>Feature sequence0001 2286 259 gene locus_tag LOCUS_00010 2286 259 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_00010 2565 4928 gene locus_tag LOCUS_00020 2565 4928 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_00020 4925 6289 gene locus_tag LOCUS_00030 4925 6289 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_00030 6356 8725 gene locus_tag LOCUS_00040 6356 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8980 9450 gene locus_tag LOCUS_00050 8980 9450 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_00050 9550 10497 gene locus_tag LOCUS_00060 9550 10497 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_00060 11103 10549 gene locus_tag LOCUS_00070 11103 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 12067 11147 gene locus_tag LOCUS_00080 12067 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13581 12202 gene locus_tag LOCUS_00090 13581 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_00090 13916 16528 gene locus_tag LOCUS_00100 13916 16528 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_00100 17589 16543 gene locus_tag LOCUS_00110 17589 16543 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_00110 17790 18563 gene locus_tag LOCUS_00120 17790 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18630 19064 gene locus_tag LOCUS_00130 18630 19064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20187 19222 gene locus_tag LOCUS_00140 gene fba 20187 19222 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_00140 21813 20329 gene locus_tag LOCUS_00150 21813 20329 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_00150 23250 22036 gene locus_tag LOCUS_00160 23250 22036 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_00160 23703 24056 gene locus_tag LOCUS_00170 23703 24056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24053 24394 gene locus_tag LOCUS_00180 24053 24394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24404 26245 gene locus_tag LOCUS_00190 24404 26245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26315 26764 gene locus_tag LOCUS_00200 26315 26764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 >Feature sequence0002 <1 1973 gene locus_tag LOCUS_00210 <1 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404985.1:Na-K-Cl cotransporter 2445 1981 gene locus_tag LOCUS_00220 gene purE 2445 1981 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945979.1 protein_id gnl|my_center|LOCUS_00220 4841 2640 gene locus_tag LOCUS_00230 4841 2640 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530052.1 protein_id gnl|my_center|LOCUS_00230 4995 5468 gene locus_tag LOCUS_00240 4995 5468 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_00240 7418 5475 gene locus_tag LOCUS_00250 7418 5475 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922210.1 protein_id gnl|my_center|LOCUS_00250 7648 7803 gene locus_tag LOCUS_00260 7648 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 7952 8698 gene locus_tag LOCUS_00270 7952 8698 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113665.1 protein_id gnl|my_center|LOCUS_00270 8731 9741 gene locus_tag LOCUS_00280 8731 9741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 9741 10628 gene locus_tag LOCUS_00290 gene folD 9741 10628 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_00290 10659 11099 gene locus_tag LOCUS_00300 10659 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 11237 12052 gene locus_tag LOCUS_00310 11237 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 13505 12558 gene locus_tag LOCUS_00320 13505 12558 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_00320 14446 13529 gene locus_tag LOCUS_00330 gene oppB 14446 13529 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 protein_id gnl|my_center|LOCUS_00330 16061 14472 gene locus_tag LOCUS_00340 16061 14472 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_00340 16782 16273 gene locus_tag LOCUS_00350 16782 16273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 17559 16795 gene locus_tag LOCUS_00360 gene tpiA 17559 16795 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_00360 18872 17616 gene locus_tag LOCUS_00370 18872 17616 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_00370 20710 19190 gene locus_tag LOCUS_00380 20710 19190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 21308 22606 gene locus_tag LOCUS_00390 21308 22606 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_00390 22740 24560 gene locus_tag LOCUS_00400 22740 24560 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_00400 <27348 24755 gene locus_tag LOCUS_00410 <27348 24755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027613.1:DEAD/DEAH box helicase >Feature sequence0003 <1 1193 gene locus_tag LOCUS_00420 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein 1418 2395 gene locus_tag LOCUS_00430 gene selD 1418 2395 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_00430 2392 3117 gene locus_tag LOCUS_00440 gene hisH 2392 3117 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_00440 4146 3913 gene locus_tag LOCUS_00450 4146 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 4403 5911 gene locus_tag LOCUS_00460 4403 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 6472 7071 gene locus_tag LOCUS_00470 gene sodA 6472 7071 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_00470 8590 7139 gene locus_tag LOCUS_00480 gene lysS 8590 7139 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_00480 8694 9932 gene locus_tag LOCUS_00490 8694 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 11029 10007 gene locus_tag LOCUS_00500 11029 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 12638 11091 gene locus_tag LOCUS_00510 12638 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 12785 13975 gene locus_tag LOCUS_00520 12785 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 14235 14032 gene locus_tag LOCUS_00530 14235 14032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 15244 14123 gene locus_tag LOCUS_00540 15244 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 15978 15241 gene locus_tag LOCUS_00550 15978 15241 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257257.1 protein_id gnl|my_center|LOCUS_00550 17316 16063 gene locus_tag LOCUS_00560 17316 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 18206 17316 gene locus_tag LOCUS_00570 18206 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 19035 18208 gene locus_tag LOCUS_00580 19035 18208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 20808 19159 gene locus_tag LOCUS_00590 20808 19159 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_00590 23469 20818 gene locus_tag LOCUS_00600 23469 20818 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_00600 <25322 24087 gene locus_tag LOCUS_00610 <25322 24087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989822.1:primosomal protein N' >Feature sequence0004 86 538 gene locus_tag LOCUS_00620 86 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 763 2751 gene locus_tag LOCUS_00630 763 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2793 3569 gene locus_tag LOCUS_00640 2793 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 3621 4670 gene locus_tag LOCUS_00650 3621 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 4715 4927 gene locus_tag LOCUS_00660 4715 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 4996 5619 gene locus_tag LOCUS_00670 4996 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 5603 6214 gene locus_tag LOCUS_00680 5603 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6214 7959 gene locus_tag LOCUS_00690 6214 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 9004 7976 gene locus_tag LOCUS_00700 gene hemC 9004 7976 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_00700 10065 9031 gene locus_tag LOCUS_00710 gene hemA 10065 9031 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_00710 10986 10162 gene locus_tag LOCUS_00720 gene ccsB 10986 10162 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944563.1 protein_id gnl|my_center|LOCUS_00720 12422 11694 gene locus_tag LOCUS_00730 12422 11694 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583618.1 protein_id gnl|my_center|LOCUS_00730 12605 13261 gene locus_tag LOCUS_00740 12605 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 13319 14779 gene locus_tag LOCUS_00750 13319 14779 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_00750 15747 14776 gene locus_tag LOCUS_00760 15747 14776 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_00760 16514 15744 gene locus_tag LOCUS_00770 16514 15744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914047.1 protein_id gnl|my_center|LOCUS_00770 17262 16516 gene locus_tag LOCUS_00780 17262 16516 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_00780 18895 17243 gene locus_tag LOCUS_00790 18895 17243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_00790 21699 18961 gene locus_tag LOCUS_00800 21699 18961 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_00800 22618 21881 gene locus_tag LOCUS_00810 22618 21881 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_00810 23162 22647 gene locus_tag LOCUS_00820 23162 22647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 24168 23164 gene locus_tag LOCUS_00830 24168 23164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence0005 845 465 gene locus_tag LOCUS_00840 845 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1090 1356 gene locus_tag LOCUS_00850 1090 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1493 1756 gene locus_tag LOCUS_00860 1493 1756 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_00860 1753 2250 gene locus_tag LOCUS_00870 1753 2250 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_00870 3953 2616 gene locus_tag LOCUS_00880 3953 2616 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_00880 4075 4293 gene locus_tag LOCUS_00890 4075 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4532 5269 gene locus_tag LOCUS_00900 4532 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6680 5418 gene locus_tag LOCUS_00910 6680 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 8901 7120 gene locus_tag LOCUS_00920 8901 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 9609 10997 gene locus_tag LOCUS_00930 9609 10997 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_00930 11290 13677 gene locus_tag LOCUS_00940 11290 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 13721 15004 gene locus_tag LOCUS_00950 13721 15004 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_00950 15436 16155 gene locus_tag LOCUS_00960 15436 16155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 16169 17134 gene locus_tag LOCUS_00970 gene thiL 16169 17134 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_00970 17112 17540 gene locus_tag LOCUS_00980 gene tsaE 17112 17540 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_00980 17521 18189 gene locus_tag LOCUS_00990 gene tsaB 17521 18189 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385746.1 protein_id gnl|my_center|LOCUS_00990 18269 21529 gene locus_tag LOCUS_01000 18269 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 21550 22722 gene locus_tag LOCUS_01010 21550 22722 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence0006 <1 584 gene locus_tag LOCUS_01020 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942950.1:diguanylate cyclase 512 1567 gene locus_tag LOCUS_01030 512 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1560 1931 gene locus_tag LOCUS_01040 1560 1931 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943385.1 protein_id gnl|my_center|LOCUS_01040 3658 1952 gene locus_tag LOCUS_01050 3658 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 4553 3825 gene locus_tag LOCUS_01060 4553 3825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173716.1 protein_id gnl|my_center|LOCUS_01060 5403 4594 gene locus_tag LOCUS_01070 5403 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 6205 5408 gene locus_tag LOCUS_01080 6205 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 7764 6268 gene locus_tag LOCUS_01090 7764 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 9139 7772 gene locus_tag LOCUS_01100 9139 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 10501 9260 gene locus_tag LOCUS_01110 10501 9260 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_01110 12554 10524 gene locus_tag LOCUS_01120 12554 10524 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_01120 13742 12636 gene locus_tag LOCUS_01130 13742 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 14685 13750 gene locus_tag LOCUS_01140 14685 13750 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269416.1 protein_id gnl|my_center|LOCUS_01140 16590 14701 gene locus_tag LOCUS_01150 16590 14701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 17708 16599 gene locus_tag LOCUS_01160 17708 16599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 18869 17961 gene locus_tag LOCUS_01170 18869 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 19687 19142 gene locus_tag LOCUS_01180 19687 19142 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943276.1 protein_id gnl|my_center|LOCUS_01180 20774 19731 gene locus_tag LOCUS_01190 20774 19731 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_01190 21557 20787 gene locus_tag LOCUS_01200 gene lgt 21557 20787 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171692.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence0007 218 898 gene locus_tag LOCUS_01210 218 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 947 2191 gene locus_tag LOCUS_01220 947 2191 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_01220 2337 3266 gene locus_tag LOCUS_01230 gene hemB 2337 3266 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460178.1 protein_id gnl|my_center|LOCUS_01230 3783 3274 gene locus_tag LOCUS_01240 3783 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5046 3886 gene locus_tag LOCUS_01250 gene carA 5046 3886 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_01250 6047 5223 gene locus_tag LOCUS_01260 6047 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 6691 6305 gene locus_tag LOCUS_01270 6691 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 7755 10100 gene locus_tag LOCUS_01280 7755 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 13252 10157 gene locus_tag LOCUS_01290 13252 10157 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_01290 13694 13281 gene locus_tag LOCUS_01300 13694 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 13575 14681 gene locus_tag LOCUS_01310 13575 14681 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_01310 15519 14689 gene locus_tag LOCUS_01320 15519 14689 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012321.1 protein_id gnl|my_center|LOCUS_01320 15695 16222 gene locus_tag LOCUS_01330 15695 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 16278 17486 gene locus_tag LOCUS_01340 gene lhgO 16278 17486 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_01340 17509 18459 gene locus_tag LOCUS_01350 17509 18459 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_01350 18462 19205 gene locus_tag LOCUS_01360 18462 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 19206 19682 gene locus_tag LOCUS_01370 19206 19682 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987100.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence0008 270 2090 gene locus_tag LOCUS_01380 270 2090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_01380 3058 2096 gene locus_tag LOCUS_01390 3058 2096 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975888.1 protein_id gnl|my_center|LOCUS_01390 3344 6415 gene locus_tag LOCUS_01400 3344 6415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6578 8011 gene locus_tag LOCUS_01410 6578 8011 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_01410 8060 8854 gene locus_tag LOCUS_01420 8060 8854 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_01420 10333 8879 gene locus_tag LOCUS_01430 10333 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10787 12577 gene locus_tag LOCUS_01440 10787 12577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_01440 12581 14383 gene locus_tag LOCUS_01450 12581 14383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_01450 15206 14421 gene locus_tag LOCUS_01460 15206 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 15861 15214 gene locus_tag LOCUS_01470 15861 15214 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_01470 16464 16024 gene locus_tag LOCUS_01480 gene mlaD 16464 16024 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941481.1 protein_id gnl|my_center|LOCUS_01480 17238 16492 gene locus_tag LOCUS_01490 17238 16492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_01490 17889 17248 gene locus_tag LOCUS_01500 17889 17248 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_01500 18961 18368 gene locus_tag LOCUS_01510 18961 18368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 >Feature sequence0009 5067 1816 gene locus_tag LOCUS_01520 5067 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5469 5071 gene locus_tag LOCUS_01530 5469 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 8105 5478 gene locus_tag LOCUS_01540 8105 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8315 8791 gene locus_tag LOCUS_01550 8315 8791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 9217 9020 gene locus_tag LOCUS_01560 9217 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 9348 9503 gene locus_tag LOCUS_01570 9348 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9776 9609 gene locus_tag LOCUS_01580 9776 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 10039 9794 gene locus_tag LOCUS_01590 10039 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 10268 10032 gene locus_tag LOCUS_01600 10268 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 10543 10716 gene locus_tag LOCUS_01610 10543 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 11827 10925 gene locus_tag LOCUS_01620 11827 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 12112 11930 gene locus_tag LOCUS_01630 12112 11930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 12132 12986 gene locus_tag LOCUS_01640 12132 12986 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943341.1 protein_id gnl|my_center|LOCUS_01640 13093 14193 gene locus_tag LOCUS_01650 13093 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 14200 14913 gene locus_tag LOCUS_01660 14200 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 15034 16308 gene locus_tag LOCUS_01670 15034 16308 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_01670 16305 16937 gene locus_tag LOCUS_01680 16305 16937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 16934 17395 gene locus_tag LOCUS_01690 16934 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence0010 2128 659 gene locus_tag LOCUS_01700 gene der 2128 659 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_01700 3516 2197 gene locus_tag LOCUS_01710 3516 2197 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_01710 4426 3509 gene locus_tag LOCUS_01720 4426 3509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_01720 5295 4531 gene locus_tag LOCUS_01730 5295 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 7996 5309 gene locus_tag LOCUS_01740 7996 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8168 9508 gene locus_tag LOCUS_01750 8168 9508 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_01750 12103 9590 gene locus_tag LOCUS_01760 12103 9590 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_01760 13877 12285 gene locus_tag LOCUS_01770 13877 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 14987 14082 gene locus_tag LOCUS_01780 14987 14082 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_01780 16053 15124 gene locus_tag LOCUS_01790 16053 15124 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390313.1 protein_id gnl|my_center|LOCUS_01790 18662 16167 gene locus_tag LOCUS_01800 18662 16167 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390312.1 protein_id gnl|my_center|LOCUS_01800 18881 18956 gene locus_tag LOCUS_t00010 18881 18956 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0011 <1 990 gene locus_tag LOCUS_01810 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967587.1:HlyD family efflux transporter periplasmic adaptor subunit 2757 1093 gene locus_tag LOCUS_01820 2757 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 3814 3302 gene locus_tag LOCUS_01830 3814 3302 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892873.1 protein_id gnl|my_center|LOCUS_01830 7417 4049 gene locus_tag LOCUS_01840 7417 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 7992 7756 gene locus_tag LOCUS_01850 7992 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 8150 11896 gene locus_tag LOCUS_01860 8150 11896 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_01860 15038 12084 gene locus_tag LOCUS_01870 15038 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 18985 15257 gene locus_tag LOCUS_01880 18985 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence0012 721 4833 gene locus_tag LOCUS_01890 721 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 4916 6781 gene locus_tag LOCUS_01900 4916 6781 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 protein_id gnl|my_center|LOCUS_01900 6778 8199 gene locus_tag LOCUS_01910 6778 8199 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921825.1 protein_id gnl|my_center|LOCUS_01910 8862 8233 gene locus_tag LOCUS_01920 8862 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 10672 8981 gene locus_tag LOCUS_01930 10672 8981 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243080.1 protein_id gnl|my_center|LOCUS_01930 12020 10698 gene locus_tag LOCUS_01940 gene ftsZ 12020 10698 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073896.1 protein_id gnl|my_center|LOCUS_01940 13278 12052 gene locus_tag LOCUS_01950 gene ftsA 13278 12052 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216485.1 protein_id gnl|my_center|LOCUS_01950 14236 13271 gene locus_tag LOCUS_01960 14236 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 15196 14237 gene locus_tag LOCUS_01970 15196 14237 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_01970 17621 15189 gene locus_tag LOCUS_01980 17621 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 18854 17652 gene locus_tag LOCUS_01990 gene murG 18854 17652 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_01990 >Feature sequence0013 2488 119 gene locus_tag LOCUS_02000 2488 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 3454 3116 gene locus_tag LOCUS_02010 3454 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3354 5141 gene locus_tag LOCUS_02020 3354 5141 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_02020 5546 5355 gene locus_tag LOCUS_02030 5546 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 5593 6174 gene locus_tag LOCUS_02040 5593 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 6264 6082 gene locus_tag LOCUS_02050 6264 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 8171 6318 gene locus_tag LOCUS_02060 8171 6318 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_02060 9731 8229 gene locus_tag LOCUS_02070 9731 8229 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_02070 11316 9871 gene locus_tag LOCUS_02080 11316 9871 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_02080 12381 11371 gene locus_tag LOCUS_02090 12381 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 12625 13011 gene locus_tag LOCUS_02100 12625 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 13025 13180 gene locus_tag LOCUS_02110 13025 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 13164 14861 gene locus_tag LOCUS_02120 gene pilB 13164 14861 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_02120 15042 16505 gene locus_tag LOCUS_02130 15042 16505 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939946.1 protein_id gnl|my_center|LOCUS_02130 18933 16642 gene locus_tag LOCUS_02140 18933 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 >Feature sequence0014 <1 637 gene locus_tag LOCUS_02150 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816129.1:cytochrome c peroxidase 1237 923 gene locus_tag LOCUS_02160 1237 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2909 1371 gene locus_tag LOCUS_02170 2909 1371 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391643.1 protein_id gnl|my_center|LOCUS_02170 3541 2975 gene locus_tag LOCUS_02180 gene pyrE 3541 2975 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_02180 3684 4964 gene locus_tag LOCUS_02190 3684 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 5134 7071 gene locus_tag LOCUS_02200 5134 7071 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_02200 7244 8617 gene locus_tag LOCUS_02210 7244 8617 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145033984.1 protein_id gnl|my_center|LOCUS_02210 8765 9445 gene locus_tag LOCUS_02220 gene tmk 8765 9445 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_02220 9500 9763 gene locus_tag LOCUS_02230 gene rpsT 9500 9763 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_02230 9941 9865 gene locus_tag LOCUS_t00020 9941 9865 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10744 11634 gene locus_tag LOCUS_02240 10744 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 14865 11680 gene locus_tag LOCUS_02250 14865 11680 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974364.1 protein_id gnl|my_center|LOCUS_02250 16637 15060 gene locus_tag LOCUS_02260 16637 15060 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 protein_id gnl|my_center|LOCUS_02260 17371 16679 gene locus_tag LOCUS_02270 17371 16679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 17539 18423 gene locus_tag LOCUS_02280 17539 18423 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence0015 3154 2432 gene locus_tag LOCUS_02290 3154 2432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_02290 4544 3225 gene locus_tag LOCUS_02300 4544 3225 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667541.1 protein_id gnl|my_center|LOCUS_02300 5098 4541 gene locus_tag LOCUS_02310 5098 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5608 5165 gene locus_tag LOCUS_02320 5608 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 6939 5620 gene locus_tag LOCUS_02330 6939 5620 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_02330 8332 7052 gene locus_tag LOCUS_02340 8332 7052 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_02340 8996 8409 gene locus_tag LOCUS_02350 8996 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921915.1 protein_id gnl|my_center|LOCUS_02350 10397 9048 gene locus_tag LOCUS_02360 10397 9048 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_02360 11547 10423 gene locus_tag LOCUS_02370 11547 10423 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_02370 11954 14401 gene locus_tag LOCUS_02380 11954 14401 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_02380 14398 15741 gene locus_tag LOCUS_02390 14398 15741 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_02390 15826 16683 gene locus_tag LOCUS_02400 15826 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 16691 17878 gene locus_tag LOCUS_02410 16691 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence0016 1232 342 gene locus_tag LOCUS_02420 1232 342 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_02420 2267 1260 gene locus_tag LOCUS_02430 2267 1260 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_02430 3744 2290 gene locus_tag LOCUS_02440 3744 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4148 3825 gene locus_tag LOCUS_02450 4148 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4405 5655 gene locus_tag LOCUS_02460 4405 5655 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_02460 6891 5815 gene locus_tag LOCUS_02470 6891 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_02470 8537 6918 gene locus_tag LOCUS_02480 8537 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 10923 8554 gene locus_tag LOCUS_02490 10923 8554 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146514631.1 protein_id gnl|my_center|LOCUS_02490 11083 11652 gene locus_tag LOCUS_02500 11083 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 11784 12884 gene locus_tag LOCUS_02510 11784 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 12881 14851 gene locus_tag LOCUS_02520 gene mutL 12881 14851 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537966.1 protein_id gnl|my_center|LOCUS_02520 14857 15606 gene locus_tag LOCUS_02530 14857 15606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_02530 >Feature sequence0017 799 2346 gene locus_tag LOCUS_02540 gene pelF 799 2346 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_02540 2435 3898 gene locus_tag LOCUS_02550 gene pelG 2435 3898 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_02550 4096 5952 gene locus_tag LOCUS_02560 gene thrS 4096 5952 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421565.1 protein_id gnl|my_center|LOCUS_02560 6902 6015 gene locus_tag LOCUS_02570 6902 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 7144 10725 gene locus_tag LOCUS_02580 7144 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 10784 12229 gene locus_tag LOCUS_02590 10784 12229 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_02590 13324 12254 gene locus_tag LOCUS_02600 13324 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 15246 13390 gene locus_tag LOCUS_02610 15246 13390 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195899535.1 protein_id gnl|my_center|LOCUS_02610 15276 16670 gene locus_tag LOCUS_02620 15276 16670 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_02620 16744 17352 gene locus_tag LOCUS_02630 16744 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence0018 980 2419 gene locus_tag LOCUS_02640 980 2419 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_02640 2803 2438 gene locus_tag LOCUS_02650 2803 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3567 2809 gene locus_tag LOCUS_02660 gene tmk 3567 2809 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_02660 4267 3557 gene locus_tag LOCUS_02670 gene tmk 4267 3557 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_02670 4403 8089 gene locus_tag LOCUS_02680 gene mfd 4403 8089 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 protein_id gnl|my_center|LOCUS_02680 8446 8099 gene locus_tag LOCUS_02690 8446 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 11195 8619 gene locus_tag LOCUS_02700 11195 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12154 11204 gene locus_tag LOCUS_02710 12154 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 12345 14090 gene locus_tag LOCUS_02720 12345 14090 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_02720 14099 15109 gene locus_tag LOCUS_02730 14099 15109 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_02730 15866 15087 gene locus_tag LOCUS_02740 15866 15087 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence0019 <1 1881 gene locus_tag LOCUS_02750 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120839.1:PSD1 and planctomycete cytochrome C domain-containing protein 1890 3329 gene locus_tag LOCUS_02760 1890 3329 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_02760 3277 4488 gene locus_tag LOCUS_02770 3277 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 5426 4524 gene locus_tag LOCUS_02780 5426 4524 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_02780 5616 6365 gene locus_tag LOCUS_02790 5616 6365 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_02790 8215 6509 gene locus_tag LOCUS_02800 8215 6509 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922209.1 protein_id gnl|my_center|LOCUS_02800 8435 10162 gene locus_tag LOCUS_02810 gene ggt 8435 10162 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 protein_id gnl|my_center|LOCUS_02810 10438 10223 gene locus_tag LOCUS_02820 10438 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 11300 10416 gene locus_tag LOCUS_02830 11300 10416 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_02830 11373 11579 gene locus_tag LOCUS_02840 11373 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 11851 11636 gene locus_tag LOCUS_02850 11851 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 13433 11892 gene locus_tag LOCUS_02860 gene guaA 13433 11892 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_02860 13942 13568 gene locus_tag LOCUS_02870 13942 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 14072 14518 gene locus_tag LOCUS_02880 14072 14518 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_02880 14532 15701 gene locus_tag LOCUS_02890 14532 15701 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337623.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence0020 1234 404 gene locus_tag LOCUS_02900 1234 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 2864 1359 gene locus_tag LOCUS_02910 2864 1359 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120961.1 protein_id gnl|my_center|LOCUS_02910 5632 2861 gene locus_tag LOCUS_02920 5632 2861 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921983.1 protein_id gnl|my_center|LOCUS_02920 5920 5699 gene locus_tag LOCUS_02930 5920 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7269 5893 gene locus_tag LOCUS_02940 7269 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 7430 11236 gene locus_tag LOCUS_02950 gene smc 7430 11236 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_02950 11295 12020 gene locus_tag LOCUS_02960 11295 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 13134 12052 gene locus_tag LOCUS_02970 13134 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 13292 14002 gene locus_tag LOCUS_02980 13292 14002 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667131.1 protein_id gnl|my_center|LOCUS_02980 14009 15325 gene locus_tag LOCUS_02990 14009 15325 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_02990 16131 15793 gene locus_tag LOCUS_03000 16131 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence0021 2029 80 gene locus_tag LOCUS_03010 2029 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2679 2065 gene locus_tag LOCUS_03020 2679 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3687 2797 gene locus_tag LOCUS_03030 3687 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 3975 4394 gene locus_tag LOCUS_03040 3975 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4391 5716 gene locus_tag LOCUS_03050 4391 5716 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_03050 6733 5774 gene locus_tag LOCUS_03060 6733 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 6989 6771 gene locus_tag LOCUS_03070 6989 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 7490 7002 gene locus_tag LOCUS_03080 7490 7002 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_03080 8250 7585 gene locus_tag LOCUS_03090 8250 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03090 8622 8266 gene locus_tag LOCUS_03100 8622 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 9163 8645 gene locus_tag LOCUS_03110 9163 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 10201 9641 gene locus_tag LOCUS_03120 gene folK 10201 9641 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_03120 10953 10396 gene locus_tag LOCUS_03130 10953 10396 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_03130 11779 11051 gene locus_tag LOCUS_03140 11779 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12675 11776 gene locus_tag LOCUS_03150 12675 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 13462 12689 gene locus_tag LOCUS_03160 13462 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 13847 15301 gene locus_tag LOCUS_03170 13847 15301 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence0022 135 1097 gene locus_tag LOCUS_03180 135 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 1110 2990 gene locus_tag LOCUS_03190 1110 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 5328 3001 gene locus_tag LOCUS_03200 5328 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5793 5374 gene locus_tag LOCUS_03210 5793 5374 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_03210 6682 5888 gene locus_tag LOCUS_03220 6682 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 7609 6692 gene locus_tag LOCUS_03230 gene lipA 7609 6692 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_03230 7887 7630 gene locus_tag LOCUS_03240 7887 7630 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356779.1 protein_id gnl|my_center|LOCUS_03240 8448 8083 gene locus_tag LOCUS_03250 8448 8083 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792791.1 protein_id gnl|my_center|LOCUS_03250 8538 8909 gene locus_tag LOCUS_03260 8538 8909 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 protein_id gnl|my_center|LOCUS_03260 9138 9506 gene locus_tag LOCUS_03270 9138 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10846 9674 gene locus_tag LOCUS_03280 10846 9674 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_03280 12695 10941 gene locus_tag LOCUS_03290 12695 10941 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_03290 13210 12701 gene locus_tag LOCUS_03300 13210 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 14077 13211 gene locus_tag LOCUS_03310 14077 13211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 14989 14216 gene locus_tag LOCUS_03320 14989 14216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence0023 653 2680 gene locus_tag LOCUS_03330 653 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4521 2821 gene locus_tag LOCUS_03340 4521 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 4608 4922 gene locus_tag LOCUS_03350 gene rhaM 4608 4922 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_03350 5848 4925 gene locus_tag LOCUS_03360 5848 4925 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_03360 7379 5928 gene locus_tag LOCUS_03370 7379 5928 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671603.1 protein_id gnl|my_center|LOCUS_03370 9772 7397 gene locus_tag LOCUS_03380 9772 7397 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922542.1 protein_id gnl|my_center|LOCUS_03380 10044 12608 gene locus_tag LOCUS_03390 10044 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 12624 14123 gene locus_tag LOCUS_03400 12624 14123 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_03400 14636 14289 gene locus_tag LOCUS_03410 14636 14289 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479796.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence0024 877 287 gene locus_tag LOCUS_03420 877 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03420 1872 820 gene locus_tag LOCUS_03430 1872 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2363 3691 gene locus_tag LOCUS_03440 2363 3691 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_03440 4597 3767 gene locus_tag LOCUS_03450 gene garL 4597 3767 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058209.1 protein_id gnl|my_center|LOCUS_03450 7828 4601 gene locus_tag LOCUS_03460 7828 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 8917 7910 gene locus_tag LOCUS_03470 8917 7910 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_03470 9985 9131 gene locus_tag LOCUS_03480 9985 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 10877 10026 gene locus_tag LOCUS_03490 10877 10026 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_03490 12725 11331 gene locus_tag LOCUS_03500 12725 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 13075 13305 gene locus_tag LOCUS_03510 13075 13305 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764789.1 protein_id gnl|my_center|LOCUS_03510 13452 14183 gene locus_tag LOCUS_03520 13452 14183 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_03520 >Feature sequence0025 2000 1131 gene locus_tag LOCUS_03530 2000 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2146 3537 gene locus_tag LOCUS_03540 2146 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3543 5762 gene locus_tag LOCUS_03550 3543 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6339 5776 gene locus_tag LOCUS_03560 6339 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7195 6341 gene locus_tag LOCUS_03570 7195 6341 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_03570 8573 7305 gene locus_tag LOCUS_03580 8573 7305 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_03580 8976 10697 gene locus_tag LOCUS_03590 8976 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 10699 12558 gene locus_tag LOCUS_03600 10699 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 12443 13375 gene locus_tag LOCUS_03610 12443 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 13380 14666 gene locus_tag LOCUS_03620 13380 14666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence0026 985 350 gene locus_tag LOCUS_03630 985 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1607 1011 gene locus_tag LOCUS_03640 1607 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2127 1615 gene locus_tag LOCUS_03650 2127 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2334 2909 gene locus_tag LOCUS_03660 2334 2909 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_03660 3032 3964 gene locus_tag LOCUS_03670 3032 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4005 5675 gene locus_tag LOCUS_03680 4005 5675 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_03680 7226 6006 gene locus_tag LOCUS_03690 7226 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 7521 8510 gene locus_tag LOCUS_03700 7521 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 10906 9317 gene locus_tag LOCUS_03710 10906 9317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 11255 12349 gene locus_tag LOCUS_03720 11255 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 13006 12371 gene locus_tag LOCUS_03730 13006 12371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 13001 14221 gene locus_tag LOCUS_03740 13001 14221 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence0027 1339 4212 gene locus_tag LOCUS_03750 1339 4212 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339535.1 protein_id gnl|my_center|LOCUS_03750 4224 6134 gene locus_tag LOCUS_03760 4224 6134 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_03760 6382 6807 gene locus_tag LOCUS_03770 6382 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03770 6801 8612 gene locus_tag LOCUS_03780 6801 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 9980 8631 gene locus_tag LOCUS_03790 9980 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 10259 11362 gene locus_tag LOCUS_03800 10259 11362 CDS product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396629.1 protein_id gnl|my_center|LOCUS_03800 11629 12381 gene locus_tag LOCUS_03810 11629 12381 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259457.1 protein_id gnl|my_center|LOCUS_03810 12302 12562 gene locus_tag LOCUS_03820 12302 12562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12728 14143 gene locus_tag LOCUS_03830 12728 14143 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence0028 238 792 gene locus_tag LOCUS_03840 gene sufT 238 792 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_03840 798 2063 gene locus_tag LOCUS_03850 gene sufS 798 2063 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_03850 2072 2638 gene locus_tag LOCUS_03860 2072 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 2635 3150 gene locus_tag LOCUS_03870 2635 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3278 5068 gene locus_tag LOCUS_03880 3278 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 5076 7211 gene locus_tag LOCUS_03890 gene aas 5076 7211 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899035.1 protein_id gnl|my_center|LOCUS_03890 8785 7208 gene locus_tag LOCUS_03900 gene purH 8785 7208 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_03900 9571 8837 gene locus_tag LOCUS_03910 9571 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 10402 9578 gene locus_tag LOCUS_03920 10402 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11178 12497 gene locus_tag LOCUS_03930 11178 12497 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117790.1 protein_id gnl|my_center|LOCUS_03930 12580 13452 gene locus_tag LOCUS_03940 12580 13452 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence0029 7199 8455 gene locus_tag LOCUS_03950 7199 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 8511 9773 gene locus_tag LOCUS_03960 8511 9773 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_03960 10088 11290 gene locus_tag LOCUS_03970 10088 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 12532 11357 gene locus_tag LOCUS_03980 12532 11357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 12838 13497 gene locus_tag LOCUS_03990 12838 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence0030 1802 819 gene locus_tag LOCUS_04000 1802 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3224 1809 gene locus_tag LOCUS_04010 3224 1809 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119569.1 protein_id gnl|my_center|LOCUS_04010 3556 4224 gene locus_tag LOCUS_04020 3556 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4240 4971 gene locus_tag LOCUS_04030 4240 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 6266 4977 gene locus_tag LOCUS_04040 6266 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 7027 6272 gene locus_tag LOCUS_04050 7027 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 9070 7211 gene locus_tag LOCUS_04060 gene greA 9070 7211 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883379.1 protein_id gnl|my_center|LOCUS_04060 9111 10415 gene locus_tag LOCUS_04070 gene rsmB 9111 10415 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_04070 11189 10419 gene locus_tag LOCUS_04080 gene fabI 11189 10419 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 protein_id gnl|my_center|LOCUS_04080 11801 11253 gene locus_tag LOCUS_04090 gene rplI 11801 11253 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777136.1 protein_id gnl|my_center|LOCUS_04090 12356 11880 gene locus_tag LOCUS_04100 gene ssb 12356 11880 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_04100 12670 12359 gene locus_tag LOCUS_04110 12670 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 13285 12671 gene locus_tag LOCUS_04120 gene pth 13285 12671 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_04120 <13940 13339 gene locus_tag LOCUS_04130 <13940 13339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768871.1:50S ribosomal protein L25/general stress protein Ctc >Feature sequence0031 449 1033 gene locus_tag LOCUS_04140 449 1033 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_04140 1483 1115 gene locus_tag LOCUS_04150 1483 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 1567 1493 gene locus_tag LOCUS_t00030 1567 1493 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2182 1673 gene locus_tag LOCUS_04160 2182 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2813 2250 gene locus_tag LOCUS_04170 2813 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4240 3080 gene locus_tag LOCUS_04180 gene chrA 4240 3080 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_04180 5535 4237 gene locus_tag LOCUS_04190 5535 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 6492 5566 gene locus_tag LOCUS_04200 6492 5566 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_04200 7728 6670 gene locus_tag LOCUS_04210 7728 6670 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_04210 8030 7725 gene locus_tag LOCUS_04220 8030 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 8321 8043 gene locus_tag LOCUS_04230 8321 8043 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382338.1 protein_id gnl|my_center|LOCUS_04230 9821 8328 gene locus_tag LOCUS_04240 9821 8328 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_04240 10195 9881 gene locus_tag LOCUS_04250 10195 9881 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_04250 10572 10309 gene locus_tag LOCUS_04260 10572 10309 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719393.1 protein_id gnl|my_center|LOCUS_04260 11811 10630 gene locus_tag LOCUS_04270 11811 10630 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_04270 12114 11836 gene locus_tag LOCUS_04280 gene pduA 12114 11836 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_04280 12444 12154 gene locus_tag LOCUS_04290 gene eutM 12444 12154 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_04290 13195 12518 gene locus_tag LOCUS_04300 13195 12518 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence0032 1042 1497 gene locus_tag LOCUS_04310 gene nrdR 1042 1497 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_04310 1494 2048 gene locus_tag LOCUS_04320 1494 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2092 2436 gene locus_tag LOCUS_04330 2092 2436 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_04330 2534 2710 gene locus_tag LOCUS_04340 2534 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3466 2732 gene locus_tag LOCUS_04350 gene dapB 3466 2732 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_04350 4175 3528 gene locus_tag LOCUS_04360 4175 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 4426 4166 gene locus_tag LOCUS_04370 4426 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 5351 4500 gene locus_tag LOCUS_04380 gene dapF 5351 4500 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_04380 5436 7463 gene locus_tag LOCUS_04390 gene shc 5436 7463 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_04390 7583 8263 gene locus_tag LOCUS_04400 7583 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 8488 9276 gene locus_tag LOCUS_04410 8488 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9354 11078 gene locus_tag LOCUS_04420 9354 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 13095 11134 gene locus_tag LOCUS_04430 13095 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence0033 911 228 gene locus_tag LOCUS_04440 911 228 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_04440 1443 3095 gene locus_tag LOCUS_04450 1443 3095 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_04450 3192 4364 gene locus_tag LOCUS_04460 gene nagA 3192 4364 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922541.1 protein_id gnl|my_center|LOCUS_04460 5466 4348 gene locus_tag LOCUS_04470 5466 4348 CDS product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989338.1 protein_id gnl|my_center|LOCUS_04470 5616 5921 gene locus_tag LOCUS_04480 gene phnA 5616 5921 CDS product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 protein_id gnl|my_center|LOCUS_04480 6072 7232 gene locus_tag LOCUS_04490 6072 7232 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_04490 8264 7272 gene locus_tag LOCUS_04500 8264 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_04500 10642 8261 gene locus_tag LOCUS_04510 10642 8261 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_04510 >Feature sequence0034 347 5779 gene locus_tag LOCUS_04520 347 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04520 5801 6517 gene locus_tag LOCUS_04530 5801 6517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 6521 7111 gene locus_tag LOCUS_04540 6521 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 8300 7311 gene locus_tag LOCUS_04550 8300 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9278 8541 gene locus_tag LOCUS_04560 9278 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 9625 9275 gene locus_tag LOCUS_04570 9625 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 12924 10345 gene locus_tag LOCUS_04580 12924 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence0035 449 1246 gene locus_tag LOCUS_04590 449 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1249 2211 gene locus_tag LOCUS_04600 1249 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2208 3479 gene locus_tag LOCUS_04610 gene nrfD 2208 3479 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_04610 3552 3986 gene locus_tag LOCUS_04620 3552 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 6317 4296 gene locus_tag LOCUS_04630 6317 4296 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_04630 7557 6430 gene locus_tag LOCUS_04640 7557 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 9591 7558 gene locus_tag LOCUS_04650 9591 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 10505 9621 gene locus_tag LOCUS_04660 10505 9621 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_04660 11817 10558 gene locus_tag LOCUS_04670 11817 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 12554 11832 gene locus_tag LOCUS_04680 12554 11832 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_04680 <13172 12668 gene locus_tag LOCUS_04690 <13172 12668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974125.1:sugar phosphate isomerase/epimerase >Feature sequence0036 1568 459 gene locus_tag LOCUS_04700 gene thrC 1568 459 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_04700 2905 1571 gene locus_tag LOCUS_04710 2905 1571 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_04710 3399 2995 gene locus_tag LOCUS_04720 3399 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3581 4141 gene locus_tag LOCUS_04730 gene frr 3581 4141 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_04730 6980 4308 gene locus_tag LOCUS_04740 6980 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 7278 9761 gene locus_tag LOCUS_04750 7278 