>Feature sequence01 1008 169 gene locus_tag LOCUS_00010 gene folD 1008 169 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_00010 2330 1005 gene locus_tag LOCUS_00020 gene purD 2330 1005 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101962.1 protein_id gnl|my_center|LOCUS_00020 3864 2335 gene locus_tag LOCUS_00030 gene purH 3864 2335 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_00030 4421 3861 gene locus_tag LOCUS_00040 gene purN 4421 3861 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 protein_id gnl|my_center|LOCUS_00040 5602 4532 gene locus_tag LOCUS_00050 gene purM 5602 4532 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_00050 6963 5605 gene locus_tag LOCUS_00060 gene purF 6963 5605 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989807.1 protein_id gnl|my_center|LOCUS_00060 7688 6966 gene locus_tag LOCUS_00070 7688 6966 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_00070 11434 7685 gene locus_tag LOCUS_00080 11434 7685 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263132.1 protein_id gnl|my_center|LOCUS_00080 11956 11486 gene locus_tag LOCUS_00090 gene purE 11956 11486 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_00090 14046 12136 gene locus_tag LOCUS_00100 gene dnaK 14046 12136 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_00100 14165 14884 gene locus_tag LOCUS_00110 14165 14884 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_00110 15851 14790 gene locus_tag LOCUS_00120 15851 14790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16899 15970 gene locus_tag LOCUS_00130 16899 15970 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_00130 17818 16886 gene locus_tag LOCUS_00140 17818 16886 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108649.1 protein_id gnl|my_center|LOCUS_00140 20547 17815 gene locus_tag LOCUS_00150 gene leuS 20547 17815 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_00150 21770 20553 gene locus_tag LOCUS_00160 21770 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22287 21763 gene locus_tag LOCUS_00170 22287 21763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23250 22312 gene locus_tag LOCUS_00180 23250 22312 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_00180 24161 23247 gene locus_tag LOCUS_00190 24161 23247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25529 24210 gene locus_tag LOCUS_00200 25529 24210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28094 25548 gene locus_tag LOCUS_00210 gene gyrA 28094 25548 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_00210 28194 28709 gene locus_tag LOCUS_00220 28194 28709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28709 29659 gene locus_tag LOCUS_00230 28709 29659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30525 29656 gene locus_tag LOCUS_00240 30525 29656 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_00240 30909 30535 gene locus_tag LOCUS_00250 30909 30535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31416 30913 gene locus_tag LOCUS_00260 31416 30913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32514 31426 gene locus_tag LOCUS_00270 gene prfA 32514 31426 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_00270 33655 32522 gene locus_tag LOCUS_00280 33655 32522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_00280 34967 33669 gene locus_tag LOCUS_00290 34967 33669 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_00290 35019 35810 gene locus_tag LOCUS_00300 gene mazG 35019 35810 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_00300 36333 35797 gene locus_tag LOCUS_00310 36333 35797 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_00310 36809 36330 gene locus_tag LOCUS_00320 36809 36330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37507 36812 gene locus_tag LOCUS_00330 37507 36812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_00330 37599 38630 gene locus_tag LOCUS_00340 37599 38630 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_00340 38631 39650 gene locus_tag LOCUS_00350 38631 39650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 39652 41025 gene locus_tag LOCUS_00360 39652 41025 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_00360 40988 42301 gene locus_tag LOCUS_00370 40988 42301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44123 42285 gene locus_tag LOCUS_00380 44123 42285 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_00380 44256 45320 gene locus_tag LOCUS_00390 44256 45320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45342 46076 gene locus_tag LOCUS_00400 45342 46076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 47681 46674 gene locus_tag LOCUS_00410 gene pta 47681 46674 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_00410 48893 47685 gene locus_tag LOCUS_00420 48893 47685 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_00420 48977 50035 gene locus_tag LOCUS_00430 48977 50035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50881 50078 gene locus_tag LOCUS_00440 50881 50078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 51453 50881 gene locus_tag LOCUS_00450 51453 50881 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_00450 52474 51476 gene locus_tag LOCUS_00460 52474 51476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 52564 53220 gene locus_tag LOCUS_00470 52564 53220 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_00470 53217 55631 gene locus_tag LOCUS_00480 53217 55631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55639 56130 gene locus_tag LOCUS_00490 55639 56130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 56127 59042 gene locus_tag LOCUS_00500 56127 59042 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_00500 