>Feature sequence01 702 292 gene locus_tag LOCUS_0010 702 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 1196 759 gene locus_tag LOCUS_0020 1196 759 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054571.1 protein_id gnl|my_center|LOCUS_0020 1924 1196 gene locus_tag LOCUS_0030 gene yhdJ 1924 1196 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258951.1 protein_id gnl|my_center|LOCUS_0030 1970 2854 gene locus_tag LOCUS_0040 1970 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 2857 3750 gene locus_tag LOCUS_0050 2857 3750 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_0050 4327 3743 gene locus_tag LOCUS_0060 4327 3743 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653302.1 protein_id gnl|my_center|LOCUS_0060 5295 4324 gene locus_tag LOCUS_0070 5295 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 5878 5288 gene locus_tag LOCUS_0080 gene coaE 5878 5288 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_0080 6429 5878 gene locus_tag LOCUS_0090 6429 5878 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 protein_id gnl|my_center|LOCUS_0090 6921 6430 gene locus_tag LOCUS_0100 6921 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 7896 6925 gene locus_tag LOCUS_0110 gene floA 7896 6925 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583132.1 protein_id gnl|my_center|LOCUS_0110 9161 7956 gene locus_tag LOCUS_0120 9161 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 9298 10020 gene locus_tag LOCUS_0130 9298 10020 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545432.1 protein_id gnl|my_center|LOCUS_0130 10020 10583 gene locus_tag LOCUS_0140 10020 10583 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_0140 10583 11296 gene locus_tag LOCUS_0150 10583 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 12350 11277 gene locus_tag LOCUS_0160 gene rseP 12350 11277 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_0160 13492 12347 gene locus_tag LOCUS_0170 13492 12347 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_0170 13935 13501 gene locus_tag LOCUS_0180 13935 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 14712 14281 gene locus_tag LOCUS_0190 14712 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0190 15629 14709 gene locus_tag LOCUS_0200 15629 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0200 16614 15619 gene locus_tag LOCUS_0210 gene lpxD 16614 15619 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210023.1 protein_id gnl|my_center|LOCUS_0210 17143 16628 gene locus_tag LOCUS_0220 17143 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 19533 17158 gene locus_tag LOCUS_0230 gene bamA 19533 17158 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_0230 20208 19537 gene locus_tag LOCUS_0240 20208 19537 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_0240 21331 20225 gene locus_tag LOCUS_0250 21331 20225 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_0250 21684 21388 gene locus_tag LOCUS_0260 21684 21388 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_0260 21716 22912 gene locus_tag LOCUS_0270 21716 22912 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391912.1 protein_id gnl|my_center|LOCUS_0270 23617 22904 gene locus_tag LOCUS_0280 23617 22904 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616577.1 protein_id gnl|my_center|LOCUS_0280 23817 23629 gene locus_tag LOCUS_0290 23817 23629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 24664 24071 gene locus_tag LOCUS_0300 24664 24071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0300 25694 24684 gene locus_tag LOCUS_0310 25694 24684 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_0310 26249 25785 gene locus_tag LOCUS_0320 26249 25785 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933079.1 protein_id gnl|my_center|LOCUS_0320 26347 26778 gene locus_tag LOCUS_0330 26347 26778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 27221 26775 gene locus_tag LOCUS_0340 gene rplI 27221 26775 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_0340 27447 27223 gene locus_tag LOCUS_0350 gene rpsR 27447 27223 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721669.1 protein_id gnl|my_center|LOCUS_0350 27803 27447 gene locus_tag LOCUS_0360 gene rpsF 27803 27447 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002942403.1 protein_id gnl|my_center|LOCUS_0360 29854 27815 gene locus_tag LOCUS_0370 29854 27815 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_0370 30423 29854 gene locus_tag LOCUS_0380 gene pth 30423 29854 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545410.1 protein_id gnl|my_center|LOCUS_0380 31124 30423 gene locus_tag LOCUS_0390 31124 30423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 32089 31121 gene locus_tag LOCUS_0400 32089 31121 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_0400 32168 32096 gene locus_tag LOCUS_t0010 32168 32096 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 33008 32172 gene locus_tag LOCUS_0410 gene ispE 33008 32172 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_0410 34138 32999 gene locus_tag LOCUS_0420 gene ispD 34138 32999 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_0420 35192 34140 gene locus_tag LOCUS_0430 gene queA 35192 34140 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_0430 36203 35211 gene locus_tag LOCUS_0440 gene ruvB 36203 35211 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_0440 39058 36245 gene locus_tag LOCUS_0450 gene uvrA 39058 36245 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_0450 39140 39685 gene locus_tag LOCUS_0460 39140 39685 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 protein_id gnl|my_center|LOCUS_0460 39682 39831 gene locus_tag LOCUS_0470 39682 39831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 40614 39835 gene locus_tag LOCUS_0480 40614 39835 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_0480 40665 41756 gene locus_tag LOCUS_0490 gene ychF 40665 41756 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 protein_id gnl|my_center|LOCUS_0490 41753 42736 gene locus_tag LOCUS_0500 41753 42736 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_0500 42729 43832 gene locus_tag LOCUS_0510 gene lpxB 42729 43832 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947101.1 protein_id gnl|my_center|LOCUS_0510 43825 44445 gene locus_tag LOCUS_0520 43825 44445 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_0520 44588 45466 gene locus_tag LOCUS_0530 gene lpxK 44588 45466 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_0530 45539 46144 gene locus_tag LOCUS_0540 45539 46144 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_0540 46149 46547 gene locus_tag LOCUS_0550 46149 46547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 46547 46960 gene locus_tag LOCUS_0560 46547 46960 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_0560 46960 47652 gene locus_tag LOCUS_0570 46960 47652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 48264 47653 gene locus_tag LOCUS_0580 48264 47653 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397169.1 protein_id gnl|my_center|LOCUS_0580 49022 48261 gene locus_tag LOCUS_0590 49022 48261 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_0590 50945 49023 gene locus_tag LOCUS_0600 50945 49023 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_0600 51601 50942 gene locus_tag LOCUS_0610 51601 50942 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_0610 51979 51662 gene locus_tag LOCUS_0620 51979 51662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 53100 51979 gene locus_tag LOCUS_0630 53100 51979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 53226 55844 gene locus_tag LOCUS_0640 gene ppdK 53226 55844 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_0640 55841 57037 gene locus_tag LOCUS_0650 55841 57037 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142387.1 protein_id gnl|my_center|LOCUS_0650 57351 57034 gene locus_tag LOCUS_0660 57351 57034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 57535 58815 gene locus_tag LOCUS_0670 57535 58815 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_0670 59602 58790 gene locus_tag LOCUS_0680 59602 58790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 59571 60461 gene locus_tag LOCUS_0690 59571 60461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 60808 60458 gene locus_tag LOCUS_0700 60808 60458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 61868 61002 gene locus_tag LOCUS_0710 61868 61002 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889254.1 protein_id gnl|my_center|LOCUS_0710 62353 61865 gene locus_tag LOCUS_0720 gene folA 62353 61865 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624378.1 protein_id gnl|my_center|LOCUS_0720 65056 62360 gene locus_tag LOCUS_0730 65056 62360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 66229 65567 gene locus_tag LOCUS_0740 66229 65567 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_0740 68669 66189 gene locus_tag LOCUS_0750 gene gyrA 68669 66189 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_0750 70611 68671 gene locus_tag LOCUS_0760 gene gyrB 70611 68671 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_0760 71710 70604 gene locus_tag LOCUS_0770 gene dnaN 71710 70604 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402793.1 protein_id gnl|my_center|LOCUS_0770 73240 71945 gene locus_tag LOCUS_0780 73240 71945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 75126 73237 gene locus_tag LOCUS_0790 gene mnmG 75126 73237 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_0790 76428 75133 gene locus_tag LOCUS_0800 gene mnmE 76428 75133 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082971.1 protein_id gnl|my_center|LOCUS_0800 78096 76444 gene locus_tag LOCUS_0810 gene yidC 78096 76444 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_0810 78392 79732 gene locus_tag LOCUS_0820 gene dnaA 78392 79732 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_0820 79743 80186 gene locus_tag LOCUS_0830 79743 80186 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168289.1 protein_id gnl|my_center|LOCUS_0830 80322 80807 gene locus_tag LOCUS_0840 80322 80807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 80822 81157 gene locus_tag LOCUS_0850 80822 81157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 82155 81154 gene locus_tag LOCUS_0860 82155 81154 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_0860 83663 82164 gene locus_tag LOCUS_0870 gene purH 83663 82164 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881280.1 protein_id gnl|my_center|LOCUS_0870 83998 83902 gene locus_tag LOCUS_t0020 83998 83902 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 