LOCUS_4750 7657 7325 gene locus_tag LOCUS_4760 7657 7325 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_4760 7959 7717 gene locus_tag LOCUS_4770 gene secG 7959 7717 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224669.1 protein_id gnl|my_center|LOCUS_4770 8775 7984 gene locus_tag LOCUS_4780 gene tpiA 8775 7984 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_4780 10004 8772 gene locus_tag LOCUS_4790 10004 8772 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032737730.1 protein_id gnl|my_center|LOCUS_4790 11011 10007 gene locus_tag LOCUS_4800 gene gap 11011 10007 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_4800 12181 11198 gene locus_tag LOCUS_4810 gene whiA 12181 11198 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_4810 12996 12199 gene locus_tag LOCUS_4820 12996 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 13934 13071 gene locus_tag LOCUS_4830 gene rapZ 13934 13071 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_4830 15870 13945 gene locus_tag LOCUS_4840 gene uvrC 15870 13945 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_4840 16411 15881 gene locus_tag LOCUS_4850 16411 15881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 <17852 16449 gene locus_tag LOCUS_4860 <17852 16449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028066.1:excinuclease ABC subunit UvrA >Feature sequence15 1007 2740 gene locus_tag LOCUS_4870 1007 2740 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969849.1 protein_id gnl|my_center|LOCUS_4870 5946 7124 gene locus_tag LOCUS_4880 gene neuC 5946 7124 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_4880 7205 8545 gene locus_tag LOCUS_4890 7205 8545 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084529509.1 protein_id gnl|my_center|LOCUS_4890 8542 9522 gene locus_tag LOCUS_4900 8542 9522 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403376.1 protein_id gnl|my_center|LOCUS_4900 9519 10718 gene locus_tag LOCUS_4910 9519 10718 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_4910 10715 11407 gene locus_tag LOCUS_4920 10715 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 12405 11743 gene locus_tag LOCUS_4930 gene hisH 12405 11743 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946487.1 protein_id gnl|my_center|LOCUS_4930 13204 12386 gene locus_tag LOCUS_4940 gene wbuZ 13204 12386 CDS product glycosyl amidation-associated protein WbuZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213307.1 protein_id gnl|my_center|LOCUS_4940 14104 13217 gene locus_tag LOCUS_4950 14104 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 15517 16599 gene locus_tag LOCUS_4960 gene neuB 15517 16599 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088733.1 protein_id gnl|my_center|LOCUS_4960 16596 17243 gene locus_tag LOCUS_4970 16596 17243 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869453.1 protein_id gnl|my_center|LOCUS_4970 >Feature sequence16 690 277 gene locus_tag LOCUS_4980 690 277 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222764.1 protein_id gnl|my_center|LOCUS_4980 1085 687 gene locus_tag LOCUS_4990 gene sdhC 1085 687 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222765.1 protein_id gnl|my_center|LOCUS_4990 1199 2839 gene locus_tag LOCUS_5000 1199 2839 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974103.1 protein_id gnl|my_center|LOCUS_5000 2867 3289 gene locus_tag LOCUS_5010 2867 3289 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877157.1 protein_id gnl|my_center|LOCUS_5010 3300 4061 gene locus_tag LOCUS_5020 gene mtnP 3300 4061 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_5020 4058 5365 gene locus_tag LOCUS_5030 4058 5365 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_5030 5368 5838 gene locus_tag LOCUS_5040 5368 5838 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_5040 5844 6605 gene locus_tag LOCUS_5050 5844 6605 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229219.1 protein_id gnl|my_center|LOCUS_5050 6787 7968 gene locus_tag LOCUS_5060 6787 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 8102 9220 gene locus_tag LOCUS_5070 8102 9220 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_5070 9217 10191 gene locus_tag LOCUS_5080 9217 10191 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_5080 10201 11757 gene locus_tag LOCUS_5090 10201 11757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_5090 11754 13037 gene locus_tag LOCUS_5100 11754 13037 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_5100 14086 13055 gene locus_tag LOCUS_5110 14086 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5110 14144 14494 gene locus_tag LOCUS_5120 14144 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 14505 15668 gene locus_tag LOCUS_5130 14505 15668 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_5130 15674 15934 gene locus_tag LOCUS_5140 15674 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 15946 16758 gene locus_tag LOCUS_5150 15946 16758 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_5150 >Feature sequence17 373 582 gene locus_tag LOCUS_5160 373 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 2125 938 gene locus_tag LOCUS_5170 2125 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 3021 2338 gene locus_tag LOCUS_5180 3021 2338 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_5180 3977 4168 gene locus_tag LOCUS_5190 3977 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 4532 5119 gene locus_tag LOCUS_5200 4532 