9761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 12527 9804 gene locus_tag LOCUS_04760 12527 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence0037 155 2599 gene locus_tag LOCUS_04770 155 2599 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_04770 4154 2835 gene locus_tag LOCUS_04780 4154 2835 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792516.1 protein_id gnl|my_center|LOCUS_04780 4371 8039 gene locus_tag LOCUS_04790 4371 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 8036 9499 gene locus_tag LOCUS_04800 8036 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 11236 9524 gene locus_tag LOCUS_04810 11236 9524 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929287.1 protein_id gnl|my_center|LOCUS_04810 11478 12725 gene locus_tag LOCUS_04820 11478 12725 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence0038 1084 2379 gene locus_tag LOCUS_04830 1084 2379 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615504.1 protein_id gnl|my_center|LOCUS_04830 4358 2616 gene locus_tag LOCUS_04840 4358 2616 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_04840 4281 4553 gene locus_tag LOCUS_04850 4281 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4655 4984 gene locus_tag LOCUS_04860 4655 4984 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_04860 7687 5108 gene locus_tag LOCUS_04870 7687 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 12655 7754 gene locus_tag LOCUS_04880 12655 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence0039 1447 452 gene locus_tag LOCUS_04890 1447 452 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085835.1 protein_id gnl|my_center|LOCUS_04890 2711 1542 gene locus_tag LOCUS_04900 2711 1542 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_04900 4906 2768 gene locus_tag LOCUS_04910 4906 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5847 4993 gene locus_tag LOCUS_04920 gene prpC 5847 4993 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_04920 6236 5838 gene locus_tag LOCUS_04930 6236 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 6529 7551 gene locus_tag LOCUS_04940 6529 7551 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530581.1 protein_id gnl|my_center|LOCUS_04940 10480 7706 gene locus_tag LOCUS_04950 10480 7706 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_04950 12687 10768 gene locus_tag LOCUS_04960 12687 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence0040 1684 3450 gene locus_tag LOCUS_04970 1684 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3652 5331 gene locus_tag LOCUS_04980 3652 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5683 6981 gene locus_tag LOCUS_04990 5683 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 7364 7056 gene locus_tag LOCUS_05000 7364 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 10001 8847 gene locus_tag LOCUS_05010 10001 8847 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_05010 11205 10003 gene locus_tag LOCUS_05020 11205 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12014 11217 gene locus_tag LOCUS_05030 gene kdsB 12014 11217 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence0041 <1 2355 gene locus_tag LOCUS_05040 <1 2355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120599.1:FG-GAP-like repeat-containing protein 2280 2456 gene locus_tag LOCUS_05050 2280 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2490 2810 gene locus_tag LOCUS_05060 2490 2810 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_05060 3119 2841 gene locus_tag LOCUS_05070 3119 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3937 3209 gene locus_tag LOCUS_05080 3937 3209 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_05080 4180 7770 gene locus_tag LOCUS_05090 4180 7770 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 protein_id gnl|my_center|LOCUS_05090 7921 7706 gene locus_tag LOCUS_05100 7921 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 8090 8545 gene locus_tag LOCUS_05110 8090 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 11244 8782 gene locus_tag LOCUS_05120 11244 8782 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence0042 4450 4079 gene locus_tag LOCUS_05130 4450 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 5277 4480 gene locus_tag LOCUS_05140 5277 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5773 7275 gene locus_tag LOCUS_05150 5773 7275 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_05150 11648 7539 gene locus_tag LOCUS_05160 11648 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence0043 350 1522 gene locus_tag LOCUS_05170 350 1522 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 protein_id gnl|my_center|LOCUS_05170 1771 2244 gene locus_tag LOCUS_05180 1771 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 2337 2789 gene locus_tag LOCUS_05190 2337 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3722 2910 gene locus_tag LOCUS_05200 3722 2910 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_05200 4865 3861 gene locus_tag LOCUS_05210 4865 3861 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598029.1 protein_id gnl|my_center|LOCUS_05210 5916 4993 gene locus_tag LOCUS_05220 5916 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6550 6011 gene locus_tag LOCUS_05230 6550 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7930 6572 gene locus_tag LOCUS_05240 gene miaB 7930 6572 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_05240 8090 8350 gene locus_tag LOCUS_05250 8090 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 8353 10071 gene locus_tag LOCUS_05260 8353 10071 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013917.1 protein_id gnl|my_center|LOCUS_05260 10131 11681 gene locus_tag LOCUS_05270 10131 11681 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_05270 11678 11911 gene locus_tag LOCUS_05280 11678 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence0044 842 564 gene locus_tag LOCUS_05290 842 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2731 1034 gene locus_tag LOCUS_05300 2731 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3185 3565 gene locus_tag LOCUS_05310 gene flgB 3185 3565 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546345.1 protein_id gnl|my_center|LOCUS_05310 3565 3993 gene locus_tag LOCUS_05320 gene flgC 3565 3993 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_05320 4012 4395 gene locus_tag LOCUS_05330 4012 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4462 6189 gene locus_tag LOCUS_05340 4462 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6246 7223 gene locus_tag LOCUS_05350 gene fliG 6246 7223 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_05350 7227 7883 gene locus_tag LOCUS_05360 7227 7883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7880 9286 gene locus_tag LOCUS_05370 gene fliI 7880 9286 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_05370 9290 9748 gene locus_tag LOCUS_05380 9290 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 9756 10484 gene locus_tag LOCUS_05390 9756 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence0045 3539 354 gene locus_tag LOCUS_05400 3539 354 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_05400 4744 3536 gene locus_tag LOCUS_05410 4744 3536 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_05410 6228 4741 gene locus_tag LOCUS_05420 gene adeC 6228 4741 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811956.1 protein_id gnl|my_center|LOCUS_05420 6884 6225 gene locus_tag LOCUS_05430 6884 6225 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810117.1 protein_id gnl|my_center|LOCUS_05430 7382 9862 gene locus_tag LOCUS_05440 7382 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10801 9899 gene locus_tag LOCUS_05450 10801 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence0046 616 371 gene locus_tag LOCUS_05460 616 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 1124 3016 gene locus_tag LOCUS_05470 1124 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3156 11054 gene locus_tag LOCUS_05480 3156 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 <11678 11088 gene locus_tag LOCUS_05490 <11678 11088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544941.1:beta-ketoacyl-ACP synthase II >Feature sequence0047 1679 546 gene locus_tag LOCUS_05500 1679 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1990 3081 gene locus_tag LOCUS_05510 1990 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3233 3835 gene locus_tag LOCUS_05520 3233 3835 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_05520 3832 4734 gene locus_tag LOCUS_05530 3832 4734 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_05530 4731 4865 gene locus_tag LOCUS_05540 4731 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 4852 5604 gene locus_tag LOCUS_05550 4852 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5620 5805 gene locus_tag LOCUS_05560 5620 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 6514 6113 gene locus_tag LOCUS_05570 6514 6113 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017285767.1 protein_id gnl|my_center|LOCUS_05570 6759 6511 gene locus_tag LOCUS_05580 6759 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 8437 7157 gene locus_tag LOCUS_05590 8437 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 9187 8573 gene locus_tag LOCUS_05600 9187 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 <11614 9228 gene locus_tag LOCUS_05610 <11614 9228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123669.1:serine/threonine-protein kinase >Feature sequence0048 157 4299 gene locus_tag LOCUS_05620 157 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4437 5453 gene locus_tag LOCUS_05630 4437 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence0049 <1 1411 gene locus_tag LOCUS_05640 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173442613.1:PQQ-binding-like beta-propeller repeat protein 2184 1408 gene locus_tag LOCUS_05650 2184 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 3319 2564 gene locus_tag LOCUS_05660 3319 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3541 4860 gene locus_tag LOCUS_05670 3541 4860 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_05670 4919 5827 gene locus_tag LOCUS_05680 4919 5827 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_05680 6279 5830 gene locus_tag LOCUS_05690 6279 5830 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941140.1 protein_id gnl|my_center|LOCUS_05690 6736 6299 gene locus_tag LOCUS_05700 6736 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6920 8398 gene locus_tag LOCUS_05710 6920 8398 CDS product polyphosphate--AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387976.1 protein_id gnl|my_center|LOCUS_05710 8472 8888 gene locus_tag LOCUS_05720 8472 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 11328 9301 gene locus_tag LOCUS_05730 11328 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence0050 468 1517 gene locus_tag LOCUS_05740 gene gap 468 1517 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_05740 1579 2181 gene locus_tag LOCUS_05750 gene rsmD 1579 2181 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565250.1 protein_id gnl|my_center|LOCUS_05750 4309 2330 gene locus_tag LOCUS_05760 4309 2330 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_05760 4787 4371 gene locus_tag LOCUS_05770 4787 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5431 6192 gene locus_tag LOCUS_05780 5431 6192 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_05780 6244 6684 gene locus_tag LOCUS_05790 6244 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 7307 6708 gene locus_tag LOCUS_05800 7307 6708 CDS product DUF2585 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122157.1 protein_id gnl|my_center|LOCUS_05800 7903 7355 gene locus_tag LOCUS_05810 7903 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 8913 7900 gene locus_tag LOCUS_05820 gene rfaE1 8913 7900 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291586.1 protein_id gnl|my_center|LOCUS_05820 9687 8917 gene locus_tag LOCUS_05830 9687 8917 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_05830 10233 9736 gene locus_tag LOCUS_05840 10233 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence0051 2355 289 gene locus_tag LOCUS_05850 2355 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2723 3388 gene locus_tag LOCUS_05860 gene plsY 2723 3388 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_05860 3489 4469 gene locus_tag LOCUS_05870 3489 4469 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_05870 5137 4526 gene locus_tag LOCUS_05880 gene thrH 5137 4526 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_05880 6125 5205 gene locus_tag LOCUS_05890 6125 5205 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052404.1 protein_id gnl|my_center|LOCUS_05890 8904 6181 gene locus_tag LOCUS_05900 8904 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence0052 3066 595 gene locus_tag LOCUS_05910 3066 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5748 3367 gene locus_tag LOCUS_05920 5748 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 7772 6231 gene locus_tag LOCUS_05930 7772 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9351 7789 gene locus_tag LOCUS_05940 9351 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05940 10549 9353 gene locus_tag LOCUS_05950 10549 9353 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922398.1 protein_id gnl|my_center|LOCUS_05950 <11404 10546 gene locus_tag LOCUS_05960 <11404 10546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082901032.1:efflux transporter outer membrane subunit >Feature sequence0053 1412 2332 gene locus_tag LOCUS_05970 1412 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2661 2344 gene locus_tag LOCUS_05980 2661 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3141 2689 gene locus_tag LOCUS_05990 3141 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3606 3223 gene locus_tag LOCUS_06000 3606 3223 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_06000 3827 7708 gene locus_tag LOCUS_06010 3827 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 7846 9720 gene locus_tag LOCUS_06020 7846 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 10163 10879 gene locus_tag LOCUS_06030 10163 10879 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence0054 796 296 gene locus_tag LOCUS_06040 796 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3918 793 gene locus_tag LOCUS_06050 3918 793 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184173497.1 protein_id gnl|my_center|LOCUS_06050 5759 4158 gene locus_tag LOCUS_06060 5759 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 5921 8161 gene locus_tag LOCUS_06070 5921 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 9897 8170 gene locus_tag LOCUS_06080 9897 8170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 10449 9907 gene locus_tag LOCUS_06090 10449 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence0055 319 1206 gene locus_tag LOCUS_06100 319 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1212 2216 gene locus_tag LOCUS_06110 1212 2216 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921881.1 protein_id gnl|my_center|LOCUS_06110 2486 2253 gene locus_tag LOCUS_06120 2486 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5473 2633 gene locus_tag LOCUS_06130 5473 2633 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_06130 6168 5491 gene locus_tag LOCUS_06140 6168 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 6428 7168 gene locus_tag LOCUS_06150 6428 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 8789 7350 gene locus_tag LOCUS_06160 8789 7350 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 protein_id gnl|my_center|LOCUS_06160 10029 8848 gene locus_tag LOCUS_06170 10029 8848 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_06170 10845 10048 gene locus_tag LOCUS_06180 10845 10048 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence0056 1110 1757 gene locus_tag LOCUS_06190 1110 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3634 2135 gene locus_tag LOCUS_06200 gene rpoN 3634 2135 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_06200 3762 4772 gene locus_tag LOCUS_06210 3762 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 7473 4810 gene locus_tag LOCUS_06220 7473 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 7750 8025 gene locus_tag LOCUS_06230 7750 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 8329 10101 gene locus_tag LOCUS_06240 gene ptsP 8329 10101 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence0057 <1 1117 gene locus_tag LOCUS_06250 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922407.1:DUF1501 domain-containing protein 1180 1908 gene locus_tag LOCUS_06260 gene queE 1180 1908 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_06260 1937 3289 gene locus_tag LOCUS_06270 gene gabT 1937 3289 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 protein_id gnl|my_center|LOCUS_06270 3558 3304 gene locus_tag LOCUS_06280 3558 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3628 4485 gene locus_tag LOCUS_06290 gene rsmA 3628 4485 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101015.1 protein_id gnl|my_center|LOCUS_06290 4466 4975 gene locus_tag LOCUS_06300 4466 4975 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_06300 5842 4982 gene locus_tag LOCUS_06310 5842 4982 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_06310 7363 5843 gene locus_tag LOCUS_06320 7363 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 8069 7512 gene locus_tag LOCUS_06330 8069 7512 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534501.1 protein_id gnl|my_center|LOCUS_06330 9156 8074 gene locus_tag LOCUS_06340 9156 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9897 9214 gene locus_tag LOCUS_06350 9897 9214 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_06350 <11202 10295 gene locus_tag LOCUS_06360 <11202 10295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545082.1:signal peptide peptidase SppA >Feature sequence0058 1044 739 gene locus_tag LOCUS_06370 1044 739 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_06370 1460 1041 gene locus_tag LOCUS_06380 1460 1041 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_06380 1954 1457 gene locus_tag LOCUS_06390 1954 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2119 2463 gene locus_tag LOCUS_06400 2119 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2869 2645 gene locus_tag LOCUS_06410 2869 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4132 2999 gene locus_tag LOCUS_06420 4132 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4441 6408 gene locus_tag LOCUS_06430 4441 6408 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_06430 6380 6787 gene locus_tag LOCUS_06440 6380 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7959 6835 gene locus_tag LOCUS_06450 7959 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 8128 8385 gene locus_tag LOCUS_06460 gene rpsP 8128 8385 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870158.1 protein_id gnl|my_center|LOCUS_06460 8402 8662 gene locus_tag LOCUS_06470 8402 8662 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883358.1 protein_id gnl|my_center|LOCUS_06470 8735 9436 gene locus_tag LOCUS_06480 gene trmD 8735 9436 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_06480 9446 9817 gene locus_tag LOCUS_06490 gene rplS 9446 9817 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_06490 9824 10504 gene locus_tag LOCUS_06500 9824 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 10892 10482 gene locus_tag LOCUS_06510 10892 10482 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence0059 1758 376 gene locus_tag LOCUS_06520 1758 376 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942268.1 protein_id gnl|my_center|LOCUS_06520 1875 3038 gene locus_tag LOCUS_06530 gene speY 1875 3038 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_06530 3303 3608 gene locus_tag LOCUS_06540 3303 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3578 5059 gene locus_tag LOCUS_06550 3578 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5223 6071 gene locus_tag LOCUS_06560 gene larB 5223 6071 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_06560 6077 7417 gene locus_tag LOCUS_06570 gene larC 6077 7417 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_06570 7461 7718 gene locus_tag LOCUS_06580 7461 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 8440 8754 gene locus_tag LOCUS_06590 8440 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 8781 9905 gene locus_tag LOCUS_06600 8781 9905 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence0060 171 2744 gene locus_tag LOCUS_06610 171 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2741 4141 gene locus_tag LOCUS_06620 2741 4141 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_06620 4269 5417 gene locus_tag LOCUS_06630 4269 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9591 5431 gene locus_tag LOCUS_06640 9591 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence0061 166 441 gene locus_tag LOCUS_06650 166 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 1000 542 gene locus_tag LOCUS_06660 gene mntR 1000 542 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398443.1 protein_id gnl|my_center|LOCUS_06660 1147 2013 gene locus_tag LOCUS_06670 1147 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3181 2174 gene locus_tag LOCUS_06680 3181 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6675 3427 gene locus_tag LOCUS_06690 6675 3427 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_06690 7337 6732 gene locus_tag LOCUS_06700 7337 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 8619 7351 gene locus_tag LOCUS_06710 8619 7351 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946742.1 protein_id gnl|my_center|LOCUS_06710 9859 8657 gene locus_tag LOCUS_06720 9859 8657 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_06720 10292 10462 gene locus_tag LOCUS_06730 10292 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 10854 10708 gene locus_tag LOCUS_06740 10854 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence0062 2213 684 gene locus_tag LOCUS_06750 2213 684 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_06750 2538 5993 gene locus_tag LOCUS_06760 2538 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 6011 7483 gene locus_tag LOCUS_06770 6011 7483 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_06770 7538 9808 gene locus_tag LOCUS_06780 7538 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 9805 10782 gene locus_tag LOCUS_06790 gene rnhC 9805 10782 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence0063 <1 869 gene locus_tag LOCUS_06800 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121135.1:Gfo/Idh/MocA family oxidoreductase 887 2002 gene locus_tag LOCUS_06810 887 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2050 2634 gene locus_tag LOCUS_06820 2050 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4159 2648 gene locus_tag LOCUS_06830 4159 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4554 4261 gene locus_tag LOCUS_06840 4554 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4922 6289 gene locus_tag LOCUS_06850 gene mnmE 4922 6289 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 protein_id gnl|my_center|LOCUS_06850 6477 8945 gene locus_tag LOCUS_06860 6477 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 9499 8942 gene locus_tag LOCUS_06870 9499 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 10612 9545 gene locus_tag LOCUS_06880 gene floA 10612 9545 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_06880 10933 10625 gene locus_tag LOCUS_06890 10933 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence0064 605 931 gene locus_tag LOCUS_06900 605 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06900 2027 2254 gene locus_tag LOCUS_06910 2027 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2251 2655 gene locus_tag LOCUS_06920 2251 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2706 2945 gene locus_tag LOCUS_06930 2706 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2942 3172 gene locus_tag LOCUS_06940 2942 3172 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_06940 3169 3555 gene locus_tag LOCUS_06950 3169 3555 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_06950 4304 5029 gene locus_tag LOCUS_06960 4304 5029 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261527.1 protein_id gnl|my_center|LOCUS_06960 5162 6808 gene locus_tag LOCUS_06970 5162 6808 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404996.1 protein_id gnl|my_center|LOCUS_06970 6805 8415 gene locus_tag LOCUS_06980 6805 8415 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404997.1 protein_id gnl|my_center|LOCUS_06980 8551 8476 gene locus_tag LOCUS_t00040 8551 8476 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9502 8771 gene locus_tag LOCUS_06990 9502 8771 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_06990 10210 9515 gene locus_tag LOCUS_07000 10210 9515 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence0065 1 138 gene locus_tag LOCUS_07010 1 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 135 647 gene locus_tag LOCUS_07020 135 647 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_07020 644 952 gene locus_tag LOCUS_07030 gene nuoK 644 952 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_07030 953 2827 gene locus_tag LOCUS_07040 gene nuoL 953 2827 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_07040 2851 3036 gene locus_tag LOCUS_07050 2851 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3076 4395 gene locus_tag LOCUS_07060 3076 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07060 4392 5831 gene locus_tag LOCUS_07070 4392 5831 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392502.1 protein_id gnl|my_center|LOCUS_07070 5867 6553 gene locus_tag LOCUS_07080 5867 6553 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121399.1 protein_id gnl|my_center|LOCUS_07080 <10799 6554 gene locus_tag LOCUS_07090 <10799 6554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:tandem-95 repeat protein >Feature sequence0066 203 3073 gene locus_tag LOCUS_07100 203 3073 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_07100 3234 4802 gene locus_tag LOCUS_07110 3234 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5849 4875 gene locus_tag LOCUS_07120 gene dusB 5849 4875 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207350.1 protein_id gnl|my_center|LOCUS_07120 6805 5957 gene locus_tag LOCUS_07130 6805 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8395 7235 gene locus_tag LOCUS_07140 8395 7235 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_07140 8702 9601 gene locus_tag LOCUS_07150 gene lsrB 8702 9601 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564137.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence0067 2200 797 gene locus_tag LOCUS_07160 2200 797 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_07160 3022 2276 gene locus_tag LOCUS_07170 3022 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4023 3049 gene locus_tag LOCUS_07180 4023 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5098 4085 gene locus_tag LOCUS_07190 5098 4085 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_07190 5974 5153 gene locus_tag LOCUS_07200 5974 5153 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_07200 7105 6029 gene locus_tag LOCUS_07210 7105 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 8274 7102 gene locus_tag LOCUS_07220 8274 7102 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_07220 9053 8271 gene locus_tag LOCUS_07230 9053 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 <10701 9101 gene locus_tag LOCUS_07240 <10701 9101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940879.1:radical SAM protein >Feature sequence0068 <1 1235 gene locus_tag LOCUS_07250 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392267.1:flagellar hook-associated protein FlgK 1285 2220 gene locus_tag LOCUS_07260 gene flgL 1285 2220 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460796.1 protein_id gnl|my_center|LOCUS_07260 10632 2455 gene locus_tag LOCUS_07270 10632 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence0069 1050 736 gene locus_tag LOCUS_07280 1050 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1435 1190 gene locus_tag LOCUS_07290 1435 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2432 1572 gene locus_tag LOCUS_07300 2432 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 10492 2456 gene locus_tag LOCUS_07310 10492 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence0070 <1 1294 gene locus_tag LOCUS_07320 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933019.1:ABC transporter permease 2192 1503 gene locus_tag LOCUS_07330 2192 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2978 4282 gene locus_tag LOCUS_07340 2978 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4562 5608 gene locus_tag LOCUS_07350 4562 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145385480.1 protein_id gnl|my_center|LOCUS_07350 5605 6183 gene locus_tag LOCUS_07360 5605 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 6237 7664 gene locus_tag LOCUS_07370 6237 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 7652 9499 gene locus_tag LOCUS_07380 7652 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence0071 1746 172 gene locus_tag LOCUS_07390 1746 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2726 1743 gene locus_tag LOCUS_07400 2726 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3992 2742 gene locus_tag LOCUS_07410 3992 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 5484 3994 gene locus_tag LOCUS_07420 gene asnB 5484 3994 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337072.1 protein_id gnl|my_center|LOCUS_07420 5753 9388 gene locus_tag LOCUS_07430 5753 9388 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048304.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence0072 228 1133 gene locus_tag LOCUS_07440 228 1133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258911.1 protein_id gnl|my_center|LOCUS_07440 1208 1987 gene locus_tag LOCUS_07450 1208 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4148 2538 gene locus_tag LOCUS_07460 4148 2538 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_07460 5792 4323 gene locus_tag LOCUS_07470 5792 4323 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_07470 7876 5789 gene locus_tag LOCUS_07480 7876 5789 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_07480 9311 7962 gene locus_tag LOCUS_07490 9311 7962 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_07490 <10421 9470 gene locus_tag LOCUS_07500 <10421 9470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120107.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0073 <1 7280 gene locus_tag LOCUS_07510 <1 7280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172992225.1:lamin tail domain-containing protein 8544 7294 gene locus_tag LOCUS_07520 8544 7294 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence0074 <1 791 gene locus_tag LOCUS_07530 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123135.1:VTT domain-containing protein 869 1600 gene locus_tag LOCUS_07540 869 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 1733 2518 gene locus_tag LOCUS_07550 1733 2518 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_07550 2983 2573 gene locus_tag LOCUS_07560 2983 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3875 3060 gene locus_tag LOCUS_07570 gene trpC 3875 3060 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087578.1 protein_id gnl|my_center|LOCUS_07570 4927 3872 gene locus_tag LOCUS_07580 gene prfB 4927 3872 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_07580 5761 5081 gene locus_tag LOCUS_07590 5761 5081 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123040.1 protein_id gnl|my_center|LOCUS_07590 6137 7102 gene locus_tag LOCUS_07600 6137 7102 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_07600 7110 8318 gene locus_tag LOCUS_07610 7110 8318 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089073.1 protein_id gnl|my_center|LOCUS_07610 9703 8462 gene locus_tag LOCUS_07620 9703 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 <10374 9747 gene locus_tag LOCUS_07630 <10374 9747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326676.1:DUF1501 domain-containing protein >Feature sequence0075 724 1176 gene locus_tag LOCUS_07640 724 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1554 1898 gene locus_tag LOCUS_07650 1554 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2079 2369 gene locus_tag LOCUS_07660 2079 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 5493 2614 gene locus_tag LOCUS_07670 5493 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8798 5781 gene locus_tag LOCUS_07680 8798 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 9930 9508 gene locus_tag LOCUS_07690 9930 9508 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412752.1 protein_id gnl|my_center|LOCUS_07690 10190 9927 gene locus_tag LOCUS_07700 10190 9927 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412749.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence0076 <1 639 gene locus_tag LOCUS_07710 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615986.1:aldehyde dehydrogenase family protein 636 2216 gene locus_tag LOCUS_07720 gene crtI 636 2216 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123504.1 protein_id gnl|my_center|LOCUS_07720 2485 3147 gene locus_tag LOCUS_07730 2485 3147 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123503.1 protein_id gnl|my_center|LOCUS_07730 3144 4298 gene locus_tag LOCUS_07740 3144 4298 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922473.1 protein_id gnl|my_center|LOCUS_07740 4295 4858 gene locus_tag LOCUS_07750 4295 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 4906 6267 gene locus_tag LOCUS_07760 4906 6267 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120139.1 protein_id gnl|my_center|LOCUS_07760 7513 6380 gene locus_tag LOCUS_07770 7513 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 7781 7599 gene locus_tag LOCUS_07780 7781 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 8146 9423 gene locus_tag LOCUS_07790 8146 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence0077 <1 685 gene locus_tag LOCUS_07800 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045033.1:transposase 955 689 gene locus_tag LOCUS_07810 955 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 2941 1421 gene locus_tag LOCUS_07820 2941 1421 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_07820 3016 4230 gene locus_tag LOCUS_07830 gene thiH 3016 4230 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939370.1 protein_id gnl|my_center|LOCUS_07830 4227 4436 gene locus_tag LOCUS_07840 4227 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4834 4472 gene locus_tag LOCUS_07850 4834 4472 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_07850 5012 6844 gene locus_tag LOCUS_07860 5012 6844 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_07860 6872 7858 gene locus_tag LOCUS_07870 6872 7858 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868678.1 protein_id gnl|my_center|LOCUS_07870 8004 8918 gene locus_tag LOCUS_07880 8004 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526695.1 protein_id gnl|my_center|LOCUS_07880 8948 9949 gene locus_tag LOCUS_07890 8948 9949 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence0078 173 3652 gene locus_tag LOCUS_07900 173 3652 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928885.1 protein_id gnl|my_center|LOCUS_07900 5358 3673 gene locus_tag LOCUS_07910 gene recN 5358 3673 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_07910 5528 6085 gene locus_tag LOCUS_07920 gene folE 5528 6085 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390685.1 protein_id gnl|my_center|LOCUS_07920 6208 9312 gene locus_tag LOCUS_07930 6208 9312 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_07930 9336 10103 gene locus_tag LOCUS_07940 9336 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence0079 886 26 gene locus_tag LOCUS_07950 886 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2364 883 gene locus_tag LOCUS_07960 2364 883 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123736.1 protein_id gnl|my_center|LOCUS_07960 3192 2368 gene locus_tag LOCUS_07970 3192 2368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_07970 4203 3196 gene locus_tag LOCUS_07980 4203 3196 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_07980 4327 5001 gene locus_tag LOCUS_07990 4327 5001 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_07990 5450 5668 gene locus_tag LOCUS_08000 5450 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5794 7101 gene locus_tag LOCUS_08010 5794 7101 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762738.1 protein_id gnl|my_center|LOCUS_08010 8785 7112 gene locus_tag LOCUS_08020 8785 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 9919 9197 gene locus_tag LOCUS_08030 9919 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence0080 781 2466 gene locus_tag LOCUS_08040 781 2466 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_08040 2579 6682 gene locus_tag LOCUS_08050 2579 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 7202 8605 gene locus_tag LOCUS_08060 7202 8605 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence0081 <1 502 gene locus_tag LOCUS_08070 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070653.1:pilus assembly protein PilM 583 1071 gene locus_tag LOCUS_08080 583 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1138 2811 gene locus_tag LOCUS_08090 1138 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2835 5885 gene locus_tag LOCUS_08100 2835 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5997 9347 gene locus_tag LOCUS_08110 5997 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence0082 2315 705 gene locus_tag LOCUS_08120 2315 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2643 4565 gene locus_tag LOCUS_08130 2643 4565 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_08130 5877 4612 gene locus_tag LOCUS_08140 5877 4612 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_08140 6447 5956 gene locus_tag LOCUS_08150 6447 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 6926 6588 gene locus_tag LOCUS_08160 6926 6588 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_08160 8407 6971 gene locus_tag LOCUS_08170 8407 6971 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_08170 9864 8845 gene locus_tag LOCUS_08180 9864 8845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence0083 1406 567 gene locus_tag LOCUS_08190 1406 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2189 3172 gene locus_tag LOCUS_08200 2189 3172 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948058.1 protein_id gnl|my_center|LOCUS_08200 3174 3845 gene locus_tag LOCUS_08210 gene deoC 3174 3845 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436656.1 protein_id gnl|my_center|LOCUS_08210 4709 3873 gene locus_tag LOCUS_08220 gene larE 4709 3873 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_08220 6014 4770 gene locus_tag LOCUS_08230 6014 4770 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_08230 8361 6250 gene locus_tag LOCUS_08240 8361 6250 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_08240 9314 8463 gene locus_tag LOCUS_08250 9314 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence0084 157 375 gene locus_tag LOCUS_08260 157 375 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932270.1 protein_id gnl|my_center|LOCUS_08260 372 686 gene locus_tag LOCUS_08270 372 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 780 1022 gene locus_tag LOCUS_08280 780 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1019 1249 gene locus_tag LOCUS_08290 1019 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1259 1459 gene locus_tag LOCUS_08300 1259 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1861 3540 gene locus_tag LOCUS_08310 1861 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3766 4719 gene locus_tag LOCUS_08320 3766 4719 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_08320 4716 6020 gene locus_tag LOCUS_08330 4716 6020 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_08330 6146 6925 gene locus_tag LOCUS_08340 6146 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 8025 6922 gene locus_tag LOCUS_08350 gene ychF 8025 6922 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_08350 9173 8019 gene locus_tag LOCUS_08360 9173 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 9620 9357 gene locus_tag LOCUS_08370 gene rpmA 9620 9357 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence0085 <1 602 gene locus_tag LOCUS_08380 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962533.1:phosphate ABC transporter permease subunit PstC 599 1090 gene locus_tag LOCUS_08390 599 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08390 1118 1564 gene locus_tag LOCUS_08400 1118 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08400 1576 2409 gene locus_tag LOCUS_08410 gene pstB 1576 2409 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_08410 2462 3154 gene locus_tag LOCUS_08420 gene phoU 2462 3154 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_08420 3179 3862 gene locus_tag LOCUS_08430 3179 3862 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_08430 3890 5104 gene locus_tag LOCUS_08440 3890 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6098 5130 gene locus_tag LOCUS_08450 gene hflC 6098 5130 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_08450 7090 6095 gene locus_tag LOCUS_08460 gene hflK 7090 6095 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_08460 7443 7192 gene locus_tag LOCUS_08470 7443 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8554 7565 gene locus_tag LOCUS_08480 gene pdxA 8554 7565 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121619.1 protein_id gnl|my_center|LOCUS_08480 9604 8570 gene locus_tag LOCUS_08490 9604 8570 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence0086 <1 739 gene locus_tag LOCUS_08500 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein 746 2449 gene locus_tag LOCUS_08510 746 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2622 4502 gene locus_tag LOCUS_08520 2622 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4499 6154 gene locus_tag LOCUS_08530 4499 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6132 6821 gene locus_tag LOCUS_08540 6132 6821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_08540 6821 7999 gene locus_tag LOCUS_08550 6821 7999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_08550 8229 9584 gene locus_tag LOCUS_08560 gene gdhA 8229 9584 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence0087 <1 1014 gene locus_tag LOCUS_08570 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767110.1:S41 family peptidase 1070 3241 gene locus_tag LOCUS_08580 1070 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 3398 4933 gene locus_tag LOCUS_08590 gene rho 3398 4933 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_08590 5250 6263 gene locus_tag LOCUS_08600 5250 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6253 7584 gene locus_tag LOCUS_08610 6253 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08610 7581 9560 gene locus_tag LOCUS_08620 7581 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence0088 2288 345 gene locus_tag LOCUS_08630 2288 345 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119442.1 protein_id gnl|my_center|LOCUS_08630 2386 3456 gene locus_tag LOCUS_08640 2386 3456 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence0089 1097 651 gene locus_tag LOCUS_08650 gene tnpA 1097 651 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_08650 1367 1654 gene locus_tag LOCUS_08660 1367 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1664 9724 gene locus_tag LOCUS_08670 1664 9724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence0090 126 809 gene locus_tag LOCUS_08680 gene rpe 126 809 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085374.1 protein_id gnl|my_center|LOCUS_08680 809 2227 gene locus_tag LOCUS_08690 809 2227 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_08690 2900 4210 gene locus_tag LOCUS_08700 gene hisD 2900 4210 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_08700 4247 5419 gene locus_tag LOCUS_08710 gene hisC 4247 5419 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208421.1 protein_id gnl|my_center|LOCUS_08710 5493 6365 gene locus_tag LOCUS_08720 5493 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 9153 6382 gene locus_tag LOCUS_08730 9153 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence0091 919 662 gene locus_tag LOCUS_08740 919 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 851 1936 gene locus_tag LOCUS_08750 851 1936 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_08750 2082 3275 gene locus_tag LOCUS_08760 2082 3275 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922457.1 protein_id gnl|my_center|LOCUS_08760 4876 3527 gene locus_tag LOCUS_08770 4876 3527 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_08770 7462 4892 gene locus_tag LOCUS_08780 7462 4892 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_08780 7822 9111 gene locus_tag LOCUS_08790 7822 9111 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941843.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence0092 320 1180 gene locus_tag LOCUS_08800 320 1180 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_08800 1221 2033 gene locus_tag LOCUS_08810 1221 2033 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399665.1 protein_id gnl|my_center|LOCUS_08810 2074 2268 gene locus_tag LOCUS_08820 2074 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2293 3480 gene locus_tag LOCUS_08830 2293 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4230 3508 gene locus_tag LOCUS_08840 4230 3508 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_08840 4366 5439 gene locus_tag LOCUS_08850 4366 5439 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_08850 5559 5978 gene locus_tag LOCUS_08860 5559 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 6644 5970 gene locus_tag LOCUS_08870 6644 5970 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_08870 7160 7699 gene locus_tag LOCUS_08880 7160 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 7824 8987 gene locus_tag LOCUS_08890 7824 8987 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence0093 199 918 gene locus_tag LOCUS_08900 199 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1057 2439 gene locus_tag LOCUS_08910 1057 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2706 3731 gene locus_tag LOCUS_08920 gene aroF 2706 3731 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_08920 3746 4669 gene locus_tag LOCUS_08930 3746 4669 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_08930 4747 5631 gene locus_tag LOCUS_08940 4747 5631 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_08940 5721 6989 gene locus_tag LOCUS_08950 gene aroA 5721 6989 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971031.1 protein_id gnl|my_center|LOCUS_08950 7028 7678 gene locus_tag LOCUS_08960 gene cmk 7028 7678 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_08960 7675 8328 gene locus_tag LOCUS_08970 7675 8328 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_08970 <9546 8339 gene locus_tag LOCUS_08980 <9546 8339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143073.1:quinone-dependent dihydroorotate dehydrogenase >Feature sequence0094 1304 390 gene locus_tag LOCUS_08990 1304 390 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_08990 4983 1420 gene locus_tag LOCUS_09000 4983 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 5884 5135 gene locus_tag LOCUS_09010 5884 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 6818 5976 gene locus_tag LOCUS_09020 6818 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 8241 6865 gene locus_tag LOCUS_09030 8241 6865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447207.1 protein_id gnl|my_center|LOCUS_09030 <9527 8339 gene locus_tag LOCUS_09040 <9527 8339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767236.1:GH92 family glycosyl hydrolase >Feature sequence0095 <1 6248 gene locus_tag LOCUS_09050 <1 6248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein 6488 6823 gene locus_tag LOCUS_09060 6488 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6765 6971 gene locus_tag LOCUS_09070 6765 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09070 8748 7321 gene locus_tag LOCUS_09080 8748 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 9332 9256 gene locus_tag LOCUS_t00050 9332 9256 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0096 8179 7637 gene locus_tag LOCUS_09090 8179 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence0097 193 1575 gene locus_tag LOCUS_09100 193 1575 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_09100 1620 2651 gene locus_tag LOCUS_09110 1620 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4664 2655 gene locus_tag LOCUS_09120 4664 2655 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_09120 5620 4763 gene locus_tag LOCUS_09130 5620 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 5847 7697 gene locus_tag LOCUS_09140 5847 7697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_09140 7725 9191 gene locus_tag LOCUS_09150 7725 9191 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence0098 2269 239 gene locus_tag LOCUS_09160 2269 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 2325 3302 gene locus_tag LOCUS_09170 2325 3302 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_09170 5827 3284 gene locus_tag LOCUS_09180 5827 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 6453 5992 gene locus_tag LOCUS_09190 6453 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 6863 6594 gene locus_tag LOCUS_09200 6863 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 7036 6869 gene locus_tag LOCUS_09210 gene rpmG 7036 6869 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_09210 7639 7040 gene locus_tag LOCUS_09220 7639 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence0099 2 406 gene locus_tag LOCUS_09230 2 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 907 461 gene locus_tag LOCUS_09240 907 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2474 1038 gene locus_tag LOCUS_09250 2474 1038 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_09250 2805 3779 gene locus_tag LOCUS_09260 2805 3779 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922457.1 protein_id gnl|my_center|LOCUS_09260 4877 4008 gene locus_tag LOCUS_09270 4877 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6311 5142 gene locus_tag LOCUS_09280 6311 5142 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_09280 6569 8074 gene locus_tag LOCUS_09290 6569 8074 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226485.1 protein_id gnl|my_center|LOCUS_09290 9165 8254 gene locus_tag LOCUS_09300 9165 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence0100 <9365 4366 gene locus_tag LOCUS_09310 <9365 4366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence0101 369 1670 gene locus_tag LOCUS_09320 369 1670 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615621.1 protein_id gnl|my_center|LOCUS_09320 2526 1720 gene locus_tag LOCUS_09330 2526 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3337 2747 gene locus_tag LOCUS_09340 3337 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 6147 3409 gene locus_tag LOCUS_09350 6147 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7896 6163 gene locus_tag LOCUS_09360 7896 6163 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404200.1 protein_id gnl|my_center|LOCUS_09360 8218 8066 gene locus_tag LOCUS_09370 8218 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 9216 8215 gene locus_tag LOCUS_09380 9216 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence0102 865 1572 gene locus_tag LOCUS_09390 865 1572 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444858.1 protein_id gnl|my_center|LOCUS_09390 1579 3045 gene locus_tag LOCUS_09400 1579 3045 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_09400 3042 4289 gene locus_tag LOCUS_09410 3042 4289 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_09410 5937 4312 gene locus_tag LOCUS_09420 5937 4312 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245514.1 protein_id gnl|my_center|LOCUS_09420 8732 6042 gene locus_tag LOCUS_09430 8732 6042 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141113.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence0103 <1 2473 gene locus_tag LOCUS_09440 <1 2473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067544393.1:VCBS repeat-containing protein note possible pseudo, frameshifted 2431 3540 gene locus_tag LOCUS_09450 2431 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09450 3958 7896 gene locus_tag LOCUS_09460 3958 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 8229 9101 gene locus_tag LOCUS_09470 8229 9101 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459147.