59039 61891 gene locus_tag LOCUS_00510 59039 61891 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_00510 61888 63000 gene locus_tag LOCUS_00520 61888 63000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63853 63377 gene locus_tag LOCUS_00530 63853 63377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 64869 63856 gene locus_tag LOCUS_00540 64869 63856 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_00540 64944 66956 gene locus_tag LOCUS_00550 64944 66956 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_00550 66953 67528 gene locus_tag LOCUS_00560 66953 67528 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_00560 67530 67913 gene locus_tag LOCUS_00570 67530 67913 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_00570 67894 68598 gene locus_tag LOCUS_00580 67894 68598 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_00580 68784 69656 gene locus_tag LOCUS_00590 68784 69656 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_00590 69661 70683 gene locus_tag LOCUS_00600 69661 70683 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_00600 70696 72405 gene locus_tag LOCUS_00610 70696 72405 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_00610 73109 72408 gene locus_tag LOCUS_00620 73109 72408 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582813.1 protein_id gnl|my_center|LOCUS_00620 73453 73322 gene locus_tag LOCUS_00630 73453 73322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73950 73723 gene locus_tag LOCUS_00640 73950 73723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 74338 74039 gene locus_tag LOCUS_00650 74338 74039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 77148 74338 gene locus_tag LOCUS_00660 77148 74338 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_00660 78025 77204 gene locus_tag LOCUS_00670 78025 77204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 78495 78025 gene locus_tag LOCUS_00680 gene coaD 78495 78025 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_00680 79151 78483 gene locus_tag LOCUS_00690 gene ung 79151 78483 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972337.1 protein_id gnl|my_center|LOCUS_00690 81547 79151 gene locus_tag LOCUS_00700 gene lon 81547 79151 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_00700 81706 81981 gene locus_tag LOCUS_00710 81706 81981 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_00710 82160 83728 gene locus_tag LOCUS_00720 82160 83728 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_00720 84928 83744 gene locus_tag LOCUS_00730 84928 83744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_00730 86315 85056 gene locus_tag LOCUS_00740 gene fabF 86315 85056 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_00740 87304 86357 gene locus_tag LOCUS_00750 87304 86357 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_00750 88963 87347 gene locus_tag LOCUS_00760 gene lnt 88963 87347 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_00760 90177 88960 gene locus_tag LOCUS_00770 90177 88960 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_00770 90997 90185 gene locus_tag LOCUS_00780 90997 90185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 91505 91035 gene locus_tag LOCUS_00790 91505 91035 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_00790 94421 91512 gene locus_tag LOCUS_00800 94421 91512 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_00800 95018 94455 gene locus_tag LOCUS_00810 gene ruvC 95018 94455 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_00810 96282 95011 gene locus_tag LOCUS_00820 gene serS 96282 95011 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_00820 96622 96362 gene locus_tag LOCUS_00830 gene rpmA 96622 96362 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_00830 96939 96628 gene locus_tag LOCUS_00840 gene rplU 96939 96628 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_00840 97107 98255 gene locus_tag LOCUS_00850 97107 98255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 98252 98953 gene locus_tag LOCUS_00860 98252 98953 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_00860 99011 99205 gene locus_tag LOCUS_00870 gene rpsU 99011 99205 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_00870 99895 99257 gene locus_tag LOCUS_00880 99895 99257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 101277 99910 gene locus_tag LOCUS_00890 101277 99910 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108647.1 protein_id gnl|my_center|LOCUS_00890 105592 101375 gene locus_tag LOCUS_00900 105592 101375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 106826 105708 gene locus_tag LOCUS_00910 106826 105708 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 protein_id gnl|my_center|LOCUS_00910 108401 106989 gene locus_tag LOCUS_00920 108401 106989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 111421 108410 gene locus_tag LOCUS_00930 111421 108410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 111691 111560 gene locus_tag LOCUS_00940 111691 111560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 115095 111703 gene locus_tag LOCUS_00950 115095 111703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 117430 115118 gene locus_tag LOCUS_00960 117430 115118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 119237 117441 gene locus_tag LOCUS_00970 119237 117441 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_00970 122492 119250 gene locus_tag LOCUS_00980 122492 119250 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_00980 123376 122528 gene locus_tag LOCUS_00990 123376 122528 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815888.1 protein_id gnl|my_center|LOCUS_00990 124157 123396 gene locus_tag LOCUS_01000 124157 