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 5469 5588 gene locus_tag LOCUS_5210 5469 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 5784 7109 gene locus_tag LOCUS_5220 5784 7109 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_5220 7213 7644 gene locus_tag LOCUS_5230 7213 7644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 8347 7760 gene locus_tag LOCUS_5240 8347 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 8913 9632 gene locus_tag LOCUS_5250 8913 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 9837 10364 gene locus_tag LOCUS_5260 9837 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 10893 10690 gene locus_tag LOCUS_5270 10893 10690 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_5270 11052 11339 gene locus_tag LOCUS_5280 11052 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 11703 11485 gene locus_tag LOCUS_5290 11703 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 12108 12521 gene locus_tag LOCUS_5300 12108 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 13393 12536 gene locus_tag LOCUS_5310 13393 12536 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403610.1 protein_id gnl|my_center|LOCUS_5310 13530 14609 gene locus_tag LOCUS_5320 13530 14609 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860244.1 protein_id gnl|my_center|LOCUS_5320 14772 14954 gene locus_tag LOCUS_5330 14772 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 15099 15590 gene locus_tag LOCUS_5340 15099 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 15850 16026 gene locus_tag LOCUS_5350 15850 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 >Feature sequence18 6 482 gene locus_tag LOCUS_5360 6 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 526 1221 gene locus_tag LOCUS_5370 gene sigR 526 1221 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_5370 1218 1499 gene locus_tag LOCUS_5380 1218 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 1542 1757 gene locus_tag LOCUS_5390 1542 1757 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416887.1 protein_id gnl|my_center|LOCUS_5390 1768 2172 gene locus_tag LOCUS_5400 1768 2172 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 protein_id gnl|my_center|LOCUS_5400 3946 2180 gene locus_tag LOCUS_5410 3946 2180 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 protein_id gnl|my_center|LOCUS_5410 3970 5469 gene locus_tag LOCUS_5420 3970 5469 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_5420 5673 6326 gene locus_tag LOCUS_5430 5673 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 6756 7193 gene locus_tag LOCUS_5440 6756 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 9002 8460 gene locus_tag LOCUS_5450 9002 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 9599 9384 gene locus_tag LOCUS_5460 9599 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 9480 10103 gene locus_tag LOCUS_5470 9480 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 10163 10435 gene locus_tag LOCUS_5480 10163 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 11370 10558 gene locus_tag LOCUS_5490 11370 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 11723 11490 gene locus_tag LOCUS_5500 11723 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 11788 12366 gene locus_tag LOCUS_5510 11788 12366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 12363 13538 gene locus_tag LOCUS_5520 12363 13538 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_5520 14632 14078 gene locus_tag LOCUS_5530 14632 14078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 >Feature sequence19 506 4042 gene locus_tag LOCUS_5540 gene dnaE 506 4042 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_5540 4044 4628 gene locus_tag LOCUS_5550 4044 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5550 5143 4625 gene locus_tag LOCUS_5560 gene ybaK 5143 4625 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_5560 5803 5144 gene locus_tag LOCUS_5570 5803 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 5917 7236 gene locus_tag LOCUS_5580 gene hisD 5917 7236 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068574.1 protein_id gnl|my_center|LOCUS_5580 7229 8362 gene locus_tag LOCUS_5590 7229 8362 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929983.1 protein_id gnl|my_center|LOCUS_5590 8359 8955 gene locus_tag LOCUS_5600 gene hisB 8359 8955 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_5600 9026 9649 gene locus_tag LOCUS_5610 gene hisH 9026 9649 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_5610 9733 10521 gene locus_tag LOCUS_5620 gene priA 9733 10521 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_5620 10518 11309 gene locus_tag LOCUS_5630 gene hisF 10518 11309 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_5630 11293 11670 gene locus_tag LOCUS_5640 gene hisI 11293 11670 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111201.1 protein_id gnl|my_center|LOCUS_5640 11660 13264 gene locus_tag LOCUS_5650 11660 13264 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_5650 >Feature sequence20 723 799 gene locus_tag LOCUS_t0080 723 799 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1352 882 gene locus_tag LOCUS_5660 1352 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5660 1675 2058 gene locus_tag LOCUS_5670 1675 2058 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 protein_id gnl|my_center|LOCUS_5670 2770 2501 gene locus_tag LOCUS_5680 2770 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 3086 