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence0104 1303 4407 gene locus_tag LOCUS_09480 1303 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4499 4771 gene locus_tag LOCUS_09490 4499 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4774 5151 gene locus_tag LOCUS_09500 4774 5151 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_09500 5300 5124 gene locus_tag LOCUS_09510 5300 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5368 5514 gene locus_tag LOCUS_09520 5368 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 5629 6054 gene locus_tag LOCUS_09530 5629 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 6051 6392 gene locus_tag LOCUS_09540 6051 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 6410 6778 gene locus_tag LOCUS_09550 6410 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6785 6964 gene locus_tag LOCUS_09560 6785 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 7708 6998 gene locus_tag LOCUS_09570 gene pyrF 7708 6998 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_09570 7895 9049 gene locus_tag LOCUS_09580 7895 9049 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227266.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence0105 2817 1003 gene locus_tag LOCUS_09590 2817 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3068 2814 gene locus_tag LOCUS_09600 3068 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3753 3259 gene locus_tag LOCUS_09610 3753 3259 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_09610 3834 4079 gene locus_tag LOCUS_09620 3834 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4124 5116 gene locus_tag LOCUS_09630 gene cbpA 4124 5116 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817008.1 protein_id gnl|my_center|LOCUS_09630 5169 5546 gene locus_tag LOCUS_09640 5169 5546 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_09640 6636 5647 gene locus_tag LOCUS_09650 6636 5647 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_09650 6995 6696 gene locus_tag LOCUS_09660 6995 6696 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_09660 7365 8378 gene locus_tag LOCUS_09670 7365 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence0106 5193 3502 gene locus_tag LOCUS_09680 5193 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 <9190 5239 gene locus_tag LOCUS_09690 <9190 5239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:Calx-beta domain-containing protein >Feature sequence0107 <1 1794 gene locus_tag LOCUS_09700 <1 1794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185449.1:sulfurtransferase 2130 1933 gene locus_tag LOCUS_09710 2130 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2307 3518 gene locus_tag LOCUS_09720 2307 3518 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_09720 3767 8506 gene locus_tag LOCUS_09730 3767 8506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence0108 239 1618 gene locus_tag LOCUS_09740 239 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1689 5006 gene locus_tag LOCUS_09750 1689 5006 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615966.1 protein_id gnl|my_center|LOCUS_09750 5003 5209 gene locus_tag LOCUS_09760 5003 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09760 5234 6352 gene locus_tag LOCUS_09770 5234 6352 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09770 8674 6419 gene locus_tag LOCUS_09780 8674 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence0109 1578 220 gene locus_tag LOCUS_09790 1578 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3146 1647 gene locus_tag LOCUS_09800 3146 1647 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973731.1 protein_id gnl|my_center|LOCUS_09800 5905 3134 gene locus_tag LOCUS_09810 5905 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 8452 5951 gene locus_tag LOCUS_09820 8452 5951 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence0110 3 857 gene locus_tag LOCUS_09830 3 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1027 2637 gene locus_tag LOCUS_09840 1027 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2879 2694 gene locus_tag LOCUS_09850 2879 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3273 5003 gene locus_tag LOCUS_09860 gene ilvD 3273 5003 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_09860 5045 5503 gene locus_tag LOCUS_09870 5045 5503 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_09870 <8906 5677 gene locus_tag LOCUS_09880 <8906 5677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022589.1:amylo-alpha-1,6-glucosidase >Feature sequence0111 504 785 gene locus_tag LOCUS_09890 504 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 842 1267 gene locus_tag LOCUS_09900 842 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2434 1322 gene locus_tag LOCUS_09910 2434 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3504 2512 gene locus_tag LOCUS_09920 3504 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3822 8600 gene locus_tag LOCUS_09930 3822 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence0112 320 105 gene locus_tag LOCUS_09940 320 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 319 585 gene locus_tag LOCUS_09950 319 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 688 3399 gene locus_tag LOCUS_09960 688 3399 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_09960 4031 3771 gene locus_tag LOCUS_09970 4031 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4501 3980 gene locus_tag LOCUS_09980 4501 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 6213 4561 gene locus_tag LOCUS_09990 6213 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 7552 6230 gene locus_tag LOCUS_10000 7552 6230 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_10000 <8842 7846 gene locus_tag LOCUS_10010 <8842 7846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107614.1:DUF1460 domain-containing protein >Feature sequence0113 <1 2163 gene locus_tag LOCUS_10020 <1 2163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921992.1:prolyl oligopeptidase family serine peptidase 2250 2783 gene locus_tag LOCUS_10030 2250 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2797 3654 gene locus_tag LOCUS_10040 2797 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 4310 5419 gene locus_tag LOCUS_10050 gene dnaN 4310 5419 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_10050 5467 5964 gene locus_tag LOCUS_10060 gene lspA 5467 5964 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 protein_id gnl|my_center|LOCUS_10060 6109 7008 gene locus_tag LOCUS_10070 gene miaA 6109 7008 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_10070 7073 8341 gene locus_tag LOCUS_10080 7073 8341 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920949.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence0114 1144 305 gene locus_tag LOCUS_10090 1144 305 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_10090 1277 3313 gene locus_tag LOCUS_10100 gene ligA 1277 3313 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_10100 3502 4917 gene locus_tag LOCUS_10110 3502 4917 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_10110 4954 5871 gene locus_tag LOCUS_10120 4954 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118058.1 protein_id gnl|my_center|LOCUS_10120 6011 6184 gene locus_tag LOCUS_10130 6011 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 8035 6284 gene locus_tag LOCUS_10140 8035 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence0115 <1 1014 gene locus_tag LOCUS_10150 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942916.1:DUF1015 family protein 1096 2373 gene locus_tag LOCUS_10160 1096 2373 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_10160 2386 2883 gene locus_tag LOCUS_10170 2386 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2947 4110 gene locus_tag LOCUS_10180 2947 4110 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_10180 4219 5436 gene locus_tag LOCUS_10190 4219 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 6691 5555 gene locus_tag LOCUS_10200 6691 5555 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_10200 8313 6775 gene locus_tag LOCUS_10210 8313 6775 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence0116 1609 464 gene locus_tag LOCUS_10220 1609 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1801 2205 gene locus_tag LOCUS_10230 1801 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 5362 2210 gene locus_tag LOCUS_10240 5362 2210 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_10240 <8671 5373 gene locus_tag LOCUS_10250 <8671 5373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037293.1:efflux RND transporter permease subunit >Feature sequence0117 993 31 gene locus_tag LOCUS_10260 993 31 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_10260 1505 1017 gene locus_tag LOCUS_10270 1505 1017 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879700.1 protein_id gnl|my_center|LOCUS_10270 2156 1575 gene locus_tag LOCUS_10280 2156 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2342 3400 gene locus_tag LOCUS_10290 2342 3400 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_10290 3397 4791 gene locus_tag LOCUS_10300 gene tilS 3397 4791 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404456.1 protein_id gnl|my_center|LOCUS_10300 6471 5188 gene locus_tag LOCUS_10310 gene mgtE 6471 5188 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_10310 7650 6592 gene locus_tag LOCUS_10320 7650 6592 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence0118 50 2431 gene locus_tag LOCUS_10330 50 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2445 3938 gene locus_tag LOCUS_10340 2445 3938 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_10340 3969 6029 gene locus_tag LOCUS_10350 gene recG 3969 6029 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_10350 8440 6098 gene locus_tag LOCUS_10360 8440 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence0119 <1 540 gene locus_tag LOCUS_10370 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194485.1:excinuclease ABC subunit UvrA 971 753 gene locus_tag LOCUS_10380 971 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 994 4545 gene locus_tag LOCUS_10390 994 4545 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_10390 4761 8411 gene locus_tag LOCUS_10400 4761 8411 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence0120 2924 1587 gene locus_tag LOCUS_10410 2924 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3850 2999 gene locus_tag LOCUS_10420 3850 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5184 3850 gene locus_tag LOCUS_10430 5184 3850 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_10430 7837 5207 gene locus_tag LOCUS_10440 7837 5207 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615693.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence0121 3368 1083 gene locus_tag LOCUS_10450 3368 1083 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117969.1 protein_id gnl|my_center|LOCUS_10450 4559 3729 gene locus_tag LOCUS_10460 4559 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 5254 5090 gene locus_tag LOCUS_10470 5254 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5247 6716 gene locus_tag LOCUS_10480 5247 6716 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_10480 <8579 6747 gene locus_tag LOCUS_10490 <8579 6747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032841441.1:dihydrofolate reductase >Feature sequence0122 397 780 gene locus_tag LOCUS_10500 397 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2290 1058 gene locus_tag LOCUS_10510 2290 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2614 2318 gene locus_tag LOCUS_10520 gene tatA 2614 2318 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410768.1 protein_id gnl|my_center|LOCUS_10520 2738 4873 gene locus_tag LOCUS_10530 2738 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 6132 4846 gene locus_tag LOCUS_10540 6132 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_10540 7114 6209 gene locus_tag LOCUS_10550 7114 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7679 7260 gene locus_tag LOCUS_10560 7679 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8373 7963 gene locus_tag LOCUS_10570 8373 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence0123 <1 1765 gene locus_tag LOCUS_10580 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921646.1:DUF4185 domain-containing protein 2570 1803 gene locus_tag LOCUS_10590 2570 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5164 2597 gene locus_tag LOCUS_10600 5164 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 <8563 5370 gene locus_tag LOCUS_10610 <8563 5370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615995.1:c-type cytochrome >Feature sequence0124 2678 60 gene locus_tag LOCUS_10620 2678 60 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_10620 4094 2712 gene locus_tag LOCUS_10630 4094 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4383 4865 gene locus_tag LOCUS_10640 4383 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4869 5129 gene locus_tag LOCUS_10650 4869 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 5390 6658 gene locus_tag LOCUS_10660 5390 6658 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_10660 6655 7908 gene locus_tag LOCUS_10670 6655 7908 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838600.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0125 1085 648 gene locus_tag LOCUS_10680 gene fabZ 1085 648 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_10680 1849 1082 gene locus_tag LOCUS_10690 1849 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 5115 1804 gene locus_tag LOCUS_10700 5115 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 5597 5112 gene locus_tag LOCUS_10710 5597 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 6972 5674 gene locus_tag LOCUS_10720 6972 5674 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_10720 7117 8274 gene locus_tag LOCUS_10730 gene hpnI 7117 8274 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence0126 <1 1647 gene locus_tag LOCUS_10740 <1 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940778.1:selenocysteine-specific translation elongation factor 1977 5429 gene locus_tag LOCUS_10750 1977 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 5477 7492 gene locus_tag LOCUS_10760 5477 7492 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974271.1 protein_id gnl|my_center|LOCUS_10760 8049 7516 gene locus_tag LOCUS_10770 8049 7516 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124788.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence0127 467 3010 gene locus_tag LOCUS_10780 467 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3175 4350 gene locus_tag LOCUS_10790 3175 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5826 4435 gene locus_tag LOCUS_10800 5826 4435 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_10800 8345 5823 gene locus_tag LOCUS_10810 8345 5823 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence0128 1571 210 gene locus_tag LOCUS_10820 1571 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2199 1681 gene locus_tag LOCUS_10830 2199 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 3740 2214 gene locus_tag LOCUS_10840 3740 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6229 3887 gene locus_tag LOCUS_10850 6229 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 <8463 6243 gene locus_tag LOCUS_10860 <8463 6243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113950.1:bifunctional glycoside hydrolase 114/ polysaccharide deacetylase family protein >Feature sequence0129 366 2555 gene locus_tag LOCUS_10870 366 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4033 2657 gene locus_tag LOCUS_10880 4033 2657 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_10880 4581 4312 gene locus_tag LOCUS_10890 4581 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5536 4856 gene locus_tag LOCUS_10900 5536 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6082 6825 gene locus_tag LOCUS_10910 6082 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 6985 8247 gene locus_tag LOCUS_10920 6985 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence0130 3 200 gene locus_tag LOCUS_10930 3 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 193 1269 gene locus_tag LOCUS_10940 193 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1565 2926 gene locus_tag LOCUS_10950 1565 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_10950 3135 4070 gene locus_tag LOCUS_10960 3135 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 4400 4101 gene locus_tag LOCUS_10970 4400 4101 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_10970 5287 4397 gene locus_tag LOCUS_10980 gene sucD 5287 4397 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_10980 6549 5344 gene locus_tag LOCUS_10990 gene sucC 6549 5344 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_10990 6924 7739 gene locus_tag LOCUS_11000 gene murI 6924 7739 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_11000 8003 7755 gene locus_tag LOCUS_11010 8003 7755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence0131 <1 629 gene locus_tag LOCUS_11020 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947219.1:adenylate/guanylate cyclase domain-containing protein 1160 723 gene locus_tag LOCUS_11030 1160 723 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_11030 1416 3440 gene locus_tag LOCUS_11040 1416 3440 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262804.1 protein_id gnl|my_center|LOCUS_11040 3440 5383 gene locus_tag LOCUS_11050 3440 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5598 6098 gene locus_tag LOCUS_11060 5598 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence0132 <8379 3297 gene locus_tag LOCUS_11070 <8379 3297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073976.1:retention module-containing protein >Feature sequence0133 <1 658 gene locus_tag LOCUS_11080 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090949.1:ABC transporter ATP-binding protein 718 3216 gene locus_tag LOCUS_11090 718 3216 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_11090 3651 3265 gene locus_tag LOCUS_11100 3651 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3986 8023 gene locus_tag LOCUS_11110 3986 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence0134 472 1536 gene locus_tag LOCUS_11120 472 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1591 3126 gene locus_tag LOCUS_11130 1591 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 3512 3327 gene locus_tag LOCUS_11140 3512 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4117 3743 gene locus_tag LOCUS_11150 4117 3743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4390 4671 gene locus_tag LOCUS_11160 4390 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 5710 4826 gene locus_tag LOCUS_11170 5710 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 6198 7571 gene locus_tag LOCUS_11180 6198 7571 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_11180 7986 7732 gene locus_tag LOCUS_11190 7986 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence0135 2565 112 gene locus_tag LOCUS_11200 2565 112 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_11200 6469 2552 gene locus_tag LOCUS_11210 6469 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 7699 6821 gene locus_tag LOCUS_11220 7699 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence0136 <1 2812 gene locus_tag LOCUS_11230 <1 2812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921950.1:zinc-dependent metalloprotease 3038 3259 gene locus_tag LOCUS_11240 3038 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 3329 3604 gene locus_tag LOCUS_11250 3329 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4651 3779 gene locus_tag LOCUS_11260 4651 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 6345 5059 gene locus_tag LOCUS_11270 6345 5059 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_11270 7476 6397 gene locus_tag LOCUS_11280 7476 6397 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930472.1 protein_id gnl|my_center|LOCUS_11280 7988 7494 gene locus_tag LOCUS_11290 7988 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence0137 3794 468 gene locus_tag LOCUS_11300 3794 468 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_11300 3922 4638 gene locus_tag LOCUS_11310 3922 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6517 4832 gene locus_tag LOCUS_11320 6517 4832 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880567.1 protein_id gnl|my_center|LOCUS_11320 7628 6528 gene locus_tag LOCUS_11330 7628 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence0138 534 1436 gene locus_tag LOCUS_11340 534 1436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392678.1 protein_id gnl|my_center|LOCUS_11340 1433 4687 gene locus_tag LOCUS_11350 1433 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4866 5717 gene locus_tag LOCUS_11360 4866 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 5745 6632 gene locus_tag LOCUS_11370 5745 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7517 6681 gene locus_tag LOCUS_11380 7517 6681 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172344.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence0139 7424 3801 gene locus_tag LOCUS_11390 7424 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence0140 2414 1236 gene locus_tag LOCUS_11400 2414 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3155 2484 gene locus_tag LOCUS_11410 3155 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4036 3152 gene locus_tag LOCUS_11420 4036 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4815 4033 gene locus_tag LOCUS_11430 4815 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5342 4812 gene locus_tag LOCUS_11440 5342 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6768 5335 gene locus_tag LOCUS_11450 6768 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8135 6765 gene locus_tag LOCUS_11460 8135 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence0141 <1 1049 gene locus_tag LOCUS_11470 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083434952.1:glucose 1-dehydrogenase 1926 1087 gene locus_tag LOCUS_11480 1926 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11480 3714 2002 gene locus_tag LOCUS_11490 3714 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11490 3969 4451 gene locus_tag LOCUS_11500 3969 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4948 5838 gene locus_tag LOCUS_11510 4948 5838 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_11510 <8168 5895 gene locus_tag LOCUS_11520 <8168 5895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615995.1:c-type cytochrome >Feature sequence0142 75 1490 gene locus_tag LOCUS_11530 75 1490 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_11530 2629 1541 gene locus_tag LOCUS_11540 2629 1541 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583800.1 protein_id gnl|my_center|LOCUS_11540 3016 2690 gene locus_tag LOCUS_11550 3016 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4109 3072 gene locus_tag LOCUS_11560 4109 3072 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_11560 5152 4106 gene locus_tag LOCUS_11570 gene plsX 5152 4106 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938504.1 protein_id gnl|my_center|LOCUS_11570 5885 5406 gene locus_tag LOCUS_11580 5885 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 6386 5895 gene locus_tag LOCUS_11590 gene coaD 6386 5895 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_11590 7286 6543 gene locus_tag LOCUS_11600 7286 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 7354 7569 gene locus_tag LOCUS_11610 7354 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence0143 259 1230 gene locus_tag LOCUS_11620 gene galE 259 1230 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674228.1 protein_id gnl|my_center|LOCUS_11620 1332 3362 gene locus_tag LOCUS_11630 1332 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 3949 3419 gene locus_tag LOCUS_11640 3949 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5019 4069 gene locus_tag LOCUS_11650 5019 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5120 5944 gene locus_tag LOCUS_11660 5120 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 6019 6840 gene locus_tag LOCUS_11670 gene kdsA 6019 6840 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence0144 <1 957 gene locus_tag LOCUS_11680 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933176.1:carbon-nitrogen hydrolase 1516 1175 gene locus_tag LOCUS_11690 1516 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1769 1500 gene locus_tag LOCUS_11700 1769 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2059 3516 gene locus_tag LOCUS_11710 2059 3516 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_11710 3522 4514 gene locus_tag LOCUS_11720 3522 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 6653 4713 gene locus_tag LOCUS_11730 6653 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6983 8068 gene locus_tag LOCUS_11740 6983 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence0145 <1 649 gene locus_tag LOCUS_11750 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB 682 1326 gene locus_tag LOCUS_11760 682 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1677 2966 gene locus_tag LOCUS_11770 1677 2966 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_11770 3175 4851 gene locus_tag LOCUS_11780 3175 4851 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_11780 6656 4929 gene locus_tag LOCUS_11790 gene argS 6656 4929 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096072.1 protein_id gnl|my_center|LOCUS_11790 7183 6716 gene locus_tag LOCUS_11800 7183 6716 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069646.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence0146 2071 194 gene locus_tag LOCUS_11810 2071 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4181 2073 gene locus_tag LOCUS_11820 4181 2073 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_11820 4490 7864 gene locus_tag LOCUS_11830 4490 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence0147 891 70 gene locus_tag LOCUS_11840 891 70 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_11840 3607 1133 gene locus_tag LOCUS_11850 3607 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5132 3648 gene locus_tag LOCUS_11860 5132 3648 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_11860 6016 5204 gene locus_tag LOCUS_11870 6016 5204 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_11870 <7923 6359 gene locus_tag LOCUS_11880 <7923 6359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120839.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0148 2807 1425 gene locus_tag LOCUS_11890 2807 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5869 2807 gene locus_tag LOCUS_11900 5869 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 7222 5870 gene locus_tag LOCUS_11910 7222 5870 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122381.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence0149 1106 438 gene locus_tag LOCUS_11920 1106 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1534 2826 gene locus_tag LOCUS_11930 1534 2826 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_11930 2931 6029 gene locus_tag LOCUS_11940 2931 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 <7907 6125 gene locus_tag LOCUS_11950 <7907 6125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259351.1:sensor domain-containing diguanylate cyclase >Feature sequence0150 324 1577 gene locus_tag LOCUS_11960 324 1577 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_11960 2420 2037 gene locus_tag LOCUS_11970 2420 2037 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_11970 5028 2443 gene locus_tag LOCUS_11980 5028 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6255 5212 gene locus_tag LOCUS_11990 gene mtnA 6255 5212 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_11990 6561 7580 gene locus_tag LOCUS_12000 6561 7580 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence0151 1523 765 gene locus_tag LOCUS_12010 1523 765 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889578.1 protein_id gnl|my_center|LOCUS_12010 2363 1566 gene locus_tag LOCUS_12020 2363 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3138 2443 gene locus_tag LOCUS_12030 gene urtE 3138 2443 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_12030 3908 3132 gene locus_tag LOCUS_12040 gene urtD 3908 3132 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531846.1 protein_id gnl|my_center|LOCUS_12040 5075 3912 gene locus_tag LOCUS_12050 gene urtC 5075 3912 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 protein_id gnl|my_center|LOCUS_12050 6826 5081 gene locus_tag LOCUS_12060 gene urtB 6826 5081 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535962.1 protein_id gnl|my_center|LOCUS_12060 <7821 6964 gene locus_tag LOCUS_12070 <7821 6964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527581.1:urea ABC transporter substrate-binding protein >Feature sequence0152 1388 3631 gene locus_tag LOCUS_12080 1388 3631 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_12080 3648 4220 gene locus_tag LOCUS_12090 3648 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 5667 4237 gene locus_tag LOCUS_12100 5667 4237 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_12100 7441 6389 gene locus_tag LOCUS_12110 7441 6389 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence0153 <1 957 gene locus_tag LOCUS_12120 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_100003378.1:Ldh family oxidoreductase 3495 985 gene locus_tag LOCUS_12130 3495 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4216 3557 gene locus_tag LOCUS_12140 4216 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4346 6943 gene locus_tag LOCUS_12150 4346 6943 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117969.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence0154 99 1214 gene locus_tag LOCUS_12160 gene ugpC 99 1214 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_12160 1342 1914 gene locus_tag LOCUS_12170 1342 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3227 3607 gene locus_tag LOCUS_12180 3227 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3798 5384 gene locus_tag LOCUS_12190 3798 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12190 5284 6285 gene locus_tag LOCUS_12200 5284 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12200 6319 6972 gene locus_tag LOCUS_12210 6319 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12210 7025 7291 gene locus_tag LOCUS_12220 7025 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence0155 1411 407 gene locus_tag LOCUS_12230 gene iolX 1411 407 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_12230 1716 2270 gene locus_tag LOCUS_12240 1716 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2379 2978 gene locus_tag LOCUS_12250 2379 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3039 4922 gene locus_tag LOCUS_12260 3039 4922 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_12260 4992 6164 gene locus_tag LOCUS_12270 gene lpxK 4992 6164 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_12270 6168 6578 gene locus_tag LOCUS_12280 6168 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6588 7436 gene locus_tag LOCUS_12290 6588 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence0156 <1 532 gene locus_tag LOCUS_12300 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966234.1:1-phosphofructokinase family hexose kinase 2227 674 gene locus_tag LOCUS_12310 2227 674 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944579.1 protein_id gnl|my_center|LOCUS_12310 3834 2290 gene locus_tag LOCUS_12320 3834 2290 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_12320 4240 5643 gene locus_tag LOCUS_12330 4240 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 6701 5640 gene locus_tag LOCUS_12340 6701 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence0157 <1 1095 gene locus_tag LOCUS_12350 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803778.1:Gfo/Idh/MocA family oxidoreductase 1222 2592 gene locus_tag LOCUS_12360 1222 2592 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146491.1 protein_id gnl|my_center|LOCUS_12360 2630 2878 gene locus_tag LOCUS_12370 2630 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 3128 3343 gene locus_tag LOCUS_12380 3128 3343 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_12380 3405 4685 gene locus_tag LOCUS_12390 3405 4685 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171281526.1 protein_id gnl|my_center|LOCUS_12390 4682 5806 gene locus_tag LOCUS_12400 4682 5806 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0158 1242 1802 gene locus_tag LOCUS_12410 1242 1802 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_12410 2172 1804 gene locus_tag LOCUS_12420 2172 1804 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811293.1 protein_id gnl|my_center|LOCUS_12420 3129 2278 gene locus_tag LOCUS_12430 3129 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3327 3596 gene locus_tag LOCUS_12440 3327 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3841 3692 gene locus_tag LOCUS_12450 3841 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4309 3917 gene locus_tag LOCUS_12460 4309 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5074 4343 gene locus_tag LOCUS_12470 5074 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5217 6668 gene locus_tag LOCUS_12480 gene bioA 5217 6668 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_12480 7365 6724 gene locus_tag LOCUS_12490 7365 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence0159 158 673 gene locus_tag LOCUS_12500 158 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2030 654 gene locus_tag LOCUS_12510 2030 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2353 3762 gene locus_tag LOCUS_12520 2353 3762 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815383.1 protein_id gnl|my_center|LOCUS_12520 3841 5625 gene locus_tag LOCUS_12530 3841 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence0160 2107 2727 gene locus_tag LOCUS_12540 2107 2727 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_12540 2997 7259 gene locus_tag LOCUS_12550 2997 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence0161 315 49 gene locus_tag LOCUS_12560 315 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 220 648 gene locus_tag LOCUS_12570 220 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2740 836 gene locus_tag LOCUS_12580 gene ettA 2740 836 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_12580 4350 2749 gene locus_tag LOCUS_12590 4350 2749 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_12590 4496 5560 gene locus_tag LOCUS_12600 4496 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5608 6591 gene locus_tag LOCUS_12610 5608 6591 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence0162 574 1383 gene locus_tag LOCUS_12620 574 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1408 3543 gene locus_tag LOCUS_12630 1408 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3740 4069 gene locus_tag LOCUS_12640 3740 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 4211 6076 gene locus_tag LOCUS_12650 4211 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7124 6084 gene locus_tag LOCUS_12660 7124 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7138 7470 gene locus_tag LOCUS_12670 7138 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence0163 1570 461 gene locus_tag LOCUS_12680 1570 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2240 1554 gene locus_tag LOCUS_12690 2240 1554 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_12690 3079 2237 gene locus_tag LOCUS_12700 3079 2237 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_12700 <7655 3237 gene locus_tag LOCUS_12710 <7655 3237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172992225.1:lamin tail domain-containing protein >Feature sequence0164 1810 299 gene locus_tag LOCUS_12720 1810 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12720 2679 1807 gene locus_tag LOCUS_12730 2679 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 4245 3082 gene locus_tag LOCUS_12740 gene recA 4245 3082 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224217.1 protein_id gnl|my_center|LOCUS_12740 5246 4389 gene locus_tag LOCUS_12750 5246 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 6509 5286 gene locus_tag LOCUS_12760 6509 5286 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082320.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence0165 289 696 gene locus_tag LOCUS_12770 289 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 731 1621 gene locus_tag LOCUS_12780 731 1621 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_12780 1657 3615 gene locus_tag LOCUS_12790 1657 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3731 3919 gene locus_tag LOCUS_12800 3731 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 4126 5067 gene locus_tag LOCUS_12810 4126 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5064 5633 gene locus_tag LOCUS_12820 5064 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5773 6867 gene locus_tag LOCUS_12830 5773 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 6855 7178 gene locus_tag LOCUS_12840 6855 7178 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008142319.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence0166 834 100 gene locus_tag LOCUS_12850 834 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2288 906 gene locus_tag LOCUS_12860 2288 906 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_12860 4825 2354 gene locus_tag LOCUS_12870 4825 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence0167 1505 1230 gene locus_tag LOCUS_12880 1505 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2315 1536 gene locus_tag LOCUS_12890 2315 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2664 7346 gene locus_tag LOCUS_12900 2664 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0168 176 1288 gene locus_tag LOCUS_12910 gene argJ 176 1288 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12910 1321 2196 gene locus_tag LOCUS_12920 gene argB 1321 2196 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_12920 2264 3550 gene locus_tag LOCUS_12930 2264 3550 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928539.1 protein_id gnl|my_center|LOCUS_12930 3564 4460 gene locus_tag LOCUS_12940 gene argF 3564 4460 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_12940 4467 5261 gene locus_tag LOCUS_12950 4467 5261 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_12950 7086 5452 gene locus_tag LOCUS_12960 7086 5452 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120298.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence0169 <1 1691 gene locus_tag LOCUS_12970 <1 1691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120349.1:DUF1553 domain-containing protein 1769 5314 gene locus_tag LOCUS_12980 1769 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence0170 700 1770 gene locus_tag LOCUS_12990 700 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1802 2869 gene locus_tag LOCUS_13000 gene dinB 1802 2869 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989855.1 protein_id gnl|my_center|LOCUS_13000 3817 2933 gene locus_tag LOCUS_13010 3817 2933 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_13010 5238 3892 gene locus_tag LOCUS_13020 5238 3892 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_13020 5844 5587 gene locus_tag LOCUS_13030 5844 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence0171 491 276 gene locus_tag LOCUS_13040 491 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1735 563 gene locus_tag LOCUS_13050 1735 563 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_13050 2029 2373 gene locus_tag LOCUS_13060 2029 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2370 3035 gene locus_tag LOCUS_13070 2370 3035 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122034.1 protein_id gnl|my_center|LOCUS_13070 4487 3129 gene locus_tag LOCUS_13080 4487 3129 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_13080 6841 4565 gene locus_tag LOCUS_13090 6841 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 <7544 6988 gene locus_tag LOCUS_13100 <7544 6988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228286.1:response regulator >Feature sequence0172 1180 890 gene locus_tag LOCUS_13110 1180 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5256 1264 gene locus_tag LOCUS_13120 5256 1264 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_13120 7227 5263 gene locus_tag LOCUS_13130 7227 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence0173 2611 2321 gene locus_tag LOCUS_13140 2611 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 4588 3179 gene locus_tag LOCUS_13150 4588 3179 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_13150 6711 4765 gene locus_tag LOCUS_13160 6711 4765 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_13160 7434 6724 gene locus_tag LOCUS_13170 7434 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence0174 <1 548 gene locus_tag LOCUS_13180 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259010.1:phosphoenolpyruvate carboxylase 877 629 gene locus_tag LOCUS_13190 877 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2298 1024 gene locus_tag LOCUS_13200 2298 1024 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_13200 2546 4789 gene locus_tag LOCUS_13210 2546 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6201 4753 gene locus_tag LOCUS_13220 6201 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 7298 6348 gene locus_tag LOCUS_13230 7298 6348 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986252.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence0175 2977 4350 gene locus_tag LOCUS_13240 2977 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4377 5138 gene locus_tag LOCUS_13250 4377 5138 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_13250 5135 6352 gene locus_tag LOCUS_13260 5135 6352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence0176 2292 940 gene locus_tag LOCUS_13270 gene trkA 2292 940 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327001.1 protein_id gnl|my_center|LOCUS_13270 2654 2406 gene locus_tag LOCUS_13280 2654 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2804 3781 gene locus_tag LOCUS_13290 2804 3781 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_13290 3970 4710 gene locus_tag LOCUS_13300 3970 4710 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_13300 4713 6197 gene locus_tag LOCUS_13310 gene glpK 4713 6197 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_13310 <7500 6618 gene locus_tag LOCUS_13320 <7500 6618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142258.1:PQQ-dependent sugar dehydrogenase >Feature sequence0177 917 1348 gene locus_tag LOCUS_13330 gene nsrR 917 1348 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_13330 1514 2254 gene locus_tag LOCUS_13340 1514 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2251 3612 gene locus_tag LOCUS_13350 2251 3612 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_13350 3642 4412 gene locus_tag LOCUS_13360 gene nirQ 3642 4412 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_13360 4478 6193 gene locus_tag LOCUS_13370 4478 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 <7500 6279 gene locus_tag LOCUS_13380 <7500 6279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922975.1:sulfatase >Feature sequence0178 826 1770 gene locus_tag LOCUS_13390 826 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1767 3347 gene locus_tag LOCUS_13400 1767 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3512 4291 gene locus_tag LOCUS_13410 3512 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 4295 5119 gene locus_tag LOCUS_13420 4295 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5151 6209 gene locus_tag LOCUS_13430 5151 6209 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268762.1 protein_id gnl|my_center|LOCUS_13430 6228 7034 gene locus_tag LOCUS_13440 6228 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence0179 2898 358 gene locus_tag LOCUS_13450 2898 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3441 4802 gene locus_tag LOCUS_13460 3441 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5310 6794 gene locus_tag LOCUS_13470 5310 6794 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence0180 1258 146 gene locus_tag LOCUS_13480 gene argC 1258 146 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_13480 1716 1321 gene locus_tag LOCUS_13490 gene rpsI 1716 1321 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_13490 2160 1726 gene locus_tag LOCUS_13500 gene rplM 2160 1726 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_13500 3286 2240 gene locus_tag LOCUS_13510 gene lpxD 3286 2240 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_13510 3795 3358 gene locus_tag LOCUS_13520 3795 3358 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_13520 3899 4639 gene locus_tag LOCUS_13530 3899 4639 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083339.1 protein_id gnl|my_center|LOCUS_13530 5131 4709 gene locus_tag LOCUS_13540 5131 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6389 5244 gene locus_tag LOCUS_13550 6389 5244 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_13550 <7428 6434 gene locus_tag LOCUS_13560 <7428 6434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123542.1:TIM barrel protein >Feature sequence0181 490 1077 gene locus_tag LOCUS_13570 490 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2197 1448 gene locus_tag LOCUS_13580 2197 1448 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_13580 2432 3082 gene locus_tag LOCUS_13590 gene pdxH 2432 3082 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 protein_id gnl|my_center|LOCUS_13590 3384 3097 gene locus_tag LOCUS_13600 3384 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3658 5997 gene locus_tag LOCUS_13610 gene pfeT 3658 5997 CDS product metal-transporting ATPase PfeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245873.1 protein_id gnl|my_center|LOCUS_13610 6143 6739 gene locus_tag LOCUS_13620 6143 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence0182 549 839 gene locus_tag LOCUS_13630 549 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1388 2269 gene locus_tag LOCUS_13640 1388 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2582 3661 gene locus_tag LOCUS_13650 2582 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3693 4361 gene locus_tag LOCUS_13660 3693 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 4425 6074 gene locus_tag LOCUS_13670 gene murJ 4425 6074 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_13670 6955 6119 gene locus_tag LOCUS_13680 6955 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence0183 171 2621 gene locus_tag LOCUS_13690 171 2621 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061787.1 protein_id gnl|my_center|LOCUS_13690 2991 5006 gene locus_tag LOCUS_13700 2991 5006 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036903.1 protein_id gnl|my_center|LOCUS_13700 5288 6238 gene locus_tag LOCUS_13710 5288 6238 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_13710 6430 6765 gene locus_tag LOCUS_13720 6430 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6746 7273 gene locus_tag LOCUS_13730 6746 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403820.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0184 168 2753 gene locus_tag LOCUS_13740 168 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_13740 2875 5709 gene locus_tag LOCUS_13750 2875 5709 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_13750 5852 7216 gene locus_tag LOCUS_13760 5852 7216 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339839.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence0185 2149 1202 gene locus_tag LOCUS_13770 2149 1202 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037557.1 protein_id gnl|my_center|LOCUS_13770 3144 2218 gene locus_tag LOCUS_13780 3144 2218 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807565.1 protein_id gnl|my_center|LOCUS_13780 3423 5186 gene locus_tag LOCUS_13790 3423 5186 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_13790 5265 6773 gene locus_tag LOCUS_13800 5265 6773 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098271.1 protein_id gnl|my_center|LOCUS_13800 7202 6792 gene locus_tag LOCUS_13810 7202 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence0186 3916 818 gene locus_tag LOCUS_13820 3916 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5223 3976 gene locus_tag LOCUS_13830 5223 3976 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_13830 5833 5381 gene locus_tag LOCUS_13840 5833 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6171 5830 gene locus_tag LOCUS_13850 6171 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6756 6181 gene locus_tag LOCUS_13860 6756 6181 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230856.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence0187 <1 1223 gene locus_tag LOCUS_13870 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546857.1:outer membrane protein assembly factor BamA 1286 1906 gene locus_tag LOCUS_13880 1286 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2479 1976 gene locus_tag LOCUS_13890 2479 1976 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_13890 3680 2598 gene locus_tag LOCUS_13900 3680 2598 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_13900 3780 4973 gene locus_tag LOCUS_13910 gene pelA 3780 4973 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_13910 6505 5012 gene locus_tag LOCUS_13920 6505 5012 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence0188 881 1114 gene locus_tag LOCUS_13930 881 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1930 1136 gene locus_tag LOCUS_13940 1930 1136 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120572.1 protein_id gnl|my_center|LOCUS_13940 2412 2242 gene locus_tag LOCUS_13950 2412 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3787 2357 gene locus_tag LOCUS_13960 3787 2357 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_13960 4249 3869 gene locus_tag LOCUS_13970 4249 3869 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_13970 4340 5062 gene locus_tag LOCUS_13980 4340 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5222 6511 gene locus_tag LOCUS_13990 5222 6511 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_13990 6543 6950 gene locus_tag LOCUS_14000 6543 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0189 <1 650 gene locus_tag LOCUS_14010 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389600.1:transglutaminase family protein 2930 663 gene locus_tag LOCUS_14020 2930 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145375047.1 protein_id gnl|my_center|LOCUS_14020 6404 3000 gene locus_tag LOCUS_14030 6404 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 <7285 6482 gene locus_tag LOCUS_14040 <7285 6482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258190.1:AEC family transporter >Feature sequence0190 757 41 gene locus_tag LOCUS_14050 gene radC 757 41 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_14050 2074 848 gene locus_tag LOCUS_14060 gene hflX 2074 848 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_14060 3989 2253 gene locus_tag LOCUS_14070 3989 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 4398 5576 gene locus_tag LOCUS_14080 4398 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence0191 <1 771 gene locus_tag LOCUS_14090 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142825.1:PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein 768 7115 gene locus_tag LOCUS_14100 768 7115 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484145.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence0192 2282 864 gene locus_tag LOCUS_14110 gene phnY 2282 864 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 protein_id gnl|my_center|LOCUS_14110 3600 2320 gene locus_tag LOCUS_14120 gene phnA 3600 2320 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061791.1 protein_id gnl|my_center|LOCUS_14120 4909 3611 gene locus_tag LOCUS_14130 4909 3611 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_14130 6094 4925 gene locus_tag LOCUS_14140 gene phnW 6094 4925 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703876.1 protein_id gnl|my_center|LOCUS_14140 7167 6469 gene locus_tag LOCUS_14150 7167 6469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence0193 1870 440 gene locus_tag LOCUS_14160 1870 440 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_14160 3941 1863 gene locus_tag LOCUS_14170 3941 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 6699 4057 gene locus_tag LOCUS_14180 6699 4057 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214114.