84619 84044 gene locus_tag LOCUS_0880 gene purN 84619 84044 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947399.1 protein_id gnl|my_center|LOCUS_0880 85923 84616 gene locus_tag LOCUS_0890 85923 84616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 87371 85920 gene locus_tag LOCUS_0900 gene purF 87371 85920 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036167.1 protein_id gnl|my_center|LOCUS_0900 88722 87373 gene locus_tag LOCUS_0910 gene purB 88722 87373 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946537.1 protein_id gnl|my_center|LOCUS_0910 89114 88719 gene locus_tag LOCUS_0920 gene purE 89114 88719 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582680.1 protein_id gnl|my_center|LOCUS_0920 90085 89111 gene locus_tag LOCUS_0930 90085 89111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 91319 90075 gene locus_tag LOCUS_0940 gene purQ 91319 90075 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946656.1 protein_id gnl|my_center|LOCUS_0940 92355 91309 gene locus_tag LOCUS_0950 gene purM 92355 91309 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020889.1 protein_id gnl|my_center|LOCUS_0950 94682 92352 gene locus_tag LOCUS_0960 gene purL 94682 92352 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947405.1 protein_id gnl|my_center|LOCUS_0960 95968 94682 gene locus_tag LOCUS_0970 95968 94682 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972411.1 protein_id gnl|my_center|LOCUS_0970 96096 97244 gene locus_tag LOCUS_0980 96096 97244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 97494 100610 gene locus_tag LOCUS_0990 97494 100610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 100637 103900 gene locus_tag LOCUS_1000 100637 103900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 103913 104968 gene locus_tag LOCUS_1010 103913 104968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 105756 105031 gene locus_tag LOCUS_1020 105756 105031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 106291 105746 gene locus_tag LOCUS_1030 106291 105746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 107526 106288 gene locus_tag LOCUS_1040 gene mgtE 107526 106288 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 protein_id gnl|my_center|LOCUS_1040 107715 109175 gene locus_tag LOCUS_1050 gene proS 107715 109175 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_1050 109249 110244 gene locus_tag LOCUS_1060 109249 110244 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_1060 110241 110915 gene locus_tag LOCUS_1070 110241 110915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 111202 110918 gene locus_tag LOCUS_1080 111202 110918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 112482 111199 gene locus_tag LOCUS_1090 gene eno 112482 111199 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_1090 112777 112986 gene locus_tag LOCUS_1100 112777 112986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 113059 113271 gene locus_tag LOCUS_1110 113059 113271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 113357 114508 gene locus_tag LOCUS_1120 113357 114508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 114512 115756 gene locus_tag LOCUS_1130 114512 115756 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865066.1 protein_id gnl|my_center|LOCUS_1130 115816 117096 gene locus_tag LOCUS_1140 gene rho 115816 117096 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456756.1 protein_id gnl|my_center|LOCUS_1140 117097 118293 gene locus_tag LOCUS_1150 117097 118293 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_1150 118290 118544 gene locus_tag LOCUS_1160 118290 118544 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_1160 118638 119630 gene locus_tag LOCUS_1170 gene prfA 118638 119630 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_1170 119633 120481 gene locus_tag LOCUS_1180 gene prmC 119633 120481 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546726.1 protein_id gnl|my_center|LOCUS_1180 120488 123910 gene locus_tag LOCUS_1190 120488 123910 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_1190 123914 124330 gene locus_tag LOCUS_1200 123914 124330 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_1200 124327 124737 gene locus_tag LOCUS_1210 124327 124737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 124746 125834 gene locus_tag LOCUS_1220 gene papA 124746 125834 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_1220 125930 126799 gene locus_tag LOCUS_1230 125930 126799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 126772 128787 gene locus_tag LOCUS_1240 gene ligA 126772 128787 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_1240 128777 129946 gene locus_tag LOCUS_1250 128777 129946 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_1250 129939 130868 gene locus_tag LOCUS_1260 129939 130868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946137.1 protein_id gnl|my_center|LOCUS_1260 130861 131625 gene locus_tag LOCUS_1270 130861 131625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_1270 131654 132754 gene locus_tag LOCUS_1280 gene carA 131654 132754 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_1280 132741 135938 gene locus_tag LOCUS_1290 gene carB 132741 135938 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_1290 138765 135949 gene locus_tag LOCUS_1300 gene gcvP 138765 135949 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_1300 138862 138790 gene locus_tag LOCUS_t0030 138862 138790 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 139109 139454 gene locus_tag LOCUS_tm0010 139109 139454 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 140236 139463 gene locus_tag LOCUS_1310 140236 139463 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_1310 141465 140236 gene locus_tag LOCUS_1320 141465 140236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 143090 141468 gene locus_tag LOCUS_1330 gene argS 143090 141468 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_1330 143416 143087 gene locus_tag LOCUS_1340 gene rsfS 143416 143087 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921947.1 protein_id gnl|my_center|LOCUS_1340 143892 143413 gene locus_tag LOCUS_1350 143892 143413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 144614 143889 gene locus_tag LOCUS_1360 144614 143889 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931943.1 protein_id gnl|my_center|LOCUS_1360 145719 144607 gene locus_tag LOCUS_1370 gene mnmA 145719 144607 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005022119.1 protein_id gnl|my_center|LOCUS_1370 145753 146658 gene locus_tag LOCUS_1380 145753 146658 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_1380 146713 147813 gene locus_tag LOCUS_1390 146713 147813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 148772 147810 gene locus_tag LOCUS_1400 148772 147810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 150546 148747 gene locus_tag LOCUS_1410 gene ggt 150546 148747 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254471.1 protein_id gnl|my_center|LOCUS_1410 153453 150616 gene locus_tag LOCUS_1420 153453 150616 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_1420 154292 153564 gene locus_tag LOCUS_1430 154292 153564 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_1430 155749 154313 gene locus_tag LOCUS_1440 155749 154313 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_1440 156115 155762 gene locus_tag LOCUS_1450 156115 155762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 158544 156112 gene locus_tag LOCUS_1460 gene topA 158544 156112 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812879.1 protein_id gnl|my_center|LOCUS_1460 159843 158620 gene locus_tag LOCUS_1470 gene hisS 159843 158620 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583333.1 protein_id gnl|my_center|LOCUS_1470 163139 159879 gene locus_tag LOCUS_1480 163139 159879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 163177 163488 gene locus_tag LOCUS_1490 163177 163488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 163506 164354 gene locus_tag LOCUS_1500 163506 164354 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_1500 164355 165107 gene locus_tag LOCUS_1510 164355 165107 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_1510 165756 165112 gene locus_tag LOCUS_1520 165756 165112 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112761.1 protein_id gnl|my_center|LOCUS_1520 165755 166405 gene locus_tag LOCUS_1530 165755 166405 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_1530 167266 166409 gene locus_tag LOCUS_1540 167266 166409 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225766.1 protein_id gnl|my_center|LOCUS_1540 167804 167361 gene locus_tag LOCUS_1550 167804 167361 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259089.1 protein_id gnl|my_center|LOCUS_1550 168549 167818 gene locus_tag LOCUS_1560 168549 167818 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_1560 168979 168683 gene locus_tag LOCUS_1570 168979 168683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 169036 169668 gene locus_tag LOCUS_1580 169036 169668 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_1580 172862 169665 gene locus_tag LOCUS_1590 172862 169665 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_1590 174005 172863 gene locus_tag LOCUS_1600 174005 172863 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073986.1 protein_id gnl|my_center|LOCUS_1600 175423 174002 gene locus_tag LOCUS_1610 gene cmeC 175423 174002 CDS product multidrug efflux transporter outer membrane subunit CmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858696.1 protein_id gnl|my_center|LOCUS_1610 175961 175425 gene locus_tag LOCUS_1620 175961 175425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 176494 175961 gene locus_tag LOCUS_1630 176494 175961 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_1630 176577 176504 gene locus_tag LOCUS_t0040 176577 176504 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 176649 177239 gene locus_tag LOCUS_1640 176649 177239 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641531.1 protein_id gnl|my_center|LOCUS_1640 177240 183410 gene locus_tag LOCUS_1650 177240 183410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 183410 184333 gene locus_tag LOCUS_1660 183410 184333 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_1660 >Feature sequence02 449 1621 gene locus_tag LOCUS_1670 449 1621 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905558.1 protein_id gnl|my_center|LOCUS_1670 1664 1746 gene locus_tag LOCUS_t0050 1664 1746 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1749 3533 gene locus_tag