123396 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108968.1 protein_id gnl|my_center|LOCUS_01000 124370 127093 gene locus_tag LOCUS_01010 124370 127093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 127108 128427 gene locus_tag LOCUS_01020 127108 128427 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_01020 128441 130258 gene locus_tag LOCUS_01030 gene fucI 128441 130258 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_01030 131421 130495 gene locus_tag LOCUS_01040 131421 130495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 132393 131731 gene locus_tag LOCUS_01050 132393 131731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 132576 133835 gene locus_tag LOCUS_01060 132576 133835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 135346 133832 gene locus_tag LOCUS_01070 135346 133832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 136075 135521 gene locus_tag LOCUS_01080 136075 135521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 136175 136492 gene locus_tag LOCUS_01090 136175 136492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 137202 137444 gene locus_tag LOCUS_01100 137202 137444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 138975 139262 gene locus_tag LOCUS_01110 138975 139262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 144373 139793 gene locus_tag LOCUS_01120 144373 139793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 145433 144378 gene locus_tag LOCUS_01130 145433 144378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 146461 145484 gene locus_tag LOCUS_01140 146461 145484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 147727 146537 gene locus_tag LOCUS_01150 147727 146537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 148920 147781 gene locus_tag LOCUS_01160 148920 147781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 150311 148917 gene locus_tag LOCUS_01170 150311 148917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 150471 151100 gene locus_tag LOCUS_01180 gene upp 150471 151100 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966163.1 protein_id gnl|my_center|LOCUS_01180 152324 151158 gene locus_tag LOCUS_01190 152324 151158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 152752 152336 gene locus_tag LOCUS_01200 152752 152336 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_01200 153159 153078 gene locus_tag LOCUS_t00010 153159 153078 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 156695 153183 gene locus_tag LOCUS_01210 156695 153183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 158321 156699 gene locus_tag LOCUS_01220 158321 156699 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_01220 159368 158343 gene locus_tag LOCUS_01230 gene prfB 159368 158343 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800204.1 protein_id gnl|my_center|LOCUS_01230 159430 160119 gene locus_tag LOCUS_01240 159430 160119 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_01240 161098 160094 gene locus_tag LOCUS_01250 161098 160094 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203721.1 protein_id gnl|my_center|LOCUS_01250 161940 161095 gene locus_tag LOCUS_01260 161940 161095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 162689 161937 gene locus_tag LOCUS_01270 gene murI 162689 161937 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_01270 163770 162904 gene locus_tag LOCUS_01280 163770 162904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 165746 164415 gene locus_tag LOCUS_01290 165746 164415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_01290 167863 165743 gene locus_tag LOCUS_01300 167863 165743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 168434 167865 gene locus_tag LOCUS_01310 168434 167865 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203496.1 protein_id gnl|my_center|LOCUS_01310 169223 168438 gene locus_tag LOCUS_01320 169223 168438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 169327 169403 gene locus_tag LOCUS_t00020 169327 169403 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 169486 170319 gene locus_tag LOCUS_01330 169486 170319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 170783 170316 gene locus_tag LOCUS_01340 gene greA 170783 170316 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_01340 171719 170793 gene locus_tag LOCUS_01350 171719 170793 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_01350 171848 172927 gene locus_tag LOCUS_01360 171848 172927 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_01360 172927 173433 gene locus_tag LOCUS_01370 172927 173433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 174294 175424 gene locus_tag LOCUS_01380 174294 175424 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965437.1 protein_id gnl|my_center|LOCUS_01380 175424 176587 gene locus_tag LOCUS_01390 175424 176587 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_01390 176630 177535 gene locus_tag LOCUS_01400 176630 177535 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_01400 177850 177557 gene locus_tag LOCUS_01410 177850 177557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 179682 177931 gene locus_tag LOCUS_01420 179682 177931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 180764 179694 gene locus_tag LOCUS_01430 180764 179694 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201945.1 protein_id gnl|my_center|LOCUS_01430 181798 180767 gene locus_tag LOCUS_01440 181798 180767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 183166 181799 gene locus_tag LOCUS_01450 183166 181799 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_01450 183239 184297 gene locus_tag LOCUS_01460 183239 184297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 