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence0194 260 580 gene locus_tag LOCUS_14190 260 580 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_14190 876 1796 gene locus_tag LOCUS_14200 876 1796 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_14200 2102 1854 gene locus_tag LOCUS_14210 2102 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3935 2394 gene locus_tag LOCUS_14220 3935 2394 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 protein_id gnl|my_center|LOCUS_14220 5287 3947 gene locus_tag LOCUS_14230 5287 3947 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_14230 <7217 5284 gene locus_tag LOCUS_14240 <7217 5284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921320.1:DUF1592 domain-containing protein >Feature sequence0195 <1 4545 gene locus_tag LOCUS_14250 <1 4545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein 4649 5737 gene locus_tag LOCUS_14260 4649 5737 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_14260 6227 5784 gene locus_tag LOCUS_14270 6227 5784 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_14270 6975 6283 gene locus_tag LOCUS_14280 6975 6283 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118448.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence0196 <1 1068 gene locus_tag LOCUS_14290 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202553.1:endonuclease/exonuclease/phosphatase family protein 1502 1203 gene locus_tag LOCUS_14300 1502 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2383 1844 gene locus_tag LOCUS_14310 2383 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2756 3754 gene locus_tag LOCUS_14320 2756 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 3751 4818 gene locus_tag LOCUS_14330 3751 4818 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945986.1 protein_id gnl|my_center|LOCUS_14330 4815 6224 gene locus_tag LOCUS_14340 4815 6224 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667792.1 protein_id gnl|my_center|LOCUS_14340 <7181 6314 gene locus_tag LOCUS_14350 <7181 6314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921947.1:PQQ-like beta-propeller repeat protein >Feature sequence0197 36 2621 gene locus_tag LOCUS_14360 gene mutS 36 2621 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_14360 3277 2777 gene locus_tag LOCUS_14370 gene sixA 3277 2777 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_14370 3298 3522 gene locus_tag LOCUS_14380 3298 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3543 4277 gene locus_tag LOCUS_14390 gene pyrH 3543 4277 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_14390 4556 6100 gene locus_tag LOCUS_14400 4556 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 6882 6133 gene locus_tag LOCUS_14410 6882 6133 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229010.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence0198 1593 2549 gene locus_tag LOCUS_14420 1593 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2546 3379 gene locus_tag LOCUS_14430 2546 3379 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_14430 3560 4738 gene locus_tag LOCUS_14440 3560 4738 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_14440 5980 4769 gene locus_tag LOCUS_14450 5980 4769 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169978569.1 protein_id gnl|my_center|LOCUS_14450 6336 5983 gene locus_tag LOCUS_14460 6336 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence0199 <1 537 gene locus_tag LOCUS_14470 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481438.1:aspartate aminotransferase family protein 522 1676 gene locus_tag LOCUS_14480 gene tgt 522 1676 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_14480 1852 2208 gene locus_tag LOCUS_14490 1852 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2221 4731 gene locus_tag LOCUS_14500 gene secDF 2221 4731 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_14500 4790 6526 gene locus_tag LOCUS_14510 gene recJ 4790 6526 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence0200 608 4909 gene locus_tag LOCUS_14520 608 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5573 4920 gene locus_tag LOCUS_14530 5573 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 <7131 5780 gene locus_tag LOCUS_14540 <7131 5780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044997.1:ATP-binding protein >Feature sequence0201 2131 1310 gene locus_tag LOCUS_14550 2131 1310 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_14550 3275 3081 gene locus_tag LOCUS_14560 3275 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3291 6620 gene locus_tag LOCUS_14570 3291 6620 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence0202 1 1026 gene locus_tag LOCUS_14580 1 1026 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_14580 4360 1172 gene locus_tag LOCUS_14590 4360 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5141 4374 gene locus_tag LOCUS_14600 gene lpxA 5141 4374 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_14600 6585 5203 gene locus_tag LOCUS_14610 6585 5203 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_14610 7046 6717 gene locus_tag LOCUS_14620 7046 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence0203 244 1209 gene locus_tag LOCUS_14630 gene trpS 244 1209 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_14630 2224 1247 gene locus_tag LOCUS_14640 2224 1247 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_14640 3422 2361 gene locus_tag LOCUS_14650 gene pheA 3422 2361 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_14650 4183 3437 gene locus_tag LOCUS_14660 4183 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4983 4174 gene locus_tag LOCUS_14670 4983 4174 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_14670 5120 5281 gene locus_tag LOCUS_14680 5120 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence0204 >Feature sequence0205 3658 1835 gene locus_tag LOCUS_14690 3658 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 5077 3854 gene locus_tag LOCUS_14700 gene lptF 5077 3854 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_14700 5281 6081 gene locus_tag LOCUS_14710 5281 6081 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_14710 6351 6950 gene locus_tag LOCUS_14720 6351 6950 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence0206 2957 2274 gene locus_tag LOCUS_14730 2957 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3805 3011 gene locus_tag LOCUS_14740 3805 3011 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_14740 4835 3795 gene locus_tag LOCUS_14750 4835 3795 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_14750 5826 4885 gene locus_tag LOCUS_14760 5826 4885 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532950.1 protein_id gnl|my_center|LOCUS_14760 6803 5823 gene locus_tag LOCUS_14770 6803 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence0207 374 742 gene locus_tag LOCUS_14780 374 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2222 972 gene locus_tag LOCUS_14790 2222 972 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_14790 3784 2231 gene locus_tag LOCUS_14800 3784 2231 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_14800 5378 3954 gene locus_tag LOCUS_14810 5378 3954 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922839.1 protein_id gnl|my_center|LOCUS_14810 <6844 5392 gene locus_tag LOCUS_14820 <6844 5392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615465.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0208 578 2035 gene locus_tag LOCUS_14830 578 2035 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_14830 2037 2894 gene locus_tag LOCUS_14840 2037 2894 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_14840 3036 4310 gene locus_tag LOCUS_14850 3036 4310 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_14850 5478 4510 gene locus_tag LOCUS_14860 5478 4510 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_14860 <6838 5516 gene locus_tag LOCUS_14870 <6838 5516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333131.1:DUF1501 domain-containing protein >Feature sequence0209 1190 423 gene locus_tag LOCUS_14880 1190 423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_14880 2485 1220 gene locus_tag LOCUS_14890 2485 1220 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_14890 3261 2803 gene locus_tag LOCUS_14900 3261 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14900 3489 3277 gene locus_tag LOCUS_14910 3489 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14910 4145 5626 gene locus_tag LOCUS_14920 4145 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence0210 <1 645 gene locus_tag LOCUS_14930 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036461.1:RNA polymerase sigma factor RpoE 648 1136 gene locus_tag LOCUS_14940 648 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2556 1177 gene locus_tag LOCUS_14950 2556 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2735 3697 gene locus_tag LOCUS_14960 2735 3697 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088486.1 protein_id gnl|my_center|LOCUS_14960 3870 6752 gene locus_tag LOCUS_14970 3870 6752 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence0211 <1 1472 gene locus_tag LOCUS_14980 <1 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545143.1:DegQ family serine endoprotease 1756 1439 gene locus_tag LOCUS_14990 1756 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3801 1810 gene locus_tag LOCUS_15000 3801 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 5253 3883 gene locus_tag LOCUS_15010 5253 3883 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_15010 <6800 5261 gene locus_tag LOCUS_15020 <6800 5261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930460.1:glycosyltransferase >Feature sequence0212 <1 917 gene locus_tag LOCUS_15030 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460040.1:molecular chaperone HtpG 1083 1397 gene locus_tag LOCUS_15040 1083 1397 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246602.1 protein_id gnl|my_center|LOCUS_15040 2261 1518 gene locus_tag LOCUS_15050 2261 1518 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_15050 4150 2318 gene locus_tag LOCUS_15060 4150 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4423 5880 gene locus_tag LOCUS_15070 gene pabB 4423 5880 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_15070 5886 6722 gene locus_tag LOCUS_15080 gene ilvE 5886 6722 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870345.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence0213 <1 1530 gene locus_tag LOCUS_15090 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118670.1:polyamine aminopropyltransferase 1587 2456 gene locus_tag LOCUS_15100 1587 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2480 3388 gene locus_tag LOCUS_15110 2480 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3397 4206 gene locus_tag LOCUS_15120 3397 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4230 5327 gene locus_tag LOCUS_15130 4230 5327 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124219794.1 protein_id gnl|my_center|LOCUS_15130 5328 5777 gene locus_tag LOCUS_15140 5328 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 5820 6506 gene locus_tag LOCUS_15150 5820 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence0214 >Feature sequence0215 1132 284 gene locus_tag LOCUS_15160 1132 284 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_15160 2560 1424 gene locus_tag LOCUS_15170 2560 1424 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_15170 4089 2653 gene locus_tag LOCUS_15180 4089 2653 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_15180 <6707 4099 gene locus_tag LOCUS_15190 <6707 4099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008666716.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0216 764 1417 gene locus_tag LOCUS_15200 764 1417 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_15200 1424 2929 gene locus_tag LOCUS_15210 1424 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4591 3140 gene locus_tag LOCUS_15220 4591 3140 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_15220 <6692 4604 gene locus_tag LOCUS_15230 <6692 4604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119443.1:PAS domain-containing protein >Feature sequence0217 359 604 gene locus_tag LOCUS_15240 359 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1191 769 gene locus_tag LOCUS_15250 1191 769 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582698.1 protein_id gnl|my_center|LOCUS_15250 3580 1985 gene locus_tag LOCUS_15260 3580 1985 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975714.1 protein_id gnl|my_center|LOCUS_15260 5046 4021 gene locus_tag LOCUS_15270 5046 4021 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346255.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence0218 243 1148 gene locus_tag LOCUS_15280 243 1148 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_15280 1175 3193 gene locus_tag LOCUS_15290 1175 3193 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_15290 3190 5382 gene locus_tag LOCUS_15300 3190 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_15300 6407 5379 gene locus_tag LOCUS_15310 6407 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence0219 416 2530 gene locus_tag LOCUS_15320 gene flhA 416 2530 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460749.1 protein_id gnl|my_center|LOCUS_15320 2657 3817 gene locus_tag LOCUS_15330 2657 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 4057 4494 gene locus_tag LOCUS_15340 4057 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4553 4807 gene locus_tag LOCUS_15350 4553 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4839 5651 gene locus_tag LOCUS_15360 4839 5651 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_15360 5685 6503 gene locus_tag LOCUS_15370 5685 6503 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence0220 407 1453 gene locus_tag LOCUS_15380 407 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1527 2744 gene locus_tag LOCUS_15390 1527 2744 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927045.1 protein_id gnl|my_center|LOCUS_15390 2841 4106 gene locus_tag LOCUS_15400 2841 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 4103 4567 gene locus_tag LOCUS_15410 4103 4567 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566213.1 protein_id gnl|my_center|LOCUS_15410 4589 5896 gene locus_tag LOCUS_15420 4589 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 6016 6639 gene locus_tag LOCUS_15430 6016 6639 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence0221 1006 299 gene locus_tag LOCUS_15440 1006 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1719 1012 gene locus_tag LOCUS_15450 1719 1012 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_15450 3203 1716 gene locus_tag LOCUS_15460 3203 1716 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_15460 3583 3200 gene locus_tag LOCUS_15470 3583 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4871 3627 gene locus_tag LOCUS_15480 4871 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_15480 5531 4875 gene locus_tag LOCUS_15490 5531 4875 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_15490 6074 5535 gene locus_tag LOCUS_15500 6074 5535 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_15500 <6633 6076 gene locus_tag LOCUS_15510 <6633 6076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404833.1:polysulfide reductase NrfD >Feature sequence0222 373 1188 gene locus_tag LOCUS_15520 373 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1293 2282 gene locus_tag LOCUS_15530 1293 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2301 2966 gene locus_tag LOCUS_15540 2301 2966 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_15540 3182 3544 gene locus_tag LOCUS_15550 3182 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5819 3630 gene locus_tag LOCUS_15560 5819 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence0223 322 2145 gene locus_tag LOCUS_15570 322 2145 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_15570 2181 3122 gene locus_tag LOCUS_15580 2181 3122 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256841.1 protein_id gnl|my_center|LOCUS_15580 3129 3641 gene locus_tag LOCUS_15590 3129 3641 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_15590 3642 4103 gene locus_tag LOCUS_15600 3642 4103 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142766.1 protein_id gnl|my_center|LOCUS_15600 5085 4147 gene locus_tag LOCUS_15610 gene ppk2 5085 4147 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460167.1 protein_id gnl|my_center|LOCUS_15610 <6610 5716 gene locus_tag LOCUS_15620 <6610 5716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403232.1:M20 family metallopeptidase >Feature sequence0224 2189 321 gene locus_tag LOCUS_15630 2189 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2815 3540 gene locus_tag LOCUS_15640 2815 3540 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288806.1 protein_id gnl|my_center|LOCUS_15640 3583 4704 gene locus_tag LOCUS_15650 3583 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 4832 5416 gene locus_tag LOCUS_15660 gene def 4832 5416 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124236.1 protein_id gnl|my_center|LOCUS_15660 6242 5400 gene locus_tag LOCUS_15670 6242 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence0225 <1 1729 gene locus_tag LOCUS_15680 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929065.1:DNA helicase RecQ 1704 1949 gene locus_tag LOCUS_15690 1704 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3185 1893 gene locus_tag LOCUS_15700 3185 1893 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_15700 3480 4460 gene locus_tag LOCUS_15710 3480 4460 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_15710 4469 5515 gene locus_tag LOCUS_15720 4469 5515 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence0226 3127 938 gene locus_tag LOCUS_15730 3127 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence0227 486 1643 gene locus_tag LOCUS_15740 486 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2720 1650 gene locus_tag LOCUS_15750 2720 1650 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_15750 2783 3877 gene locus_tag LOCUS_15760 gene proB 2783 3877 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_15760 3910 4590 gene locus_tag LOCUS_15770 3910 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4837 5946 gene locus_tag LOCUS_15780 4837 5946 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_15780 <6549 5986 gene locus_tag LOCUS_15790 <6549 5986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584135.1:serine/threonine-protein kinase >Feature sequence0228 1732 1232 gene locus_tag LOCUS_15800 1732 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2211 3587 gene locus_tag LOCUS_15810 2211 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_15810 3936 3544 gene locus_tag LOCUS_15820 3936 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3953 4144 gene locus_tag LOCUS_15830 3953 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4708 4935 gene locus_tag LOCUS_15840 4708 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4932 5222 gene locus_tag LOCUS_15850 4932 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence0229 5423 3405 gene locus_tag LOCUS_15860 5423 3405 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence0230 <1 746 gene locus_tag LOCUS_15870 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942438.1:XTP/dITP diphosphatase 771 1295 gene locus_tag LOCUS_15880 771 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1601 1176 gene locus_tag LOCUS_15890 1601 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2882 1680 gene locus_tag LOCUS_15900 2882 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 <6520 2940 gene locus_tag LOCUS_15910 <6520 2940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105494.1:ATP-dependent RNA helicase HrpA >Feature sequence0231 619 1674 gene locus_tag LOCUS_15920 gene rsmH 619 1674 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_15920 2354 1671 gene locus_tag LOCUS_15930 2354 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15930 2842 2351 gene locus_tag LOCUS_15940 2842 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15940 3330 3001 gene locus_tag LOCUS_15950 3330 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 3586 5100 gene locus_tag LOCUS_15960 gene istA 3586 5100 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_15960 5090 5848 gene locus_tag LOCUS_15970 gene istB 5090 5848 CDS product IS21-like element ISBj11 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018270204.1 protein_id gnl|my_center|LOCUS_15970 6277 6486 gene locus_tag LOCUS_15980 6277 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence0232 1859 825 gene locus_tag LOCUS_15990 gene hemE 1859 825 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403024.1 protein_id gnl|my_center|LOCUS_15990 2209 3174 gene locus_tag LOCUS_16000 gene xerC 2209 3174 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_16000 4255 3623 gene locus_tag LOCUS_16010 4255 3623 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392046.1 protein_id gnl|my_center|LOCUS_16010 4510 5226 gene locus_tag LOCUS_16020 4510 5226 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence0233 2186 309 gene locus_tag LOCUS_16030 2186 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2283 3425 gene locus_tag LOCUS_16040 2283 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 4184 3465 gene locus_tag LOCUS_16050 4184 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 5856 4189 gene locus_tag LOCUS_16060 5856 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6487 5984 gene locus_tag LOCUS_16070 6487 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0234 1019 2032 gene locus_tag LOCUS_16080 1019 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117899.1 protein_id gnl|my_center|LOCUS_16080 2883 2056 gene locus_tag LOCUS_16090 2883 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3979 2954 gene locus_tag LOCUS_16100 gene ilvC 3979 2954 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880791.1 protein_id gnl|my_center|LOCUS_16100 4508 4035 gene locus_tag LOCUS_16110 gene ilvN 4508 4035 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_16110 4792 5787 gene locus_tag LOCUS_16120 4792 5787 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704979.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence0235 1100 282 gene locus_tag LOCUS_16130 1100 282 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396453.1 protein_id gnl|my_center|LOCUS_16130 2109 1216 gene locus_tag LOCUS_16140 2109 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3054 2299 gene locus_tag LOCUS_16150 3054 2299 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_16150 3563 4888 gene locus_tag LOCUS_16160 3563 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5100 5876 gene locus_tag LOCUS_16170 5100 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence0236 35 907 gene locus_tag LOCUS_16180 35 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1718 930 gene locus_tag LOCUS_16190 1718 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1850 3043 gene locus_tag LOCUS_16200 1850 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 4629 3118 gene locus_tag LOCUS_16210 4629 3118 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937338.1 protein_id gnl|my_center|LOCUS_16210 4783 6255 gene locus_tag LOCUS_16220 4783 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence0237 <1 521 gene locus_tag LOCUS_16230 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140268.1:efflux RND transporter permease subunit 525 1955 gene locus_tag LOCUS_16240 525 1955 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 protein_id gnl|my_center|LOCUS_16240 3369 2026 gene locus_tag LOCUS_16250 3369 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4905 3421 gene locus_tag LOCUS_16260 4905 3421 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_16260 5912 4920 gene locus_tag LOCUS_16270 5912 4920 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392149.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence0238 1313 219 gene locus_tag LOCUS_16280 1313 219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_16280 2821 1331 gene locus_tag LOCUS_16290 2821 1331 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_16290 3934 2942 gene locus_tag LOCUS_16300 3934 2942 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_16300 5625 4225 gene locus_tag LOCUS_16310 5625 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 6359 5622 gene locus_tag LOCUS_16320 6359 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence0239 507 1457 gene locus_tag LOCUS_16330 507 1457 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_16330 2792 1590 gene locus_tag LOCUS_16340 2792 1590 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772618.1 protein_id gnl|my_center|LOCUS_16340 2892 3065 gene locus_tag LOCUS_16350 2892 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4236 3037 gene locus_tag LOCUS_16360 gene lpxB 4236 3037 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_16360 5237 4254 gene locus_tag LOCUS_16370 5237 4254 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence0240 387 1109 gene locus_tag LOCUS_16380 387 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1129 1668 gene locus_tag LOCUS_16390 1129 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3165 1681 gene locus_tag LOCUS_16400 3165 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4579 3152 gene locus_tag LOCUS_16410 4579 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5663 4653 gene locus_tag LOCUS_16420 5663 4653 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence0241 <1 2423 gene locus_tag LOCUS_16430 <1 2423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence0242 <1 546 gene locus_tag LOCUS_16440 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392074.1:rod shape-determining protein 588 1409 gene locus_tag LOCUS_16450 gene mreC 588 1409 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 protein_id gnl|my_center|LOCUS_16450 1409 1963 gene locus_tag LOCUS_16460 1409 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1967 3916 gene locus_tag LOCUS_16470 gene mrdA 1967 3916 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919420.1 protein_id gnl|my_center|LOCUS_16470 3933 5183 gene locus_tag LOCUS_16480 gene rodA 3933 5183 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence0243 1274 423 gene locus_tag LOCUS_16490 1274 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2349 1330 gene locus_tag LOCUS_16500 gene iolG 2349 1330 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_16500 3286 2360 gene locus_tag LOCUS_16510 gene iolE 3286 2360 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192432.1 protein_id gnl|my_center|LOCUS_16510 4814 3330 gene locus_tag LOCUS_16520 4814 3330 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_16520 <6354 4914 gene locus_tag LOCUS_16530 <6354 4914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729994.1:3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) >Feature sequence0244 1550 513 gene locus_tag LOCUS_16540 1550 513 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 protein_id gnl|my_center|LOCUS_16540 1714 2559 gene locus_tag LOCUS_16550 1714 2559 CDS product ATP-grasp domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265999.1 protein_id gnl|my_center|LOCUS_16550 3348 2587 gene locus_tag LOCUS_16560 3348 2587 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973118.1 protein_id gnl|my_center|LOCUS_16560 3863 3345 gene locus_tag LOCUS_16570 3863 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 <6340 4240 gene locus_tag LOCUS_16580 <6340 4240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922073.1:VWA domain-containing protein >Feature sequence0245 352 1065 gene locus_tag LOCUS_16590 352 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1143 2639 gene locus_tag LOCUS_16600 1143 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2620 3306 gene locus_tag LOCUS_16610 2620 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3303 3713 gene locus_tag LOCUS_16620 3303 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3735 4394 gene locus_tag LOCUS_16630 3735 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4462 5925 gene locus_tag LOCUS_16640 4462 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence0246 478 810 gene locus_tag LOCUS_16650 478 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2603 879 gene locus_tag LOCUS_16660 2603 879 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_16660 4348 2600 gene locus_tag LOCUS_16670 4348 2600 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330113.1 protein_id gnl|my_center|LOCUS_16670 5529 4345 gene locus_tag LOCUS_16680 5529 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence0247 136 2079 gene locus_tag LOCUS_16690 136 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2220 3407 gene locus_tag LOCUS_16700 2220 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence0248 >Feature sequence0249 1252 881 gene locus_tag LOCUS_16710 1252 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2932 1277 gene locus_tag LOCUS_16720 2932 1277 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_16720 4965 2929 gene locus_tag LOCUS_16730 4965 2929 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_16730 5544 5344 gene locus_tag LOCUS_16740 5544 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence0250 1387 956 gene locus_tag LOCUS_16750 1387 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2058 1444 gene locus_tag LOCUS_16760 2058 1444 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_16760 2156 4930 gene locus_tag LOCUS_16770 gene glnD 2156 4930 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_16770 4971 5546 gene locus_tag LOCUS_16780 4971 5546 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence0251 3402 1726 gene locus_tag LOCUS_16790 3402 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 3709 4314 gene locus_tag LOCUS_16800 3709 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4624 5286 gene locus_tag LOCUS_16810 4624 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence0252 1406 3 gene locus_tag LOCUS_16820 1406 3 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_16820 4667 1500 gene locus_tag LOCUS_16830 4667 1500 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_16830 4913 5365 gene locus_tag LOCUS_16840 gene dtd 4913 5365 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_16840 5650 5411 gene locus_tag LOCUS_16850 5650 5411 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390667.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence0253 559 1428 gene locus_tag LOCUS_16860 559 1428 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812797.1 protein_id gnl|my_center|LOCUS_16860 1495 1971 gene locus_tag LOCUS_16870 1495 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 1959 2213 gene locus_tag LOCUS_16880 1959 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2409 3092 gene locus_tag LOCUS_16890 2409 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 <6184 3239 gene locus_tag LOCUS_16900 <6184 3239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123898.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence0254 1477 644 gene locus_tag LOCUS_16910 1477 644 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_16910 2660 1515 gene locus_tag LOCUS_16920 2660 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4135 2657 gene locus_tag LOCUS_16930 4135 2657 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257358.1 protein_id gnl|my_center|LOCUS_16930 4258 5673 gene locus_tag LOCUS_16940 4258 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5674 6075 gene locus_tag LOCUS_16950 5674 6075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence0255 <1 1557 gene locus_tag LOCUS_16960 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001969726.1:sodium-dependent transporter 1554 1706 gene locus_tag LOCUS_16970 1554 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3872 1722 gene locus_tag LOCUS_16980 3872 1722 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 protein_id gnl|my_center|LOCUS_16980 <6170 3899 gene locus_tag LOCUS_16990 <6170 3899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081461260.1:PAS domain S-box protein >Feature sequence0256 2124 1276 gene locus_tag LOCUS_17000 2124 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2266 3321 gene locus_tag LOCUS_17010 2266 3321 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_17010 3800 3387 gene locus_tag LOCUS_17020 3800 3387 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_17020 4074 5108 gene locus_tag LOCUS_17030 4074 5108 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329644.1 protein_id gnl|my_center|LOCUS_17030 5105 6121 gene locus_tag LOCUS_17040 5105 6121 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence0257 281 1915 gene locus_tag LOCUS_17050 281 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1932 3317 gene locus_tag LOCUS_17060 1932 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence0258 306 1316 gene locus_tag LOCUS_17070 306 1316 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_17070 3497 1341 gene locus_tag LOCUS_17080 gene ppk1 3497 1341 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521820.1 protein_id gnl|my_center|LOCUS_17080 3745 3545 gene locus_tag LOCUS_17090 3745 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 3897 4166 gene locus_tag LOCUS_17100 3897 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4172 4984 gene locus_tag LOCUS_17110 4172 4984 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence0259 1331 99 gene locus_tag LOCUS_17120 1331 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2114 1362 gene locus_tag LOCUS_17130 2114 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 <6110 2122 gene locus_tag LOCUS_17140 <6110 2122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031052.1:BREX system serine/threonine kinase PglW >Feature sequence0260 <1 1287 gene locus_tag LOCUS_17150 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193427755.1:DUF1549 and DUF1553 domain-containing protein 1338 2795 gene locus_tag LOCUS_17160 1338 2795 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666043.1 protein_id gnl|my_center|LOCUS_17160 3225 2977 gene locus_tag LOCUS_17170 3225 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3451 5118 gene locus_tag LOCUS_17180 3451 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0261 1228 53 gene locus_tag LOCUS_17190 1228 53 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836207.1 protein_id gnl|my_center|LOCUS_17190 3024 1270 gene locus_tag LOCUS_17200 3024 1270 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665727.1 protein_id gnl|my_center|LOCUS_17200 3175 3053 gene locus_tag LOCUS_17210 3175 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3183 4790 gene locus_tag LOCUS_17220 3183 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615582.1 protein_id gnl|my_center|LOCUS_17220 5901 4816 gene locus_tag LOCUS_17230 5901 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence0262 731 1471 gene locus_tag LOCUS_17240 731 1471 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_17240 2238 1579 gene locus_tag LOCUS_17250 2238 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 4747 2327 gene locus_tag LOCUS_17260 4747 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 5771 5088 gene locus_tag LOCUS_17270 5771 5088 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460200.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence0263 794 456 gene locus_tag LOCUS_17280 794 456 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_17280 1479 877 gene locus_tag LOCUS_17290 1479 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2035 1457 gene locus_tag LOCUS_17300 2035 1457 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940878.1 protein_id gnl|my_center|LOCUS_17300 3110 2136 gene locus_tag LOCUS_17310 3110 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5339 3270 gene locus_tag LOCUS_17320 5339 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence0264 1205 174 gene locus_tag LOCUS_17330 1205 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1340 2770 gene locus_tag LOCUS_17340 1340 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 2776 5508 gene locus_tag LOCUS_17350 2776 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 <6051 5516 gene locus_tag LOCUS_17360 <6051 5516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:type I polyketide synthase >Feature sequence0265 638 2350 gene locus_tag LOCUS_17370 638 2350 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_17370 2479 2916 gene locus_tag LOCUS_17380 2479 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3098 3580 gene locus_tag LOCUS_17390 3098 3580 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_17390 3577 5055 gene locus_tag LOCUS_17400 3577 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4964 5758 gene locus_tag LOCUS_17410 4964 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence0266 4786 2798 gene locus_tag LOCUS_17420 4786 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5841 4783 gene locus_tag LOCUS_17430 5841 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0267 1 1026 gene locus_tag LOCUS_17440 gene vmeC 1 1026 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 protein_id gnl|my_center|LOCUS_17440 1053 4253 gene locus_tag LOCUS_17450 1053 4253 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_17450 5042 4275 gene locus_tag LOCUS_17460 5042 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 <6012 5078 gene locus_tag LOCUS_17470 <6012 5078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000635999.1:family 10 glycosylhydrolase >Feature sequence0268 1751 927 gene locus_tag LOCUS_17480 1751 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2375 3691 gene locus_tag LOCUS_17490 2375 3691 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_17490 4862 3834 gene locus_tag LOCUS_17500 4862 3834 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887947.1 protein_id gnl|my_center|LOCUS_17500 5675 4884 gene locus_tag LOCUS_17510 5675 4884 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228542.1 protein_id gnl|my_center|LOCUS_17510 5986 5672 gene locus_tag LOCUS_17520 5986 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence0269 268 1824 gene locus_tag LOCUS_17530 268 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1843 2025 gene locus_tag LOCUS_17540 1843 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2105 2533 gene locus_tag LOCUS_17550 2105 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2588 3463 gene locus_tag LOCUS_17560 gene ispE 2588 3463 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_17560 4465 3458 gene locus_tag LOCUS_17570 4465 3458 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359341.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence0270 3213 46 gene locus_tag LOCUS_17580 3213 46 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_17580 4414 3218 gene locus_tag LOCUS_17590 4414 3218 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence0271 1699 809 gene locus_tag LOCUS_17600 1699 809 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530184.1 protein_id gnl|my_center|LOCUS_17600 3063 1798 gene locus_tag LOCUS_17610 3063 1798 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399072.1 protein_id gnl|my_center|LOCUS_17610 3833 3168 gene locus_tag LOCUS_17620 3833 3168 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_17620 4702 5295 gene locus_tag LOCUS_17630 4702 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence0272 1211 30 gene locus_tag LOCUS_17640 1211 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2225 1302 gene locus_tag LOCUS_17650 2225 1302 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_17650 2502 5078 gene locus_tag LOCUS_17660 2502 5078 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence0273 3171 430 gene locus_tag LOCUS_17670 3171 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 4776 3328 gene locus_tag LOCUS_17680 4776 3328 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_17680 <5949 4898 gene locus_tag LOCUS_17690 <5949 4898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118122.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0274 496 1260 gene locus_tag LOCUS_17700 496 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1267 2514 gene locus_tag LOCUS_17710 1267 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3082 2522 gene locus_tag LOCUS_17720 3082 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 5855 3705 gene locus_tag LOCUS_17730 5855 3705 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404730.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence0275 99 1007 gene locus_tag LOCUS_17740 99 1007 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259034.1 protein_id gnl|my_center|LOCUS_17740 1200 3533 gene locus_tag LOCUS_17750 1200 3533 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 protein_id gnl|my_center|LOCUS_17750 3647 4486 gene locus_tag LOCUS_17760 gene fdhD 3647 4486 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084892.1 protein_id gnl|my_center|LOCUS_17760 4911 4501 gene locus_tag LOCUS_17770 4911 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5178 4918 gene locus_tag LOCUS_17780 5178 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5658 5266 gene locus_tag LOCUS_17790 gene apaG 5658 5266 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383338.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence0276 <1 708 gene locus_tag LOCUS_17800 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056920.1:A/G-specific adenine glycosylase 1598 717 gene locus_tag LOCUS_17810 1598 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2411 1632 gene locus_tag LOCUS_17820 2411 1632 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035441.1 protein_id gnl|my_center|LOCUS_17820 4927 2459 gene locus_tag LOCUS_17830 4927 2459 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942301.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence0277 <5910 5354 gene locus_tag LOCUS_17840 <5910 5354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326676.1:DUF1501 domain-containing protein >Feature sequence0278 >Feature sequence0279 578 2233 gene locus_tag LOCUS_17850 578 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2319 2597 gene locus_tag LOCUS_17860 2319 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2885 4999 gene locus_tag LOCUS_17870 2885 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 <5906 5087 gene locus_tag LOCUS_17880 <5906 5087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943853.1:ribonuclease G >Feature sequence0280 1031 285 gene locus_tag LOCUS_17890 1031 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1942 1409 gene locus_tag LOCUS_17900 1942 1409 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207970.1 protein_id gnl|my_center|LOCUS_17900 2545 1973 gene locus_tag LOCUS_17910 gene pgsA 2545 1973 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_17910 4139 2574 gene locus_tag LOCUS_17920 gene rimO 4139 2574 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_17920 4285 5607 gene locus_tag LOCUS_17930 4285 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence0281 4081 3869 gene locus_tag LOCUS_17940 4081 3869 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_17940 4771 4406 gene locus_tag LOCUS_17950 4771 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4988 4776 gene locus_tag LOCUS_17960 4988 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence0282 633 875 gene locus_tag LOCUS_17970 633 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 912 2162 gene locus_tag LOCUS_17980 912 2162 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_17980 2159 2959 gene locus_tag LOCUS_17990 2159 2959 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_17990 <5879 3036 gene locus_tag LOCUS_18000 <5879 3036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118002.1:serine/threonine-protein kinase >Feature sequence0283 2102 12 gene locus_tag LOCUS_18010 2102 12 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_18010 3028 2111 gene locus_tag LOCUS_18020 3028 2111 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_18020 3895 3122 gene locus_tag LOCUS_18030 gene mip 3895 3122 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_18030 5341 4082 gene locus_tag LOCUS_18040 5341 4082 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence0284 <1 1726 gene locus_tag LOCUS_18050 <1 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096675.1:glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase 1738 2340 gene locus_tag LOCUS_18060 1738 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2417 4087 gene locus_tag LOCUS_18070 2417 4087 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197709.1 protein_id gnl|my_center|LOCUS_18070 4128 5423 gene locus_tag LOCUS_18080 4128 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence0285 4484 2166 gene locus_tag LOCUS_18090 4484 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4617 5705 gene locus_tag LOCUS_18100 4617 5705 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence0286 4753 5550 gene locus_tag LOCUS_18110 4753 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence0287 <1 791 gene locus_tag LOCUS_18120 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005449968.1:TRAP transporter substrate-binding protein 798 1310 gene locus_tag LOCUS_18130 798 1310 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091409.1 protein_id gnl|my_center|LOCUS_18130 1307 2611 gene locus_tag LOCUS_18140 1307 2611 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_18140 2899 4440 gene locus_tag LOCUS_18150 2899 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4476 4721 gene locus_tag LOCUS_18160 4476 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4731 5213 gene locus_tag LOCUS_18170 4731 5213 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_18170 >Feature sequence0288 297 2645 gene locus_tag LOCUS_18180 gene purL 297 2645 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142111.1 protein_id gnl|my_center|LOCUS_18180 2576 4105 gene locus_tag LOCUS_18190 gene purF 2576 4105 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_18190 4122 5174 gene locus_tag LOCUS_18200 gene purM 4122 5174 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_18200 5652 5200 gene locus_tag LOCUS_18210 5652 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence0289 691 275 gene locus_tag LOCUS_18220 691 275 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976410.1 protein_id gnl|my_center|LOCUS_18220 992 786 gene locus_tag LOCUS_18230 992 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1583 2581 gene locus_tag LOCUS_18240 1583 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2627 2773 gene locus_tag LOCUS_18250 2627 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2953 3087 gene locus_tag LOCUS_18260 2953 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3237 3998 gene locus_tag LOCUS_18270 3237 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3995 4918 gene locus_tag LOCUS_18280 3995 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5142 5708 gene locus_tag LOCUS_18290 5142 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence0290 <1 1025 gene locus_tag LOCUS_18300 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001034325.1:ABC transporter ATP-binding protein 1022 1984 gene locus_tag LOCUS_18310 1022 1984 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_18310 3578 2115 gene locus_tag LOCUS_18320 3578 2115 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_18320 <5794 3575 gene locus_tag LOCUS_18330 <5794 3575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:DUF1553 domain-containing protein >Feature sequence0291 937 128 gene locus_tag LOCUS_18340 937 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1263 2627 gene locus_tag LOCUS_18350 gene hpnH 1263 2627 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_18350 3339 2593 gene locus_tag LOCUS_18360 3339 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4367 3336 gene locus_tag LOCUS_18370 4367 3336 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence0292 934 1152 gene locus_tag LOCUS_18380 gene infA 934 1152 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_18380 1371 2393 gene locus_tag LOCUS_18390 1371 2393 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_18390 2414 4510 gene locus_tag LOCUS_18400 2414 4510 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099653.1 protein_id gnl|my_center|LOCUS_18400 <5764 4516 gene locus_tag LOCUS_18410 <5764 4516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119585.1:DPP IV N-terminal domain-containing protein >Feature sequence0293 281 1519 gene locus_tag LOCUS_18420 281 1519 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_18420 1560 2276 gene locus_tag LOCUS_18430 1560 2276 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_18430 2273 3316 gene locus_tag LOCUS_18440 2273 3316 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921854.1 protein_id gnl|my_center|LOCUS_18440 3363 4262 gene locus_tag LOCUS_18450 3363 4262 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_18450 <5751 4263 gene locus_tag LOCUS_18460 <5751 4263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008663661.1:Nramp family divalent metal transporter >Feature sequence0294 <1 1425 gene locus_tag LOCUS_18470 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933331.1:DNA polymerase I 2345 1545 gene locus_tag LOCUS_18480 gene istB 2345 1545 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_18480 3954 2377 gene locus_tag LOCUS_18490 3954 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence0295 <1 3450 gene locus_tag LOCUS_18500 <1 3450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118002.1:serine/threonine-protein kinase 3631 4188 gene locus_tag LOCUS_18510 3631 4188 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence0296 1626 349 gene locus_tag LOCUS_18520 1626 349 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 protein_id gnl|my_center|LOCUS_18520 2148 1636 gene locus_tag LOCUS_18530 2148 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 3189 2161 gene locus_tag LOCUS_18540 3189 2161 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_18540 4074 3208 gene locus_tag LOCUS_18550 4074 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4986 4096 gene locus_tag LOCUS_18560 4986 4096 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528721.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence0297 3708 550 gene locus_tag LOCUS_18570 3708 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4869 3955 gene locus_tag LOCUS_18580 4869 3955 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_18580 5479 4892 gene locus_tag LOCUS_18590 5479 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0298 442 843 gene locus_tag LOCUS_18600 gene raiA 442 843 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 protein_id gnl|my_center|LOCUS_18600 982 2229 gene locus_tag LOCUS_18610 982 2229 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_18610 2226 3455 gene locus_tag LOCUS_18620 gene bioF 2226 3455 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_18620 3542 4363 gene locus_tag LOCUS_18630 3542 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5011 4835 gene locus_tag LOCUS_18640 5011 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence0299 4024 2111 gene locus_tag LOCUS_18650 4024 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 5363 4056 gene locus_tag LOCUS_18660 5363 4056 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942782.1 protein_id gnl|my_center|LOCUS_18660 5399 5647 gene locus_tag LOCUS_18670 5399 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence0300 4737 3898 gene locus_tag LOCUS_18680 4737 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence0301 <1 1683 gene locus_tag LOCUS_18690 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944073.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 1983 2414 gene locus_tag LOCUS_18700 gene perR 1983 2414 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110007.1 protein_id gnl|my_center|LOCUS_18700 2472 3920 gene locus_tag LOCUS_18710 gene sufB 2472 3920 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_18710 4011 4781 gene locus_tag LOCUS_18720 gene sufC 4011 4781 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence0302 <1 1020 gene locus_tag LOCUS_18730 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184173497.1:VCBS repeat-containing protein 2650 1127 gene locus_tag LOCUS_18740 gene cobA 2650 1127 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_18740 3888 2917 gene locus_tag LOCUS_18750 3888 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 4659 4276 gene locus_tag LOCUS_18760 4659 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 5239 4979 gene locus_tag LOCUS_18770 5239 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence0303 2429 1260 gene locus_tag LOCUS_18780 2429 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4002 2434 gene locus_tag LOCUS_18790 4002 2434 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_238581565.1 protein_id gnl|my_center|LOCUS_18790 4449 4066 gene locus_tag LOCUS_18800 4449 4066 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081498.1 protein_id gnl|my_center|LOCUS_18800 <5613 4446 gene locus_tag LOCUS_18810 <5613 4446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:SpoIIE family protein phosphatase >Feature sequence0304 667 17 gene locus_tag LOCUS_18820 667 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 837 661 gene locus_tag LOCUS_18830 837 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1331 783 gene locus_tag LOCUS_18840 1331 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18840 1700 1332 gene locus_tag LOCUS_18850 1700 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18850 2170 1697 gene locus_tag LOCUS_18860 2170 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2430 4481 gene locus_tag LOCUS_18870 2430 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 5604 4822 gene locus_tag LOCUS_18880 5604 4822 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence0305 1 432 gene locus_tag LOCUS_18890 1 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 485 1786 gene locus_tag LOCUS_18900 485 1786 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_18900 1806 3440 gene locus_tag LOCUS_18910 1806 3440 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921294.