3583 gene locus_tag LOCUS_5690 3086 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 3684 4763 gene locus_tag LOCUS_5700 3684 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 5318 4962 gene locus_tag LOCUS_5710 5318 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 8256 5812 gene locus_tag LOCUS_5720 8256 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 9908 8388 gene locus_tag LOCUS_5730 9908 8388 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119293.1 protein_id gnl|my_center|LOCUS_5730 10329 9913 gene locus_tag LOCUS_5740 10329 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 10219 11703 gene locus_tag LOCUS_5750 10219 11703 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729279.1 protein_id gnl|my_center|LOCUS_5750 <13048 11825 gene locus_tag LOCUS_5760 <13048 11825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898547.1:arylsulfatase AtsD >Feature sequence21 775 77 gene locus_tag LOCUS_5770 775 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 1176 817 gene locus_tag LOCUS_5780 1176 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 2873 2427 gene locus_tag LOCUS_5790 2873 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 4174 2870 gene locus_tag LOCUS_5800 gene fliI 4174 2870 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_5800 4911 4171 gene locus_tag LOCUS_5810 4911 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5810 5914 4895 gene locus_tag LOCUS_5820 gene fliG 5914 4895 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870078.1 protein_id gnl|my_center|LOCUS_5820 7527 5926 gene locus_tag LOCUS_5830 gene fliF 7527 5926 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_5830 7712 7524 gene locus_tag LOCUS_5840 7712 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 7711 7896 gene locus_tag LOCUS_5850 7711 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 8320 7898 gene locus_tag LOCUS_5860 gene flgC 8320 7898 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_5860 8682 8323 gene locus_tag LOCUS_5870 8682 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 9493 8846 gene locus_tag LOCUS_5880 9493 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5880 10702 9578 gene locus_tag LOCUS_5890 10702 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 10880 11161 gene locus_tag LOCUS_5900 10880 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 11914 11189 gene locus_tag LOCUS_5910 11914 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 11963 12301 gene locus_tag LOCUS_5920 11963 12301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 >Feature sequence22 1194 526 gene locus_tag LOCUS_5930 1194 526 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_5930 2262 1684 gene locus_tag LOCUS_5940 2262 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 3161 3532 gene locus_tag LOCUS_5950 3161 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 3777 3529 gene locus_tag LOCUS_5960 3777 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 3891 4253 gene locus_tag LOCUS_5970 3891 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 4570 4385 gene locus_tag LOCUS_5980 4570 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 4877 5038 gene locus_tag LOCUS_5990 4877 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 5733 5146 gene locus_tag LOCUS_6000 5733 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 6348 5869 gene locus_tag LOCUS_6010 6348 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 6501 7604 gene locus_tag LOCUS_6020 6501 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 7962 7630 gene locus_tag LOCUS_6030 7962 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 8150 8554 gene locus_tag LOCUS_6040 8150 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 8576 8648 gene locus_tag LOCUS_t0090 8576 8648 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8868 9023 gene locus_tag LOCUS_6050 8868 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 9139 9498 gene locus_tag LOCUS_6060 9139 9498 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_6060 9663 9947 gene locus_tag LOCUS_6070 9663 9947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 10120 10497 gene locus_tag LOCUS_6080 10120 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 10691 10524 gene locus_tag LOCUS_6090 10691 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 11168 10764 gene locus_tag LOCUS_6100 11168 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 >Feature sequence23 1464 424 gene locus_tag LOCUS_6110 1464 424 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131609.1 protein_id gnl|my_center|LOCUS_6110 2526 1474 gene locus_tag LOCUS_6120 2526 1474 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729987.1 protein_id gnl|my_center|LOCUS_6120 2525 3643 gene locus_tag LOCUS_6130 2525 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 4543 3581 gene locus_tag LOCUS_6140 4543 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 5018 4647 gene locus_tag LOCUS_tm0010 5018 4647 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6354 5065 gene locus_tag LOCUS_6150 6354 5065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494076.1 protein_id gnl|my_center|LOCUS_6150 6873 6358 gene locus_tag LOCUS_6160 gene smpB 6873 6358 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056461.1 protein_id gnl|my_center|LOCUS_6160 8320 6947 gene locus_tag LOCUS_6170 8320 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 9269 8361 gene locus_tag LOCUS_6180 gene