LOCUS_1680 1749 3533 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_1680 3535 3768 gene locus_tag LOCUS_1690 3535 3768 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_1690 3769 4662 gene locus_tag LOCUS_1700 3769 4662 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_1700 5446 4655 gene locus_tag LOCUS_1710 5446 4655 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_1710 5480 6451 gene locus_tag LOCUS_1720 5480 6451 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_1720 11241 6460 gene locus_tag LOCUS_1730 11241 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 12271 11234 gene locus_tag LOCUS_1740 12271 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 13416 12334 gene locus_tag LOCUS_1750 13416 12334 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_1750 13499 13425 gene locus_tag LOCUS_t0060 13499 13425 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13772 13503 gene locus_tag LOCUS_1760 13772 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 13812 14801 gene locus_tag LOCUS_1770 gene mltG 13812 14801 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_1770 14798 16963 gene locus_tag LOCUS_1780 gene pcrA 14798 16963 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546275.1 protein_id gnl|my_center|LOCUS_1780 16990 17454 gene locus_tag LOCUS_1790 16990 17454 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_1790 17459 18340 gene locus_tag LOCUS_1800 17459 18340 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_1800 18330 19928 gene locus_tag LOCUS_1810 18330 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 21991 19925 gene locus_tag LOCUS_1820 21991 19925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 22212 22739 gene locus_tag LOCUS_1830 22212 22739 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_1830 22743 23708 gene locus_tag LOCUS_1840 gene trpS 22743 23708 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221812.1 protein_id gnl|my_center|LOCUS_1840 23709 24431 gene locus_tag LOCUS_1850 23709 24431 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965361.1 protein_id gnl|my_center|LOCUS_1850 24428 24958 gene locus_tag LOCUS_1860 gene scpB 24428 24958 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_1860 24958 25665 gene locus_tag LOCUS_1870 24958 25665 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903490.1 protein_id gnl|my_center|LOCUS_1870 25725 26381 gene locus_tag LOCUS_1880 gene cmk 25725 26381 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 protein_id gnl|my_center|LOCUS_1880 26383 28173 gene locus_tag LOCUS_1890 gene rpsA 26383 28173 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_1890 28160 29122 gene locus_tag LOCUS_1900 28160 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 29119 30093 gene locus_tag LOCUS_1910 gene tsaD 29119 30093 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_1910 30093 31295 gene locus_tag LOCUS_1920 30093 31295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 31312 32577 gene locus_tag LOCUS_1930 gene serS 31312 32577 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_1930 32578 33279 gene locus_tag LOCUS_1940 32578 33279 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 protein_id gnl|my_center|LOCUS_1940 33281 33745 gene locus_tag LOCUS_1950 33281 33745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 33785 35536 gene locus_tag LOCUS_1960 33785 35536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 35545 35835 gene locus_tag LOCUS_1970 35545 35835 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404129.1 protein_id gnl|my_center|LOCUS_1970 35947 36810 gene locus_tag LOCUS_1980 35947 36810 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_1980 36823 38166 gene locus_tag LOCUS_1990 36823 38166 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576225.1 protein_id gnl|my_center|LOCUS_1990 38167 38649 gene locus_tag LOCUS_2000 38167 38649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 39543 38629 gene locus_tag LOCUS_2010 39543 38629 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_2010 39574 40782 gene locus_tag LOCUS_2020 39574 40782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 40871 42202 gene locus_tag LOCUS_2030 40871 42202 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_2030 42205 43383 gene locus_tag LOCUS_2040 42205 43383 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337389.1 protein_id gnl|my_center|LOCUS_2040 43373 44128 gene locus_tag LOCUS_2050 43373 44128 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_2050 44115 44768 gene locus_tag LOCUS_2060 44115 44768 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_2060 44769 45392 gene locus_tag LOCUS_2070 gene nqrE 44769 45392 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328966.1 protein_id gnl|my_center|LOCUS_2070 45392 46618 gene locus_tag LOCUS_2080 gene nqrF 45392 46618 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368114.1 protein_id gnl|my_center|LOCUS_2080 46602 47597 gene locus_tag LOCUS_2090 46602 47597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 47758 47594 gene locus_tag LOCUS_2100 47758 47594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 47827 49140 gene locus_tag LOCUS_2110 gene nhaD 47827 49140 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_2110 49140 49682 gene locus_tag LOCUS_2120 49140 49682 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708720.1 protein_id gnl|my_center|LOCUS_2120 49686 50684 gene locus_tag LOCUS_2130 49686 50684 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_2130 50665 51531 gene locus_tag LOCUS_2140 gene ispH 50665 51531 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_2140 51524 52396 gene locus_tag LOCUS_2150 gene pdxS 51524 52396 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016899.1 protein_id gnl|my_center|LOCUS_2150 52399 52974 gene locus_tag LOCUS_2160 gene pdxT 52399 52974 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871185.1 protein_id gnl|my_center|LOCUS_2160 52961 54832 gene locus_tag LOCUS_2170 gene dxs 52961 54832 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880536.1 protein_id gnl|my_center|LOCUS_2170 54825 56420 gene locus_tag LOCUS_2180 54825 56420 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249802.1 protein_id gnl|my_center|LOCUS_2180 56424 56831 gene locus_tag LOCUS_2190 56424 56831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 56831 58798 gene locus_tag LOCUS_2200 gene ccsA 56831 58798 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997623.1 protein_id gnl|my_center|LOCUS_2200 58888 59484 gene locus_tag LOCUS_2210 58888 59484 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870536.1 protein_id gnl|my_center|LOCUS_2210 59486 60145 gene locus_tag LOCUS_2220 59486 60145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 60145 60792 gene locus_tag LOCUS_2230 gene ccsA 60145 60792 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886993.1 protein_id gnl|my_center|LOCUS_2230 60905 61969 gene locus_tag LOCUS_2240 60905 61969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_2240 61969 62601 gene locus_tag LOCUS_2250 61969 62601 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_2250 62591 63910 gene locus_tag LOCUS_2260 gene tilS 62591 63910 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_2260 63947 65842 gene locus_tag LOCUS_2270 gene ftsH 63947 65842 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_2270 65846 66697 gene locus_tag LOCUS_2280 gene folP 65846 66697 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_2280 66826 67485 gene locus_tag LOCUS_2290 66826 67485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 67488 68963 gene locus_tag LOCUS_2300 67488 68963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 69078 70049 gene locus_tag LOCUS_2310 gene prfB 69078 70049 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 protein_id gnl|my_center|LOCUS_2310 70059 71534 gene locus_tag LOCUS_2320 gene lysS 70059 71534 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_2320 71531 72679 gene locus_tag LOCUS_2330 71531 72679 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862413.1 protein_id gnl|my_center|LOCUS_2330 72676 73815 gene locus_tag LOCUS_2340 72676 73815 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545027.1 protein_id gnl|my_center|LOCUS_2340 73812 74384 gene locus_tag LOCUS_2350 73812 74384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 74500 76407 gene locus_tag LOCUS_2360 gene dnaK 74500 76407 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_2360 76451 77650 gene locus_tag LOCUS_2370 76451 77650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 77637 78629 gene locus_tag LOCUS_2380 77637 78629 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_2380 78636 79514 gene locus_tag LOCUS_2390 78636 79514 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_2390 79514 80377 gene locus_tag LOCUS_2400 79514 80377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 80405 80968 gene locus_tag LOCUS_2410 gene efp 80405 80968 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076127.1 protein_id gnl|my_center|LOCUS_2410 80973 81440 gene locus_tag LOCUS_2420 gene accB 80973 81440 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269006.1 protein_id gnl|my_center|LOCUS_2420 81512 82810 gene locus_tag LOCUS_2430 gene accC 81512 82810 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_2430 82797 83174 gene locus_tag LOCUS_2440 gene gcvH 82797 83174 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831963.1 protein_id gnl|my_center|LOCUS_2440 83167 84084 gene locus_tag LOCUS_2450 gene xerD 83167 84084 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_2450 >Feature sequence03 3002 312 gene locus_tag LOCUS_2460 3002 312 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_2460 3172 4071 gene locus_tag LOCUS_2470 3172 4071 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088169.1 protein_id gnl|my_center|LOCUS_2470 4064 5089 gene locus_tag LOCUS_2480 gene rfbB 4064 5089 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202143.1 protein_id gnl|my_center|LOCUS_2480 5129 7033 gene locus_tag LOCUS_2490 5129 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 7040 7780 gene locus_tag LOCUS_2500 gene gpmA 7040 7780 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_2500 7777 8694 gene locus_tag LOCUS_2510 7777 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 8691 9248 gene locus_tag LOCUS_2520 gene gmhA 8691 9248 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351733.1 protein_id gnl|my_center|LOCUS_2520 10502 9243 gene locus_tag LOCUS_2530 10502 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 12207 10477 gene