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence0306 1069 347 gene locus_tag LOCUS_18920 1069 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2700 1156 gene locus_tag LOCUS_18930 gene murD 2700 1156 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_18930 3988 2789 gene locus_tag LOCUS_18940 gene mraY 3988 2789 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194370.1 protein_id gnl|my_center|LOCUS_18940 5382 3985 gene locus_tag LOCUS_18950 gene murF 5382 3985 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927184.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence0307 2976 2044 gene locus_tag LOCUS_18960 2976 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3566 2991 gene locus_tag LOCUS_18970 3566 2991 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_18970 4321 3821 gene locus_tag LOCUS_18980 gene rplQ 4321 3821 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975188.1 protein_id gnl|my_center|LOCUS_18980 5320 4334 gene locus_tag LOCUS_18990 5320 4334 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence0308 2171 699 gene locus_tag LOCUS_19000 2171 699 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_19000 3703 2219 gene locus_tag LOCUS_19010 3703 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4709 3885 gene locus_tag LOCUS_19020 4709 3885 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence0309 2005 137 gene locus_tag LOCUS_19030 2005 137 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403141.1 protein_id gnl|my_center|LOCUS_19030 2246 3220 gene locus_tag LOCUS_19040 2246 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3543 4955 gene locus_tag LOCUS_19050 gene cysS 3543 4955 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence0310 752 1564 gene locus_tag LOCUS_19060 752 1564 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_19060 1694 2944 gene locus_tag LOCUS_19070 1694 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4289 3012 gene locus_tag LOCUS_19080 4289 3012 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_19080 4758 5498 gene locus_tag LOCUS_19090 4758 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence0311 457 149 gene locus_tag LOCUS_19100 457 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 716 378 gene locus_tag LOCUS_19110 716 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2304 1459 gene locus_tag LOCUS_19120 2304 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2469 3785 gene locus_tag LOCUS_19130 2469 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 3800 5134 gene locus_tag LOCUS_19140 3800 5134 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence0312 991 587 gene locus_tag LOCUS_19150 991 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1895 993 gene locus_tag LOCUS_19160 gene rsmH 1895 993 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_19160 2474 1947 gene locus_tag LOCUS_19170 2474 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2982 2479 gene locus_tag LOCUS_19180 2982 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 3267 4388 gene locus_tag LOCUS_19190 gene queA 3267 4388 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_19190 4455 5192 gene locus_tag LOCUS_19200 4455 5192 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence0313 497 1417 gene locus_tag LOCUS_19210 497 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19210 1418 1855 gene locus_tag LOCUS_19220 gene ruvX 1418 1855 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_19220 1858 2658 gene locus_tag LOCUS_19230 gene truA 1858 2658 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_19230 2655 3164 gene locus_tag LOCUS_19240 gene trmL 2655 3164 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_19240 3218 3955 gene locus_tag LOCUS_19250 3218 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence0314 261 632 gene locus_tag LOCUS_19260 gene rplT 261 632 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058700.1 protein_id gnl|my_center|LOCUS_19260 701 1735 gene locus_tag LOCUS_19270 gene pheS 701 1735 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_19270 1737 4214 gene locus_tag LOCUS_19280 gene pheT 1737 4214 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_19280 <5481 4340 gene locus_tag LOCUS_19290 <5481 4340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein >Feature sequence0315 1792 845 gene locus_tag LOCUS_19300 1792 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1962 3965 gene locus_tag LOCUS_19310 1962 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4016 4663 gene locus_tag LOCUS_19320 4016 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence0316 1035 1595 gene locus_tag LOCUS_19330 1035 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 1629 2735 gene locus_tag LOCUS_19340 gene recF 1629 2735 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266662.1 protein_id gnl|my_center|LOCUS_19340 2796 4328 gene locus_tag LOCUS_19350 2796 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19350 4240 4662 gene locus_tag LOCUS_19360 4240 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5063 4680 gene locus_tag LOCUS_19370 5063 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence0317 323 4498 gene locus_tag LOCUS_19380 323 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 4694 5350 gene locus_tag LOCUS_19390 4694 5350 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence0318 1116 166 gene locus_tag LOCUS_19400 1116 166 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258797.1 protein_id gnl|my_center|LOCUS_19400 2393 1266 gene locus_tag LOCUS_19410 gene rho 2393 1266 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_19410 3627 2587 gene locus_tag LOCUS_19420 3627 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5067 3673 gene locus_tag LOCUS_19430 5067 3673 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence0319 4065 1054 gene locus_tag LOCUS_19440 4065 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 5307 4147 gene locus_tag LOCUS_19450 5307 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence0320 <1 677 gene locus_tag LOCUS_19460 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083850.1:DUF3369 domain-containing protein 687 2084 gene locus_tag LOCUS_19470 gene algB 687 2084 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_19470 2790 2326 gene locus_tag LOCUS_19480 2790 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3431 3928 gene locus_tag LOCUS_19490 3431 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 4147 5184 gene locus_tag LOCUS_19500 4147 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence0321 265 1248 gene locus_tag LOCUS_19510 gene cysK 265 1248 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_19510 1391 2629 gene locus_tag LOCUS_19520 1391 2629 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_19520 2754 3647 gene locus_tag LOCUS_19530 2754 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4622 3684 gene locus_tag LOCUS_19540 4622 3684 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_19540 5155 4619 gene locus_tag LOCUS_19550 gene pyrR 5155 4619 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence0322 305 520 gene locus_tag LOCUS_19560 305 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2413 1151 gene locus_tag LOCUS_19570 2413 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3062 2514 gene locus_tag LOCUS_19580 3062 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 3590 4948 gene locus_tag LOCUS_19590 gene ffh 3590 4948 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence0323 127 1002 gene locus_tag LOCUS_19600 127 1002 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176762490.1 protein_id gnl|my_center|LOCUS_19600 999 2396 gene locus_tag LOCUS_19610 999 2396 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_19610 2608 3708 gene locus_tag LOCUS_19620 2608 3708 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922070.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence0324 125 1015 gene locus_tag LOCUS_19630 125 1015 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_19630 1080 2000 gene locus_tag LOCUS_19640 gene xerD 1080 2000 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294386.1 protein_id gnl|my_center|LOCUS_19640 2190 2684 gene locus_tag LOCUS_19650 2190 2684 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_19650 <5408 2676 gene locus_tag LOCUS_19660 <5408 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616068.1:UTP--glucose-1-phosphate uridylyltransferase >Feature sequence0325 1287 34 gene locus_tag LOCUS_19670 1287 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1627 2652 gene locus_tag LOCUS_19680 1627 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3212 2775 gene locus_tag LOCUS_19690 3212 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3491 4411 gene locus_tag LOCUS_19700 3491 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 <5397 4416 gene locus_tag LOCUS_19710 <5397 4416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_098074942.1:DUF4097 family beta strand repeat-containing protein >Feature sequence0326 760 2616 gene locus_tag LOCUS_19720 760 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 4022 2892 gene locus_tag LOCUS_19730 4022 2892 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_19730 4858 4049 gene locus_tag LOCUS_19740 gene trpA 4858 4049 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_19740 <5371 4855 gene locus_tag LOCUS_19750 <5371 4855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000578368.1:type III pantothenate kinase >Feature sequence0327 764 351 gene locus_tag LOCUS_19760 764 351 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923289.1 protein_id gnl|my_center|LOCUS_19760 1242 2666 gene locus_tag LOCUS_19770 1242 2666 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence0328 551 1651 gene locus_tag LOCUS_19780 551 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2550 1654 gene locus_tag LOCUS_19790 2550 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3505 2783 gene locus_tag LOCUS_19800 3505 2783 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_19800 3806 3528 gene locus_tag LOCUS_19810 3806 3528 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_19810 4126 5001 gene locus_tag LOCUS_19820 4126 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence0329 1859 270 gene locus_tag LOCUS_19830 1859 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2379 1927 gene locus_tag LOCUS_19840 2379 1927 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_19840 2721 2383 gene locus_tag LOCUS_19850 2721 2383 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_19850 3617 2793 gene locus_tag LOCUS_19860 3617 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 4086 3826 gene locus_tag LOCUS_19870 4086 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4803 4261 gene locus_tag LOCUS_19880 4803 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 5211 4942 gene locus_tag LOCUS_19890 5211 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence0330 1482 172 gene locus_tag LOCUS_19900 1482 172 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_19900 1666 3243 gene locus_tag LOCUS_19910 1666 3243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339547.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence0331 253 903 gene locus_tag LOCUS_19920 253 903 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098375.1 protein_id gnl|my_center|LOCUS_19920 1961 924 gene locus_tag LOCUS_19930 gene cytR 1961 924 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_19930 2863 1964 gene locus_tag LOCUS_19940 2863 1964 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_19940 3605 2847 gene locus_tag LOCUS_19950 3605 2847 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_19950 4073 3606 gene locus_tag LOCUS_19960 4073 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 5268 4108 gene locus_tag LOCUS_19970 5268 4108 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence0332 3663 547 gene locus_tag LOCUS_19980 3663 547 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_19980 3848 4783 gene locus_tag LOCUS_19990 3848 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 5198 4800 gene locus_tag LOCUS_20000 5198 4800 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence0333 386 2080 gene locus_tag LOCUS_20010 386 2080 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_20010 3907 2087 gene locus_tag LOCUS_20020 3907 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence0334 >Feature sequence0335 1687 245 gene locus_tag LOCUS_20030 1687 245 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_20030 4012 1748 gene locus_tag LOCUS_20040 4012 1748 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence0336 1248 211 gene locus_tag LOCUS_20050 1248 211 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408248.1 protein_id gnl|my_center|LOCUS_20050 2283 1267 gene locus_tag LOCUS_20060 2283 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2927 2280 gene locus_tag LOCUS_20070 2927 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 5062 3116 gene locus_tag LOCUS_20080 5062 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence0337 38 235 gene locus_tag LOCUS_20090 gene rpsU 38 235 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357777.1 protein_id gnl|my_center|LOCUS_20090 355 1215 gene locus_tag LOCUS_20100 355 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 1212 2321 gene locus_tag LOCUS_20110 1212 2321 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121174.1 protein_id gnl|my_center|LOCUS_20110 2447 3892 gene locus_tag LOCUS_20120 2447 3892 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937421.1 protein_id gnl|my_center|LOCUS_20120 4115 5071 gene locus_tag LOCUS_20130 gene atpB 4115 5071 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258899.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence0338 401 3655 gene locus_tag LOCUS_20140 401 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3652 5025 gene locus_tag LOCUS_20150 3652 5025 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123538.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence0339 1213 341 gene locus_tag LOCUS_20160 1213 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1957 1217 gene locus_tag LOCUS_20170 gene istB 1957 1217 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_20170 3452 1950 gene locus_tag LOCUS_20180 gene istA 3452 1950 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392192.1 protein_id gnl|my_center|LOCUS_20180 4329 3430 gene locus_tag LOCUS_20190 4329 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 4373 5116 gene locus_tag LOCUS_20200 4373 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence0340 1529 507 gene locus_tag LOCUS_20210 1529 507 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461454.1 protein_id gnl|my_center|LOCUS_20210 2581 1559 gene locus_tag LOCUS_20220 2581 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 3521 2607 gene locus_tag LOCUS_20230 3521 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 4609 3773 gene locus_tag LOCUS_20240 4609 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence0341 265 1548 gene locus_tag LOCUS_20250 265 1548 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_20250 1553 4720 gene locus_tag LOCUS_20260 1553 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence0342 6 1541 gene locus_tag LOCUS_20270 6 1541 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_20270 4354 1574 gene locus_tag LOCUS_20280 4354 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence0343 1602 5153 gene locus_tag LOCUS_20290 1602 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence0344 >Feature sequence0345 747 67 gene locus_tag LOCUS_20300 747 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1574 744 gene locus_tag LOCUS_20310 1574 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20310 1827 1543 gene locus_tag LOCUS_20320 1827 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20320 2236 1817 gene locus_tag LOCUS_20330 2236 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2618 2229 gene locus_tag LOCUS_20340 2618 2229 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_20340 4965 2677 gene locus_tag LOCUS_20350 4965 2677 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence0346 161 565 gene locus_tag LOCUS_20360 161 565 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357588.1 protein_id gnl|my_center|LOCUS_20360 1738 608 gene locus_tag LOCUS_20370 1738 608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_20370 3003 1735 gene locus_tag LOCUS_20380 3003 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3932 3000 gene locus_tag LOCUS_20390 gene lnrL 3932 3000 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_20390 <5182 4006 gene locus_tag LOCUS_20400 <5182 4006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943711.1:DNA primase >Feature sequence0347 28 639 gene locus_tag LOCUS_20410 28 639 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_20410 643 1065 gene locus_tag LOCUS_20420 643 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2115 1087 gene locus_tag LOCUS_20430 gene tsaD 2115 1087 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_20430 3504 2179 gene locus_tag LOCUS_20440 3504 2179 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_20440 4306 3659 gene locus_tag LOCUS_20450 gene ispD 4306 3659 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_20450 <5182 4404 gene locus_tag LOCUS_20460 <5182 4404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921573.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0348 333 713 gene locus_tag LOCUS_20470 333 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 848 1519 gene locus_tag LOCUS_20480 gene pxpB 848 1519 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672280.1 protein_id gnl|my_center|LOCUS_20480 1516 2382 gene locus_tag LOCUS_20490 1516 2382 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249287.1 protein_id gnl|my_center|LOCUS_20490 2410 3126 gene locus_tag LOCUS_20500 2410 3126 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815560.1 protein_id gnl|my_center|LOCUS_20500 4433 3246 gene locus_tag LOCUS_20510 4433 3246 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039960.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence0349 1378 5 gene locus_tag LOCUS_20520 1378 5 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_20520 2435 1707 gene locus_tag LOCUS_20530 2435 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20530 4441 2387 gene locus_tag LOCUS_20540 4441 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 5108 4878 gene locus_tag LOCUS_20550 5108 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence0350 1386 793 gene locus_tag LOCUS_20560 1386 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2681 1470 gene locus_tag LOCUS_20570 2681 1470 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_20570 3319 2678 gene locus_tag LOCUS_20580 3319 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 3933 3319 gene locus_tag LOCUS_20590 3933 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 4344 3967 gene locus_tag LOCUS_20600 gene ndhC 4344 3967 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_20600 4667 4437 gene locus_tag LOCUS_20610 4667 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence0351 1214 573 gene locus_tag LOCUS_20620 1214 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1708 1211 gene locus_tag LOCUS_20630 1708 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2517 1705 gene locus_tag LOCUS_20640 2517 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 4478 2514 gene locus_tag LOCUS_20650 4478 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence0352 3478 629 gene locus_tag LOCUS_20660 3478 629 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_20660 <5119 3773 gene locus_tag LOCUS_20670 <5119 3773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929486.1:FG-GAP-like repeat-containing protein >Feature sequence0353 <1 891 gene locus_tag LOCUS_20680 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005739890.1:ammonium transporter 905 1243 gene locus_tag LOCUS_20690 905 1243 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_20690 2835 1282 gene locus_tag LOCUS_20700 gene pyk 2835 1282 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143313.1 protein_id gnl|my_center|LOCUS_20700 4288 2888 gene locus_tag LOCUS_20710 4288 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence0354 1159 1548 gene locus_tag LOCUS_20720 1159 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1641 3317 gene locus_tag LOCUS_20730 1641 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4509 3340 gene locus_tag LOCUS_20740 4509 3340 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence0355 2336 1017 gene locus_tag LOCUS_20750 2336 1017 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_20750 3408 2356 gene locus_tag LOCUS_20760 3408 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 3754 4119 gene locus_tag LOCUS_20770 3754 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 <5084 4177 gene locus_tag LOCUS_20780 <5084 4177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937318.1:asparagine--tRNA ligase >Feature sequence0356 3857 147 gene locus_tag LOCUS_20790 3857 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence0357 <1 1725 gene locus_tag LOCUS_20800 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_180938057.1:rhodanese-like domain-containing protein 1914 4064 gene locus_tag LOCUS_20810 1914 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 4142 5026 gene locus_tag LOCUS_20820 4142 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence0358 848 393 gene locus_tag LOCUS_20830 848 393 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882790.1 protein_id gnl|my_center|LOCUS_20830 987 1472 gene locus_tag LOCUS_20840 gene rfaE2 987 1472 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142636.1 protein_id gnl|my_center|LOCUS_20840 3034 1631 gene locus_tag LOCUS_20850 3034 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence0359 4381 827 gene locus_tag LOCUS_20860 4381 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence0360 2141 90 gene locus_tag LOCUS_20870 2141 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2863 2207 gene locus_tag LOCUS_20880 2863 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3987 2863 gene locus_tag LOCUS_20890 3987 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 <5041 4161 gene locus_tag LOCUS_20900 <5041 4161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941995.1:LysR family transcriptional regulator >Feature sequence0361 224 3751 gene locus_tag LOCUS_20910 224 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3790 4269 gene locus_tag LOCUS_20920 gene ispF 3790 4269 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_20920 4272 4541 gene locus_tag LOCUS_20930 4272 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence0362 <1 1026 gene locus_tag LOCUS_20940 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003144052.1:aryl-sulfate sulfotransferase 1428 4124 gene locus_tag LOCUS_20950 1428 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence0363 3010 2132 gene locus_tag LOCUS_20960 3010 2132 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837901.1 protein_id gnl|my_center|LOCUS_20960 3500 3273 gene locus_tag LOCUS_20970 3500 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence0364 974 1228 gene locus_tag LOCUS_20980 974 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1339 4419 gene locus_tag LOCUS_20990 1339 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 5028 4459 gene locus_tag LOCUS_21000 5028 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence0365 <1 1019 gene locus_tag LOCUS_21010 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037399469.1:PleD family two-component system response regulator 1527 1030 gene locus_tag LOCUS_21020 1527 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence0366 1746 223 gene locus_tag LOCUS_21030 1746 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2871 1762 gene locus_tag LOCUS_21040 2871 1762 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121284.1 protein_id gnl|my_center|LOCUS_21040 3455 2877 gene locus_tag LOCUS_21050 3455 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 <5023 3473 gene locus_tag LOCUS_21060 <5023 3473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073607.1:M13 family peptidase >Feature sequence0367 <1 3206 gene locus_tag LOCUS_21070 <1 3206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665981.1:TIM barrel protein 3934 3488 gene locus_tag LOCUS_21080 3934 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 4440 4787 gene locus_tag LOCUS_21090 4440 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence0368 250 1908 gene locus_tag LOCUS_21100 250 1908 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_21100 1996 3099 gene locus_tag LOCUS_21110 1996 3099 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_21110 3104 4813 gene locus_tag LOCUS_21120 3104 4813 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_21120 >Feature sequence0369 2 1411 gene locus_tag LOCUS_21130 2 1411 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_21130 1408 2838 gene locus_tag LOCUS_21140 1408 2838 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence0370 173 2086 gene locus_tag LOCUS_21150 173 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3364 2087 gene locus_tag LOCUS_21160 gene eno 3364 2087 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_21160 3587 4492 gene locus_tag LOCUS_21170 3587 4492 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700204.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence0371 362 3436 gene locus_tag LOCUS_21180 362 3436 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118986.1 protein_id gnl|my_center|LOCUS_21180 3429 4868 gene locus_tag LOCUS_21190 3429 4868 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921559.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence0372 222 602 gene locus_tag LOCUS_21200 222 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1833 631 gene locus_tag LOCUS_21210 1833 631 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_21210 3198 2014 gene locus_tag LOCUS_21220 3198 2014 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_21220 3399 3812 gene locus_tag LOCUS_21230 3399 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 4348 3899 gene locus_tag LOCUS_21240 4348 3899 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121094.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence0373 273 4280 gene locus_tag LOCUS_21250 273 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence0374 <1 4374 gene locus_tag LOCUS_21260 <1 4374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223771.1:discoidin domain-containing protein >Feature sequence0375 4449 1963 gene locus_tag LOCUS_21270 4449 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence0376 1533 85 gene locus_tag LOCUS_21280 gene ggt 1533 85 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_21280 1694 3355 gene locus_tag LOCUS_21290 1694 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 3359 4837 gene locus_tag LOCUS_21300 3359 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence0377 405 686 gene locus_tag LOCUS_21310 405 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 832 1281 gene locus_tag LOCUS_21320 832 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1367 1987 gene locus_tag LOCUS_21330 1367 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2490 2188 gene locus_tag LOCUS_21340 2490 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 2750 2487 gene locus_tag LOCUS_21350 2750 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3980 3432 gene locus_tag LOCUS_21360 3980 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 4255 4046 gene locus_tag LOCUS_21370 4255 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4551 4240 gene locus_tag LOCUS_21380 4551 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence0378 439 3768 gene locus_tag LOCUS_21390 439 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 4829 3777 gene locus_tag LOCUS_21400 gene mnmA 4829 3777 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657419.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence0379 <1 887 gene locus_tag LOCUS_21410 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123043.1:terpene cyclase/mutase family protein 1088 1999 gene locus_tag LOCUS_21420 1088 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672702.1 protein_id gnl|my_center|LOCUS_21420 2487 2008 gene locus_tag LOCUS_21430 2487 2008 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_21430 2750 3697 gene locus_tag LOCUS_21440 2750 3697 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 protein_id gnl|my_center|LOCUS_21440 <4952 3694 gene locus_tag LOCUS_21450 <4952 3694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943758.1:isoleucine--tRNA ligase >Feature sequence0380 >Feature sequence0381 940 404 gene locus_tag LOCUS_21460 940 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 1527 2555 gene locus_tag LOCUS_21470 1527 2555 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_21470 2616 3545 gene locus_tag LOCUS_21480 2616 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 3605 4867 gene locus_tag LOCUS_21490 3605 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence0382 234 674 gene locus_tag LOCUS_21500 234 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1406 4222 gene locus_tag LOCUS_21510 1406 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence0383 1763 549 gene locus_tag LOCUS_21520 gene dgoD 1763 549 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_21520 4844 2004 gene locus_tag LOCUS_21530 4844 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence0384 <1 510 gene locus_tag LOCUS_21540 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922160.1:sulfatase 574 1677 gene locus_tag LOCUS_21550 574 1677 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_21550 4046 1770 gene locus_tag LOCUS_21560 4046 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence0385 2726 1428 gene locus_tag LOCUS_21570 2726 1428 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_21570 3592 2741 gene locus_tag LOCUS_21580 3592 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 3984 3589 gene locus_tag LOCUS_21590 3984 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 <4865 4061 gene locus_tag LOCUS_21600 <4865 4061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122599.1:GTP-binding protein >Feature sequence0386 4853 4089 gene locus_tag LOCUS_21610 4853 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence0387 <1 1095 gene locus_tag LOCUS_21620 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392052.1:histidinol-phosphate transaminase 1127 2443 gene locus_tag LOCUS_21630 gene argA 1127 2443 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_21630 2707 3075 gene locus_tag LOCUS_21640 2707 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 3120 4400 gene locus_tag LOCUS_21650 3120 4400 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208002273.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence0388 210 893 gene locus_tag LOCUS_21660 210 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1978 890 gene locus_tag LOCUS_21670 gene mqnC 1978 890 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence0389 <1 915 gene locus_tag LOCUS_21680 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008663784.1:tetratricopeptide repeat protein 2289 931 gene locus_tag LOCUS_21690 2289 931 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_21690 2574 2500 gene locus_tag LOCUS_t00060 2574 2500 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4525 2639 gene locus_tag LOCUS_21700 4525 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0390 269 670 gene locus_tag LOCUS_21710 269 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 703 1344 gene locus_tag LOCUS_21720 703 1344 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_21720 1378 1773 gene locus_tag LOCUS_21730 1378 1773 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_21730 3193 1814 gene locus_tag LOCUS_21740 3193 1814 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_21740 3527 4615 gene locus_tag LOCUS_21750 3527 4615 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence0391 235 1836 gene locus_tag LOCUS_21760 235 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence0392 <1 1155 gene locus_tag LOCUS_21770 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615922.1:ATPase, T2SS/T4P/T4SS family 1159 2391 gene locus_tag LOCUS_21780 1159 2391 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_21780 2402 2866 gene locus_tag LOCUS_21790 gene gspG 2402 2866 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_21790 2884 3528 gene locus_tag LOCUS_21800 2884 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3551 3865 gene locus_tag LOCUS_21810 3551 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence0393 1238 2710 gene locus_tag LOCUS_21820 1238 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3106 3609 gene locus_tag LOCUS_21830 3106 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3699 4196 gene locus_tag LOCUS_21840 3699 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence0394 >Feature sequence0395 1255 365 gene locus_tag LOCUS_21850 1255 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 3064 1397 gene locus_tag LOCUS_21860 3064 1397 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921786.1 protein_id gnl|my_center|LOCUS_21860 3894 3085 gene locus_tag LOCUS_21870 3894 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 <4719 3891 gene locus_tag LOCUS_21880 <4719 3891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545682.1:aspartate kinase >Feature sequence0396 378 1289 gene locus_tag LOCUS_21890 378 1289 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921521.1 protein_id gnl|my_center|LOCUS_21890 1440 1297 gene locus_tag LOCUS_21900 1440 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1733 2305 gene locus_tag LOCUS_21910 1733 2305 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_21910 3700 2321 gene locus_tag LOCUS_21920 3700 2321 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_21920 3887 4645 gene locus_tag LOCUS_21930 3887 4645 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061265.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0397 3405 145 gene locus_tag LOCUS_21940 3405 145 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063831.1 protein_id gnl|my_center|LOCUS_21940 3817 3518 gene locus_tag LOCUS_21950 3817 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 4077 3814 gene locus_tag LOCUS_21960 4077 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 4565 4305 gene locus_tag LOCUS_21970 4565 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence0398 485 1258 gene locus_tag LOCUS_21980 485 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1272 2246 gene locus_tag LOCUS_21990 1272 2246 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_21990 3037 2327 gene locus_tag LOCUS_22000 3037 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence0399 1039 1446 gene locus_tag LOCUS_22010 1039 1446 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769424.1 protein_id gnl|my_center|LOCUS_22010 1552 3057 gene locus_tag LOCUS_22020 1552 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 3054 3887 gene locus_tag LOCUS_22030 3054 3887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948646.1 protein_id gnl|my_center|LOCUS_22030 3890 4210 gene locus_tag LOCUS_22040 3890 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence0400 1633 842 gene locus_tag LOCUS_22050 1633 842 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_22050 2262 1630 gene locus_tag LOCUS_22060 2262 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2455 3300 gene locus_tag LOCUS_22070 2455 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence0401 3556 116 gene locus_tag LOCUS_22080 3556 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 <4671 3636 gene locus_tag LOCUS_22090 <4671 3636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582688.1:glycosyl hydrolase >Feature sequence0402 567 1685 gene locus_tag LOCUS_22100 567 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1832 2929 gene locus_tag LOCUS_22110 1832 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4248 3139 gene locus_tag LOCUS_22120 4248 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence0403 265 2019 gene locus_tag LOCUS_22130 265 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2036 3448 gene locus_tag LOCUS_22140 2036 3448 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921791.1 protein_id gnl|my_center|LOCUS_22140 4381 3461 gene locus_tag LOCUS_22150 4381 3461 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence0404 1990 710 gene locus_tag LOCUS_22160 1990 710 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254437.1 protein_id gnl|my_center|LOCUS_22160 2658 1987 gene locus_tag LOCUS_22170 2658 1987 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532179.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence0405 730 1527 gene locus_tag LOCUS_22180 730 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 >Feature sequence0406 456 2876 gene locus_tag LOCUS_22190 gene lon 456 2876 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_22190 2873 3625 gene locus_tag LOCUS_22200 2873 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3715 4066 gene locus_tag LOCUS_tm00010 3715 4066 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0407 1025 705 gene locus_tag LOCUS_22210 1025 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1470 1108 gene locus_tag LOCUS_22220 1470 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2085 1582 gene locus_tag LOCUS_22230 2085 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2839 2597 gene locus_tag LOCUS_22240 2839 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 3464 3042 gene locus_tag LOCUS_22250 3464 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4071 3577 gene locus_tag LOCUS_22260 4071 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence0408 825 67 gene locus_tag LOCUS_22270 825 67 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227987.1 protein_id gnl|my_center|LOCUS_22270 2164 851 gene locus_tag LOCUS_22280 2164 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2483 4279 gene locus_tag LOCUS_22290 2483 4279 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence0409 314 1633 gene locus_tag LOCUS_22300 314 1633 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123609.1 protein_id gnl|my_center|LOCUS_22300 1731 2717 gene locus_tag LOCUS_22310 1731 2717 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615605.1 protein_id gnl|my_center|LOCUS_22310 2721 4277 gene locus_tag LOCUS_22320 2721 4277 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665541.1 protein_id gnl|my_center|LOCUS_22320 4627 4304 gene locus_tag LOCUS_22330 4627 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence0410 1641 982 gene locus_tag LOCUS_22340 1641 982 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060787.1 protein_id gnl|my_center|LOCUS_22340 1943 1722 gene locus_tag LOCUS_22350 1943 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2345 1956 gene locus_tag LOCUS_22360 2345 1956 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_22360 3997 2462 gene locus_tag LOCUS_22370 gene trpE 3997 2462 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_22370 4555 4010 gene locus_tag LOCUS_22380 4555 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence0411 <1 1353 gene locus_tag LOCUS_22390 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052279167.1:CotH kinase family protein 1530 2888 gene locus_tag LOCUS_22400 1530 2888 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence0412 389 1006 gene locus_tag LOCUS_22410 389 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2006 1008 gene locus_tag LOCUS_22420 gene arsS 2006 1008 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_22420 3148 2021 gene locus_tag LOCUS_22430 3148 2021 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262659.1 protein_id gnl|my_center|LOCUS_22430 4317 3148 gene locus_tag LOCUS_22440 4317 3148 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence0413 619 1317 gene locus_tag LOCUS_22450 gene rncS 619 1317 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_22450 2831 1350 gene locus_tag LOCUS_22460 2831 1350 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_22460 3510 2953 gene locus_tag LOCUS_22470 3510 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 <4608 3507 gene locus_tag LOCUS_22480 <4608 3507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010904125.1:oligopeptide transporter, OPT family >Feature sequence0414 <1 649 gene locus_tag LOCUS_22490 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338989.1:DUF1080 domain-containing protein 1446 2165 gene locus_tag LOCUS_22500 1446 2165 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199379.1 protein_id gnl|my_center|LOCUS_22500 4402 2156 gene locus_tag LOCUS_22510 4402 2156 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence0415 330 1256 gene locus_tag LOCUS_22520 330 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1448 2359 gene locus_tag LOCUS_22530 1448 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2459 4594 gene locus_tag LOCUS_22540 2459 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence0416 605 1798 gene locus_tag LOCUS_22550 605 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1897 2766 gene locus_tag LOCUS_22560 1897 2766 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253110.1 protein_id gnl|my_center|LOCUS_22560 4199 2844 gene locus_tag LOCUS_22570 4199 2844 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence0417 <1 1857 gene locus_tag LOCUS_22580 <1 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942254.1:TolC family protein 2032 2691 gene locus_tag LOCUS_22590 2032 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence0418 1038 205 gene locus_tag LOCUS_22600 1038 205 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_22600 2197 1109 gene locus_tag LOCUS_22610 2197 1109 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_22610 2475 3797 gene locus_tag LOCUS_22620 2475 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_22620 4320 3829 gene locus_tag LOCUS_22630 4320 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence0419 <1 624 gene locus_tag LOCUS_22640 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405133.1:class I SAM-dependent methyltransferase 1886 648 gene locus_tag LOCUS_22650 1886 648 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_22650 2140 2009 gene locus_tag LOCUS_22660 2140 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 4108 3140 gene locus_tag LOCUS_22670 4108 3140 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence0420 1662 343 gene locus_tag LOCUS_22680 1662 343 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764578.1 protein_id gnl|my_center|LOCUS_22680 2886 1888 gene locus_tag LOCUS_22690 2886 1888 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964012.1 protein_id gnl|my_center|LOCUS_22690 <4553 3077 gene locus_tag LOCUS_22700 <4553 3077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173402000.1:arylsulfatase >Feature sequence0421 <1 507 gene locus_tag LOCUS_22710 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004202932.1:membrane protein 2663 924 gene locus_tag LOCUS_22720 2663 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3868 2747 gene locus_tag LOCUS_22730 gene lptG 3868 2747 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_22730 4270 3914 gene locus_tag LOCUS_22740 gene queD 4270 3914 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167265.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence0422 532 729 gene locus_tag LOCUS_22750 532 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 710 1027 gene locus_tag LOCUS_22760 710 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1356 1147 gene locus_tag LOCUS_22770 1356 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1612 1397 gene locus_tag LOCUS_22780 1612 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 protein_id gnl|my_center|LOCUS_22780 3939 2377 gene locus_tag LOCUS_22790 3939 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence0423 76 2640 gene locus_tag LOCUS_22800 76 2640 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615881.1 protein_id gnl|my_center|LOCUS_22800 2643 3296 gene locus_tag LOCUS_22810 2643 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 <4544 3286 gene locus_tag LOCUS_22820 <4544 3286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026198931.1:uroporphyrinogen decarboxylase family protein >Feature sequence0424 1485 2087 gene locus_tag LOCUS_22830 1485 2087 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350872.1 protein_id gnl|my_center|LOCUS_22830 4397 2316 gene locus_tag LOCUS_22840 4397 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence0425 438 1367 gene locus_tag LOCUS_22850 438 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1364 4204 gene locus_tag LOCUS_22860 1364 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence0426 <1 708 gene locus_tag LOCUS_22870 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261371.1:exodeoxyribonuclease VII large subunit 757 1002 gene locus_tag LOCUS_22880 757 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2256 1009 gene locus_tag LOCUS_22890 2256 1009 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_22890 3048 2311 gene locus_tag LOCUS_22900 3048 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4413 3175 gene locus_tag LOCUS_22910 4413 3175 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence0427 1519 629 gene locus_tag LOCUS_22920 1519 629 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_22920 3798 1678 gene locus_tag LOCUS_22930 3798 1678 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_22930 <4525 3876 gene locus_tag LOCUS_22940 <4525 3876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943871.1:NapC/NirT family cytochrome c >Feature sequence0428 1318 986 gene locus_tag LOCUS_22950 1318 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 2174 1836 gene locus_tag LOCUS_22960 2174 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 3197 2562 gene locus_tag LOCUS_22970 3197 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence0429 1524 805 gene locus_tag LOCUS_22980 1524 805 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_22980 4519 1586 gene locus_tag LOCUS_22990 4519 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence0430 <1 1373 gene locus_tag LOCUS_23000 <1 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250564.1:NADH-quinone oxidoreductase subunit NuoF 1376 3013 gene locus_tag LOCUS_23010 1376 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 3508 3122 gene locus_tag LOCUS_23020 3508 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 3527 3814 gene locus_tag LOCUS_23030 3527 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3872 4024 gene locus_tag LOCUS_23040 3872 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence0431 1959 1483 gene locus_tag LOCUS_23050 1959 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 3191 2040 gene locus_tag LOCUS_23060 3191 2040 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_23060 4202 3204 gene locus_tag LOCUS_23070 4202 3204 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence0432 3403 770 gene locus_tag LOCUS_23080 3403 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence0433 3 263 gene locus_tag LOCUS_23090 3 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 351 1463 gene locus_tag LOCUS_23100 gene ribD 351 1463 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_23100 1476 2096 gene locus_tag LOCUS_23110 gene ribE 1476 2096 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493840.1 protein_id gnl|my_center|LOCUS_23110 3972 2185 gene locus_tag LOCUS_23120 3972 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 >Feature sequence0434 344 964 gene locus_tag LOCUS_23130 344 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1085 2545 gene locus_tag LOCUS_23140 1085 2545 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525148.1 protein_id gnl|my_center|LOCUS_23140 2787 3098 gene locus_tag LOCUS_23150 2787 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 3185 4369 gene locus_tag LOCUS_23160 3185 4369 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314635.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence0435 109 654 gene locus_tag LOCUS_23170 109 654 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122524.1 protein_id gnl|my_center|LOCUS_23170 3488 684 gene locus_tag LOCUS_23180 3488 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 3586 4194 gene locus_tag LOCUS_23190 3586 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence0436 1823 243 gene locus_tag LOCUS_23200 gene rny 1823 243 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354863.1 protein_id gnl|my_center|LOCUS_23200 2431 1820 gene locus_tag LOCUS_23210 2431 1820 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817342.1 protein_id gnl|my_center|LOCUS_23210 3819 2428 gene locus_tag LOCUS_23220 3819 2428 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence0437 699 1166 gene locus_tag LOCUS_23230 699 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 1186 1449 gene locus_tag LOCUS_23240 1186 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1514 3322 gene locus_tag LOCUS_23250 1514 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 3926 3486 gene locus_tag LOCUS_23260 3926 3486 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412970.1 protein_id gnl|my_center|LOCUS_23260 4150 3923 gene locus_tag LOCUS_23270 4150 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence0438 1702 449 gene locus_tag LOCUS_23280 1702 449 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_23280 3075 1768 gene locus_tag LOCUS_23290 3075 1768 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_23290 3065 3247 gene locus_tag LOCUS_23300 3065 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence0439 244 420 gene locus_tag LOCUS_23310 244 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 417 620 gene locus_tag LOCUS_23320 417 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 646 981 gene locus_tag LOCUS_23330 646 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 1183 2103 gene locus_tag LOCUS_23340 gene floA 1183 2103 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_23340 2109 2303 gene locus_tag LOCUS_23350 2109 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 3816 2887 gene locus_tag LOCUS_23360 gene rlmF 3816 2887 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097467.1 protein_id gnl|my_center|LOCUS_23360 4128 4343 gene locus_tag LOCUS_23370 4128 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence0440 808 182 gene locus_tag LOCUS_23380 808 182 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_23380 3858 805 gene locus_tag LOCUS_23390 3858 805 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence0441 >Feature sequence0442 1044 43 gene locus_tag LOCUS_23400 1044 43 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_23400 2071 1139 gene locus_tag LOCUS_23410 2071 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 3699 2407 gene locus_tag LOCUS_23420 3699 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence0443 257 913 gene locus_tag LOCUS_23430 257 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2446 1199 gene locus_tag LOCUS_23440 2446 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 <4385 2526 gene locus_tag LOCUS_23450 <4385 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974101.1:gamma-glutamyltransferase >Feature sequence0444 183 1442 gene locus_tag LOCUS_23460 183 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1737 1474 gene locus_tag LOCUS_23470 1737 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2360 3499 gene locus_tag LOCUS_23480 2360 3499 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_23480 3545 4339 gene locus_tag LOCUS_23490 3545 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence0445 >Feature sequence0446 239 613 gene locus_tag LOCUS_23500 239 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23500 570 2213 gene locus_tag LOCUS_23510 570 2213 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23510 >Feature sequence0447 1327 152 gene locus_tag LOCUS_23520 gene cdaA 1327 152 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941532.1 protein_id gnl|my_center|LOCUS_23520 1805 3088 gene locus_tag LOCUS_23530 gene argH 1805 3088 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_23530 3058 4176 gene locus_tag LOCUS_23540 3058 4176 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence0448 3375 478 gene locus_tag LOCUS_23550 3375 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence0449 3514 3750 gene locus_tag LOCUS_23560 3514 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 3735 4304 gene locus_tag LOCUS_23570 3735 4304 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence0450 773 159 gene locus_tag LOCUS_23580 773 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 822 2135 gene locus_tag LOCUS_23590 gene xylA 822 2135 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_23590 4276 2132 gene locus_tag LOCUS_23600 4276 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 >Feature sequence0451 1054 149 gene locus_tag LOCUS_23610 1054 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 3830 1104 gene locus_tag LOCUS_23620 3830 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 4298 3999 gene locus_tag LOCUS_23630 4298 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence0452 1504 1307 gene locus_tag LOCUS_23640 1504 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1849 2682 gene locus_tag LOCUS_23650 1849 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4000 2765 gene locus_tag LOCUS_23660 4000 2765 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942736.