184310 184954 gene locus_tag LOCUS_01470 184310 184954 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_01470 184956 185534 gene locus_tag LOCUS_01480 184956 185534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 185522 186352 gene locus_tag LOCUS_01490 185522 186352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 186349 188544 gene locus_tag LOCUS_01500 186349 188544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 188550 188855 gene locus_tag LOCUS_01510 188550 188855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 189419 188865 gene locus_tag LOCUS_01520 gene def 189419 188865 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_01520 189838 189416 gene locus_tag LOCUS_01530 gene ruvX 189838 189416 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_01530 189862 190710 gene locus_tag LOCUS_01540 189862 190710 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_01540 190717 191868 gene locus_tag LOCUS_01550 190717 191868 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_01550 191880 193208 gene locus_tag LOCUS_01560 gene rseP 191880 193208 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_01560 193215 194213 gene locus_tag LOCUS_01570 193215 194213 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_01570 194261 194333 gene locus_tag LOCUS_t00030 194261 194333 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 194358 194612 gene locus_tag LOCUS_01580 gene rpsT 194358 194612 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_01580 194649 194722 gene locus_tag LOCUS_t00040 194649 194722 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 195991 194912 gene locus_tag LOCUS_01590 195991 194912 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_01590 196836 195991 gene locus_tag LOCUS_01600 196836 195991 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_01600 197996 196833 gene locus_tag LOCUS_01610 197996 196833 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_01610 198826 197993 gene locus_tag LOCUS_01620 198826 197993 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_01620 199397 198819 gene locus_tag LOCUS_01630 gene rfbC 199397 198819 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_01630 200286 199387 gene locus_tag LOCUS_01640 gene rfbD 200286 199387 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_01640 200318 200800 gene locus_tag LOCUS_01650 gene rnhA 200318 200800 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_01650 200797 201885 gene locus_tag LOCUS_01660 gene pdxA 200797 201885 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_01660 203405 201873 gene locus_tag LOCUS_01670 203405 201873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 203714 204466 gene locus_tag LOCUS_01680 gene preA 203714 204466 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_01680 204932 204477 gene locus_tag LOCUS_01690 204932 204477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 207447 205009 gene locus_tag LOCUS_01700 207447 205009 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_01700 208525 207440 gene locus_tag LOCUS_01710 gene rlmN 208525 207440 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_01710 208602 209633 gene locus_tag LOCUS_01720 gene recA 208602 209633 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_01720 209633 210781 gene locus_tag LOCUS_01730 gene trpS 209633 210781 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760790.1 protein_id gnl|my_center|LOCUS_01730 211357 210785 gene locus_tag LOCUS_01740 211357 210785 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_01740 211413 212123 gene locus_tag LOCUS_01750 gene rsmI 211413 212123 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784666.1 protein_id gnl|my_center|LOCUS_01750 212139 213086 gene locus_tag LOCUS_01760 212139 213086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 213932 213114 gene locus_tag LOCUS_01770 gene xerD 213932 213114 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761920.1 protein_id gnl|my_center|LOCUS_01770 214036 215313 gene locus_tag LOCUS_01780 214036 215313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 215428 216009 gene locus_tag LOCUS_01790 215428 216009 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_01790 216022 216600 gene locus_tag LOCUS_01800 gene pth 216022 216600 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_01800 216718 216894 gene locus_tag LOCUS_01810 216718 216894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 217039 218754 gene locus_tag LOCUS_01820 217039 218754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 218751 219152 gene locus_tag LOCUS_01830 218751 219152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 219924 219169 gene locus_tag LOCUS_01840 gene tpiA 219924 219169 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_01840 220087 221376 gene locus_tag LOCUS_01850 gene tyrS 220087 221376 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_01850 221379 221726 gene locus_tag LOCUS_01860 gene rbfA 221379 221726 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_01860 221723 222913 gene locus_tag LOCUS_01870 221723 222913 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_01870 222175 222085 gene locus_tag LOCUS_t00050 222175 222085 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 223043 224461 gene locus_tag LOCUS_01880 gene rmuC 223043 224461 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_01880 224468 225838 gene locus_tag LOCUS_01890 224468 225838 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_01890 227940 225871 gene locus_tag LOCUS_01900 227940 225871 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_01900 228204 228052 gene locus_tag LOCUS_01910 gene rpmH 228204 228052 