locus_tag LOCUS_2540 12207 10477 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_2540 13020 12310 gene locus_tag LOCUS_2550 13020 12310 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_2550 13928 13017 gene locus_tag LOCUS_2560 13928 13017 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_2560 14005 13931 gene locus_tag LOCUS_t0070 14005 13931 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14105 15166 gene locus_tag LOCUS_2570 14105 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 15163 15477 gene locus_tag LOCUS_2580 15163 15477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 16171 15482 gene locus_tag LOCUS_2590 16171 15482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 17394 16228 gene locus_tag LOCUS_2600 17394 16228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 17487 17948 gene locus_tag LOCUS_2610 17487 17948 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_2610 17948 19054 gene locus_tag LOCUS_2620 17948 19054 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_2620 19055 20164 gene locus_tag LOCUS_2630 19055 20164 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_2630 20183 21064 gene locus_tag LOCUS_2640 20183 21064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 21054 21518 gene locus_tag LOCUS_2650 gene cysC 21054 21518 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868289.1 protein_id gnl|my_center|LOCUS_2650 21493 21840 gene locus_tag LOCUS_2660 21493 21840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 21837 23084 gene locus_tag LOCUS_2670 gene wzx 21837 23084 CDS product O-antigen flipase Wzx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119725.1 protein_id gnl|my_center|LOCUS_2670 23087 23710 gene locus_tag LOCUS_2680 gene hisH 23087 23710 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_2680 23730 24476 gene locus_tag LOCUS_2690 23730 24476 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_2690 24506 25621 gene locus_tag LOCUS_2700 24506 25621 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_2700 26481 25642 gene locus_tag LOCUS_2710 26481 25642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203007.1 protein_id gnl|my_center|LOCUS_2710 26590 27498 gene locus_tag LOCUS_2720 26590 27498 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_2720 27470 28624 gene locus_tag LOCUS_2730 27470 28624 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_2730 28621 29601 gene locus_tag LOCUS_2740 gene gmd 28621 29601 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330038.1 protein_id gnl|my_center|LOCUS_2740 30173 29604 gene locus_tag LOCUS_2750 30173 29604 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_2750 30247 31170 gene locus_tag LOCUS_2760 30247 31170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 31784 32326 gene locus_tag LOCUS_2770 31784 32326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 32344 33468 gene locus_tag LOCUS_2780 32344 33468 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_2780 33495 34709 gene locus_tag LOCUS_2790 33495 34709 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 protein_id gnl|my_center|LOCUS_2790 34763 35710 gene locus_tag LOCUS_2800 34763 35710 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_2800 35710 36327 gene locus_tag LOCUS_2810 35710 36327 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243002.1 protein_id gnl|my_center|LOCUS_2810 36308 36727 gene locus_tag LOCUS_2820 36308 36727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 36720 37880 gene locus_tag LOCUS_2830 36720 37880 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_2830 37892 39676 gene locus_tag LOCUS_2840 37892 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 40787 39654 gene locus_tag LOCUS_2850 40787 39654 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972527.1 protein_id gnl|my_center|LOCUS_2850 42274 40787 gene locus_tag LOCUS_2860 gene ahcY 42274 40787 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_2860 43401 42283 gene locus_tag LOCUS_2870 gene metK 43401 42283 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088686.1 protein_id gnl|my_center|LOCUS_2870 43727 43401 gene locus_tag LOCUS_2880 43727 43401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 43831 44538 gene locus_tag LOCUS_2890 43831 44538 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880775.1 protein_id gnl|my_center|LOCUS_2890 44930 45928 gene locus_tag LOCUS_2900 44930 45928 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_2900 45930 48212 gene locus_tag LOCUS_2910 45930 48212 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404269.1 protein_id gnl|my_center|LOCUS_2910 48205 48639 gene locus_tag LOCUS_2920 gene ybeY 48205 48639 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_2920 48632 49402 gene locus_tag LOCUS_2930 gene mazG 48632 49402 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583864.1 protein_id gnl|my_center|LOCUS_2930 49389 49811 gene locus_tag LOCUS_2940 49389 49811 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261186.1 protein_id gnl|my_center|LOCUS_2940 50386 49808 gene locus_tag LOCUS_2950 50386 49808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 50418 51587 gene locus_tag LOCUS_2960 gene envC 50418 51587 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704298.1 protein_id gnl|my_center|LOCUS_2960 51577 52641 gene locus_tag LOCUS_2970 51577 52641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 52645 54120 gene locus_tag LOCUS_2980 gene metG 52645 54120 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_2980 54120 54878 gene locus_tag LOCUS_2990 54120 54878 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081106.1 protein_id gnl|my_center|LOCUS_2990 54879 55640 gene locus_tag LOCUS_3000 gene rsmA 54879 55640 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768067.1 protein_id gnl|my_center|LOCUS_3000 55678 55872 gene locus_tag LOCUS_3010 gene rpsU 55678 55872 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933577.1 protein_id gnl|my_center|LOCUS_3010 55924 57237 gene locus_tag LOCUS_3020 gene glmM 55924 57237 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_3020 57234 59858 gene locus_tag LOCUS_3030 57234 59858 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_3030 59855 61183 gene locus_tag LOCUS_3040 59855 61183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 61190 63289 gene locus_tag LOCUS_3050 gene recG 61190 63289 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_3050 63297 63611 gene locus_tag LOCUS_3060 63297 63611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 63614 66493 gene locus_tag LOCUS_3070 63614 66493 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927134.1 protein_id gnl|my_center|LOCUS_3070 66493 67506 gene locus_tag LOCUS_3080 66493 67506 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_3080 68360 67491 gene locus_tag LOCUS_3090 68360 67491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 68391 69812 gene locus_tag LOCUS_3100 68391 69812 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_3100 69929 71197 gene locus_tag LOCUS_3110 69929 71197 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_3110 71207 72466 gene locus_tag LOCUS_3120 71207 72466 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_3120 72459 73148 gene locus_tag LOCUS_3130 72459 73148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_3130 >Feature sequence04 485 60 gene locus_tag LOCUS_3140 485 60 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_3140 1133 498 gene locus_tag LOCUS_3150 1133 498 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_3150 1522 1142 gene locus_tag LOCUS_3160 1522 1142 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789114.1 protein_id gnl|my_center|LOCUS_3160 2784 1519 gene locus_tag LOCUS_3170 2784 1519 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_3170 4633 2798 gene locus_tag LOCUS_3180 4633 2798 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926815.1 protein_id gnl|my_center|LOCUS_3180 5055 4630 gene locus_tag LOCUS_3190 5055 4630 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543296.1 protein_id gnl|my_center|LOCUS_3190 5080 5829 gene locus_tag LOCUS_3200 5080 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 6596 5826 gene locus_tag LOCUS_3210 6596 5826 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 protein_id gnl|my_center|LOCUS_3210 6645 6956 gene locus_tag LOCUS_3220 gene grxD 6645 6956 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597012.1 protein_id gnl|my_center|LOCUS_3220 7011 7083 gene locus_tag LOCUS_t0080 7011 7083 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7317 7390 gene locus_tag LOCUS_t0090 7317 7390 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8488 7394 gene locus_tag LOCUS_3230 8488 7394 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_3230 9326 8505 gene locus_tag LOCUS_3240 9326 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 10166 9363 gene locus_tag LOCUS_3250 10166 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 10188 10934 gene locus_tag LOCUS_3260 10188 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 10931 11425 gene locus_tag LOCUS_3270 10931 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 12318 11422 gene locus_tag LOCUS_3280 gene zupT 12318 11422 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_3280 12224 12571 gene locus_tag LOCUS_3290 12224 12571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 12573 13085 gene locus_tag LOCUS_3300 12573 13085 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_3300 13325 13095 gene locus_tag LOCUS_3310 gene yidD 13325 13095 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_3310 13845 13318 gene locus_tag LOCUS_3320 gene dcd 13845 13318 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_3320 13908 14756 gene locus_tag LOCUS_3330 gene lgt 13908 14756 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932768.1 protein_id gnl|my_center|LOCUS_3330 15216 14740 gene locus_tag LOCUS_3340 15216 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 17700 15235 gene locus_tag LOCUS_3350 17700 15235 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_3350 17803 18135 gene locus_tag LOCUS_3360 17803 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 18169 18813 gene locus_tag LOCUS_3370 18169 18813 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_3370 19562 18810 gene locus_tag LOCUS_3380 19562 18810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 20533 19562 gene locus_tag LOCUS_3390 20533 19562 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948665.1 protein_id gnl|my_center|LOCUS_3390 21648 20626 gene locus_tag LOCUS_3400 gene alkB1 21648 20626 CDS product