ftsX 9269 8361 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_6180 9958 9269 gene locus_tag LOCUS_6190 gene ftsE 9958 9269 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_6190 11142 10030 gene locus_tag LOCUS_6200 gene prfB 11142 10030 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_6200 >Feature sequence24 141 1409 gene locus_tag LOCUS_6210 141 1409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_6210 1406 3028 gene locus_tag LOCUS_6220 1406 3028 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143420.1 protein_id gnl|my_center|LOCUS_6220 4184 3033 gene locus_tag LOCUS_6230 4184 3033 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_6230 4203 4853 gene locus_tag LOCUS_6240 gene msrA 4203 4853 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884809.1 protein_id gnl|my_center|LOCUS_6240 4874 6109 gene locus_tag LOCUS_6250 4874 6109 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_6250 6106 6972 gene locus_tag LOCUS_6260 6106 6972 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193173633.1 protein_id gnl|my_center|LOCUS_6260 8632 6980 gene locus_tag LOCUS_6270 8632 6980 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_6270 9503 8655 gene locus_tag LOCUS_6280 9503 8655 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966315.1 protein_id gnl|my_center|LOCUS_6280 >Feature sequence25 1142 159 gene locus_tag LOCUS_6290 1142 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 1801 2064 gene locus_tag LOCUS_6300 1801 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 2281 3135 gene locus_tag LOCUS_6310 2281 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 3343 4233 gene locus_tag LOCUS_6320 3343 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 4280 5035 gene locus_tag LOCUS_6330 4280 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 5494 5234 gene locus_tag LOCUS_6340 5494 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 5943 5662 gene locus_tag LOCUS_6350 5943 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 6331 7251 gene locus_tag LOCUS_6360 6331 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6360 >Feature sequence26 739 1338 gene locus_tag LOCUS_6370 739 1338 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225203.1 protein_id gnl|my_center|LOCUS_6370 1839 1240 gene locus_tag LOCUS_6380 1839 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_6380 2941 1820 gene locus_tag LOCUS_6390 gene recA 2941 1820 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_6390 4440 3112 gene locus_tag LOCUS_6400 4440 3112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902466.1 protein_id gnl|my_center|LOCUS_6400 5141 4437 gene locus_tag LOCUS_6410 5141 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 5408 5217 gene locus_tag LOCUS_6420 5408 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 >Feature sequence27 <1 987 gene locus_tag LOCUS_6430 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957733.1:nucleotide sugar dehydrogenase 980 1831 gene locus_tag LOCUS_6440 980 1831 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771849.1 protein_id gnl|my_center|LOCUS_6440 1828 2946 gene locus_tag LOCUS_6450 1828 2946 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_6450 2952 4079 gene locus_tag LOCUS_6460 2952 4079 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957744.1 protein_id gnl|my_center|LOCUS_6460 4091 5020 gene locus_tag LOCUS_6470 4091 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 6126 5032 gene locus_tag LOCUS_6480 6126 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 >Feature sequence28 <1 1315 gene locus_tag LOCUS_6490 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034350815.1:aminotransferase class V-fold PLP-dependent enzyme 3182 1344 gene locus_tag LOCUS_6500 3182 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 3893 3246 gene locus_tag LOCUS_6510 3893 3246 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_6510 4569 3988 gene locus_tag LOCUS_6520 4569 3988 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788598.1 protein_id gnl|my_center|LOCUS_6520 5580 4696 gene locus_tag LOCUS_6530 5580 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 5850 5584 gene locus_tag LOCUS_6540 5850 5584 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_6540 >Feature sequence29 293 835 gene locus_tag LOCUS_6550 293 835 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_6550 2168 816 gene locus_tag LOCUS_6560 2168 816 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_6560 2692 2165 gene locus_tag LOCUS_6570 2692 2165 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119799.1 protein_id gnl|my_center|LOCUS_6570 4858 2783 gene locus_tag LOCUS_6580 4858 2783 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_6580 5076 5306 gene locus_tag LOCUS_6590 5076 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_6590 <6192 5328 gene locus_tag LOCUS_6600 <6192 5328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973202.1:RNA polymerase sigma factor >Feature sequence30 480 235 gene locus_tag LOCUS_6610 480 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 1860 499 gene locus_tag LOCUS_6620 1860 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 2343 2137 gene locus_tag LOCUS_6630 2343 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 2519 3370 gene locus_tag LOCUS_6640 2519 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 3367 4509 gene locus_tag LOCUS_6650 3367 4509 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_6650 