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_01910 229009 228230 gene locus_tag LOCUS_01920 229009 228230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 229839 229003 gene locus_tag LOCUS_01930 229839 229003 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_01930 231313 229832 gene locus_tag LOCUS_01940 231313 229832 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020541.1 protein_id gnl|my_center|LOCUS_01940 231903 231310 gene locus_tag LOCUS_01950 231903 231310 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_01950 234508 231875 gene locus_tag LOCUS_01960 gene polA 234508 231875 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408063.1 protein_id gnl|my_center|LOCUS_01960 234574 235008 gene locus_tag LOCUS_01970 234574 235008 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_01970 235034 235107 gene locus_tag LOCUS_t00060 235034 235107 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 235211 235483 gene locus_tag LOCUS_01980 235211 235483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 235480 235929 gene locus_tag LOCUS_01990 235480 235929 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_01990 237580 235907 gene locus_tag LOCUS_02000 gene ettA 237580 235907 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_02000 240343 237593 gene locus_tag LOCUS_02010 240343 237593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 241653 240367 gene locus_tag LOCUS_02020 gene nusA 241653 240367 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_02020 241929 241666 gene locus_tag LOCUS_02030 241929 241666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 242086 243489 gene locus_tag LOCUS_02040 242086 243489 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582782.1 protein_id gnl|my_center|LOCUS_02040 244451 243732 gene locus_tag LOCUS_02050 244451 243732 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_02050 245308 244496 gene locus_tag LOCUS_02060 gene lpxA 245308 244496 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_02060 246209 245313 gene locus_tag LOCUS_02070 246209 245313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 247240 246251 gene locus_tag LOCUS_02080 gene lpxD 247240 246251 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202193.1 protein_id gnl|my_center|LOCUS_02080 249016 247247 gene locus_tag LOCUS_02090 249016 247247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 249200 249423 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctgcgggagtaggaactgc 250251 251729 gene locus_tag LOCUS_02100 gene proS 250251 251729 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_02100 251740 252747 gene locus_tag LOCUS_02110 251740 252747 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_02110 252747 253640 gene locus_tag LOCUS_02120 252747 253640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 253652 254995 gene locus_tag LOCUS_02130 gene hisS 253652 254995 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_02130 254977 256638 gene locus_tag LOCUS_02140 254977 256638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 256968 256651 gene locus_tag LOCUS_02150 256968 256651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 257035 257110 gene locus_tag LOCUS_t00070 257035 257110 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 257241 258413 gene locus_tag LOCUS_02160 257241 258413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 258605 258429 gene locus_tag LOCUS_02170 258605 258429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 259117 258926 gene locus_tag LOCUS_02180 259117 258926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 259734 259114 gene locus_tag LOCUS_02190 259734 259114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 260206 259718 gene locus_tag LOCUS_02200 260206 259718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 260476 260273 gene locus_tag LOCUS_02210 260476 260273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 262019 260367 gene locus_tag LOCUS_02220 262019 260367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 262441 262028 gene locus_tag LOCUS_02230 262441 262028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 268637 262566 gene locus_tag LOCUS_02240 268637 262566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 269096 268650 gene locus_tag LOCUS_02250 269096 268650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 269428 269093 gene locus_tag LOCUS_02260 269428 269093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 269802 269431 gene locus_tag LOCUS_02270 269802 269431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 271092 269812 gene locus_tag LOCUS_02280 271092 269812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 273127 271094 gene locus_tag LOCUS_02290 273127 271094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 276324 273124 gene locus_tag LOCUS_02300 276324 273124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 276834 276412 gene locus_tag LOCUS_02310 276834 276412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 277380 276946 gene locus_tag LOCUS_02320 277380 276946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 277893 277510 gene locus_tag LOCUS_02330 277893 277510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 278528 277983 gene locus_tag LOCUS_02340 278528 277983 CDS product holin-associated N-acetylmuramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337867.1 protein_id gnl|my_center|LOCUS_02340 279061 278525 gene locus_tag LOCUS_02350 279061 278525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 279931 279068 gene locus_tag LOCUS_02360 279931 279068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 280799 279936 gene locus_tag LOCUS_02370 280799 