alkane 1-monooxygenase AlkB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102475.1 protein_id gnl|my_center|LOCUS_3400 21917 21705 gene locus_tag LOCUS_3410 21917 21705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 22020 21945 gene locus_tag LOCUS_t0100 22020 21945 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22104 22031 gene locus_tag LOCUS_t0110 22104 22031 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22186 23535 gene locus_tag LOCUS_3420 22186 23535 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_3420 25618 23537 gene locus_tag LOCUS_3430 25618 23537 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_3430 27012 25615 gene locus_tag LOCUS_3440 gene fumC 27012 25615 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172644.1 protein_id gnl|my_center|LOCUS_3440 28025 27012 gene locus_tag LOCUS_3450 28025 27012 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_3450 29865 28018 gene locus_tag LOCUS_3460 29865 28018 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403201.1 protein_id gnl|my_center|LOCUS_3460 29988 30299 gene locus_tag LOCUS_3470 29988 30299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 30301 30648 gene locus_tag LOCUS_3480 30301 30648 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_3480 30648 32093 gene locus_tag LOCUS_3490 gene sufB 30648 32093 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_3490 32098 32838 gene locus_tag LOCUS_3500 gene sufC 32098 32838 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771014.1 protein_id gnl|my_center|LOCUS_3500 32840 34021 gene locus_tag LOCUS_3510 gene sufD 32840 34021 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_3510 34014 34439 gene locus_tag LOCUS_3520 34014 34439 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_3520 34432 34953 gene locus_tag LOCUS_3530 gene sufT 34432 34953 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_3530 34960 36153 gene locus_tag LOCUS_3540 gene sufS 34960 36153 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020767.1 protein_id gnl|my_center|LOCUS_3540 36153 36398 gene locus_tag LOCUS_3550 36153 36398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 38245 36395 gene locus_tag LOCUS_3560 38245 36395 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_3560 39226 38255 gene locus_tag LOCUS_3570 gene etfA 39226 38255 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398999.1 protein_id gnl|my_center|LOCUS_3570 39990 39226 gene locus_tag LOCUS_3580 39990 39226 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877797.1 protein_id gnl|my_center|LOCUS_3580 40606 40193 gene locus_tag LOCUS_3590 40606 40193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 41402 40641 gene locus_tag LOCUS_3600 41402 40641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 41902 41399 gene locus_tag LOCUS_3610 41902 41399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 41965 43482 gene locus_tag LOCUS_3620 41965 43482 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_3620 43498 44070 gene locus_tag LOCUS_3630 43498 44070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 44061 44660 gene locus_tag LOCUS_3640 44061 44660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 45804 44635 gene locus_tag LOCUS_3650 45804 44635 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421587.1 protein_id gnl|my_center|LOCUS_3650 <46594 45838 gene locus_tag LOCUS_3660 <46594 45838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_170039298.1:3'(2'),5'-bisphosphate nucleotidase CysQ >Feature sequence05 <1 788 gene locus_tag LOCUS_3670 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787921.1:VWA domain-containing protein 785 1780 gene locus_tag LOCUS_3680 785 1780 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_3680 1777 2505 gene locus_tag LOCUS_3690 1777 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 2499 4205 gene locus_tag LOCUS_3700 2499 4205 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_3700 4198 4938 gene locus_tag LOCUS_3710 4198 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 4940 5353 gene locus_tag LOCUS_3720 4940 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 5353 6081 gene locus_tag LOCUS_3730 5353 6081 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_3730 6081 6551 gene locus_tag LOCUS_3740 gene ruvC 6081 6551 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583962.1 protein_id gnl|my_center|LOCUS_3740 6552 7145 gene locus_tag LOCUS_3750 gene ruvA 6552 7145 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545070.1 protein_id gnl|my_center|LOCUS_3750 7142 8215 gene locus_tag LOCUS_3760 gene gcvT 7142 8215 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_3760 8212 10524 gene locus_tag LOCUS_3770 8212 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 10514 11071 gene locus_tag LOCUS_3780 10514 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 11068 11619 gene locus_tag LOCUS_3790 11068 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 11763 12503 gene locus_tag LOCUS_3800 11763 12503 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583317.1 protein_id gnl|my_center|LOCUS_3800 12500 13873 gene locus_tag LOCUS_3810 gene cysS 12500 13873 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966454.1 protein_id gnl|my_center|LOCUS_3810 13941 14014 gene locus_tag LOCUS_t0120 13941 14014 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14088 14171 gene locus_tag LOCUS_t0130 14088 14171 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 14179 14252 gene locus_tag LOCUS_t0140 14179 14252 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14260 14333 gene locus_tag LOCUS_t0150 14260 14333 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14375 15568 gene locus_tag LOCUS_3820 gene tuf 14375 15568 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933844.1 protein_id gnl|my_center|LOCUS_3820 15568 15732 gene locus_tag LOCUS_3830 gene rpmG 15568 15732 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_3830 15738 15811 gene locus_tag LOCUS_t0160 15738 15811 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15827 16009 gene locus_tag LOCUS_3840 15827 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 16009 16542 gene locus_tag LOCUS_3850 gene nusG 16009 16542 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536871.1 protein_id gnl|my_center|LOCUS_3850 16545 16973 gene locus_tag LOCUS_3860 gene rplK 16545 16973 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931845.1 protein_id gnl|my_center|LOCUS_3860 16970 17650 gene locus_tag LOCUS_3870 gene rplA 16970 17650 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_3870 17653 18168 gene locus_tag LOCUS_3880 gene rplJ 17653 18168 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053001.1 protein_id gnl|my_center|LOCUS_3880 18174 18554 gene locus_tag LOCUS_3890 gene rplL 18174 18554 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215374.1 protein_id gnl|my_center|LOCUS_3890 18606 22361 gene locus_tag LOCUS_3900 gene rpoB 18606 22361 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_3900 22374 26555 gene locus_tag LOCUS_3910 gene rpoC 22374 26555 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_3910 26685 27059 gene locus_tag LOCUS_3920 gene rpsL 26685 27059 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_3920 27063 27536 gene locus_tag LOCUS_3930 gene rpsG 27063 27536 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385326.1 protein_id gnl|my_center|LOCUS_3930 27536 29623 gene locus_tag LOCUS_3940 gene fusA 27536 29623 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946076.1 protein_id gnl|my_center|LOCUS_3940 29623 29931 gene locus_tag LOCUS_3950 gene rpsJ 29623 29931 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638059.1 protein_id gnl|my_center|LOCUS_3950 29939 30559 gene locus_tag LOCUS_3960 gene rplC 29939 30559 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579663.1 protein_id gnl|my_center|LOCUS_3960 30556 31173 gene locus_tag LOCUS_3970 gene rplD 30556 31173 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290446.1 protein_id gnl|my_center|LOCUS_3970 31173 31484 gene locus_tag LOCUS_3980 gene rplW 31173 31484 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583347.1 protein_id gnl|my_center|LOCUS_3980 31494 32321 gene locus_tag LOCUS_3990 gene rplB 31494 32321 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_3990 32321 32593 gene locus_tag LOCUS_4000 gene rpsS 32321 32593 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762037.1 protein_id gnl|my_center|LOCUS_4000 32593 32928 gene locus_tag LOCUS_4010 gene rplV 32593 32928 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_4010 32934 33572 gene locus_tag LOCUS_4020 gene rpsC 32934 33572 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806910.1 protein_id gnl|my_center|LOCUS_4020 33572 33994 gene locus_tag LOCUS_4030 gene rplP 33572 33994 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869922.1 protein_id gnl|my_center|LOCUS_4030 33984 34193 gene locus_tag LOCUS_4040 33984 34193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 34186 34440 gene locus_tag LOCUS_4050 34186 34440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 34440 34808 gene locus_tag LOCUS_4060 gene rplN 34440 34808 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_4060 34808 35113 gene locus_tag LOCUS_4070 gene rplX 34808 35113 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701316.1 protein_id gnl|my_center|LOCUS_4070 35118 35699 gene locus_tag LOCUS_4080 gene rplE 35118 35699 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_4080 35692 35997 gene locus_tag LOCUS_4090 gene rpsN 35692 35997 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883572.1 protein_id gnl|my_center|LOCUS_4090 36007 36405 gene locus_tag LOCUS_4100 gene rpsH 36007 36405 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904135.1 protein_id gnl|my_center|LOCUS_4100 36407 36949 gene locus_tag LOCUS_4110 gene rplF 36407 36949 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129925.1 protein_id gnl|my_center|LOCUS_4110 36949 37308 gene locus_tag LOCUS_4120 gene rplR 36949 37308 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_4120 37322 37828 gene locus_tag LOCUS_4130 gene rpsE 37322 37828 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_4130 37830 38015 gene locus_tag LOCUS_4140 gene rpmD 37830 38015 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596229.1 protein_id gnl|my_center|LOCUS_4140 38012 38443 gene locus_tag LOCUS_4150 gene rplO 38012 38443 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081797.1 protein_id gnl|my_center|LOCUS_4150 38440 39636 gene locus_tag LOCUS_4160 gene secY 38440 39636 