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence0453 122 523 gene locus_tag LOCUS_23670 122 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 1149 3533 gene locus_tag LOCUS_23680 1149 3533 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668005.1 protein_id gnl|my_center|LOCUS_23680 3542 4111 gene locus_tag LOCUS_23690 3542 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence0454 4261 1829 gene locus_tag LOCUS_23700 4261 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence0455 1178 186 gene locus_tag LOCUS_23710 1178 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2072 1383 gene locus_tag LOCUS_23720 2072 1383 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_23720 4194 2116 gene locus_tag LOCUS_23730 4194 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence0456 3887 324 gene locus_tag LOCUS_23740 3887 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence0457 180 1115 gene locus_tag LOCUS_23750 180 1115 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_23750 1129 3498 gene locus_tag LOCUS_23760 1129 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence0458 67 1332 gene locus_tag LOCUS_23770 67 1332 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_23770 1426 2268 gene locus_tag LOCUS_23780 1426 2268 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_23780 2295 3545 gene locus_tag LOCUS_23790 2295 3545 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence0459 999 121 gene locus_tag LOCUS_23800 999 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1165 1917 gene locus_tag LOCUS_23810 gene ubiE 1165 1917 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_23810 2327 1914 gene locus_tag LOCUS_23820 2327 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 3409 2324 gene locus_tag LOCUS_23830 3409 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 4148 3516 gene locus_tag LOCUS_23840 4148 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence0460 630 1202 gene locus_tag LOCUS_23850 630 1202 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 protein_id gnl|my_center|LOCUS_23850 2497 1361 gene locus_tag LOCUS_23860 2497 1361 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_23860 3438 2494 gene locus_tag LOCUS_23870 3438 2494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_23870 3833 3435 gene locus_tag LOCUS_23880 3833 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence0461 <1 2032 gene locus_tag LOCUS_23890 <1 2032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein 2091 3455 gene locus_tag LOCUS_23900 2091 3455 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119052.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence0462 295 513 gene locus_tag LOCUS_23910 295 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23910 574 1629 gene locus_tag LOCUS_23920 574 1629 CDS product Trx7/PDZ domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922213.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23920 2241 3239 gene locus_tag LOCUS_23930 2241 3239 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence0463 2029 917 gene locus_tag LOCUS_23940 2029 917 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_23940 2543 2034 gene locus_tag LOCUS_23950 2543 2034 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357604.1 protein_id gnl|my_center|LOCUS_23950 3597 2692 gene locus_tag LOCUS_23960 gene ilvE 3597 2692 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence0464 >Feature sequence0465 3054 1879 gene locus_tag LOCUS_23970 3054 1879 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence0466 <1 834 gene locus_tag LOCUS_23980 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262393.1:competence/damage-inducible protein A 1826 2728 gene locus_tag LOCUS_23990 1826 2728 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_23990 2860 3738 gene locus_tag LOCUS_24000 2860 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence0467 1458 52 gene locus_tag LOCUS_24010 1458 52 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_24010 1737 3236 gene locus_tag LOCUS_24020 1737 3236 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_24020 3486 3986 gene locus_tag LOCUS_24030 3486 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 >Feature sequence0468 1645 407 gene locus_tag LOCUS_24040 1645 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2870 1734 gene locus_tag LOCUS_24050 2870 1734 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_24050 3905 2961 gene locus_tag LOCUS_24060 3905 2961 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence0469 359 754 gene locus_tag LOCUS_24070 359 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence0470 268 798 gene locus_tag LOCUS_24080 gene infC 268 798 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_24080 2876 927 gene locus_tag LOCUS_24090 gene dnaK 2876 927 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938112.1 protein_id gnl|my_center|LOCUS_24090 2973 3620 gene locus_tag LOCUS_24100 2973 3620 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_24100 3632 4060 gene locus_tag LOCUS_24110 3632 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence0471 817 1263 gene locus_tag LOCUS_24120 817 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1319 1603 gene locus_tag LOCUS_24130 1319 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 3760 1634 gene locus_tag LOCUS_24140 3760 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence0472 >Feature sequence0473 1868 81 gene locus_tag LOCUS_24150 1868 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 3634 2606 gene locus_tag LOCUS_24160 3634 2606 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence0474 2794 1955 gene locus_tag LOCUS_24170 2794 1955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_24170 >Feature sequence0475 <1 922 gene locus_tag LOCUS_24180 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145033984.1:DUF1501 domain-containing protein 951 1679 gene locus_tag LOCUS_24190 951 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence0476 171 398 gene locus_tag LOCUS_24200 171 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 623 2212 gene locus_tag LOCUS_24210 gene istA 623 2212 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_24210 2216 2995 gene locus_tag LOCUS_24220 gene istB 2216 2995 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence0477 1214 762 gene locus_tag LOCUS_24230 1214 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1496 1257 gene locus_tag LOCUS_24240 1496 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973188.1 protein_id gnl|my_center|LOCUS_24240 1573 1842 gene locus_tag LOCUS_24250 1573 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2701 2123 gene locus_tag LOCUS_24260 2701 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2990 4003 gene locus_tag LOCUS_24270 2990 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence0478 542 3973 gene locus_tag LOCUS_24280 542 3973 CDS product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943656.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence0479 141 437 gene locus_tag LOCUS_24290 141 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 869 465 gene locus_tag LOCUS_24300 869 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1390 2709 gene locus_tag LOCUS_24310 1390 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 3640 2729 gene locus_tag LOCUS_24320 3640 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence0480 1155 196 gene locus_tag LOCUS_24330 1155 196 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_24330 1952 1158 gene locus_tag LOCUS_24340 1952 1158 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_24340 2971 1964 gene locus_tag LOCUS_24350 2971 1964 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083086.1 protein_id gnl|my_center|LOCUS_24350 3138 4121 gene locus_tag LOCUS_24360 3138 4121 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615392.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence0481 <1 549 gene locus_tag LOCUS_24370 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941173.1:rhodanese-like domain-containing protein 615 1133 gene locus_tag LOCUS_24380 615 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 1706 1359 gene locus_tag LOCUS_24390 gene erpA 1706 1359 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence0482 1117 3429 gene locus_tag LOCUS_24400 1117 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 <4103 3458 gene locus_tag LOCUS_24410 <4103 3458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393971.1:ATP-binding protein >Feature sequence0483 197 1765 gene locus_tag LOCUS_24420 197 1765 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_24420 2742 1777 gene locus_tag LOCUS_24430 2742 1777 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921394.1 protein_id gnl|my_center|LOCUS_24430 <4099 3012 gene locus_tag LOCUS_24440 <4099 3012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403103.1:cytochrome c >Feature sequence0484 3455 270 gene locus_tag LOCUS_24450 3455 270 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_24450 <4096 3462 gene locus_tag LOCUS_24460 <4096 3462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071226.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0485 743 408 gene locus_tag LOCUS_24470 743 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2898 2257 gene locus_tag LOCUS_24480 2898 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence0486 224 1291 gene locus_tag LOCUS_24490 224 1291 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921853.1 protein_id gnl|my_center|LOCUS_24490 3158 1212 gene locus_tag LOCUS_24500 3158 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 3474 3815 gene locus_tag LOCUS_24510 3474 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 >Feature sequence0487 2949 79 gene locus_tag LOCUS_24520 2949 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 3682 3026 gene locus_tag LOCUS_24530 3682 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24530 >Feature sequence0488 869 525 gene locus_tag LOCUS_24540 869 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1756 953 gene locus_tag LOCUS_24550 gene hisJ 1756 953 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_24550 1922 3643 gene locus_tag LOCUS_24560 1922 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence0489 508 125 gene locus_tag LOCUS_24570 508 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1482 712 gene locus_tag LOCUS_24580 1482 712 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_24580 3254 1479 gene locus_tag LOCUS_24590 3254 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence0490 <1 971 gene locus_tag LOCUS_24600 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879224.1:glycosyltransferase family 4 protein 994 1746 gene locus_tag LOCUS_24610 994 1746 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113620978.1 protein_id gnl|my_center|LOCUS_24610 1743 2978 gene locus_tag LOCUS_24620 1743 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3151 3462 gene locus_tag LOCUS_24630 3151 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 3467 3766 gene locus_tag LOCUS_24640 3467 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence0491 <1 1179 gene locus_tag LOCUS_24650 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258925.1:glycogen synthase 1176 2657 gene locus_tag LOCUS_24660 1176 2657 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_24660 2657 3661 gene locus_tag LOCUS_24670 2657 3661 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence0492 203 1201 gene locus_tag LOCUS_24680 gene nadA 203 1201 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_24680 2620 2024 gene locus_tag LOCUS_24690 2620 2024 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_24690 3586 2828 gene locus_tag LOCUS_24700 3586 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence0493 433 1461 gene locus_tag LOCUS_24710 433 1461 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918670.1 protein_id gnl|my_center|LOCUS_24710 1797 3077 gene locus_tag LOCUS_24720 1797 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 <4022 3171 gene locus_tag LOCUS_24730 <4022 3171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327684.1:DUF3500 domain-containing protein >Feature sequence0494 3 1004 gene locus_tag LOCUS_24740 3 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1496 1068 gene locus_tag LOCUS_24750 1496 1068 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728011.1 protein_id gnl|my_center|LOCUS_24750 2985 1798 gene locus_tag LOCUS_24760 2985 1798 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_24760 3669 3079 gene locus_tag LOCUS_24770 3669 3079 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066513.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence0495 1107 412 gene locus_tag LOCUS_24780 1107 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1547 2659 gene locus_tag LOCUS_24790 1547 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2656 3468 gene locus_tag LOCUS_24800 2656 3468 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 protein_id gnl|my_center|LOCUS_24800 3829 3461 gene locus_tag LOCUS_24810 3829 3461 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence0496 3295 1517 gene locus_tag LOCUS_24820 3295 1517 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_24820 <4005 3408 gene locus_tag LOCUS_24830 <4005 3408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256503.1:SLC13 family permease >Feature sequence0497 2126 1365 gene locus_tag LOCUS_24840 2126 1365 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence0498 <1 1046 gene locus_tag LOCUS_24850 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003978049.1:sugar ABC transporter ATP-binding protein 1081 2055 gene locus_tag LOCUS_24860 1081 2055 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530576.1 protein_id gnl|my_center|LOCUS_24860 2052 3020 gene locus_tag LOCUS_24870 2052 3020 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565164.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence0499 3563 2625 gene locus_tag LOCUS_24880 3563 2625 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence0500 1397 549 gene locus_tag LOCUS_24890 1397 549 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_24890 3825 1522 gene locus_tag LOCUS_24900 3825 1522 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence0501 3676 152 gene locus_tag LOCUS_24910 3676 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence0502 <3996 1445 gene locus_tag LOCUS_24920 <3996 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222003.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence0503 <1 1203 gene locus_tag LOCUS_24930 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945439.1:preprotein translocase subunit SecA 1268 2611 gene locus_tag LOCUS_24940 1268 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence0504 1046 18 gene locus_tag LOCUS_24950 1046 18 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence0505 823 206 gene locus_tag LOCUS_24960 823 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 985 1803 gene locus_tag LOCUS_24970 985 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 2202 2414 gene locus_tag LOCUS_24980 2202 2414 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_24980 3527 2604 gene locus_tag LOCUS_24990 3527 2604 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122858.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence0506 1406 270 gene locus_tag LOCUS_25000 1406 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 1586 2590 gene locus_tag LOCUS_25010 1586 2590 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 protein_id gnl|my_center|LOCUS_25010 3201 2674 gene locus_tag LOCUS_25020 gene efp 3201 2674 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence0507 1127 213 gene locus_tag LOCUS_25030 1127 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2263 1145 gene locus_tag LOCUS_25040 2263 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2501 3376 gene locus_tag LOCUS_25050 2501 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence0508 1248 1847 gene locus_tag LOCUS_25060 1248 1847 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 protein_id gnl|my_center|LOCUS_25060 2181 3299 gene locus_tag LOCUS_25070 2181 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3382 3774 gene locus_tag LOCUS_25080 3382 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence0509 >Feature sequence0510 878 204 gene locus_tag LOCUS_25090 gene trmB 878 204 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941189.1 protein_id gnl|my_center|LOCUS_25090 2062 875 gene locus_tag LOCUS_25100 2062 875 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_25100 2191 3942 gene locus_tag LOCUS_25110 2191 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence0511 >Feature sequence0512 <1 1968 gene locus_tag LOCUS_25120 <1 1968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327171.1:ThuA domain-containing protein 2121 2807 gene locus_tag LOCUS_25130 2121 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 3638 2817 gene locus_tag LOCUS_25140 3638 2817 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence0513 395 550 gene locus_tag LOCUS_25150 395 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1229 600 gene locus_tag LOCUS_25160 1229 600 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_25160 2153 1266 gene locus_tag LOCUS_25170 2153 1266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_25170 3947 2271 gene locus_tag LOCUS_25180 3947 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence0514 479 300 gene locus_tag LOCUS_25190 479 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 530 682 gene locus_tag LOCUS_25200 530 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1010 753 gene locus_tag LOCUS_25210 1010 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 2219 1995 gene locus_tag LOCUS_25220 2219 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2625 3059 gene locus_tag LOCUS_25230 2625 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence0515 190 801 gene locus_tag LOCUS_25240 190 801 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_25240 2292 859 gene locus_tag LOCUS_25250 2292 859 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence0516 871 59 gene locus_tag LOCUS_25260 871 59 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_25260 1211 2347 gene locus_tag LOCUS_25270 1211 2347 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_25270 2445 3323 gene locus_tag LOCUS_25280 2445 3323 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence0517 2446 851 gene locus_tag LOCUS_25290 2446 851 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_25290 2687 3631 gene locus_tag LOCUS_25300 2687 3631 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_25300 3628 3837 gene locus_tag LOCUS_25310 3628 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence0518 895 1248 gene locus_tag LOCUS_25320 895 1248 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_25320 2568 1309 gene locus_tag LOCUS_25330 2568 1309 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391965.1 protein_id gnl|my_center|LOCUS_25330 3507 2656 gene locus_tag LOCUS_25340 3507 2656 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence0519 2030 336 gene locus_tag LOCUS_25350 2030 336 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456393.1 protein_id gnl|my_center|LOCUS_25350 2887 2027 gene locus_tag LOCUS_25360 2887 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 3292 2957 gene locus_tag LOCUS_25370 3292 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3624 3280 gene locus_tag LOCUS_25380 3624 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3827 3672 gene locus_tag LOCUS_25390 3827 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence0520 1632 853 gene locus_tag LOCUS_25400 1632 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2691 1663 gene locus_tag LOCUS_25410 2691 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 3342 2698 gene locus_tag LOCUS_25420 gene rpoE 3342 2698 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003307.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence0521 >Feature sequence0522 1378 302 gene locus_tag LOCUS_25430 1378 302 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_25430 2614 1403 gene locus_tag LOCUS_25440 2614 1403 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_25440 3878 2691 gene locus_tag LOCUS_25450 3878 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 >Feature sequence0523 394 164 gene locus_tag LOCUS_25460 394 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1503 487 gene locus_tag LOCUS_25470 1503 487 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_25470 2450 1602 gene locus_tag LOCUS_25480 2450 1602 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_25480 <3872 2447 gene locus_tag LOCUS_25490 <3872 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615806.1:tetratricopeptide repeat protein >Feature sequence0524 >Feature sequence0525 >Feature sequence0526 1871 126 gene locus_tag LOCUS_25500 gene lnt 1871 126 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_25500 1886 2830 gene locus_tag LOCUS_25510 1886 2830 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189376240.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence0527 772 38 gene locus_tag LOCUS_25520 772 38 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333956.1 protein_id gnl|my_center|LOCUS_25520 2031 775 gene locus_tag LOCUS_25530 2031 775 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922632.1 protein_id gnl|my_center|LOCUS_25530 3018 2305 gene locus_tag LOCUS_25540 3018 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3184 3258 gene locus_tag LOCUS_t00070 3184 3258 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3421 3654 gene locus_tag LOCUS_25550 3421 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 3638 3823 gene locus_tag LOCUS_25560 3638 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence0528 3015 1162 gene locus_tag LOCUS_25570 3015 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 3718 3065 gene locus_tag LOCUS_25580 3718 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence0529 3421 176 gene locus_tag LOCUS_25590 3421 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence0530 1590 403 gene locus_tag LOCUS_25600 1590 403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_25600 2759 1605 gene locus_tag LOCUS_25610 2759 1605 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_25610 3448 2756 gene locus_tag LOCUS_25620 3448 2756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence0531 >Feature sequence0532 >Feature sequence0533 >Feature sequence0534 1097 1810 gene locus_tag LOCUS_25630 1097 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3349 1943 gene locus_tag LOCUS_25640 3349 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3533 3775 gene locus_tag LOCUS_25650 3533 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence0535 1640 90 gene locus_tag LOCUS_25660 gene dnaB 1640 90 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_25660 1719 1795 gene locus_tag LOCUS_t00080 1719 1795 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3004 2192 gene locus_tag LOCUS_25670 3004 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence0536 140 1402 gene locus_tag LOCUS_25680 140 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2022 1450 gene locus_tag LOCUS_25690 2022 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 2650 3219 gene locus_tag LOCUS_25700 gene msrA 2650 3219 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence0537 2488 254 gene locus_tag LOCUS_25710 2488 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence0538 3211 887 gene locus_tag LOCUS_25720 3211 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence0539 1989 586 gene locus_tag LOCUS_25730 gene selA 1989 586 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence0540 >Feature sequence0541 2569 431 gene locus_tag LOCUS_25740 2569 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence0542 <1 1301 gene locus_tag LOCUS_25750 <1 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121692.1:helicase C-terminal domain-containing protein <3752 1338 gene locus_tag LOCUS_25760 <3752 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943733.1:DNA translocase FtsK >Feature sequence0543 2525 624 gene locus_tag LOCUS_25770 2525 624 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_25770 2888 3640 gene locus_tag LOCUS_25780 2888 3640 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence0544 <3738 3124 gene locus_tag LOCUS_25790 <3738 3124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102481.1:two-component system response regulator >Feature sequence0545 307 1197 gene locus_tag LOCUS_25800 307 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1226 2059 gene locus_tag LOCUS_25810 1226 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence0546 <1 998 gene locus_tag LOCUS_25820 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047814616.1:DUF3500 domain-containing protein 1781 1002 gene locus_tag LOCUS_25830 1781 1002 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086172.1 protein_id gnl|my_center|LOCUS_25830 3125 1782 gene locus_tag LOCUS_25840 3125 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence0547 1122 370 gene locus_tag LOCUS_25850 gene cas5c 1122 370 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_25850 1940 1161 gene locus_tag LOCUS_25860 1940 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2061 2669 gene locus_tag LOCUS_25870 2061 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 >Feature sequence0548 963 106 gene locus_tag LOCUS_25880 963 106 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_25880 2635 1082 gene locus_tag LOCUS_25890 2635 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3076 2699 gene locus_tag LOCUS_25900 3076 2699 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence0549 <1 1521 gene locus_tag LOCUS_25910 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326733.1:putative manganese-dependent inorganic diphosphatase 3031 1634 gene locus_tag LOCUS_25920 3031 1634 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence0550 91 918 gene locus_tag LOCUS_25930 91 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 918 1841 gene locus_tag LOCUS_25940 918 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 >Feature sequence0551 >Feature sequence0552 2345 156 gene locus_tag LOCUS_25950 2345 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3161 3616 gene locus_tag LOCUS_25960 3161 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence0553 1257 70 gene locus_tag LOCUS_25970 1257 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 2909 1257 gene locus_tag LOCUS_25980 2909 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence0554 1 3153 gene locus_tag LOCUS_25990 1 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 <3696 3150 gene locus_tag LOCUS_26000 <3696 3150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948621.1:Lpg2936 family Dot/Icm T4SS effector methyltransferase >Feature sequence0555 >Feature sequence0556 296 1396 gene locus_tag LOCUS_26010 296 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1393 2364 gene locus_tag LOCUS_26020 1393 2364 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_26020 2801 3205 gene locus_tag LOCUS_26030 2801 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence0557 854 465 gene locus_tag LOCUS_26040 gene rbsD 854 465 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161210.1 protein_id gnl|my_center|LOCUS_26040 2403 1006 gene locus_tag LOCUS_26050 2403 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2865 3335 gene locus_tag LOCUS_26060 2865 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 3671 3480 gene locus_tag LOCUS_26070 3671 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 >Feature sequence0558 1249 407 gene locus_tag LOCUS_26080 1249 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2697 1246 gene locus_tag LOCUS_26090 2697 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence0559 1782 403 gene locus_tag LOCUS_26100 1782 403 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_26100 1980 3269 gene locus_tag LOCUS_26110 1980 3269 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108894.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence0560 3313 1136 gene locus_tag LOCUS_26120 3313 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0561 251 1921 gene locus_tag LOCUS_26130 251 1921 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_26130 2742 2032 gene locus_tag LOCUS_26140 2742 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence0562 1292 2416 gene locus_tag LOCUS_26150 1292 2416 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence0563 3651 370 gene locus_tag LOCUS_26160 3651 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence0564 2924 831 gene locus_tag LOCUS_26170 gene feoB 2924 831 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510008.1 protein_id gnl|my_center|LOCUS_26170 3200 2958 gene locus_tag LOCUS_26180 3200 2958 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545730.1 protein_id gnl|my_center|LOCUS_26180 3475 3197 gene locus_tag LOCUS_26190 3475 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 >Feature sequence0565 <1 1274 gene locus_tag LOCUS_26200 <1 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122381.1:DUF1501 domain-containing protein >Feature sequence0566 >Feature sequence0567 299 1360 gene locus_tag LOCUS_26210 299 1360 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944019.1 protein_id gnl|my_center|LOCUS_26210 1453 1743 gene locus_tag LOCUS_26220 1453 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence0568 152 544 gene locus_tag LOCUS_26230 152 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 544 1677 gene locus_tag LOCUS_26240 544 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1688 2728 gene locus_tag LOCUS_26250 1688 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 2870 3592 gene locus_tag LOCUS_26260 2870 3592 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence0569 <1 1151 gene locus_tag LOCUS_26270 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460069.1:hemolysin family protein 3191 1164 gene locus_tag LOCUS_26280 3191 1164 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence0570 572 976 gene locus_tag LOCUS_26290 572 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 2469 1165 gene locus_tag LOCUS_26300 2469 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 2783 2502 gene locus_tag LOCUS_26310 2783 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2971 2810 gene locus_tag LOCUS_26320 2971 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence0571 2008 440 gene locus_tag LOCUS_26330 gene metG 2008 440 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_26330 <3625 2132 gene locus_tag LOCUS_26340 <3625 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057338.1:AAA-like domain-containing protein >Feature sequence0572 592 3435 gene locus_tag LOCUS_26350 592 3435 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021984.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence0573 546 1568 gene locus_tag LOCUS_26360 546 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence0574 302 1939 gene locus_tag LOCUS_26370 302 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2176 2769 gene locus_tag LOCUS_26380 2176 2769 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085886197.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence0575 398 1996 gene locus_tag LOCUS_26390 398 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2908 2096 gene locus_tag LOCUS_26400 2908 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 >Feature sequence0576 818 345 gene locus_tag LOCUS_26410 818 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 982 2121 gene locus_tag LOCUS_26420 982 2121 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_26420 2174 3475 gene locus_tag LOCUS_26430 2174 3475 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence0577 2561 1356 gene locus_tag LOCUS_26440 gene nifS 2561 1356 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence0578 111 983 gene locus_tag LOCUS_26450 111 983 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_26450 996 1712 gene locus_tag LOCUS_26460 996 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1842 2903 gene locus_tag LOCUS_26470 gene gcvT 1842 2903 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764743.1 protein_id gnl|my_center|LOCUS_26470 2980 3363 gene locus_tag LOCUS_26480 gene gcvH 2980 3363 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence0579 <1 1042 gene locus_tag LOCUS_26490 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196953.1:hopanoid biosynthesis associated radical SAM protein HpnJ 1116 1640 gene locus_tag LOCUS_26500 1116 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 1803 2267 gene locus_tag LOCUS_26510 1803 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 2408 3445 gene locus_tag LOCUS_26520 2408 3445 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_26520 >Feature sequence0580 350 718 gene locus_tag LOCUS_26530 350 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 715 2130 gene locus_tag LOCUS_26540 715 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence0581 <1 769 gene locus_tag LOCUS_26550 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173402023.1:sulfatase 876 1655 gene locus_tag LOCUS_26560 876 1655 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327171.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence0582 <3522 368 gene locus_tag LOCUS_26570 <3522 368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence0583 1552 1382 gene locus_tag LOCUS_26580 1552 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 2313 1636 gene locus_tag LOCUS_26590 2313 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 3446 2310 gene locus_tag LOCUS_26600 3446 2310 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence0584 52 450 gene locus_tag LOCUS_26610 52 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 3012 535 gene locus_tag LOCUS_26620 3012 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 >Feature sequence0585 49 3108 gene locus_tag LOCUS_26630 49 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence0586 922 266 gene locus_tag LOCUS_26640 gene cas4 922 266 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176710.1 protein_id gnl|my_center|LOCUS_26640 1972 1025 gene locus_tag LOCUS_26650 gene cas7c 1972 1025 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_26650 <3509 2001 gene locus_tag LOCUS_26660 <3509 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176708.1:type I-C CRISPR-associated protein Cas8c/Csd1 >Feature sequence0587 332 1804 gene locus_tag LOCUS_26670 332 1804 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_26670 <3509 1936 gene locus_tag LOCUS_26680 <3509 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence0588 >Feature sequence0589 2 1657 gene locus_tag LOCUS_26690 2 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence0590 799 572 gene locus_tag LOCUS_26700 799 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 935 804 gene locus_tag LOCUS_26710 935 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1349 1035 gene locus_tag LOCUS_26720 1349 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2531 1377 gene locus_tag LOCUS_26730 2531 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933801.1 protein_id gnl|my_center|LOCUS_26730 2816 2577 gene locus_tag LOCUS_26740 2816 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 <3502 3001 gene locus_tag LOCUS_26750 <3502 3001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333519.1:PRC-barrel domain-containing protein >Feature sequence0591 <1 1656 gene locus_tag LOCUS_26760 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141201.1:ABC transporter permease 2290 2057 gene locus_tag LOCUS_26770 2290 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence0592 <3488 2944 gene locus_tag LOCUS_26780 <3488 2944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404835.1:cytochrome c3 family protein >Feature sequence0593 63 1052 gene locus_tag LOCUS_26790 63 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1130 2275 gene locus_tag LOCUS_26800 1130 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence0594 261 1472 gene locus_tag LOCUS_26810 261 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1522 3249 gene locus_tag LOCUS_26820 1522 3249 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813188.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence0595 <1 2990 gene locus_tag LOCUS_26830 <1 2990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165447205.1:c-type cytochrome >Feature sequence0596 907 161 gene locus_tag LOCUS_26840 gene pgl 907 161 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_26840 2457 904 gene locus_tag LOCUS_26850 gene zwf 2457 904 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_26850 3096 2500 gene locus_tag LOCUS_26860 3096 2500 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence0597 933 1103 gene locus_tag LOCUS_26870 933 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1554 1297 gene locus_tag LOCUS_26880 1554 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1755 1627 gene locus_tag LOCUS_26890 1755 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3335 1959 gene locus_tag LOCUS_26900 3335 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence0598 727 458 gene locus_tag LOCUS_26910 gene fliQ 727 458 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941093.1 protein_id gnl|my_center|LOCUS_26910 1137 730 gene locus_tag LOCUS_26920 1137 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26920 1950 1501 gene locus_tag LOCUS_26930 1950 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2216 1947 gene locus_tag LOCUS_26940 2216 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3218 2232 gene locus_tag LOCUS_26950 gene fliM 3218 2232 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183958.1 protein_id gnl|my_center|LOCUS_26950 3454 3227 gene locus_tag LOCUS_26960 3454 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence0599 977 300 gene locus_tag LOCUS_26970 977 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 2041 1127 gene locus_tag LOCUS_26980 2041 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 3163 2093 gene locus_tag LOCUS_26990 3163 2093 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_26990 >Feature sequence0600 >Feature sequence0601 >Feature sequence0602 2684 1287 gene locus_tag LOCUS_27000 2684 1287 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921348.1 protein_id gnl|my_center|LOCUS_27000 3295 2681 gene locus_tag LOCUS_27010 3295 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence0603 355 1353 gene locus_tag LOCUS_27020 355 1353 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_27020 1368 2264 gene locus_tag LOCUS_27030 1368 2264 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence0604 1326 1039 gene locus_tag LOCUS_27040 1326 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2724 2401 gene locus_tag LOCUS_27050 2724 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence0605 996 748 gene locus_tag LOCUS_27060 996 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1226 993 gene locus_tag LOCUS_27070 1226 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3045 1966 gene locus_tag LOCUS_27080 3045 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence0606 309 1691 gene locus_tag LOCUS_27090 309 1691 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_27090 <3407 1800 gene locus_tag LOCUS_27100 <3407 1800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119753.1:PQQ-dependent sugar dehydrogenase >Feature sequence0607 453 1652 gene locus_tag LOCUS_27110 453 1652 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_27110 1733 2938 gene locus_tag LOCUS_27120 1733 2938 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388450.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence0608 743 1096 gene locus_tag LOCUS_27130 743 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1096 1938 gene locus_tag LOCUS_27140 1096 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27140 2327 2713 gene locus_tag LOCUS_27150 2327 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence0609 <1 1101 gene locus_tag LOCUS_27160 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064244431.1:CusA/CzcA family heavy metal efflux RND transporter 1281 1664 gene locus_tag LOCUS_27170 1281 1664 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930621.1 protein_id gnl|my_center|LOCUS_27170 >Feature sequence0610 2660 882 gene locus_tag LOCUS_27180 2660 882 CDS product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970681.1 protein_id gnl|my_center|LOCUS_27180 3385 2657 gene locus_tag LOCUS_27190 3385 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence0611 2269 2613 gene locus_tag LOCUS_27200 2269 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence0612 1407 664 gene locus_tag LOCUS_27210 1407 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2316 1591 gene locus_tag LOCUS_27220 2316 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3224 2364 gene locus_tag LOCUS_27230 3224 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 >Feature sequence0613 548 2938 gene locus_tag LOCUS_27240 548 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence0614 458 2320 gene locus_tag LOCUS_27250 458 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2323 2553 gene locus_tag LOCUS_27260 2323 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2607 3329 gene locus_tag LOCUS_27270 2607 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence0615 296 2809 gene locus_tag LOCUS_27280 296 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 2894 3280 gene locus_tag LOCUS_27290 gene erpA 2894 3280 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence0616 <1 2363 gene locus_tag LOCUS_27300 <1 2363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403216.1:TonB-dependent receptor >Feature sequence0617 <3372 2372 gene locus_tag LOCUS_27310 <3372 2372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257049.1:DUF3536 domain-containing protein >Feature sequence0618 712 3282 gene locus_tag LOCUS_27320 712 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence0619 821 192 gene locus_tag LOCUS_27330 821 192 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_27330 1885 818 gene locus_tag LOCUS_27340 gene rsgA 1885 818 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence0620 364 603 gene locus_tag LOCUS_27350 364 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 775 2331 gene locus_tag LOCUS_27360 775 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 2328 3143 gene locus_tag LOCUS_27370 2328 3143 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480253.1 protein_id gnl|my_center|LOCUS_27370 >Feature sequence0621 949 644 gene locus_tag LOCUS_27380 949 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1808 969 gene locus_tag LOCUS_27390 1808 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2666 1926 gene locus_tag LOCUS_27400 2666 1926 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_27400 3203 2760 gene locus_tag LOCUS_27410 3203 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence0622 1546 1728 gene locus_tag LOCUS_27420 1546 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence0623 383 1723 gene locus_tag LOCUS_27430 gene dnaA 383 1723 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_27430 2543 1728 gene locus_tag LOCUS_27440 2543 1728 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_27440 >Feature sequence0624 >Feature sequence0625 2366 1038 gene locus_tag LOCUS_27450 2366 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence0626 <1 1751 gene locus_tag LOCUS_27460 <1 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392118.1:translation elongation factor 4 1807 2973 gene locus_tag LOCUS_27470 1807 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence0627 <1 1669 gene locus_tag LOCUS_27480 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120349.1:DUF1553 domain-containing protein 1742 2989 gene locus_tag LOCUS_27490 1742 2989 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence0628 <1 1262 gene locus_tag LOCUS_27500 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403039.1:apolipoprotein N-acyltransferase 1629 1309 gene locus_tag LOCUS_27510 1629 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2148 1771 gene locus_tag LOCUS_27520 2148 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence0629 371 1741 gene locus_tag LOCUS_27530 371 1741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_27530 3080 1749 gene locus_tag LOCUS_27540 3080 1749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence0630 2659 1175 gene locus_tag LOCUS_27550 2659 1175 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_27550 3293 2766 gene locus_tag LOCUS_27560 3293 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence0631 655 188 gene locus_tag LOCUS_27570 655 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 966 1568 gene locus_tag LOCUS_27580 966 1568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018676.1 protein_id gnl|my_center|LOCUS_27580 3268 1820 gene locus_tag LOCUS_27590 3268 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 >Feature sequence0632 >Feature sequence0633 <1 1405 gene locus_tag LOCUS_27600 <1 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase 1405 2445 gene locus_tag LOCUS_27610 1405 2445 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071874.1 protein_id gnl|my_center|LOCUS_27610 >Feature sequence0634 37 348 gene locus_tag LOCUS_27620 37 348 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_27620 427 1035 gene locus_tag LOCUS_27630 gene recR 427 1035 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_27630 1032 1682 gene locus_tag LOCUS_27640 1032 1682 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_27640 <3281 1696 gene locus_tag LOCUS_27650 <3281 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368537.1:dehydrogenase >Feature sequence0635 2226 994 gene locus_tag LOCUS_27660 2226 994 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_27660 <3279 2425 gene locus_tag LOCUS_27670 <3279 2425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141613167.1:ribonuclease inhibitor >Feature sequence0636 293 1399 gene locus_tag LOCUS_27680 gene dusB 293 1399 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_27680 1847 1443 gene locus_tag LOCUS_27690 1847 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3191 2091 gene locus_tag LOCUS_27700 3191 2091 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence0637 388 1290 gene locus_tag LOCUS_27710 gene prmC 388 1290 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_27710 1309 2568 gene locus_tag LOCUS_27720 gene murA 1309 2568 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_27720 2577 2981 gene locus_tag LOCUS_27730 2577 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence0638 1536 10 gene locus_tag LOCUS_27740 gene xylB 1536 10 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_27740 2839 1562 gene locus_tag LOCUS_27750 gene hisS 2839 1562 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_27750 3162 2899 gene locus_tag LOCUS_27760 3162 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence0639 >Feature sequence0640 >Feature sequence0641 525 1802 gene locus_tag LOCUS_27770 525 1802 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_27770 2789 2292 gene locus_tag LOCUS_27780 2789 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3059 2937 gene locus_tag LOCUS_27790 3059 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3217 3047 gene locus_tag LOCUS_27800 3217 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 >Feature sequence0642 2089 1844 gene locus_tag LOCUS_27810 2089 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 <3233 2178 gene locus_tag LOCUS_27820 <3233 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950630.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0643 500 174 gene locus_tag LOCUS_27830 500 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 792 517 gene locus_tag LOCUS_27840 792 517 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_27840 2069 813 gene locus_tag LOCUS_27850 gene thrC 2069 813 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_27850 2517 2380 gene locus_tag LOCUS_27860 2517 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence0644 208 486 gene locus_tag LOCUS_27870 208 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 488 1936 gene locus_tag LOCUS_27880 488 1936 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077027088.1 protein_id gnl|my_center|LOCUS_27880 1933 2523 gene locus_tag LOCUS_27890 1933 2523 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_27890 2937 2515 gene locus_tag LOCUS_27900 2937 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence0645 1523 708 gene locus_tag LOCUS_27910 1523 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 3086 1719 gene locus_tag LOCUS_27920 gene amt 3086 1719 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109815.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence0646 2581 2159 gene locus_tag LOCUS_27930 2581 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 <3219 2616 gene locus_tag LOCUS_27940 <3219 2616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000420971.1:ISAs1-like element ISEc1 family transposase note possible pseudo, frameshifted >Feature sequence0647 324 707 gene locus_tag LOCUS_27950 324 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1585 734 gene locus_tag LOCUS_27960 1585 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1697 2575 gene locus_tag LOCUS_27970 1697 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27970 2585 3160 gene locus_tag LOCUS_27980 2585 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27980 >Feature sequence0648 116 1090 gene locus_tag LOCUS_27990 116 1090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943953.1 protein_id gnl|my_center|LOCUS_27990 1062 2822 gene locus_tag LOCUS_28000 1062 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence0649 2312 1071 gene locus_tag LOCUS_28010 2312 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 3092 2340 gene locus_tag LOCUS_28020 3092 2340 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence0650 501 1931 gene locus_tag LOCUS_28030 501 1931 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117991.