4610 4684 gene locus_tag LOCUS_t0100 4610 4684 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5178 4807 gene locus_tag LOCUS_6660 5178 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 5344 5751 gene locus_tag LOCUS_6670 5344 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6670 >Feature sequence31 390 1229 gene locus_tag LOCUS_6680 390 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 1226 3094 gene locus_tag LOCUS_6690 1226 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 3198 3125 gene locus_tag LOCUS_t0110 3198 3125 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3801 3235 gene locus_tag LOCUS_6700 3801 3235 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_6700 3949 5328 gene locus_tag LOCUS_6710 3949 5328 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 protein_id gnl|my_center|LOCUS_6710 >Feature sequence32 1325 552 gene locus_tag LOCUS_6720 gene fliR 1325 552 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_6720 1603 1334 gene locus_tag LOCUS_6730 gene fliQ 1603 1334 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941093.1 protein_id gnl|my_center|LOCUS_6730 2363 1611 gene locus_tag LOCUS_6740 gene fliP 2363 1611 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_6740 2836 2360 gene locus_tag LOCUS_6750 2836 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 3690 2857 gene locus_tag LOCUS_6760 3690 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 4568 3693 gene locus_tag LOCUS_6770 4568 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 5232 4747 gene locus_tag LOCUS_6780 5232 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 >Feature sequence33 <1 579 gene locus_tag LOCUS_6790 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957730.1:transaldolase 611 1618 gene locus_tag LOCUS_6800 611 1618 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 protein_id gnl|my_center|LOCUS_6800 1782 1612 gene locus_tag LOCUS_6810 1782 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 1801 2628 gene locus_tag LOCUS_6820 1801 2628 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_6820 2835 4205 gene locus_tag LOCUS_6830 2835 4205 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771856.1 protein_id gnl|my_center|LOCUS_6830 4202 5122 gene locus_tag LOCUS_6840 4202 5122 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957732.1 protein_id gnl|my_center|LOCUS_6840 >Feature sequence34 3905 246 gene locus_tag LOCUS_6850 3905 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 >Feature sequence35 1411 275 gene locus_tag LOCUS_6860 1411 275 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222048.1 protein_id gnl|my_center|LOCUS_6860 2082 1423 gene locus_tag LOCUS_6870 2082 1423 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_6870 3156 2182 gene locus_tag LOCUS_6880 3156 2182 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_6880 <4771 3399 gene locus_tag LOCUS_6890 <4771 3399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892189.1:Na+/H+ antiporter >Feature sequence36 1743 841 gene locus_tag LOCUS_6900 1743 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 2145 1987 gene locus_tag LOCUS_6910 2145 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 2144 2638 gene locus_tag LOCUS_6920 2144 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 2638 3966 gene locus_tag LOCUS_6930 gene flgK 2638 3966 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_6930 >Feature sequence37 517 47 gene locus_tag LOCUS_6940 517 47 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_6940 1794 514 gene locus_tag LOCUS_6950 1794 514 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224700.1 protein_id gnl|my_center|LOCUS_6950 2555 1794 gene locus_tag LOCUS_6960 gene sufC 2555 1794 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_6960 2935 2582 gene locus_tag LOCUS_6970 2935 2582 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805066.1 protein_id gnl|my_center|LOCUS_6970 4083 2932 gene locus_tag LOCUS_6980 gene sufD 4083 2932 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_6980 >Feature sequence38 882 145 gene locus_tag LOCUS_6990 882 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 1015 2208 gene locus_tag LOCUS_7000 1015 2208 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776617.1 protein_id gnl|my_center|LOCUS_7000 2205 2894 gene locus_tag LOCUS_7010 2205 2894 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876008.1 protein_id gnl|my_center|LOCUS_7010 4024 2891 gene locus_tag LOCUS_7020 4024 2891 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391454.1 protein_id gnl|my_center|LOCUS_7020 >Feature sequence39 914 1381 gene locus_tag LOCUS_7030 914 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7030 1410 2771 gene locus_tag LOCUS_7040 1410 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 3652 3576 gene locus_tag LOCUS_t0120 3652 3576 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence40 255 43 gene locus_tag LOCUS_7050 255 43 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_7050 327 728 gene locus_tag LOCUS_7060 327 728 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_7060 728 1417 gene locus_tag LOCUS_7070 728 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223073.1 protein_id gnl|my_center|LOCUS_7070 3273 1414 gene locus_tag LOCUS_7080 3273 1414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_7080 <3846 3276 gene locus_tag LOCUS_7090 <3846 3276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028003.1:enoyl-CoA hydratase/isomerase family protein >Feature sequence41 2197 503 gene locus_tag LOCUS_7100 2197 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 2793 2257 gene locus_tag LOCUS_7110 2793 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 <3728 2907 gene locus_tag LOCUS_7120 <3728 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000503612.