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_4160 39739 40488 gene locus_tag LOCUS_4170 gene map 39739 40488 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357322.1 protein_id gnl|my_center|LOCUS_4170 40498 40722 gene locus_tag LOCUS_4180 gene infA 40498 40722 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933820.1 protein_id gnl|my_center|LOCUS_4180 40841 41221 gene locus_tag LOCUS_4190 gene rpsM 40841 41221 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_4190 41223 41609 gene locus_tag LOCUS_4200 gene rpsK 41223 41609 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933817.1 protein_id gnl|my_center|LOCUS_4200 41613 42227 gene locus_tag LOCUS_4210 gene rpsD 41613 42227 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933816.1 protein_id gnl|my_center|LOCUS_4210 42238 43203 gene locus_tag LOCUS_4220 42238 43203 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061621.1 protein_id gnl|my_center|LOCUS_4220 >Feature sequence06 61 618 gene locus_tag LOCUS_4230 61 618 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693206.1 protein_id gnl|my_center|LOCUS_4230 1332 619 gene locus_tag LOCUS_4240 gene ubiE 1332 619 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962498.1 protein_id gnl|my_center|LOCUS_4240 2026 4008 gene locus_tag LOCUS_4250 gene acs 2026 4008 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_4250 4963 4049 gene locus_tag LOCUS_4260 4963 4049 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945962.1 protein_id gnl|my_center|LOCUS_4260 5212 4964 gene locus_tag LOCUS_4270 5212 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 6026 5190 gene locus_tag LOCUS_4280 gene fabG 6026 5190 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_4280 7170 6028 gene locus_tag LOCUS_4290 7170 6028 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 protein_id gnl|my_center|LOCUS_4290 7301 10678 gene locus_tag LOCUS_4300 7301 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 10698 11495 gene locus_tag LOCUS_4310 10698 11495 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_4310 11502 12245 gene locus_tag LOCUS_4320 11502 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 12861 12223 gene locus_tag LOCUS_4330 12861 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 12928 13581 gene locus_tag LOCUS_4340 12928 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 13578 14105 gene locus_tag LOCUS_4350 13578 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 15124 14246 gene locus_tag LOCUS_4360 15124 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4360 16025 15108 gene locus_tag LOCUS_4370 16025 15108 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021206.1 protein_id gnl|my_center|LOCUS_4370 16225 16022 gene locus_tag LOCUS_4380 16225 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 16490 16218 gene locus_tag LOCUS_4390 16490 16218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 16634 16894 gene locus_tag LOCUS_4400 gene grxC 16634 16894 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310936.1 protein_id gnl|my_center|LOCUS_4400 17925 16897 gene locus_tag LOCUS_4410 17925 16897 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_4410 18378 17965 gene locus_tag LOCUS_4420 18378 17965 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_4420 19499 18420 gene locus_tag LOCUS_4430 19499 18420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 20487 19492 gene locus_tag LOCUS_4440 20487 19492 CDS product glycosyl transferase family 90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462500.1 protein_id gnl|my_center|LOCUS_4440 21298 20474 gene locus_tag LOCUS_4450 21298 20474 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122210.1 protein_id gnl|my_center|LOCUS_4450 21355 22035 gene locus_tag LOCUS_4460 gene queC 21355 22035 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_4460 22032 22664 gene locus_tag LOCUS_4470 gene queE 22032 22664 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085270.1 protein_id gnl|my_center|LOCUS_4470 22666 23037 gene locus_tag LOCUS_4480 gene queD 22666 23037 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108294.1 protein_id gnl|my_center|LOCUS_4480 23030 23416 gene locus_tag LOCUS_4490 gene queF 23030 23416 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080885.1 protein_id gnl|my_center|LOCUS_4490 23418 23984 gene locus_tag LOCUS_4500 23418 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 24046 24837 gene locus_tag LOCUS_4510 24046 24837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 24812 25303 gene locus_tag LOCUS_4520 24812 25303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 25296 25808 gene locus_tag LOCUS_4530 25296 25808 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083551.1 protein_id gnl|my_center|LOCUS_4530 25935 26162 gene locus_tag LOCUS_4540 25935 26162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 26170 27273 gene locus_tag LOCUS_4550 26170 27273 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_4550 27283 27759 gene locus_tag LOCUS_4560 27283 27759 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814912.1 protein_id gnl|my_center|LOCUS_4560 27756 28316 gene locus_tag LOCUS_4570 27756 28316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921973.1 protein_id gnl|my_center|LOCUS_4570 28397 28609 gene locus_tag LOCUS_4580 28397 28609 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566521.1 protein_id gnl|my_center|LOCUS_4580 28656 28728 gene locus_tag LOCUS_t0170 28656 28728 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 28738 29499 gene locus_tag LOCUS_4590 28738 29499 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_4590 29496 29732 gene locus_tag LOCUS_4600 29496 29732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4600 30363 29722 gene locus_tag LOCUS_4610 30363 29722 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_4610 30530 30814 gene locus_tag LOCUS_4620 30530 30814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 31301 32011 gene locus_tag LOCUS_4630 31301 32011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 32011 32538 gene locus_tag LOCUS_4640 32011 32538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4640 32531 33475 gene locus_tag LOCUS_4650 gene glpX 32531 33475 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545655.1 protein_id gnl|my_center|LOCUS_4650 33477 34460 gene locus_tag LOCUS_4660 33477 34460 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_4660 35079 34462 gene locus_tag LOCUS_4670 35079 34462 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_4670 35141 37291 gene locus_tag LOCUS_4680 35141 37291 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107297.1 protein_id gnl|my_center|LOCUS_4680 37376 37864 gene locus_tag LOCUS_4690 37376 37864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 38514 37912 gene locus_tag LOCUS_4700 38514 37912 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974104.1 protein_id gnl|my_center|LOCUS_4700 38598 39098 gene locus_tag LOCUS_4710 gene tpx 38598 39098 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_4710 39972 39091 gene locus_tag LOCUS_4720 39972 39091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 41378 39969 gene locus_tag LOCUS_4730 41378 39969 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_4730 41510 42157 gene locus_tag LOCUS_4740 41510 42157 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_4740 >Feature sequence07 <1 697 gene locus_tag LOCUS_4750 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927002.1:twin-arginine translocase subunit TatC 694 1695 gene locus_tag LOCUS_4760 694 1695 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_4760 1692 2927 gene locus_tag LOCUS_4770 1692 2927 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_4770 2920 3462 gene locus_tag LOCUS_4780 2920 3462 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583479.1 protein_id gnl|my_center|LOCUS_4780 3531 5525 gene locus_tag LOCUS_4790 gene uvrB 3531 5525 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403914.1 protein_id gnl|my_center|LOCUS_4790 5540 6742 gene locus_tag LOCUS_4800 5540 6742 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_4800 6786 7277 gene locus_tag LOCUS_4810 6786 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 7271 8572 gene locus_tag LOCUS_4820 gene asnS 7271 8572 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_4820 8572 9030 gene locus_tag LOCUS_4830 8572 9030 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880029.1 protein_id gnl|my_center|LOCUS_4830 9015 10649 gene locus_tag LOCUS_4840 9015 10649 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_4840 10642 12423 gene locus_tag LOCUS_4850 gene lepA 10642 12423 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_4850 12425 13120 gene locus_tag LOCUS_4860 12425 13120 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_4860 13124 13849 gene locus_tag LOCUS_4870 13124 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 13842 14831 gene locus_tag LOCUS_4880 13842 14831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 14831 15541 gene locus_tag LOCUS_4890 14831 15541 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_4890 15538 16482 gene locus_tag LOCUS_4900 15538 16482 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546641.1 protein_id gnl|my_center|LOCUS_4900 18335 16479 gene locus_tag LOCUS_4910 18335 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 18437 20164 gene locus_tag LOCUS_4920 18437 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 20209 22446 gene locus_tag LOCUS_4930 20209 22446 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_4930 24035 22443 gene locus_tag LOCUS_4940 24035 22443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 24657 24025 gene locus_tag LOCUS_4950 24657 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 24824 25318 gene locus_tag LOCUS_4960 24824 25318 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956700.1 protein_id gnl|my_center|LOCUS_4960 25315 26295 gene locus_tag LOCUS_4970 25315 26295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 26348 28744 gene locus_tag LOCUS_4980 26348 28744 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_4980 28920 29180 gene locus_tag LOCUS_4990 28920 29180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 29180 30520 gene locus_tag LOCUS_5000 29180 30520 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531905.1 protein_id gnl|my_center|LOCUS_5000 30521 31771 gene locus_tag LOCUS_5010 gene aroA 30521 31771 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403445.1 protein_id gnl|my_center|LOCUS_5010 31768 32586 gene locus_tag LOCUS_5020 gene aroE 31768 32586 