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence0651 <3183 271 gene locus_tag LOCUS_28040 <3183 271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184173497.1:VCBS repeat-containing protein >Feature sequence0652 894 568 gene locus_tag LOCUS_28050 894 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 2932 1115 gene locus_tag LOCUS_28060 2932 1115 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence0653 <1 581 gene locus_tag LOCUS_28070 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761572.1:DUF58 domain-containing protein 651 1229 gene locus_tag LOCUS_28080 651 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 1237 2232 gene locus_tag LOCUS_28090 1237 2232 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence0654 1000 272 gene locus_tag LOCUS_28100 1000 272 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_28100 1203 2006 gene locus_tag LOCUS_28110 1203 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence0655 722 1222 gene locus_tag LOCUS_28120 722 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 >Feature sequence0656 846 265 gene locus_tag LOCUS_28130 846 265 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_28130 1922 843 gene locus_tag LOCUS_28140 gene prfA 1922 843 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_28140 2234 1989 gene locus_tag LOCUS_28150 gene rpmE 2234 1989 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_28150 >Feature sequence0657 <1 1070 gene locus_tag LOCUS_28160 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141602.1:GuaB3 family IMP dehydrogenase-related protein 1331 1113 gene locus_tag LOCUS_28170 1331 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1878 2921 gene locus_tag LOCUS_28180 1878 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence0658 186 563 gene locus_tag LOCUS_28190 186 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 760 1389 gene locus_tag LOCUS_28200 760 1389 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_28200 >Feature sequence0659 551 1729 gene locus_tag LOCUS_28210 551 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence0660 >Feature sequence0661 513 1541 gene locus_tag LOCUS_28220 513 1541 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_28220 2092 1673 gene locus_tag LOCUS_28230 2092 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2312 2455 gene locus_tag LOCUS_28240 2312 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence0662 115 1473 gene locus_tag LOCUS_28250 115 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2454 1564 gene locus_tag LOCUS_28260 2454 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 3037 2576 gene locus_tag LOCUS_28270 3037 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence0663 1463 1873 gene locus_tag LOCUS_28280 1463 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28280 1878 2018 gene locus_tag LOCUS_28290 1878 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28290 2442 2744 gene locus_tag LOCUS_28300 2442 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence0664 1594 443 gene locus_tag LOCUS_28310 1594 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2463 1591 gene locus_tag LOCUS_28320 2463 1591 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence0665 579 37 gene locus_tag LOCUS_28330 579 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 695 1321 gene locus_tag LOCUS_28340 695 1321 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143750.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence0666 840 241 gene locus_tag LOCUS_28350 840 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1217 858 gene locus_tag LOCUS_28360 1217 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1345 2886 gene locus_tag LOCUS_28370 1345 2886 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921496.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence0667 <1 1206 gene locus_tag LOCUS_28380 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_068610434.1:carbohydrate-binding protein 1538 2833 gene locus_tag LOCUS_28390 1538 2833 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence0668 >Feature sequence0669 450 863 gene locus_tag LOCUS_28400 450 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 >Feature sequence0670 >Feature sequence0671 >Feature sequence0672 >Feature sequence0673 255 1475 gene locus_tag LOCUS_28410 255 1475 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390673.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence0674 250 2349 gene locus_tag LOCUS_28420 250 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3013 2687 gene locus_tag LOCUS_28430 3013 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence0675 >Feature sequence0676 749 180 gene locus_tag LOCUS_28440 749 180 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969898.1 protein_id gnl|my_center|LOCUS_28440 1064 1585 gene locus_tag LOCUS_28450 1064 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 2021 1713 gene locus_tag LOCUS_28460 2021 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence0677 2630 360 gene locus_tag LOCUS_28470 2630 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence0678 1536 55 gene locus_tag LOCUS_28480 1536 55 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence0679 5 652 gene locus_tag LOCUS_28490 5 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 685 1566 gene locus_tag LOCUS_28500 685 1566 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_28500 1654 2859 gene locus_tag LOCUS_28510 1654 2859 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence0680 978 367 gene locus_tag LOCUS_28520 978 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2387 975 gene locus_tag LOCUS_28530 2387 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 <2992 2359 gene locus_tag LOCUS_28540 <2992 2359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615922.1:ATPase, T2SS/T4P/T4SS family >Feature sequence0681 242 1180 gene locus_tag LOCUS_28550 242 1180 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227827.1 protein_id gnl|my_center|LOCUS_28550 2860 2525 gene locus_tag LOCUS_28560 2860 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence0682 <1 1686 gene locus_tag LOCUS_28570 <1 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117861.1:FAD-dependent oxidoreductase >Feature sequence0683 2297 489 gene locus_tag LOCUS_28580 2297 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence0684 1085 2137 gene locus_tag LOCUS_28590 1085 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence0685 1798 2211 gene locus_tag LOCUS_28600 1798 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 2100 2309 gene locus_tag LOCUS_28610 2100 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2483 2319 gene locus_tag LOCUS_28620 2483 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2749 2480 gene locus_tag LOCUS_28630 2749 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence0686 1 762 gene locus_tag LOCUS_28640 1 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 762 1820 gene locus_tag LOCUS_28650 762 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 2649 1771 gene locus_tag LOCUS_28660 gene rbsK 2649 1771 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence0687 907 332 gene locus_tag LOCUS_28670 907 332 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 protein_id gnl|my_center|LOCUS_28670 2801 924 gene locus_tag LOCUS_28680 2801 924 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332193.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence0688 2046 400 gene locus_tag LOCUS_28690 2046 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2192 2821 gene locus_tag LOCUS_28700 2192 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28700 >Feature sequence0689 378 64 gene locus_tag LOCUS_28710 378 64 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038930.1 protein_id gnl|my_center|LOCUS_28710 520 1629 gene locus_tag LOCUS_28720 520 1629 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_28720 2651 1626 gene locus_tag LOCUS_28730 2651 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence0690 1421 141 gene locus_tag LOCUS_28740 1421 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2808 1459 gene locus_tag LOCUS_28750 2808 1459 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_28750 >Feature sequence0691 <1 565 gene locus_tag LOCUS_28760 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975845.1:response regulator transcription factor 570 2189 gene locus_tag LOCUS_28770 570 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence0692 <1 540 gene locus_tag LOCUS_28780 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583633.1:glutamate--tRNA ligase 1043 555 gene locus_tag LOCUS_28790 1043 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 2403 1177 gene locus_tag LOCUS_28800 2403 1177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530006.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence0693 2037 565 gene locus_tag LOCUS_28810 gene gatA 2037 565 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_28810 2350 2039 gene locus_tag LOCUS_28820 gene gatC 2350 2039 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034582121.1 protein_id gnl|my_center|LOCUS_28820 2664 2347 gene locus_tag LOCUS_28830 2664 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 >Feature sequence0694 2446 371 gene locus_tag LOCUS_28840 2446 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence0695 436 1425 gene locus_tag LOCUS_28850 436 1425 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_28850 1422 2303 gene locus_tag LOCUS_28860 1422 2303 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence0696 1079 342 gene locus_tag LOCUS_28870 1079 342 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_28870 2526 1108 gene locus_tag LOCUS_28880 gene lpdA 2526 1108 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_28880 2917 2534 gene locus_tag LOCUS_28890 2917 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence0697 411 1226 gene locus_tag LOCUS_28900 411 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1223 2032 gene locus_tag LOCUS_28910 1223 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence0698 146 1174 gene locus_tag LOCUS_28920 146 1174 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525324.1 protein_id gnl|my_center|LOCUS_28920 1813 1226 gene locus_tag LOCUS_28930 1813 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2635 1853 gene locus_tag LOCUS_28940 2635 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence0699 <1 504 gene locus_tag LOCUS_28950 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880145.1:serine--tRNA ligase 2412 907 gene locus_tag LOCUS_28960 2412 907 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939946.1 protein_id gnl|my_center|LOCUS_28960 2520 2696 gene locus_tag LOCUS_28970 2520 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence0700 <1 754 gene locus_tag LOCUS_28980 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104036.1:glycoside hydrolase family 15 protein 2072 792 gene locus_tag LOCUS_28990 2072 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence0701 842 1063 gene locus_tag LOCUS_29000 842 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 >Feature sequence0702 201 1028 gene locus_tag LOCUS_29010 201 1028 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035669.1 protein_id gnl|my_center|LOCUS_29010 1071 1967 gene locus_tag LOCUS_29020 1071 1967 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence0703 408 827 gene locus_tag LOCUS_29030 gene ndk 408 827 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_29030 2027 870 gene locus_tag LOCUS_29040 gene alr 2027 870 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_29040 2656 2132 gene locus_tag LOCUS_29050 2656 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 >Feature sequence0704 1169 117 gene locus_tag LOCUS_29060 1169 117 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_29060 1593 2486 gene locus_tag LOCUS_29070 1593 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence0705 2887 2063 gene locus_tag LOCUS_29080 2887 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 >Feature sequence0706 <1 519 gene locus_tag LOCUS_29090 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942910.1:lipoprotein-releasing ABC transporter permease subunit 512 1282 gene locus_tag LOCUS_29100 gene lolD 512 1282 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence0707 1193 2302 gene locus_tag LOCUS_29110 1193 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 2362 2745 gene locus_tag LOCUS_29120 2362 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence0708 8 820 gene locus_tag LOCUS_29130 8 820 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_29130 854 2746 gene locus_tag LOCUS_29140 gene cysC 854 2746 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence0709 2806 1616 gene locus_tag LOCUS_29150 2806 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence0710 1960 791 gene locus_tag LOCUS_29160 1960 791 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040295.1 protein_id gnl|my_center|LOCUS_29160 2451 1957 gene locus_tag LOCUS_29170 gene purE 2451 1957 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335444.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence0711 933 1658 gene locus_tag LOCUS_29180 933 1658 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_29180 1842 2489 gene locus_tag LOCUS_29190 1842 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence0712 <2861 507 gene locus_tag LOCUS_29200 <2861 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459887.1:ATP-dependent DNA helicase >Feature sequence0713 2858 1533 gene locus_tag LOCUS_29210 2858 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence0714 512 2653 gene locus_tag LOCUS_29220 512 2653 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence0715 1 1383 gene locus_tag LOCUS_29230 1 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 <2849 1464 gene locus_tag LOCUS_29240 <2849 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071157.1:S8 family serine peptidase >Feature sequence0716 327 851 gene locus_tag LOCUS_29250 327 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2711 876 gene locus_tag LOCUS_29260 2711 876 CDS product TIGR03546 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020340.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence0717 3 653 gene locus_tag LOCUS_29270 3 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 <2838 731 gene locus_tag LOCUS_29280 <2838 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084771.1:S9 family peptidase >Feature sequence0718 96 878 gene locus_tag LOCUS_29290 96 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 >Feature sequence0719 1357 152 gene locus_tag LOCUS_29300 gene aar 1357 152 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_29300 <2829 1354 gene locus_tag LOCUS_29310 <2829 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111696045.1:Na+/H+ antiporter NhaC >Feature sequence0720 <1 1113 gene locus_tag LOCUS_29320 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792552.1:sigma-54 dependent transcriptional regulator >Feature sequence0721 976 50 gene locus_tag LOCUS_29330 gene fabD 976 50 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_29330 1071 2753 gene locus_tag LOCUS_29340 1071 2753 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence0722 369 1748 gene locus_tag LOCUS_29350 369 1748 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_29350 1761 2741 gene locus_tag LOCUS_29360 1761 2741 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957343.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence0723 1428 85 gene locus_tag LOCUS_29370 gene mgtE 1428 85 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_29370 2540 1437 gene locus_tag LOCUS_29380 2540 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 >Feature sequence0724 81 863 gene locus_tag LOCUS_29390 gene map 81 863 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_29390 1130 1525 gene locus_tag LOCUS_29400 gene rpsM 1130 1525 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421125.1 protein_id gnl|my_center|LOCUS_29400 1570 2307 gene locus_tag LOCUS_29410 1570 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence0725 <1 777 gene locus_tag LOCUS_29420 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921649.1:metallophosphoesterase >Feature sequence0726 1856 594 gene locus_tag LOCUS_29430 gene larA 1856 594 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484568.1 protein_id gnl|my_center|LOCUS_29430 2663 1881 gene locus_tag LOCUS_29440 2663 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence0727 <1 1682 gene locus_tag LOCUS_29450 <1 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031062.1:BREX-2 system phosphatase PglZ >Feature sequence0728 1911 1363 gene locus_tag LOCUS_29460 1911 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2547 1918 gene locus_tag LOCUS_29470 gene gmk 2547 1918 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337846.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence0729 701 2215 gene locus_tag LOCUS_29480 701 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 >Feature sequence0730 <2791 865 gene locus_tag LOCUS_29490 <2791 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073381.1:VWA domain-containing protein >Feature sequence0731 <1 1388 gene locus_tag LOCUS_29500 <1 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545621.1:penicillin-binding protein 2 >Feature sequence0732 1300 386 gene locus_tag LOCUS_29510 1300 386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442682.1 protein_id gnl|my_center|LOCUS_29510 2344 1331 gene locus_tag LOCUS_29520 2344 1331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 protein_id gnl|my_center|LOCUS_29520 2634 2380 gene locus_tag LOCUS_29530 2634 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29530 >Feature sequence0733 <1 1366 gene locus_tag LOCUS_29540 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812701.1:YihY family inner membrane protein 1486 1989 gene locus_tag LOCUS_29550 1486 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2062 2370 gene locus_tag LOCUS_29560 2062 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence0734 <1 2152 gene locus_tag LOCUS_29570 <1 2152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103123.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence0735 >Feature sequence0736 916 14 gene locus_tag LOCUS_29580 916 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1533 913 gene locus_tag LOCUS_29590 1533 913 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929203.1 protein_id gnl|my_center|LOCUS_29590 2317 1544 gene locus_tag LOCUS_29600 2317 1544 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261765.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence0737 <1 2679 gene locus_tag LOCUS_29610 <1 2679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence0738 409 2556 gene locus_tag LOCUS_29620 409 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence0739 100 2322 gene locus_tag LOCUS_29630 100 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence0740 <1 902 gene locus_tag LOCUS_29640 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061665.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 902 1879 gene locus_tag LOCUS_29650 902 1879 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_29650 1892 2101 gene locus_tag LOCUS_29660 1892 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 >Feature sequence0741 >Feature sequence0742 701 1006 gene locus_tag LOCUS_29670 701 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 1166 1978 gene locus_tag LOCUS_29680 1166 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence0743 248 1120 gene locus_tag LOCUS_29690 gene glpG 248 1120 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_29690 <2730 1147 gene locus_tag LOCUS_29700 <2730 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091593.1:carboxy terminal-processing peptidase >Feature sequence0744 149 1375 gene locus_tag LOCUS_29710 149 1375 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615753.1 protein_id gnl|my_center|LOCUS_29710 2305 1445 gene locus_tag LOCUS_29720 2305 1445 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090088.1 protein_id gnl|my_center|LOCUS_29720 2721 2320 gene locus_tag LOCUS_29730 2721 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence0745 <1 2634 gene locus_tag LOCUS_29740 <1 2634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975001.1:calcium-binding protein >Feature sequence0746 223 2511 gene locus_tag LOCUS_29750 223 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence0747 <2715 506 gene locus_tag LOCUS_29760 <2715 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765773.1:DUF5703 domain-containing protein >Feature sequence0748 215 334 gene locus_tag LOCUS_29770 215 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 488 1807 gene locus_tag LOCUS_29780 488 1807 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence0749 176 1147 gene locus_tag LOCUS_29790 176 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 2450 1185 gene locus_tag LOCUS_29800 2450 1185 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334059.1 protein_id gnl|my_center|LOCUS_29800 >Feature sequence0750 1516 176 gene locus_tag LOCUS_29810 1516 176 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922308.1 protein_id gnl|my_center|LOCUS_29810 2441 1701 gene locus_tag LOCUS_29820 2441 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence0751 144 1073 gene locus_tag LOCUS_29830 gene aroE 144 1073 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_29830 1066 2160 gene locus_tag LOCUS_29840 1066 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 >Feature sequence0752 1244 2482 gene locus_tag LOCUS_29850 1244 2482 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_29850 2534 2671 gene locus_tag LOCUS_29860 2534 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence0753 825 2630 gene locus_tag LOCUS_29870 gene polX 825 2630 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence0754 380 111 gene locus_tag LOCUS_29880 380 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 <2666 465 gene locus_tag LOCUS_29890 <2666 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase note possible pseudo, internal stop codon >Feature sequence0755 93 1685 gene locus_tag LOCUS_29900 93 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 2536 1799 gene locus_tag LOCUS_29910 2536 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence0756 1496 624 gene locus_tag LOCUS_29920 1496 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1924 1496 gene locus_tag LOCUS_29930 1924 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 <2661 1921 gene locus_tag LOCUS_29940 <2661 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940706.1:protein TolQ >Feature sequence0757 <1 501 gene locus_tag LOCUS_29950 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_225895010.1:PAS domain-containing sensor histidine kinase 653 1939 gene locus_tag LOCUS_29960 653 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 <2656 2123 gene locus_tag LOCUS_29970 <2656 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922256.1:Xaa-Pro dipeptidyl-peptidase >Feature sequence0758 >Feature sequence0759 >Feature sequence0760 261 79 gene locus_tag LOCUS_29980 261 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1964 342 gene locus_tag LOCUS_29990 1964 342 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_29990 <2645 2129 gene locus_tag LOCUS_30000 <2645 2129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141963.1:NB-ARC domain-containing protein >Feature sequence0761 <1 901 gene locus_tag LOCUS_30010 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141277.1:FG-GAP-like repeat-containing protein >Feature sequence0762 313 1272 gene locus_tag LOCUS_30020 313 1272 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941474.1 protein_id gnl|my_center|LOCUS_30020 1691 1356 gene locus_tag LOCUS_30030 1691 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 2457 1795 gene locus_tag LOCUS_30040 2457 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence0763 94 1383 gene locus_tag LOCUS_30050 94 1383 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760595.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence0764 >Feature sequence0765 >Feature sequence0766 574 1074 gene locus_tag LOCUS_30060 gene nusB 574 1074 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_30060 1088 1939 gene locus_tag LOCUS_30070 1088 1939 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence0767 2034 1168 gene locus_tag LOCUS_30080 2034 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 <2611 2047 gene locus_tag LOCUS_30090 <2611 2047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942996.1:malto-oligosyltrehalose synthase >Feature sequence0768 <1 623 gene locus_tag LOCUS_30100 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118964.1:methylamine utilization protein 698 1765 gene locus_tag LOCUS_30110 698 1765 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_30110 >Feature sequence0769 2296 908 gene locus_tag LOCUS_30120 2296 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence0770 >Feature sequence0771 3 686 gene locus_tag LOCUS_30130 3 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 692 1411 gene locus_tag LOCUS_30140 692 1411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_30140 >Feature sequence0772 >Feature sequence0773 >Feature sequence0774 813 265 gene locus_tag LOCUS_30150 813 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 1232 909 gene locus_tag LOCUS_30160 1232 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 1708 1286 gene locus_tag LOCUS_30170 1708 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence0775 >Feature sequence0776 1622 495 gene locus_tag LOCUS_30180 gene solA 1622 495 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_30180 >Feature sequence0777 777 1589 gene locus_tag LOCUS_30190 777 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1627 1770 gene locus_tag LOCUS_30200 1627 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2504 1881 gene locus_tag LOCUS_30210 2504 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence0778 176 946 gene locus_tag LOCUS_30220 176 946 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943288.1 protein_id gnl|my_center|LOCUS_30220 1019 1744 gene locus_tag LOCUS_30230 1019 1744 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_30230 1819 2550 gene locus_tag LOCUS_30240 1819 2550 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_30240 >Feature sequence0779 2270 1188 gene locus_tag LOCUS_30250 2270 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 >Feature sequence0780 <2566 570 gene locus_tag LOCUS_30260 <2566 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257848.1:NADH-quinone oxidoreductase subunit L >Feature sequence0781 1 1137 gene locus_tag LOCUS_30270 1 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 >Feature sequence0782 2036 132 gene locus_tag LOCUS_30280 2036 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence0783 2097 985 gene locus_tag LOCUS_30290 2097 985 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence0784 1484 195 gene locus_tag LOCUS_30300 1484 195 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121673.1 protein_id gnl|my_center|LOCUS_30300 <2548 1707 gene locus_tag LOCUS_30310 <2548 1707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008668005.1:DUF1592 domain-containing protein >Feature sequence0785 1470 2543 gene locus_tag LOCUS_30320 1470 2543 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_30320 >Feature sequence0786 1474 47 gene locus_tag LOCUS_30330 gene nhaC 1474 47 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_30330 2542 1589 gene locus_tag LOCUS_30340 2542 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 >Feature sequence0787 <1 1088 gene locus_tag LOCUS_30350 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393309.1:malto-oligosyltrehalose trehalohydrolase >Feature sequence0788 1370 36 gene locus_tag LOCUS_30360 1370 36 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_30360 <2540 1379 gene locus_tag LOCUS_30370 <2540 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326169.1:CTP synthase >Feature sequence0789 1612 266 gene locus_tag LOCUS_30380 gene glnA4 1612 266 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_30380 <2536 1727 gene locus_tag LOCUS_30390 <2536 1727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728460.1:aldehyde dehydrogenase family protein >Feature sequence0790 259 1437 gene locus_tag LOCUS_30400 gene dgoD 259 1437 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence0791 96 617 gene locus_tag LOCUS_30410 96 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 2072 840 gene locus_tag LOCUS_30420 2072 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence0792 >Feature sequence0793 >Feature sequence0794 <2525 1185 gene locus_tag LOCUS_30430 <2525 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922492.1:DUF1501 domain-containing protein >Feature sequence0795 1580 555 gene locus_tag LOCUS_30440 1580 555 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840140.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30440 <2524 1616 gene locus_tag LOCUS_30450 <2524 1616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250672.1:glycosyltransferase family 4 protein >Feature sequence0796 29 1000 gene locus_tag LOCUS_30460 29 1000 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_30460 1539 1066 gene locus_tag LOCUS_30470 1539 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 1694 2491 gene locus_tag LOCUS_30480 1694 2491 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 protein_id gnl|my_center|LOCUS_30480 >Feature sequence0797 731 438 gene locus_tag LOCUS_30490 731 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 2017 884 gene locus_tag LOCUS_30500 2017 884 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_30500 >Feature sequence0798 >Feature sequence0799 >Feature sequence0800 36 1151 gene locus_tag LOCUS_30510 36 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 2268 1144 gene locus_tag LOCUS_30520 gene aroC 2268 1144 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence0801 614 366 gene locus_tag LOCUS_30530 614 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 698 1105 gene locus_tag LOCUS_30540 698 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1344 1934 gene locus_tag LOCUS_30550 1344 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence0802 326 1282 gene locus_tag LOCUS_30560 326 1282 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_30560 >Feature sequence0803 2501 1497 gene locus_tag LOCUS_30570 2501 1497 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence0804 >Feature sequence0805 2366 510 gene locus_tag LOCUS_30580 2366 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence0806 <2498 1511 gene locus_tag LOCUS_30590 <2498 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257847.1:NADH-quinone oxidoreductase subunit M >Feature sequence0807 <1 870 gene locus_tag LOCUS_30600 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921772.1:DUF1080 domain-containing protein 1830 967 gene locus_tag LOCUS_30610 1830 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 >Feature sequence0808 480 980 gene locus_tag LOCUS_30620 480 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 1228 2454 gene locus_tag LOCUS_30630 1228 2454 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence0809 349 1308 gene locus_tag LOCUS_30640 349 1308 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_30640 2168 1344 gene locus_tag LOCUS_30650 2168 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence0810 416 138 gene locus_tag LOCUS_30660 416 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 618 1190 gene locus_tag LOCUS_30670 618 1190 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188272.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30670 1315 2304 gene locus_tag LOCUS_30680 1315 2304 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence0811 606 64 gene locus_tag LOCUS_30690 606 64 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 protein_id gnl|my_center|LOCUS_30690 1991 660 gene locus_tag LOCUS_30700 1991 660 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence0812 <1 820 gene locus_tag LOCUS_30710 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146457347.1:sulfatase-like hydrolase/transferase 970 1650 gene locus_tag LOCUS_30720 970 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 2319 1663 gene locus_tag LOCUS_30730 2319 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence0813 <1 1331 gene locus_tag LOCUS_30740 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403969.1:protoporphyrinogen oxidase 1328 2365 gene locus_tag LOCUS_30750 gene hemH 1328 2365 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768824.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence0814 1884 1045 gene locus_tag LOCUS_30760 1884 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30760 2161 1868 gene locus_tag LOCUS_30770 2161 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence0815 >Feature sequence0816 176 1567 gene locus_tag LOCUS_30780 176 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 2371 1643 gene locus_tag LOCUS_30790 2371 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 >Feature sequence0817 65 481 gene locus_tag LOCUS_30800 65 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 478 846 gene locus_tag LOCUS_30810 478 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 910 1794 gene locus_tag LOCUS_30820 910 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence0818 551 27 gene locus_tag LOCUS_30830 551 27 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357726.1 protein_id gnl|my_center|LOCUS_30830 850 1743 gene locus_tag LOCUS_30840 gene rpsB 850 1743 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268484.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence0819 530 1972 gene locus_tag LOCUS_30850 530 1972 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119832.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence0820 <1 783 gene locus_tag LOCUS_30860 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095374.1:xylonate dehydratase YagF >Feature sequence0821 <1 557 gene locus_tag LOCUS_30870 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165447205.1:c-type cytochrome 814 1893 gene locus_tag LOCUS_30880 gene pta 814 1893 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence0822 1781 1191 gene locus_tag LOCUS_30890 1781 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence0823 <1 1298 gene locus_tag LOCUS_30900 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941556.1:UvrD-helicase domain-containing protein note possible pseudo, frameshifted 1312 1923 gene locus_tag LOCUS_30910 1312 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30910 >Feature sequence0824 1305 1508 gene locus_tag LOCUS_30920 1305 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 1754 1966 gene locus_tag LOCUS_30930 1754 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1963 2229 gene locus_tag LOCUS_30940 1963 2229 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_30940 >Feature sequence0825 138 860 gene locus_tag LOCUS_30950 138 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 1074 865 gene locus_tag LOCUS_30960 1074 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 <2448 1125 gene locus_tag LOCUS_30970 <2448 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120961.1:DUF1501 domain-containing protein >Feature sequence0826 114 2258 gene locus_tag LOCUS_30980 114 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence0827 1721 996 gene locus_tag LOCUS_30990 1721 996 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_30990 1966 1739 gene locus_tag LOCUS_31000 1966 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence0828 >Feature sequence0829 >Feature sequence0830 1 948 gene locus_tag LOCUS_31010 1 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 1226 954 gene locus_tag LOCUS_31020 1226 954 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence0831 2355 1153 gene locus_tag LOCUS_31030 2355 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence0832 404 973 gene locus_tag LOCUS_31040 404 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1011 1190 gene locus_tag LOCUS_31050 1011 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1187 1570 gene locus_tag LOCUS_31060 1187 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1771 2058 gene locus_tag LOCUS_31070 1771 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence0833 <1 767 gene locus_tag LOCUS_31080 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943307.1:ATP-binding protein 760 1200 gene locus_tag LOCUS_31090 760 1200 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence0834 1719 628 gene locus_tag LOCUS_31100 1719 628 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_31100 1842 2267 gene locus_tag LOCUS_31110 1842 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 >Feature sequence0835 690 1235 gene locus_tag LOCUS_31120 690 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence0836 <1 897 gene locus_tag LOCUS_31130 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922034.1:FtsX-like permease family protein 915 1574 gene locus_tag LOCUS_31140 915 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence0837 110 1213 gene locus_tag LOCUS_31150 110 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1434 2135 gene locus_tag LOCUS_31160 1434 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 >Feature sequence0838 78 668 gene locus_tag LOCUS_31170 78 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1628 957 gene locus_tag LOCUS_31180 1628 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence0839 >Feature sequence0840 1090 1671 gene locus_tag LOCUS_31190 1090 1671 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463089.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence0841 743 138 gene locus_tag LOCUS_31200 743 138 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_31200 827 1621 gene locus_tag LOCUS_31210 827 1621 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence0842 1586 381 gene locus_tag LOCUS_31220 gene moeA 1586 381 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397348.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence0843 >Feature sequence0844 328 1218 gene locus_tag LOCUS_31230 gene iolB 328 1218 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640197.1 protein_id gnl|my_center|LOCUS_31230 1257 2096 gene locus_tag LOCUS_31240 1257 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence0845 <2375 366 gene locus_tag LOCUS_31250 <2375 366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008668648.1:DUF1553 domain-containing protein >Feature sequence0846 373 1737 gene locus_tag LOCUS_31260 373 1737 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_31260 2364 1855 gene locus_tag LOCUS_31270 2364 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence0847 >Feature sequence0848 594 355 gene locus_tag LOCUS_31280 594 355 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_31280 736 2094 gene locus_tag LOCUS_31290 736 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence0849 <2356 1010 gene locus_tag LOCUS_31300 <2356 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861071.1:CotH kinase family protein >Feature sequence0850 1980 871 gene locus_tag LOCUS_31310 gene rlmN 1980 871 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_31310 >Feature sequence0851 1612 482 gene locus_tag LOCUS_31320 1612 482 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064976.1 protein_id gnl|my_center|LOCUS_31320 1690 2028 gene locus_tag LOCUS_31330 1690 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence0852 >Feature sequence0853 2140 1175 gene locus_tag LOCUS_31340 gene hydE 2140 1175 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081428999.1 protein_id gnl|my_center|LOCUS_31340 >Feature sequence0854 958 1740 gene locus_tag LOCUS_31350 958 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 2328 1855 gene locus_tag LOCUS_31360 2328 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence0855 <1 927 gene locus_tag LOCUS_31370 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073846.1:VCBS domain-containing protein 1920 1714 gene locus_tag LOCUS_31380 1920 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence0856 <1 790 gene locus_tag LOCUS_31390 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939946.1:hybrid sensor histidine kinase/response regulator <2324 814 gene locus_tag LOCUS_31400 <2324 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946864.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0857 1839 2141 gene locus_tag LOCUS_31410 1839 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence0858 >Feature sequence0859 >Feature sequence0860 1043 99 gene locus_tag LOCUS_31420 1043 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 <2299 1339 gene locus_tag LOCUS_31430 <2299 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403914.1:excinuclease ABC subunit UvrB >Feature sequence0861 337 747 gene locus_tag LOCUS_31440 337 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 1023 895 gene locus_tag LOCUS_31450 1023 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1610 1122 gene locus_tag LOCUS_31460 1610 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 2000 1851 gene locus_tag LOCUS_31470 2000 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence0862 >Feature sequence0863 1083 127 gene locus_tag LOCUS_31480 1083 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2056 1178 gene locus_tag LOCUS_31490 gene rfbA 2056 1178 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942725.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence0864 <1 1211 gene locus_tag LOCUS_31500 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939632.1:sigma 54-interacting transcriptional regulator >Feature sequence0865 1145 171 gene locus_tag LOCUS_31510 1145 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 2158 1145 gene locus_tag LOCUS_31520 2158 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence0866 2000 96 gene locus_tag LOCUS_31530 2000 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence0867 300 1043 gene locus_tag LOCUS_31540 gene fabG 300 1043 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_31540 1224 1469 gene locus_tag LOCUS_31550 gene acpP 1224 1469 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_31550 >Feature sequence0868 1940 474 gene locus_tag LOCUS_31560 1940 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 >Feature sequence0869 <2286 771 gene locus_tag LOCUS_31570 <2286 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919006.1:penicillin acylase family protein >Feature sequence0870 469 134 gene locus_tag LOCUS_31580 469 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 706 2058 gene locus_tag LOCUS_31590 706 2058 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence0871 73 2184 gene locus_tag LOCUS_31600 73 2184 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_31600 >Feature sequence0872 1420 527 gene locus_tag LOCUS_31610 1420 527 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_31610 <2271 1441 gene locus_tag LOCUS_31620 <2271 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546001.1:aminofutalosine synthase MqnE >Feature sequence0873 >Feature sequence0874 >Feature sequence0875 <1 636 gene locus_tag LOCUS_31630 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942471.1:L-aspartate oxidase >Feature sequence0876 276 37 gene locus_tag LOCUS_31640 276 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 <2262 331 gene locus_tag LOCUS_31650 <2262 331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117969.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0877 592 668 gene locus_tag LOCUS_t00090 592 668 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 743 816 gene locus_tag LOCUS_t00100 743 816 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0878 >Feature sequence0879 <1 1648 gene locus_tag LOCUS_31660 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203082.1:SpoIIE family protein phosphatase >Feature sequence0880 190 951 gene locus_tag LOCUS_31670 190 951 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329167.1 protein_id gnl|my_center|LOCUS_31670 1399 974 gene locus_tag LOCUS_31680 1399 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 2034 1396 gene locus_tag LOCUS_31690 2034 1396 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833353.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence0881 381 746 gene locus_tag LOCUS_31700 gene rplR 381 746 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549040.1 protein_id gnl|my_center|LOCUS_31700 768 1550 gene locus_tag LOCUS_31710 768 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 1558 2031 gene locus_tag LOCUS_31720 gene rplO 1558 2031 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567527.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence0882 <1 1646 gene locus_tag LOCUS_31730 <1 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072023.1:efflux RND transporter permease subunit >Feature sequence0883 173 535 gene locus_tag LOCUS_31740 173 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 523 1578 gene locus_tag LOCUS_31750 523 1578 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence0884 171 596 gene locus_tag LOCUS_31760 171 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 1573 635 gene locus_tag LOCUS_31770 1573 635 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975618.1 protein_id gnl|my_center|LOCUS_31770 <2243 1570 gene locus_tag LOCUS_31780 <2243 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545798.1:HDOD domain-containing protein >Feature sequence0885 >Feature sequence0886 467 2029 gene locus_tag LOCUS_31790 467 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence0887 <1 659 gene locus_tag LOCUS_31800 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_173514171.1:tyrosine-type recombinase/integrase 924 1904 gene locus_tag LOCUS_31810 924 1904 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_31810 >Feature sequence0888 977 468 gene locus_tag LOCUS_31820 977 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 >Feature sequence0889 1808 1155 gene locus_tag LOCUS_31830 1808 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence0890 1096 101 gene locus_tag LOCUS_31840 gene yedA 1096 101 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_31840 1876 1343 gene locus_tag LOCUS_31850 1876 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence0891 2091 619 gene locus_tag LOCUS_31860 2091 619 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_31860 >Feature sequence0892 >Feature sequence0893 1606 572 gene locus_tag LOCUS_31870 gene holB 1606 572 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_31870 1979 1638 gene locus_tag LOCUS_31880 1979 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence0894 1038 217 gene locus_tag LOCUS_31890 1038 217 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_31890 1762 1190 gene locus_tag LOCUS_31900 1762 1190 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_31900 2037 1804 gene locus_tag LOCUS_31910 2037 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence0895 334 702 gene locus_tag LOCUS_31920 334 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 1375 722 gene locus_tag LOCUS_31930 1375 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 1948 1403 gene locus_tag LOCUS_31940 1948 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence0896 1320 259 gene locus_tag LOCUS_31950 1320 259 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_31950 >Feature sequence0897 78 2003 gene locus_tag LOCUS_31960 78 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence0898 >Feature sequence0899 1 360 gene locus_tag LOCUS_31970 1 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 386 1660 gene locus_tag LOCUS_31980 386 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence0900 <1 545 gene locus_tag LOCUS_31990 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058258.1:sensor histidine kinase 1062 1187 gene locus_tag LOCUS_32000 1062 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 >Feature sequence0901 <1 1737 gene locus_tag LOCUS_32010 <1 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142258.1:PQQ-dependent sugar dehydrogenase >Feature sequence0902 >Feature sequence0903 <1 1639 gene locus_tag LOCUS_32020 <1 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120839.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence0904 422 802 gene locus_tag LOCUS_32030 422 802 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_32030 807 1862 gene locus_tag LOCUS_32040 807 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence0905 44 385 gene locus_tag LOCUS_32050 gene cutA 44 385 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209122.1 protein_id gnl|my_center|LOCUS_32050 405 1334 gene locus_tag LOCUS_32060 405 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence0906 55 249 gene locus_tag LOCUS_32070 55 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 458 300 gene locus_tag LOCUS_32080 458 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 773 600 gene locus_tag LOCUS_32090 773 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 1031 774 gene locus_tag LOCUS_32100 1031 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 <2181 1243 gene locus_tag LOCUS_32110 <2181 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957983.1:SLC13 family permease >Feature sequence0907 412 215 gene locus_tag LOCUS_32120 412 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 1869 415 gene locus_tag LOCUS_32130 1869 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 >Feature sequence0908 681 532 gene locus_tag LOCUS_32140 681 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 746 1606 gene locus_tag LOCUS_32150 746 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1817 1647 gene locus_tag LOCUS_32160 1817 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 >Feature sequence0909 >Feature sequence0910 724 590 gene locus_tag LOCUS_32170 724 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence0911 1859 543 gene locus_tag LOCUS_32180 1859 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 2079 1861 gene locus_tag LOCUS_32190 2079 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 >Feature sequence0912 >Feature sequence0913 427 1038 gene locus_tag LOCUS_32200 427 1038 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117499.1 protein_id gnl|my_center|LOCUS_32200 >Feature sequence0914 >Feature sequence0915 <2153 274 gene locus_tag LOCUS_32210 <2153 274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932948.1:thioredoxin domain-containing protein >Feature sequence0916 1417 1154 gene locus_tag LOCUS_32220 1417 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence0917 1874 1254 gene locus_tag LOCUS_32230 1874 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence0918 <1 743 gene locus_tag LOCUS_32240 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933292.