279936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 282368 280833 gene locus_tag LOCUS_02380 282368 280833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 282681 282361 gene locus_tag LOCUS_02390 282681 282361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 284627 282957 gene locus_tag LOCUS_02400 284627 282957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962949.1 protein_id gnl|my_center|LOCUS_02400 285293 284631 gene locus_tag LOCUS_02410 285293 284631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 285627 285295 gene locus_tag LOCUS_02420 285627 285295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 286066 285620 gene locus_tag LOCUS_02430 286066 285620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 287022 286450 gene locus_tag LOCUS_02440 287022 286450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 288948 287083 gene locus_tag LOCUS_02450 288948 287083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 289837 288962 gene locus_tag LOCUS_02460 289837 288962 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962964.1 protein_id gnl|my_center|LOCUS_02460 290272 289898 gene locus_tag LOCUS_02470 290272 289898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 290916 290368 gene locus_tag LOCUS_02480 290916 290368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 292702 291953 gene locus_tag LOCUS_02490 292702 291953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 293034 292705 gene locus_tag LOCUS_02500 293034 292705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 293324 293034 gene locus_tag LOCUS_02510 293324 293034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 293772 293395 gene locus_tag LOCUS_02520 293772 293395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 293969 293769 gene locus_tag LOCUS_02530 293969 293769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 294349 293966 gene locus_tag LOCUS_02540 294349 293966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 294971 294342 gene locus_tag LOCUS_02550 294971 294342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 295203 294982 gene locus_tag LOCUS_02560 295203 294982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 295589 295200 gene locus_tag LOCUS_02570 295589 295200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 295845 295582 gene locus_tag LOCUS_02580 295845 295582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 296471 295893 gene locus_tag LOCUS_02590 296471 295893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 296809 296483 gene locus_tag LOCUS_02600 296809 296483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 299886 296809 gene locus_tag LOCUS_02610 299886 296809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 300165 299890 gene locus_tag LOCUS_02620 300165 299890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 300726 300541 gene locus_tag LOCUS_02630 300726 300541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 301131 300733 gene locus_tag LOCUS_02640 301131 300733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 301363 301136 gene locus_tag LOCUS_02650 301363 301136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 301527 301889 gene locus_tag LOCUS_02660 301527 301889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 301894 302148 gene locus_tag LOCUS_02670 301894 302148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 302888 303505 gene locus_tag LOCUS_02680 302888 303505 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_02680 303575 304654 gene locus_tag LOCUS_02690 303575 304654 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_02690 304659 305939 gene locus_tag LOCUS_02700 304659 305939 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_02700 305941 307068 gene locus_tag LOCUS_02710 gene pdxB 305941 307068 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_02710 307070 308527 gene locus_tag LOCUS_02720 gene gnd 307070 308527 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_02720 309253 308690 gene locus_tag LOCUS_02730 309253 308690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 309792 309253 gene locus_tag LOCUS_02740 309792 309253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 309888 311621 gene locus_tag LOCUS_02750 gene sppA 309888 311621 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_02750 312650 311625 gene locus_tag LOCUS_02760 312650 311625 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_02760 313324 312647 gene locus_tag LOCUS_02770 313324 312647 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727970.1 protein_id gnl|my_center|LOCUS_02770 313611 314486 gene locus_tag LOCUS_02780 gene folP 313611 314486 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_02780 315387 314488 gene locus_tag LOCUS_02790 315387 314488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 316321 315389 gene locus_tag LOCUS_02800 316321 315389 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_02800 316367 316690 gene locus_tag LOCUS_02810 316367 316690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 317279 316692 gene locus_tag LOCUS_02820 317279 316692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 317382 317459 gene locus_tag LOCUS_t00080 317382 317459 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 320741 318027 gene locus_tag LOCUS_02830 320741 318027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 321873 320758 gene locus_tag LOCUS_02840 321873 320758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_02840 323926 321908 gene locus_tag LOCUS_02850 323926 321908 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_02850 324725 323928 gene locus_tag LOCUS_02860 324725 323928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 325837 