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439416.1 protein_id gnl|my_center|LOCUS_5020 32580 33740 gene locus_tag LOCUS_5030 gene aroC 32580 33740 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269425.1 protein_id gnl|my_center|LOCUS_5030 33763 34236 gene locus_tag LOCUS_5040 33763 34236 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964216.1 protein_id gnl|my_center|LOCUS_5040 34229 35296 gene locus_tag LOCUS_5050 gene aroB 34229 35296 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_5050 35293 35721 gene locus_tag LOCUS_5060 gene aroQ 35293 35721 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460281.1 protein_id gnl|my_center|LOCUS_5060 35721 36287 gene locus_tag LOCUS_5070 35721 36287 CDS product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948233.1 protein_id gnl|my_center|LOCUS_5070 36284 36997 gene locus_tag LOCUS_5080 36284 36997 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957934.1 protein_id gnl|my_center|LOCUS_5080 37009 37398 gene locus_tag LOCUS_5090 37009 37398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 37458 37982 gene locus_tag LOCUS_5100 37458 37982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 38027 38908 gene locus_tag LOCUS_5110 38027 38908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5110 39009 39659 gene locus_tag LOCUS_5120 gene fsa 39009 39659 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384540.1 protein_id gnl|my_center|LOCUS_5120 39667 39740 gene locus_tag LOCUS_t0180 39667 39740 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 39828 40790 gene locus_tag LOCUS_5130 39828 40790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 >Feature sequence08 745 104 gene locus_tag LOCUS_5140 745 104 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_5140 1842 742 gene locus_tag LOCUS_5150 1842 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 2157 1846 gene locus_tag LOCUS_5160 2157 1846 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979305.1 protein_id gnl|my_center|LOCUS_5160 3947 2157 gene locus_tag LOCUS_5170 3947 2157 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_5170 4835 3966 gene locus_tag LOCUS_5180 gene folD 4835 3966 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_5180 5141 4848 gene locus_tag LOCUS_5190 5141 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 7531 5150 gene locus_tag LOCUS_5200 gene pheT 7531 5150 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021090.1 protein_id gnl|my_center|LOCUS_5200 8511 7531 gene locus_tag LOCUS_5210 gene pheS 8511 7531 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_5210 8871 8521 gene locus_tag LOCUS_5220 gene rplT 8871 8521 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081652.1 protein_id gnl|my_center|LOCUS_5220 9076 8873 gene locus_tag LOCUS_5230 gene rpmI 9076 8873 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_5230 9613 9086 gene locus_tag LOCUS_5240 gene infC 9613 9086 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_5240 11531 9591 gene locus_tag LOCUS_5250 gene thrS 11531 9591 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 protein_id gnl|my_center|LOCUS_5250 12244 11528 gene locus_tag LOCUS_5260 12244 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 12693 12241 gene locus_tag LOCUS_5270 12693 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 14909 12696 gene locus_tag LOCUS_5280 14909 12696 CDS product DUF5916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925729.1 protein_id gnl|my_center|LOCUS_5280 17253 15070 gene locus_tag LOCUS_5290 17253 15070 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_5290 18373 17342 gene locus_tag LOCUS_5300 18373 17342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 19643 18360 gene locus_tag LOCUS_5310 19643 18360 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_5310 20257 19643 gene locus_tag LOCUS_5320 20257 19643 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_5320 23946 20263 gene locus_tag LOCUS_5330 23946 20263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 24566 23997 gene locus_tag LOCUS_5340 24566 23997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 25064 24567 gene locus_tag LOCUS_5350 25064 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 25474 25070 gene locus_tag LOCUS_5360 25474 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 26426 25557 gene locus_tag LOCUS_5370 26426 25557 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967356.1 protein_id gnl|my_center|LOCUS_5370 26521 28224 gene locus_tag LOCUS_5380 26521 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 28763 28221 gene locus_tag LOCUS_5390 gene apt 28763 28221 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650156.1 protein_id gnl|my_center|LOCUS_5390 29482 28817 gene locus_tag LOCUS_5400 29482 28817 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871978.1 protein_id gnl|my_center|LOCUS_5400 <30582 29545 gene locus_tag LOCUS_5410 <30582 29545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001179955.1:deoxyribodipyrimidine photo-lyase >Feature sequence09 <1 768 gene locus_tag LOCUS_5420 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098170.1:phosphotransferase family protein 1491 817 gene locus_tag LOCUS_5430 1491 817 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_5430 1569 2165 gene locus_tag LOCUS_5440 1569 2165 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404172.1 protein_id gnl|my_center|LOCUS_5440 2262 2642 gene locus_tag LOCUS_5450 2262 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 2726 3361 gene locus_tag LOCUS_5460 2726 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 3361 3747 gene locus_tag LOCUS_5470 3361 3747 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_5470 3747 4157 gene locus_tag LOCUS_5480 3747 4157 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_5480 4160 4903 gene locus_tag LOCUS_5490 4160 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 4900 5802 gene locus_tag LOCUS_5500 4900 5802 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_5500 5881 6873 gene locus_tag LOCUS_5510 5881 6873 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_5510 6923 7297 gene locus_tag LOCUS_5520 6923 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 7340 8656 gene locus_tag LOCUS_5530 gene der 7340 8656 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_5530 8656 9942 gene locus_tag LOCUS_5540 8656 9942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_5540 10121 11581 gene locus_tag LOCUS_5550 gene aceB 10121 11581 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483026.1 protein_id gnl|my_center|LOCUS_5550 11581 12858 gene locus_tag LOCUS_5560 gene aceA 11581 12858 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104513.1 protein_id gnl|my_center|LOCUS_5560 12912 13304 gene locus_tag LOCUS_5570 12912 13304 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039053.1 protein_id gnl|my_center|LOCUS_5570 13314 14753 gene locus_tag LOCUS_5580 13314 14753 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_5580 14753 14977 gene locus_tag LOCUS_5590 14753 14977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 14980 15696 gene locus_tag LOCUS_5600 14980 15696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 16278 15688 gene locus_tag LOCUS_5610 16278 15688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 16776 16285 gene locus_tag LOCUS_5620 16776 16285 CDS product siphovirus Gp157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860996.1 protein_id gnl|my_center|LOCUS_5620 18196 16808 gene locus_tag LOCUS_5630 18196 16808 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_5630 18482 18201 gene locus_tag LOCUS_5640 18482 18201 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404931.1 protein_id gnl|my_center|LOCUS_5640 19603 18482 gene locus_tag LOCUS_5650 19603 18482 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_5650 19693 20637 gene locus_tag LOCUS_5660 gene pip 19693 20637 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_5660 21241 20639 gene locus_tag LOCUS_5670 21241 20639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 >Feature sequence10 <1 636 gene locus_tag LOCUS_5680 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016054.1:toxin-antitoxin system YwqK family antitoxin 755 976 gene locus_tag LOCUS_5690 755 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 979 1182 gene locus_tag LOCUS_5700 979 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 1591 2114 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tactacgaaaacggacaact 2582 2956 gene locus_tag LOCUS_5710 2582 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 2961 4058 gene locus_tag LOCUS_5720 2961 4058 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_5720 4173 4757 gene locus_tag LOCUS_5730 4173 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 4825 5232 gene locus_tag LOCUS_5740 4825 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 5334 5765 gene locus_tag LOCUS_5750 5334 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 5836 6312 gene locus_tag LOCUS_5760 5836 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 6723 6451 gene locus_tag LOCUS_5770 6723 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 6839 7162 gene locus_tag LOCUS_5780 gene qacH 6839 7162 CDS product quaternary ammonium compound efflux SMR transporter QacH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010730188.1 protein_id gnl|my_center|LOCUS_5780 7185 8972 gene locus_tag LOCUS_5790 7185 8972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 8979 9602 gene locus_tag LOCUS_5800 gene pgeF 8979 9602 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015675.1 protein_id gnl|my_center|LOCUS_5800 9595 10338 gene locus_tag LOCUS_5810 9595 10338 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_5810 10335 11822 gene locus_tag LOCUS_5820 gene putP 10335 11822 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_5820 11843 12841 gene locus_tag LOCUS_5830 11843 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 12834 13403 gene locus_tag LOCUS_5840 12834 13403 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_5840 13406 13876 gene locus_tag LOCUS_5850 13406 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 13925 15535 gene locus_tag LOCUS_5860 13925 15535 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_5860 15522 16085 gene locus_tag LOCUS_5870 15522 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 16085 17008 gene locus_tag LOCUS_5880 16085 17008 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_5880 17001 18113 gene locus_tag LOCUS_5890 17001 18113 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_5890 18106 18954 gene