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 750 1748 gene locus_tag LOCUS_32250 750 1748 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_32250 >Feature sequence0919 375 1208 gene locus_tag LOCUS_32260 375 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1604 1221 gene locus_tag LOCUS_32270 1604 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence0920 >Feature sequence0921 256 537 gene locus_tag LOCUS_32280 256 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 939 1193 gene locus_tag LOCUS_32290 939 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1478 2140 gene locus_tag LOCUS_32300 1478 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence0922 <2134 566 gene locus_tag LOCUS_32310 <2134 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921322.1:alpha/beta hydrolase family protein >Feature sequence0923 324 1772 gene locus_tag LOCUS_32320 324 1772 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence0924 1267 602 gene locus_tag LOCUS_32330 1267 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 >Feature sequence0925 267 1040 gene locus_tag LOCUS_32340 267 1040 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_32340 1037 1783 gene locus_tag LOCUS_32350 1037 1783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_32350 >Feature sequence0926 73 924 gene locus_tag LOCUS_32360 gene nadC 73 924 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_32360 927 1907 gene locus_tag LOCUS_32370 927 1907 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence0927 >Feature sequence0928 554 1849 gene locus_tag LOCUS_32380 gene lysA 554 1849 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence0929 >Feature sequence0930 1676 1044 gene locus_tag LOCUS_32390 1676 1044 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206063.1 protein_id gnl|my_center|LOCUS_32390 >Feature sequence0931 1343 2032 gene locus_tag LOCUS_32400 1343 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence0932 508 1995 gene locus_tag LOCUS_32410 508 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 >Feature sequence0933 <1 846 gene locus_tag LOCUS_32420 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023994.1:pyrroline-5-carboxylate reductase >Feature sequence0934 >Feature sequence0935 907 1875 gene locus_tag LOCUS_32430 907 1875 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence0936 <2106 972 gene locus_tag LOCUS_32440 <2106 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928482.1:beta-propeller fold lactonase family protein >Feature sequence0937 1207 368 gene locus_tag LOCUS_32450 gene tcdA 1207 368 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208552.1 protein_id gnl|my_center|LOCUS_32450 1692 1312 gene locus_tag LOCUS_32460 1692 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence0938 >Feature sequence0939 533 1309 gene locus_tag LOCUS_32470 533 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 2091 1522 gene locus_tag LOCUS_32480 2091 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 >Feature sequence0940 >Feature sequence0941 1221 223 gene locus_tag LOCUS_32490 1221 223 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_32490 1943 1218 gene locus_tag LOCUS_32500 1943 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence0942 515 1741 gene locus_tag LOCUS_32510 515 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence0943 <1 748 gene locus_tag LOCUS_32520 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141821.1:pirin family protein 768 1307 gene locus_tag LOCUS_32530 768 1307 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence0944 1834 311 gene locus_tag LOCUS_32540 1834 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence0945 430 173 gene locus_tag LOCUS_32550 430 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 1174 1091 gene locus_tag LOCUS_t00110 1174 1091 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1249 1686 gene locus_tag LOCUS_32560 1249 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 1683 2048 gene locus_tag LOCUS_32570 1683 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence0946 147 1169 gene locus_tag LOCUS_32580 gene fabF 147 1169 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_32580 1263 1976 gene locus_tag LOCUS_32590 gene ubiE 1263 1976 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073882.1 protein_id gnl|my_center|LOCUS_32590 >Feature sequence0947 468 1277 gene locus_tag LOCUS_32600 468 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 >Feature sequence0948 >Feature sequence0949 133 507 gene locus_tag LOCUS_32610 133 507 CDS product sigma-B regulator RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704395.1 protein_id gnl|my_center|LOCUS_32610 521 949 gene locus_tag LOCUS_32620 521 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32620 946 1527 gene locus_tag LOCUS_32630 946 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32630 >Feature sequence0950 200 646 gene locus_tag LOCUS_32640 gene crcB 200 646 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_32640 719 1759 gene locus_tag LOCUS_32650 gene ruvB 719 1759 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211198.1 protein_id gnl|my_center|LOCUS_32650 >Feature sequence0951 511 966 gene locus_tag LOCUS_32660 gene tnpA 511 966 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_32660 1886 1389 gene locus_tag LOCUS_32670 1886 1389 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence0952 1683 1102 gene locus_tag LOCUS_32680 1683 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence0953 >Feature sequence0954 779 60 gene locus_tag LOCUS_32690 779 60 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_32690 1268 786 gene locus_tag LOCUS_32700 1268 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 <2042 1269 gene locus_tag LOCUS_32710 <2042 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963297.1:cytochrome c oxidase accessory protein CcoG >Feature sequence0955 199 600 gene locus_tag LOCUS_32720 199 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 702 899 gene locus_tag LOCUS_32730 702 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 927 1787 gene locus_tag LOCUS_32740 927 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32740 >Feature sequence0956 <2036 173 gene locus_tag LOCUS_32750 <2036 173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933069.1:ATP-dependent RecD-like DNA helicase >Feature sequence0957 803 138 gene locus_tag LOCUS_32760 803 138 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624900.1 protein_id gnl|my_center|LOCUS_32760 1676 807 gene locus_tag LOCUS_32770 gene pssA 1676 807 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence0958 1390 1674 gene locus_tag LOCUS_32780 1390 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 >Feature sequence0959 1879 557 gene locus_tag LOCUS_32790 1879 557 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_32790 >Feature sequence0960 >Feature sequence0961 1165 302 gene locus_tag LOCUS_32800 1165 302 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142419.1 protein_id gnl|my_center|LOCUS_32800 1468 1599 gene locus_tag LOCUS_32810 1468 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence0962 >Feature sequence0963 >Feature sequence0964 171 1274 gene locus_tag LOCUS_32820 171 1274 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence0965 141 989 gene locus_tag LOCUS_32830 141 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence0966 381 1166 gene locus_tag LOCUS_32840 381 1166 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_32840 1163 1405 gene locus_tag LOCUS_32850 gene purS 1163 1405 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_32850 >Feature sequence0967 1054 215 gene locus_tag LOCUS_32860 1054 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 1255 1064 gene locus_tag LOCUS_32870 1255 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 <1995 1266 gene locus_tag LOCUS_32880 <1995 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945510.1:alkaline phosphatase family protein >Feature sequence0968 222 103 gene locus_tag LOCUS_32890 222 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 731 222 gene locus_tag LOCUS_32900 gene rplJ 731 222 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630583.1 protein_id gnl|my_center|LOCUS_32900 1448 753 gene locus_tag LOCUS_32910 gene rplA 1448 753 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_32910 1921 1496 gene locus_tag LOCUS_32920 gene rplK 1921 1496 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence0969 561 142 gene locus_tag LOCUS_32930 561 142 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_32930 1406 594 gene locus_tag LOCUS_32940 1406 594 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 protein_id gnl|my_center|LOCUS_32940 >Feature sequence0970 494 111 gene locus_tag LOCUS_32950 494 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence0971 136 771 gene locus_tag LOCUS_32960 136 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence0972 <1979 855 gene locus_tag LOCUS_32970 <1979 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121201.1:excinuclease ABC subunit UvrC >Feature sequence0973 1856 264 gene locus_tag LOCUS_32980 1856 264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_32980 >Feature sequence0974 >Feature sequence0975 228 1166 gene locus_tag LOCUS_32990 228 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence0976 542 934 gene locus_tag LOCUS_33000 542 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence0977 >Feature sequence0978 >Feature sequence0979 >Feature sequence0980 1337 303 gene locus_tag LOCUS_33010 1337 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1674 1369 gene locus_tag LOCUS_33020 1674 1369 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965183.1 protein_id gnl|my_center|LOCUS_33020 >Feature sequence0981 1603 212 gene locus_tag LOCUS_33030 1603 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 1958 1773 gene locus_tag LOCUS_33040 1958 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 >Feature sequence0982 1677 952 gene locus_tag LOCUS_33050 1677 952 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence0983 387 1805 gene locus_tag LOCUS_33060 387 1805 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_33060 >Feature sequence0984 1162 104 gene locus_tag LOCUS_33070 gene fmt 1162 104 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_33070 >Feature sequence0985 <1 909 gene locus_tag LOCUS_33080 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113857.1:ABC transporter ATP-binding protein 906 1658 gene locus_tag LOCUS_33090 906 1658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_33090 >Feature sequence0986 <1 597 gene locus_tag LOCUS_33100 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921368.1:sulfatase-like hydrolase/transferase <1951 608 gene locus_tag LOCUS_33110 <1951 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000262613.1:methionine synthase >Feature sequence0987 >Feature sequence0988 <1 892 gene locus_tag LOCUS_33120 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172992225.1:lamin tail domain-containing protein >Feature sequence0989 1 177 gene locus_tag LOCUS_33130 1 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 219 1580 gene locus_tag LOCUS_33140 219 1580 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012416341.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence0990 1660 1085 gene locus_tag LOCUS_33150 1660 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence0991 <1 926 gene locus_tag LOCUS_33160 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103038682.1:sodium:solute symporter 1626 991 gene locus_tag LOCUS_33170 1626 991 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_33170 >Feature sequence0992 1625 879 gene locus_tag LOCUS_33180 1625 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence0993 369 1061 gene locus_tag LOCUS_33190 369 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 1698 1087 gene locus_tag LOCUS_33200 1698 1087 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393337.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence0994 <1930 294 gene locus_tag LOCUS_33210 <1930 294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966466.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence0995 1930 1511 gene locus_tag LOCUS_33220 1930 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence0996 <1 980 gene locus_tag LOCUS_33230 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942450.1:phosphoglucosamine mutase >Feature sequence0997 >Feature sequence0998 >Feature sequence0999 >Feature sequence1000 <1 1766 gene locus_tag LOCUS_33240 <1 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119313.1:sialidase family protein >Feature sequence1001 <1 1220 gene locus_tag LOCUS_33250 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929473.1:DUF1501 domain-containing protein 1889 1236 gene locus_tag LOCUS_33260 1889 1236 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091600.1 protein_id gnl|my_center|LOCUS_33260 >Feature sequence1002 >Feature sequence1003 <1 804 gene locus_tag LOCUS_33270 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator 956 1204 gene locus_tag LOCUS_33280 956 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence1004 >Feature sequence1005 <1907 1320 gene locus_tag LOCUS_33290 <1907 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141648.1:AAA family ATPase >Feature sequence1006 626 1645 gene locus_tag LOCUS_33300 626 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence1007 >Feature sequence1008 <1 890 gene locus_tag LOCUS_33310 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_221463383.1:ThuA domain-containing protein >Feature sequence1009 >Feature sequence1010 <1 882 gene locus_tag LOCUS_33320 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388592.1:leucine-rich repeat domain-containing protein >Feature sequence1011 865 455 gene locus_tag LOCUS_33330 865 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence1012 414 235 gene locus_tag LOCUS_33340 414 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 1798 377 gene locus_tag LOCUS_33350 1798 377 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence1013 704 1231 gene locus_tag LOCUS_33360 704 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 <1886 1373 gene locus_tag LOCUS_33370 <1886 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141949.1:4'-phosphopantetheinyl transferase superfamily protein >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 520 239 gene locus_tag LOCUS_33380 gene rplX 520 239 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_33380 889 524 gene locus_tag LOCUS_33390 gene rplN 889 524 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_33390 1197 916 gene locus_tag LOCUS_33400 1197 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 1370 1203 gene locus_tag LOCUS_33410 1370 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 1836 1417 gene locus_tag LOCUS_33420 gene rplP 1836 1417 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence1017 <1 954 gene locus_tag LOCUS_33430 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925413.1:elongation factor G 1631 1206 gene locus_tag LOCUS_33440 1631 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 >Feature sequence1018 1811 123 gene locus_tag LOCUS_33450 1811 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence1019 >Feature sequence1020 314 553 gene locus_tag LOCUS_33460 314 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 553 825 gene locus_tag LOCUS_33470 553 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 804 1394 gene locus_tag LOCUS_33480 804 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence1021 >Feature sequence1022 1093 239 gene locus_tag LOCUS_33490 1093 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 1255 1842 gene locus_tag LOCUS_33500 gene parA 1255 1842 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_33500 >Feature sequence1023 889 239 gene locus_tag LOCUS_33510 gene eda 889 239 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_33510 <1868 892 gene locus_tag LOCUS_33520 <1868 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258001.1:heterodisulfide reductase-related iron-sulfur binding cluster >Feature sequence1024 395 1843 gene locus_tag LOCUS_33530 395 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence1025 <1865 1273 gene locus_tag LOCUS_33540 <1865 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962330.1:aminopeptidase P family protein >Feature sequence1026 >Feature sequence1027 >Feature sequence1028 206 946 gene locus_tag LOCUS_33550 206 946 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_33550 977 1291 gene locus_tag LOCUS_33560 977 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 1722 1348 gene locus_tag LOCUS_33570 1722 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence1029 479 1345 gene locus_tag LOCUS_33580 479 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1342 1791 gene locus_tag LOCUS_33590 1342 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 >Feature sequence1030 <1 1420 gene locus_tag LOCUS_33600 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615421.1:sodium:solute symporter >Feature sequence1031 >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 1408 647 gene locus_tag LOCUS_33610 1408 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 1628 1341 gene locus_tag LOCUS_33620 1628 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 >Feature sequence1035 >Feature sequence1036 <1 528 gene locus_tag LOCUS_33630 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074000.1:alanine--glyoxylate aminotransferase family protein 606 1460 gene locus_tag LOCUS_33640 606 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 >Feature sequence1037 >Feature sequence1038 <1 925 gene locus_tag LOCUS_33650 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921690.1:acetylxylan esterase 1027 1566 gene locus_tag LOCUS_33660 1027 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 1563 1778 gene locus_tag LOCUS_33670 1563 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence1039 <1 1447 gene locus_tag LOCUS_33680 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121863.1:thioredoxin family protein >Feature sequence1040 1648 635 gene locus_tag LOCUS_33690 1648 635 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence1041 1573 194 gene locus_tag LOCUS_33700 1573 194 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_33700 1639 1712 gene locus_tag LOCUS_t00120 1639 1712 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1042 >Feature sequence1043 <1 638 gene locus_tag LOCUS_33710 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941029.1:peptidylprolyl isomerase 642 1730 gene locus_tag LOCUS_33720 642 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence1044 <1820 908 gene locus_tag LOCUS_33730 <1820 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615747.1:DUF1588 domain-containing protein >Feature sequence1045 <1 1630 gene locus_tag LOCUS_33740 <1 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072459.1:M2 family metallopeptidase >Feature sequence1046 423 37 gene locus_tag LOCUS_33750 423 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 1208 1378 gene locus_tag LOCUS_33760 1208 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence1047 812 12 gene locus_tag LOCUS_33770 812 12 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118414.1 protein_id gnl|my_center|LOCUS_33770 >Feature sequence1048 >Feature sequence1049 631 1374 gene locus_tag LOCUS_33780 631 1374 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_33780 1417 1650 gene locus_tag LOCUS_33790 1417 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 >Feature sequence1050 >Feature sequence1051 <1 784 gene locus_tag LOCUS_33800 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390663.1:response regulator transcription factor >Feature sequence1052 >Feature sequence1053 >Feature sequence1054 <1 1554 gene locus_tag LOCUS_33810 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920396.1:M61 family metallopeptidase >Feature sequence1055 <1 746 gene locus_tag LOCUS_33820 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876085.1:response regulator >Feature sequence1056 >Feature sequence1057 883 1458 gene locus_tag LOCUS_33830 883 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence1058 2 1468 gene locus_tag LOCUS_33840 2 1468 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085833.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence1059 >Feature sequence1060 338 556 gene locus_tag LOCUS_33850 338 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 726 1664 gene locus_tag LOCUS_33860 726 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence1061 >Feature sequence1062 <1767 1020 gene locus_tag LOCUS_33870 <1767 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542051.1:4-alpha-glucanotransferase >Feature sequence1063 46 393 gene locus_tag LOCUS_33880 46 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 509 1327 gene locus_tag LOCUS_33890 509 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 1349 1672 gene locus_tag LOCUS_33900 1349 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 >Feature sequence1064 >Feature sequence1065 <1 593 gene locus_tag LOCUS_33910 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000392363.1:YqgE/AlgH family protein 1568 723 gene locus_tag LOCUS_33920 1568 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 >Feature sequence1066 1159 632 gene locus_tag LOCUS_33930 1159 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence1067 <1 1469 gene locus_tag LOCUS_33940 <1 1469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037381.1:CocE/NonD family hydrolase >Feature sequence1068 836 1669 gene locus_tag LOCUS_33950 836 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence1069 149 319 gene locus_tag LOCUS_33960 149 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 531 1388 gene locus_tag LOCUS_33970 531 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 >Feature sequence1070 1422 157 gene locus_tag LOCUS_33980 1422 157 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983670.1 protein_id gnl|my_center|LOCUS_33980 >Feature sequence1071 <1 517 gene locus_tag LOCUS_33990 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436178.1:elongation factor G 548 856 gene locus_tag LOCUS_34000 gene rpsJ 548 856 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495158.1 protein_id gnl|my_center|LOCUS_34000 861 1514 gene locus_tag LOCUS_34010 gene rplC 861 1514 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886956.1 protein_id gnl|my_center|LOCUS_34010 >Feature sequence1072 <1 1473 gene locus_tag LOCUS_34020 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141062.1:VCBS repeat-containing protein >Feature sequence1073 >Feature sequence1074 <1 654 gene locus_tag LOCUS_34030 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118727.1:DUF1501 domain-containing protein <1744 678 gene locus_tag LOCUS_34040 <1744 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026984.1:alpha-L-fucosidase >Feature sequence1075 99 1460 gene locus_tag LOCUS_34050 99 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence1076 589 278 gene locus_tag LOCUS_34060 gene nuoK 589 278 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_34060 1162 614 gene locus_tag LOCUS_34070 1162 614 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813221.1 protein_id gnl|my_center|LOCUS_34070 <1738 1224 gene locus_tag LOCUS_34080 <1738 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196426.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence1077 >Feature sequence1078 >Feature sequence1079 954 730 gene locus_tag LOCUS_34090 954 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 1202 954 gene locus_tag LOCUS_34100 1202 954 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014628886.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence1080 >Feature sequence1081 464 1330 gene locus_tag LOCUS_34110 464 1330 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_34110 >Feature sequence1082 1727 486 gene locus_tag LOCUS_34120 1727 486 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence1083 >Feature sequence1084 484 1545 gene locus_tag LOCUS_34130 484 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 >Feature sequence1085 1282 392 gene locus_tag LOCUS_34140 gene ubiA 1282 392 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_34140 >Feature sequence1086 >Feature sequence1087 573 205 gene locus_tag LOCUS_34150 573 205 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047694002.1 protein_id gnl|my_center|LOCUS_34150 1015 677 gene locus_tag LOCUS_34160 1015 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 1546 1118 gene locus_tag LOCUS_34170 1546 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141565.1 protein_id gnl|my_center|LOCUS_34170 >Feature sequence1088 106 1644 gene locus_tag LOCUS_34180 106 1644 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence1089 >Feature sequence1090 >Feature sequence1091 >Feature sequence1092 172 1638 gene locus_tag LOCUS_34190 172 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence1093 382 1245 gene locus_tag LOCUS_34200 382 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 >Feature sequence1094 >Feature sequence1095 538 158 gene locus_tag LOCUS_34210 538 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 <1695 562 gene locus_tag LOCUS_34220 <1695 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922407.1:DUF1501 domain-containing protein >Feature sequence1096 >Feature sequence1097 >Feature sequence1098 1014 391 gene locus_tag LOCUS_34230 1014 391 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_34230 >Feature sequence1099 292 1134 gene locus_tag LOCUS_34240 292 1134 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_34240 <1682 1176 gene locus_tag LOCUS_34250 <1682 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009871779.1:DUF3604 domain-containing protein >Feature sequence1100 >Feature sequence1101 >Feature sequence1102 >Feature sequence1103 397 702 gene locus_tag LOCUS_34260 397 702 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403059.1 protein_id gnl|my_center|LOCUS_34260 1318 788 gene locus_tag LOCUS_34270 1318 788 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence1104 1162 140 gene locus_tag LOCUS_34280 1162 140 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804894.1 protein_id gnl|my_center|LOCUS_34280 >Feature sequence1105 987 304 gene locus_tag LOCUS_34290 987 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 1535 1161 gene locus_tag LOCUS_34300 1535 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 >Feature sequence1106 >Feature sequence1107 >Feature sequence1108 <1651 35 gene locus_tag LOCUS_34310 <1651 35 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189933.1:tetratricopeptide repeat protein >Feature sequence1109 749 985 gene locus_tag LOCUS_34320 749 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence1110 >Feature sequence1111 >Feature sequence1112 >Feature sequence1113 >Feature sequence1114 >Feature sequence1115 >Feature sequence1116 1531 554 gene locus_tag LOCUS_34330 1531 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence1117 <1 565 gene locus_tag LOCUS_34340 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922307.1:PQQ-like beta-propeller repeat protein >Feature sequence1118 683 1111 gene locus_tag LOCUS_34350 683 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence1119 >Feature sequence1120 >Feature sequence1121 209 757 gene locus_tag LOCUS_34360 209 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence1122 <1 1275 gene locus_tag LOCUS_34370 <1 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:tetratricopeptide repeat protein >Feature sequence1123 >Feature sequence1124 47 1540 gene locus_tag LOCUS_34380 47 1540 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence1125 249 1484 gene locus_tag LOCUS_34390 249 1484 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258689.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence1126 <1614 427 gene locus_tag LOCUS_34400 <1614 427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:efflux RND transporter permease subunit >Feature sequence1127 <1614 235 gene locus_tag LOCUS_34410 <1614 235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:efflux RND transporter permease subunit >Feature sequence1128 436 699 gene locus_tag LOCUS_34420 436 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 872 1237 gene locus_tag LOCUS_34430 872 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 >Feature sequence1129 >Feature sequence1130 >Feature sequence1131 1360 71 gene locus_tag LOCUS_34440 gene purD 1360 71 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_34440 >Feature sequence1132 393 1490 gene locus_tag LOCUS_34450 393 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 >Feature sequence1133 173 1507 gene locus_tag LOCUS_34460 gene ltrA 173 1507 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118084.1 protein_id gnl|my_center|LOCUS_34460 >Feature sequence1134 1423 89 gene locus_tag LOCUS_34470 gene ltrA 1423 89 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118084.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence1135 <1 1012 gene locus_tag LOCUS_34480 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011176711.1:type I-C CRISPR-associated endonuclease Cas1c 1023 1313 gene locus_tag LOCUS_34490 gene cas2 1023 1313 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_34490 1445 >1597 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctccccacgcgggagcg >Feature sequence1136 >Feature sequence1137 <1 770 gene locus_tag LOCUS_34500 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080577418.1:cytochrome c oxidase subunit I 800 1570 gene locus_tag LOCUS_34510 800 1570 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_34510 >Feature sequence1138 1342 722 gene locus_tag LOCUS_34520 1342 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence1139 656 186 gene locus_tag LOCUS_34530 656 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 1344 751 gene locus_tag LOCUS_34540 1344 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence1140 >Feature sequence1141 1584 1024 gene locus_tag LOCUS_34550 1584 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 >Feature sequence1142 863 183 gene locus_tag LOCUS_34560 863 183 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022565.1 protein_id gnl|my_center|LOCUS_34560 >Feature sequence1143 390 683 gene locus_tag LOCUS_34570 390 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 775 1182 gene locus_tag LOCUS_34580 775 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence1144 >Feature sequence1145 >Feature sequence1146 1029 73 gene locus_tag LOCUS_34590 1029 73 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_34590 >Feature sequence1147 <1 1097 gene locus_tag LOCUS_34600 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000829484.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence1148 >Feature sequence1149 >Feature sequence1150 >Feature sequence1151 >Feature sequence1152 >Feature sequence1153 150 818 gene locus_tag LOCUS_34610 150 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 <1558 882 gene locus_tag LOCUS_34620 <1558 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097520.1:galactose-1-phosphate uridylyltransferase >Feature sequence1154 256 104 gene locus_tag LOCUS_34630 256 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 744 253 gene locus_tag LOCUS_34640 744 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 1537 1001 gene locus_tag LOCUS_34650 1537 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 >Feature sequence1155 765 1079 gene locus_tag LOCUS_34660 765 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence1156 1510 890 gene locus_tag LOCUS_34670 1510 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 >Feature sequence1157 576 812 gene locus_tag LOCUS_34680 576 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 839 988 gene locus_tag LOCUS_34690 839 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 1266 1362 gene locus_tag LOCUS_t00130 1266 1362 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1158 254 1423 gene locus_tag LOCUS_34700 254 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence1159 >Feature sequence1160 1481 753 gene locus_tag LOCUS_34710 1481 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 >Feature sequence1161 >Feature sequence1162 1005 190 gene locus_tag LOCUS_34720 1005 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 <1542 996 gene locus_tag LOCUS_34730 <1542 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104680.1:PAS domain-containing protein >Feature sequence1163 >Feature sequence1164 >Feature sequence1165 >Feature sequence1166 <1 1054 gene locus_tag LOCUS_34740 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921574.1:PSD1 and planctomycete cytochrome C domain-containing protein >Feature sequence1167 >Feature sequence1168 <1 644 gene locus_tag LOCUS_34750 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922552.1:TAT-variant-translocated molybdopterin oxidoreductase >Feature sequence1169 378 587 gene locus_tag LOCUS_34760 378 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 584 850 gene locus_tag LOCUS_34770 584 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 >Feature sequence1170 302 907 gene locus_tag LOCUS_34780 302 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 >Feature sequence1171 1129 1491 gene locus_tag LOCUS_34790 1129 1491 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392298.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence1172 >Feature sequence1173 478 1365 gene locus_tag LOCUS_34800 478 1365 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_34800 >Feature sequence1174 477 256 gene locus_tag LOCUS_34810 477 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 1401 844 gene locus_tag LOCUS_34820 1401 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence1175 2 169 gene locus_tag LOCUS_34830 2 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 >Feature sequence1176 >Feature sequence1177 >Feature sequence1178 311 1306 gene locus_tag LOCUS_34840 311 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence1179 201 461 gene locus_tag LOCUS_34850 201 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 670 1497 gene locus_tag LOCUS_34860 670 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence1180 >Feature sequence1181 917 1438 gene locus_tag LOCUS_34870 917 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence1182 853 449 gene locus_tag LOCUS_34880 853 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 >Feature sequence1183 498 755 gene locus_tag LOCUS_34890 498 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 >Feature sequence1184 <1 855 gene locus_tag LOCUS_34900 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887944.1:ABC transporter ATP-binding protein >Feature sequence1185 >Feature sequence1186 >Feature sequence1187 862 530 gene locus_tag LOCUS_34910 gene rplV 862 530 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986651.1 protein_id gnl|my_center|LOCUS_34910 1153 872 gene locus_tag LOCUS_34920 gene rpsS 1153 872 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124500.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence1188 403 80 gene locus_tag LOCUS_34930 403 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 <1476 532 gene locus_tag LOCUS_34940 <1476 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328455.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence1189 >Feature sequence1190 >Feature sequence1191 <1464 123 gene locus_tag LOCUS_34950 <1464 123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811125.1:L-lactate permease >Feature sequence1192 1162 374 gene locus_tag LOCUS_34960 1162 374 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_34960 >Feature sequence1193 918 463 gene locus_tag LOCUS_34970 gene smpB 918 463 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_34970 1226 978 gene locus_tag LOCUS_34980 1226 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 >Feature sequence1194 >Feature sequence1195 >Feature sequence1196 370 98 gene locus_tag LOCUS_34990 370 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 1100 903 gene locus_tag LOCUS_35000 1100 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 >Feature sequence1197 >Feature sequence1198 >Feature sequence1199 <1 624 gene locus_tag LOCUS_35010 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939420.1:class II fructose-1,6-bisphosphate aldolase >Feature sequence1200 871 26 gene locus_tag LOCUS_35020 871 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 1347 1054 gene locus_tag LOCUS_35030 1347 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 >Feature sequence1201 >Feature sequence1202 809 964 gene locus_tag LOCUS_35040 809 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 >Feature sequence1203 88 1335 gene locus_tag LOCUS_35050 88 1335 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035678.1 protein_id gnl|my_center|LOCUS_35050 >Feature sequence1204 291 1328 gene locus_tag LOCUS_35060 291 1328 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227260.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence1205 >Feature sequence1206 744 187 gene locus_tag LOCUS_35070 744 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 <1419 754 gene locus_tag LOCUS_35080 <1419 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259389.1:lactate racemase domain-containing protein >Feature sequence1207 589 1068 gene locus_tag LOCUS_35090 589 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence1208 502 2 gene locus_tag LOCUS_35100 502 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 <1418 601 gene locus_tag LOCUS_35110 <1418 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964012.1:peptidylprolyl isomerase >Feature sequence1209 671 84 gene locus_tag LOCUS_35120 671 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 <1411 693 gene locus_tag LOCUS_35130 <1411 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929998.1:cyclolysin secretion protein CyaE >Feature sequence1210 >Feature sequence1211 <1 708 gene locus_tag LOCUS_35140 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943657.1:amidohydrolase family protein >Feature sequence1212 690 875 gene locus_tag LOCUS_35150 690 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence1213 >Feature sequence1214 >Feature sequence1215 >Feature sequence1216 338 117 gene locus_tag LOCUS_35160 338 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 790 437 gene locus_tag LOCUS_35170 790 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence1217 3 206 gene locus_tag LOCUS_35180 3 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 376 663 gene locus_tag LOCUS_35190 376 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 666 941 gene locus_tag LOCUS_35200 666 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 >Feature sequence1218 316 1014 gene locus_tag LOCUS_35210 316 1014 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_35210 >Feature sequence1219 <1 887 gene locus_tag LOCUS_35220 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392300.1:flagellar hook-basal body complex protein >Feature sequence1220 892 1116 gene locus_tag LOCUS_35230 892 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence1221 >Feature sequence1222 >Feature sequence1223 539 1069 gene locus_tag LOCUS_35240 539 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence1224 >Feature sequence1225 >Feature sequence1226 <1375 109 gene locus_tag LOCUS_35250 <1375 109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975332.1:carbamoyltransferase >Feature sequence1227 >Feature sequence1228 268 777 gene locus_tag LOCUS_35260 268 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 1146 685 gene locus_tag LOCUS_35270 1146 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 >Feature sequence1229 <1368 741 gene locus_tag LOCUS_35280 <1368 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000764715.1:dihydropteroate synthase >Feature sequence1230 847 1323 gene locus_tag LOCUS_35290 gene aroQ 847 1323 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328041.1 protein_id gnl|my_center|LOCUS_35290 >Feature sequence1231 >Feature sequence1232 >Feature sequence1233 >Feature sequence1234 407 745 gene locus_tag LOCUS_35300 407 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 1252 797 gene locus_tag LOCUS_35310 1252 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence1235 >Feature sequence1236 >Feature sequence1237 >Feature sequence1238 2 382 gene locus_tag LOCUS_35320 2 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 395 1030 gene locus_tag LOCUS_35330 gene hpt 395 1030 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_35330 >Feature sequence1239 63 602 gene locus_tag LOCUS_35340 gene tadA 63 602 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_35340 955 638 gene locus_tag LOCUS_35350 955 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence1240 486 1343 gene locus_tag LOCUS_35360 486 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence1241 >Feature sequence1242 >Feature sequence1243 <1 928 gene locus_tag LOCUS_35370 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163515044.1:metallophosphoesterase >Feature sequence1244 <1 1174 gene locus_tag LOCUS_35380 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937421.1:sigma-54 dependent transcriptional regulator >Feature sequence1245 735 872 gene locus_tag LOCUS_35390 735 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 >Feature sequence1246 793 17 gene locus_tag LOCUS_35400 793 17 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 protein_id gnl|my_center|LOCUS_35400 1248 931 gene locus_tag LOCUS_35410 1248 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 >Feature sequence1247 6 1028 gene locus_tag LOCUS_35420 6 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence1248 >Feature sequence1249 <1338 651 gene locus_tag LOCUS_35430 <1338 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816832.1:DUF1549 and DUF1553 domain-containing protein >Feature sequence1250 <1 1192 gene locus_tag LOCUS_35440 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein >Feature sequence1251 >Feature sequence1252 <1332 336 gene locus_tag LOCUS_35450 <1332 336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964314.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence1253 495 662 gene locus_tag LOCUS_35460 495 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 <1330 692 gene locus_tag LOCUS_35470 <1330 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165447204.1:sigma-54 dependent transcriptional regulator >Feature sequence1254 310 696 gene locus_tag LOCUS_35480 310 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 1329 832 gene locus_tag LOCUS_35490 1329 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence1255 331 1110 gene locus_tag LOCUS_35500 331 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence1256 1289 144 gene locus_tag LOCUS_35510 1289 144 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869047.1 protein_id gnl|my_center|LOCUS_35510 >Feature sequence1257 898 89 gene locus_tag LOCUS_35520 898 89 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_35520 1064 1282 gene locus_tag LOCUS_35530 1064 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 >Feature sequence1258 997 14 gene locus_tag LOCUS_35540 997 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 1277 1002 gene locus_tag LOCUS_35550 1277 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence1259 730 536 gene locus_tag LOCUS_35560 730 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence1260 16 603 gene locus_tag LOCUS_35570 16 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 >Feature sequence1261 >Feature sequence1262 <1305 447 gene locus_tag LOCUS_35580 <1305 447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705319.1:dihydrodipicolinate synthase family protein >Feature sequence1263 >Feature sequence1264 1232 777 gene locus_tag LOCUS_35590 1232 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence1265 >Feature sequence1266 <1 526 gene locus_tag LOCUS_35600 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125193.1:acetate--CoA ligase <1294 568 gene locus_tag LOCUS_35610 <1294 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125281.1:acetoacetate metabolism transcriptional regulator AtoC >Feature sequence1267 62 700 gene locus_tag LOCUS_35620 62 700 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_35620 700 1140 gene locus_tag LOCUS_35630 700 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence1268 >Feature sequence1269 <1 838 gene locus_tag LOCUS_35640 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008671603.1:DUF1501 domain-containing protein >Feature sequence1270 <1 789 gene locus_tag LOCUS_35650 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119052.1:DUF1501 domain-containing protein >Feature sequence1271 >Feature sequence1272 >Feature sequence1273 >Feature sequence1274 141 962 gene locus_tag LOCUS_35660 141 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence1275 >Feature sequence1276 >Feature sequence1277 329 598 gene locus_tag LOCUS_35670 gene rpsN 329 598 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_35670 624 989 gene locus_tag LOCUS_35680 gene rpsH 624 989 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183034.1 protein_id gnl|my_center|LOCUS_35680 >Feature sequence1278 >Feature sequence1279 619 1113 gene locus_tag LOCUS_35690 619 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence1280 >Feature sequence1281 225 1136 gene locus_tag LOCUS_35700 225 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence1282 >Feature sequence1283 >Feature sequence1284 <1 789 gene locus_tag LOCUS_35710 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838671.1:ATP-binding cassette domain-containing protein >Feature sequence1285 <1 990 gene locus_tag LOCUS_35720 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:AAA-like domain-containing protein >Feature sequence1286 813 76 gene locus_tag LOCUS_35730 813 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 1031 810 gene locus_tag LOCUS_35740 1031 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 >Feature sequence1287 >Feature sequence1288 843 562 gene locus_tag LOCUS_35750 gene rplW 843 562 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_35750 >Feature sequence1289 >Feature sequence1290 389 249 gene locus_tag LOCUS_35760 389 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 902 390 gene locus_tag LOCUS_35770 902 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35770 >Feature sequence1291 <1 818 gene locus_tag LOCUS_35780 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532793.1:histone deacetylase family protein 1157 882 gene locus_tag LOCUS_35790 1157 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 >Feature sequence1292 >Feature sequence1293 >Feature sequence1294 >Feature sequence1295 597 1169 gene locus_tag LOCUS_35800 597 1169 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence1296 1031 273 gene locus_tag LOCUS_35810 1031 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence1297 917 159 gene locus_tag LOCUS_35820 917 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 >Feature sequence1298 287 463 gene locus_tag LOCUS_35830 287 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 962 477 gene locus_tag LOCUS_35840 962 477 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_35840 >Feature sequence1299 196 792 gene locus_tag LOCUS_35850 196 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence1300 >Feature sequence1301 779 219 gene locus_tag LOCUS_35860 779 219 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence1302 >Feature sequence1303 >Feature sequence1304 >Feature sequence1305 170 637 gene locus_tag LOCUS_35870 170 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 721 1128 gene locus_tag LOCUS_35880 721 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 >Feature sequence1306 3 791 gene locus_tag LOCUS_35890 3 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence1307 >Feature sequence1308 >Feature sequence1309 >Feature sequence1310 454 1074 gene locus_tag LOCUS_35900 454 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 >Feature sequence1311 >Feature sequence1312 780 118 gene locus_tag LOCUS_35910 gene aat 780 118 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence1313 990 211 gene locus_tag LOCUS_35920 990 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 >Feature sequence1314 >Feature sequence1315 >Feature sequence1316 >Feature sequence1317 758 303 gene locus_tag LOCUS_35930 758 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 1039 788 gene locus_tag LOCUS_35940 1039 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 >Feature sequence1318 <1 748 gene locus_tag LOCUS_35950 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120799.1:sulfatase 748 882 gene locus_tag LOCUS_35960 748 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence1319 >Feature sequence1320 >Feature sequence1321 >Feature sequence1322 >Feature sequence1323 >Feature sequence1324 >Feature sequence1325 487 23 gene locus_tag LOCUS_35970 487 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 913 536 gene locus_tag LOCUS_35980 913 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence1326 412 648 gene locus_tag LOCUS_35990 412 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 645 917 gene locus_tag LOCUS_36000 645 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 >Feature sequence1327 151 1155 gene locus_tag LOCUS_36010 151 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 >Feature sequence1328 >Feature sequence1329 376 83 gene locus_tag LOCUS_36020 376 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 <1152 535 gene locus_tag LOCUS_36030 <1152 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039071.1:glycosyltransferase family 2 protein >Feature sequence1330 >Feature sequence1331 >Feature sequence1332 582 385 gene locus_tag LOCUS_36040 582 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1007 660 gene locus_tag LOCUS_36050 1007 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence1333 >Feature sequence1334 >Feature sequence1335 >Feature sequence1336 <1 1003 gene locus_tag LOCUS_36060 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099259285.1:Do family serine endopeptidase >Feature sequence1337 >Feature sequence1338 >Feature sequence1339 >Feature sequence1340 >Feature sequence1341 437 510 gene locus_tag LOCUS_t00140 437 510 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1048 563 gene locus_tag LOCUS_36070 1048 563 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_36070 >Feature sequence1342 2 277 gene locus_tag LOCUS_36080 2 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence1343 >Feature sequence1344 >Feature sequence1345 <1126 321 gene locus_tag LOCUS_36090 <1126 321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939946.1:hybrid sensor histidine kinase/response regulator >Feature sequence1346 1053 325 gene locus_tag LOCUS_36100 1053 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence1347 >Feature sequence1348 >Feature sequence1349 510 115 gene locus_tag LOCUS_36110 510 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 <1124 507 gene locus_tag LOCUS_36120 <1124 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005463605.1:molybdopterin-dependent oxidoreductase >Feature sequence1350 >Feature sequence1351 104 1039 gene locus_tag LOCUS_36130 104 1039 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940307.1 protein_id gnl|my_center|LOCUS_36130 >Feature sequence1352 >Feature sequence1353 >Feature sequence1354 >Feature sequence1355 919 143 gene locus_tag LOCUS_36140 919 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 >Feature sequence1356 >Feature sequence1357 >Feature sequence1358 >Feature sequence1359 2 601 gene locus_tag LOCUS_36150 2 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 >Feature sequence1360 >Feature sequence1361 <1101 383 gene locus_tag LOCUS_36160 <1101 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188980.1:L-threonylcarbamoyladenylate synthase >Feature sequence1362 >Feature sequence1363 >Feature sequence1364 >Feature sequence1365 562 738 gene locus_tag LOCUS_36170 562 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 >Feature sequence1366 >Feature sequence1367 198 998 gene locus_tag LOCUS_36180 198 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 >Feature sequence1368 >Feature sequence1369 >Feature sequence1370 284 54 gene locus_tag LOCUS_36190 284 54 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_36190 >Feature sequence1371 >Feature sequence1372 >Feature sequence1373 539 165 gene locus_tag LOCUS_36200 539 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence1374 <1 764 gene locus_tag LOCUS_36210 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443968.1:glycosyltransferase family 9 protein >Feature sequence1375 >Feature sequence1376 >Feature sequence1377 >Feature sequence1378 216 983 gene locus_tag LOCUS_36220 216 983 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence1379 >Feature sequence1380 >Feature sequence1381 >Feature sequence1382 654 301 gene locus_tag LOCUS_36230 654 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence1383 >Feature sequence1384 <1 917 gene locus_tag LOCUS_36240 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027389.1:DEAD/DEAH box helicase family protein >Feature sequence1385 347 1006 gene locus_tag LOCUS_36250 347 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 >Feature sequence1386 <1 1049 gene locus_tag LOCUS_36260 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122785.1:hemolysin D >Feature sequence1387 >Feature sequence1388 483 352 gene locus_tag LOCUS_36270 483 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 590 856 gene locus_tag LOCUS_36280 590 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence1389 >Feature sequence1390 >Feature sequence1391 >Feature sequence1392 >Feature sequence1393 >Feature sequence1394 <1 547 gene locus_tag LOCUS_36290 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324175.1:Gfo/Idh/MocA family oxidoreductase 1051 605 gene locus_tag LOCUS_36300 1051 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 >Feature sequence1395 773 390 gene locus_tag LOCUS_36310 773 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 >Feature sequence1396 539 342 gene locus_tag LOCUS_36320 539 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 >Feature sequence1397 551 736 gene locus_tag LOCUS_36330 551 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence1398 <1 548 gene locus_tag LOCUS_36340 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence1399 <1 684 gene locus_tag LOCUS_36350 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102426.1:two-component system sensor histidine kinase GacS 725 874 gene locus_tag LOCUS_36360 725 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 >Feature sequence1400 >Feature sequence1401 <1 593 gene locus_tag LOCUS_36370 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein 1038 709 gene locus_tag LOCUS_36380 1038 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence1402 >Feature sequence1403 >Feature sequence1404 675 352 gene locus_tag LOCUS_36390 675 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence1405 >Feature sequence1406 118 858 gene locus_tag LOCUS_36400 118 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373713.1 protein_id gnl|my_center|LOCUS_36400 >Feature sequence1407 <1031 367 gene locus_tag LOCUS_36410 <1031 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459133.1:cell wall-binding repeat-containing protein >Feature sequence1408 >Feature sequence1409 >Feature sequence1410 >Feature sequence1411 >Feature sequence1412 >Feature sequence1413 597 349 gene locus_tag LOCUS_36420 597 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 >Feature sequence1414 <1 766 gene locus_tag LOCUS_36430 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766163.1:efflux RND transporter permease subunit >Feature sequence1415 763 164 gene locus_tag LOCUS_36440 763 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 >Feature sequence1416 >Feature sequence1417 <1011 163 gene locus_tag LOCUS_36450 <1011 163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921983.1:DUF1553 domain-containing protein >Feature sequence1418 >Feature sequence1419 <1 520 gene locus_tag LOCUS_36460 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942751.1:BREX-1 system adenine-specific DNA-methyltransferase PglX >Feature sequence1420 <1 531 gene locus_tag LOCUS_36470 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964010.1:MBOAT family protein >Feature sequence1421 <1006 59 gene locus_tag LOCUS_36480 <1006 59 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099263747.1:DUF1080 domain-containing protein >Feature sequence1422 >Feature sequence1423