324746 gene locus_tag LOCUS_02870 325837 324746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 326280 325837 gene locus_tag LOCUS_02880 326280 325837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 326332 326943 gene locus_tag LOCUS_02890 326332 326943 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_02890 327012 328064 gene locus_tag LOCUS_02900 gene queA 327012 328064 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_02900 328142 329308 gene locus_tag LOCUS_02910 328142 329308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 329321 330094 gene locus_tag LOCUS_02920 329321 330094 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_02920 330091 331125 gene locus_tag LOCUS_02930 330091 331125 CDS product type I asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796414.1 protein_id gnl|my_center|LOCUS_02930 331229 332026 gene locus_tag LOCUS_02940 331229 332026 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_02940 332048 332479 gene locus_tag LOCUS_02950 332048 332479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 332485 333063 gene locus_tag LOCUS_02960 332485 333063 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_02960 333076 333540 gene locus_tag LOCUS_02970 333076 333540 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_02970 333606 335015 gene locus_tag LOCUS_02980 gene asnS 333606 335015 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_02980 335019 335648 gene locus_tag LOCUS_02990 gene udk 335019 335648 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_02990 335650 336354 gene locus_tag LOCUS_03000 335650 336354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 336374 337333 gene locus_tag LOCUS_03010 336374 337333 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_03010 337378 337463 gene locus_tag LOCUS_t00090 337378 337463 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 337951 338526 gene locus_tag LOCUS_03020 337951 338526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_03020 338530 338820 gene locus_tag LOCUS_03030 338530 338820 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_03030 339236 338916 gene locus_tag LOCUS_03040 339236 338916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 339841 340065 gene locus_tag LOCUS_03050 339841 340065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 340062 341216 gene locus_tag LOCUS_03060 340062 341216 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_03060 341220 342179 gene locus_tag LOCUS_03070 341220 342179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 342179 344419 gene locus_tag LOCUS_03080 342179 344419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 345798 344416 gene locus_tag LOCUS_03090 345798 344416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 >Feature sequence02 258 1442 gene locus_tag LOCUS_03100 258 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 2108 1776 gene locus_tag LOCUS_03110 2108 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 2563 2105 gene locus_tag LOCUS_03120 2563 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3570 2572 gene locus_tag LOCUS_03130 3570 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 3885 3577 gene locus_tag LOCUS_03140 3885 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4542 4222 gene locus_tag LOCUS_03150 4542 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4794 5999 gene locus_tag LOCUS_03160 4794 5999 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_03160 6211 7341 gene locus_tag LOCUS_03170 6211 7341 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_03170 8857 7343 gene locus_tag LOCUS_03180 8857 7343 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_03180 10383 8872 gene locus_tag LOCUS_03190 10383 8872 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_03190 11768 10380 gene locus_tag LOCUS_03200 11768 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 12960 11806 gene locus_tag LOCUS_03210 12960 11806 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763289.1 protein_id gnl|my_center|LOCUS_03210 13547 12972 gene locus_tag LOCUS_03220 gene lpcA 13547 12972 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284054.1 protein_id gnl|my_center|LOCUS_03220 13626 14099 gene locus_tag LOCUS_03230 gene cdd 13626 14099 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_03230 14232 15629 gene locus_tag LOCUS_03240 14232 15629 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_03240 16608 15589 gene locus_tag LOCUS_03250 gene tsaD 16608 15589 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_03250 16730 21223 gene locus_tag LOCUS_03260 16730 21223 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_03260 21216 21923 gene locus_tag LOCUS_03270 21216 21923 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456712.1 protein_id gnl|my_center|LOCUS_03270 21935 22273 gene locus_tag LOCUS_03280 gene folB 21935 22273 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_03280 22270 23655 gene locus_tag LOCUS_03290 gene mtaB 22270 23655 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_03290 23652 24563 gene locus_tag LOCUS_03300 23652 24563 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_03300 26252 24546 gene locus_tag LOCUS_03310 26252 24546 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_03310 26393 26587 gene locus_tag LOCUS_03320 26393 26587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 26613 26840 gene locus_tag LOCUS_03330 26613 26840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 26848 27036 gene locus_tag LOCUS_03340 26848 27036 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_03340 27042 27491 gene locus_tag LOCUS_03350 27042 27491 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_03350 