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence42 811 455 gene locus_tag LOCUS_7130 811 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 1987 881 gene locus_tag LOCUS_7140 1987 881 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776654.1 protein_id gnl|my_center|LOCUS_7140 2673 1984 gene locus_tag LOCUS_7150 2673 1984 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_7150 <3693 2670 gene locus_tag LOCUS_7160 <3693 2670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776652.1:protoporphyrinogen oxidase >Feature sequence43 <1 502 gene locus_tag LOCUS_7170 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728501.1:tRNA pseudouridine(55) synthase TruB 2045 444 gene locus_tag LOCUS_7180 2045 444 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_7180 2264 2055 gene locus_tag LOCUS_7190 2264 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 2154 3041 gene locus_tag LOCUS_7200 2154 3041 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_7200 3145 3414 gene locus_tag LOCUS_7210 gene rpsO 3145 3414 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_7210 >Feature sequence44 230 433 gene locus_tag LOCUS_7220 230 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7220 926 672 gene locus_tag LOCUS_7230 926 672 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_7230 2108 1173 gene locus_tag LOCUS_7240 2108 1173 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_7240 2121 2543 gene locus_tag LOCUS_7250 2121 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 3220 2540 gene locus_tag LOCUS_7260 3220 2540 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_7260 >Feature sequence45 989 414 gene locus_tag LOCUS_7270 989 414 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804427.1 protein_id gnl|my_center|LOCUS_7270 1313 1113 gene locus_tag LOCUS_7280 1313 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7280 2174 1767 gene locus_tag LOCUS_7290 2174 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 2404 2174 gene locus_tag LOCUS_7300 2404 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7300 2729 2899 gene locus_tag LOCUS_7310 2729 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 >Feature sequence46 573 752 gene locus_tag LOCUS_7320 573 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 1014 856 gene locus_tag LOCUS_7330 1014 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 1116 1997 gene locus_tag LOCUS_7340 gene map 1116 1997 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_7340 1994 2788 gene locus_tag LOCUS_7350 1994 2788 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974207.1 protein_id gnl|my_center|LOCUS_7350 >Feature sequence47 145 939 gene locus_tag LOCUS_7360 145 939 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726753.1 protein_id gnl|my_center|LOCUS_7360 960 2198 gene locus_tag LOCUS_7370 gene ilvA 960 2198 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_7370 >Feature sequence48 579 148 gene locus_tag LOCUS_7380 579 148 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_7380 669 2099 gene locus_tag LOCUS_7390 669 2099 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_7390 >Feature sequence49 1031 525 gene locus_tag LOCUS_7400 1031 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 952 1437 gene locus_tag LOCUS_7410 952 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7410 1431 1610 gene locus_tag LOCUS_7420 1431 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 1607 2602 gene locus_tag LOCUS_7430 gene holA 1607 2602 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_7430 >Feature sequence50 1373 291 gene locus_tag LOCUS_7440 1373 291 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227400.1 protein_id gnl|my_center|LOCUS_7440 1498 2577 gene locus_tag LOCUS_7450 1498 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 >Feature sequence51 2304 1072 gene locus_tag LOCUS_7460 2304 1072 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178940705.1 protein_id gnl|my_center|LOCUS_7460 2506 2297 gene locus_tag LOCUS_7470 2506 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7470 >Feature sequence52 401 243 gene locus_tag LOCUS_7480 401 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7480 423 1250 gene locus_tag LOCUS_7490 423 1250 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_7490 1942 1352 gene locus_tag LOCUS_7500 1942 1352 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_7500 2311 1955 gene locus_tag LOCUS_7510 2311 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7510 >Feature sequence53 449 1339 gene locus_tag LOCUS_7520 449 1339 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967714.1 protein_id gnl|my_center|LOCUS_7520 >Feature sequence54 1311 94 gene locus_tag LOCUS_7530 gene hemL 1311 94 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892395.1 protein_id gnl|my_center|LOCUS_7530 <2269 1380 gene locus_tag LOCUS_7540 <2269 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776657.1:porphobilinogen synthase >Feature sequence55 100 703 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccgctgccgctgaggccgctg >Feature sequence56 >Feature sequence57