locus_tag LOCUS_5900 18106 18954 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933862.1 protein_id gnl|my_center|LOCUS_5900 18951 20462 gene locus_tag LOCUS_5910 18951 20462 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933859.1 protein_id gnl|my_center|LOCUS_5910 >Feature sequence11 993 199 gene locus_tag LOCUS_5920 993 199 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839060.1 protein_id gnl|my_center|LOCUS_5920 2036 996 gene locus_tag LOCUS_5930 2036 996 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_5930 2597 2079 gene locus_tag LOCUS_5940 2597 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 3822 2602 gene locus_tag LOCUS_5950 3822 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 5471 3819 gene locus_tag LOCUS_5960 5471 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 6096 5410 gene locus_tag LOCUS_5970 6096 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 7068 6124 gene locus_tag LOCUS_5980 gene trxB 7068 6124 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_5980 7411 7082 gene locus_tag LOCUS_5990 gene trxA 7411 7082 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_5990 8699 7488 gene locus_tag LOCUS_6000 gene tyrS 8699 7488 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932250.1 protein_id gnl|my_center|LOCUS_6000 9154 8699 gene locus_tag LOCUS_6010 gene smpB 9154 8699 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943280.1 protein_id gnl|my_center|LOCUS_6010 9300 9782 gene locus_tag LOCUS_6020 9300 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 9854 9781 gene locus_tag LOCUS_t0190 9854 9781 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11010 9901 gene locus_tag LOCUS_6030 11010 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 11439 11011 gene locus_tag LOCUS_6040 11439 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 13384 11501 gene locus_tag LOCUS_6050 gene pepF 13384 11501 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989921.1 protein_id gnl|my_center|LOCUS_6050 14672 13551 gene locus_tag LOCUS_6060 14672 13551 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261142.1 protein_id gnl|my_center|LOCUS_6060 >Feature sequence12 751 835 gene locus_tag LOCUS_t0200 751 835 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1367 888 gene locus_tag LOCUS_6070 1367 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 2413 1439 gene locus_tag LOCUS_6080 gene lepB 2413 1439 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_6080 2964 2410 gene locus_tag LOCUS_6090 2964 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 3026 4633 gene locus_tag LOCUS_6100 3026 4633 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892595.1 protein_id gnl|my_center|LOCUS_6100 5645 4653 gene locus_tag LOCUS_6110 gene recA 5645 4653 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_6110 6955 5666 gene locus_tag LOCUS_6120 6955 5666 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_6120 7473 6943 gene locus_tag LOCUS_6130 7473 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 7966 7463 gene locus_tag LOCUS_6140 7966 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 8562 7963 gene locus_tag LOCUS_6150 gene recR 8562 7963 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_6150 8876 8562 gene locus_tag LOCUS_6160 8876 8562 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582669.1 protein_id gnl|my_center|LOCUS_6160 10438 8876 gene locus_tag LOCUS_6170 gene dnaX 10438 8876 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_6170 12011 10551 gene locus_tag LOCUS_6180 12011 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 12788 12024 gene locus_tag LOCUS_6190 gene yaaA 12788 12024 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_6190 13225 12785 gene locus_tag LOCUS_6200 13225 12785 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125898.1 protein_id gnl|my_center|LOCUS_6200 >Feature sequence13 140 1687 gene locus_tag LOCUS_6210 gene guaA 140 1687 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947449.1 protein_id gnl|my_center|LOCUS_6210 1678 2907 gene locus_tag LOCUS_6220 1678 2907 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_6220 2885 3790 gene locus_tag LOCUS_6230 2885 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 3915 5561 gene locus_tag LOCUS_6240 3915 5561 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_6240 5561 6037 gene locus_tag LOCUS_6250 5561 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 >Feature sequence14 <1 2229 gene locus_tag LOCUS_6260 <1 2229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783463.1:TonB-dependent receptor 2316 2389 gene locus_tag LOCUS_t0210 2316 2389 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2427 3401 gene locus_tag LOCUS_6270 2427 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_6270 3418 4251 gene locus_tag LOCUS_6280 3418 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 4274 5047 gene locus_tag LOCUS_6290 gene fkpA 4274 5047 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_6290 5050 5997 gene locus_tag LOCUS_6300 5050 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 6124 6864 gene locus_tag LOCUS_6310 6124 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 7225 6944 gene locus_tag LOCUS_6320 7225 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 >Feature sequence15 <1 1244 gene locus_tag LOCUS_6330 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941663.1:replicative DNA helicase 1247 3409 gene locus_tag LOCUS_6340 1247 3409 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583335.1 protein_id gnl|my_center|LOCUS_6340 3402 3818 gene locus_tag LOCUS_6350 gene ruvX 3402 3818 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931776.1 protein_id gnl|my_center|LOCUS_6350 3818 5203 gene locus_tag LOCUS_6360 gene lnt 3818 5203 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_6360 5200 5940 gene locus_tag LOCUS_6370 gene truA 5200 5940 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199179.1 protein_id gnl|my_center|LOCUS_6370 >Feature sequence16 359 757 gene locus_tag LOCUS_6380 gene rpsI 359 757 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656683.1 protein_id gnl|my_center|LOCUS_6380 762 1496 gene locus_tag LOCUS_6390 gene rpsB 762 1496 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881314.1 protein_id gnl|my_center|LOCUS_6390 1497 2099 gene locus_tag LOCUS_6400 gene tsf 1497 2099 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392547.1 protein_id gnl|my_center|LOCUS_6400 2102 2659 gene locus_tag LOCUS_6410 gene frr 2102 2659 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531501.1 protein_id gnl|my_center|LOCUS_6410 <4719 2671 gene locus_tag LOCUS_6420 <4719 2671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583735.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence17 1715 1032 gene locus_tag LOCUS_6430 gene kdsB 1715 1032 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721859.1 protein_id gnl|my_center|LOCUS_6430 2023 1712 gene locus_tag LOCUS_6440 gene gatC 2023 1712 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988561.1 protein_id gnl|my_center|LOCUS_6440 3355 2084 gene locus_tag LOCUS_6450 3355 2084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_6450 <4109 3348 gene locus_tag LOCUS_6460 <4109 3348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933018.1:ABC transporter permease >Feature sequence18 9 698 gene locus_tag LOCUS_6470 9 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 719 2341 gene locus_tag LOCUS_6480 719 2341 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328372.1 protein_id gnl|my_center|LOCUS_6480 2338 2997 gene locus_tag LOCUS_6490 2338 2997 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_6490 3004 3423 gene locus_tag LOCUS_6500 3004 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 >Feature sequence19 1657 719 gene locus_tag LOCUS_6510 gene fmt 1657 719 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_6510 2156 1647 gene locus_tag LOCUS_6520 gene def 2156 1647 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279461.1 protein_id gnl|my_center|LOCUS_6520 2471 2160 gene locus_tag LOCUS_6530 2471 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 3379 2486 gene locus_tag LOCUS_6540 3379 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6540 >Feature sequence20 797 1666 gene locus_tag LOCUS_6550 797 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 1691 1765 gene locus_tag LOCUS_t0220 1691 1765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1768 2256 gene locus_tag LOCUS_6560 gene tadA 1768 2256 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 protein_id gnl|my_center|LOCUS_6560 2999 2253 gene locus_tag LOCUS_6570 2999 2253 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_6570 >Feature sequence21 <1 821 gene locus_tag LOCUS_6580 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009872901.1:transketolase 814 1254 gene locus_tag LOCUS_6590 814 1254 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804783.1 protein_id gnl|my_center|LOCUS_6590 2094 1243 gene locus_tag LOCUS_6600 gene cyoE 2094 1243 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_6600 2641 2096 gene locus_tag LOCUS_6610 2641 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 >Feature sequence22 <1 539 gene locus_tag LOCUS_6620 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760911.1:M23 family metallopeptidase 539 1864 gene locus_tag LOCUS_6630 gene miaB 539 1864 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_6630 1864 2178 gene locus_tag LOCUS_6640 1864 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 >Feature sequence23 <1 1138 gene locus_tag LOCUS_6650 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141849.1:PHB depolymerase family esterase 1185 2129 gene locus_tag LOCUS_6660 gene arcC 1185 2129 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_6660 >Feature sequence24 144 1073 gene locus_tag LOCUS_6670 144 1073 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_6670 >Feature sequence25 <1 1387 gene locus_tag LOCUS_6680 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943853.1:ribonuclease G 1497 1871 gene locus_tag LOCUS_6690 gene rplU 1497 1871 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896002.1 protein_id gnl|my_center|LOCUS_6690 1884 2138 gene locus_tag LOCUS_6700 1884 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 >Feature sequence26 257 146 gene locus_tag LOCUS_r0010 257 146 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence27 579 283 gene locus_tag LOCUS_6710 579 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 1784 582 gene locus_tag LOCUS_6720 1784 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_6720