27516 27719 gene locus_tag LOCUS_03360 27516 27719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 27766 28548 gene locus_tag LOCUS_03370 27766 28548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 28597 29751 gene locus_tag LOCUS_03380 28597 29751 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108801.1 protein_id gnl|my_center|LOCUS_03380 31279 30272 gene locus_tag LOCUS_03390 31279 30272 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_03390 31869 31342 gene locus_tag LOCUS_03400 31869 31342 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_03400 31928 33976 gene locus_tag LOCUS_03410 31928 33976 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_03410 33963 35255 gene locus_tag LOCUS_03420 33963 35255 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_03420 35351 36967 gene locus_tag LOCUS_03430 gene pckA 35351 36967 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_03430 37564 37040 gene locus_tag LOCUS_03440 37564 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 37667 39811 gene locus_tag LOCUS_03450 gene recG 37667 39811 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172726565.1 protein_id gnl|my_center|LOCUS_03450 39816 42029 gene locus_tag LOCUS_03460 39816 42029 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_03460 42026 42565 gene locus_tag LOCUS_03470 42026 42565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 42562 43491 gene locus_tag LOCUS_03480 42562 43491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 44642 43512 gene locus_tag LOCUS_03490 44642 43512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 47358 44785 gene locus_tag LOCUS_03500 47358 44785 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_03500 47736 49073 gene locus_tag LOCUS_03510 47736 49073 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_03510 49078 50166 gene locus_tag LOCUS_03520 49078 50166 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_03520 50179 50967 gene locus_tag LOCUS_03530 50179 50967 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_03530 50971 51576 gene locus_tag LOCUS_03540 50971 51576 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_03540 51594 52190 gene locus_tag LOCUS_03550 gene nqrE 51594 52190 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_03550 52206 53474 gene locus_tag LOCUS_03560 gene nqrF 52206 53474 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787210.1 protein_id gnl|my_center|LOCUS_03560 53640 54590 gene locus_tag LOCUS_03570 53640 54590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 54602 55942 gene locus_tag LOCUS_03580 54602 55942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 55945 56997 gene locus_tag LOCUS_03590 55945 56997 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931764.1 protein_id gnl|my_center|LOCUS_03590 56994 57842 gene locus_tag LOCUS_03600 56994 57842 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_03600 58603 57818 gene locus_tag LOCUS_03610 58603 57818 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_03610 59541 58600 gene locus_tag LOCUS_03620 59541 58600 CDS product Stealth CR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003607.1 protein_id gnl|my_center|LOCUS_03620 60416 59538 gene locus_tag LOCUS_03630 60416 59538 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 protein_id gnl|my_center|LOCUS_03630 61201 60416 gene locus_tag LOCUS_03640 61201 60416 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695267.1 protein_id gnl|my_center|LOCUS_03640 64011 61210 gene locus_tag LOCUS_03650 gene uvrA 64011 61210 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_03650 64509 64030 gene locus_tag LOCUS_03660 gene ybaK 64509 64030 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788187.1 protein_id gnl|my_center|LOCUS_03660 64624 64698 gene locus_tag LOCUS_t00100 64624 64698 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 64925 64755 gene locus_tag LOCUS_03670 64925 64755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 66382 64922 gene locus_tag LOCUS_03680 66382 64922 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_03680 68362 66386 gene locus_tag LOCUS_03690 68362 66386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 69706 68705 gene locus_tag LOCUS_03700 gene argF 69706 68705 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095369.1 protein_id gnl|my_center|LOCUS_03700 70640 69720 gene locus_tag LOCUS_03710 gene arcC 70640 69720 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_03710 71556 70645 gene locus_tag LOCUS_03720 71556 70645 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_03720 72702 71566 gene locus_tag LOCUS_03730 72702 71566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 75357 72709 gene locus_tag LOCUS_03740 75357 72709 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694753.1 protein_id gnl|my_center|LOCUS_03740 75997 75440 gene locus_tag LOCUS_03750 gene updY 75997 75440 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_03750 76031 76633 gene locus_tag LOCUS_03760 76031 76633 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107376.1 protein_id gnl|my_center|LOCUS_03760 76634 78421 gene locus_tag LOCUS_03770 76634 78421 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969789.1 protein_id gnl|my_center|LOCUS_03770 79094 78429 gene locus_tag LOCUS_03780 79094 78429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 82002 79180 gene locus_tag LOCUS_03790 82002 79180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 83986 82031 gene locus_tag LOCUS_03800 83986 82031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 85202 84012 gene locus_tag LOCUS_03810 85202 84012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 86481 85222 gene locus_tag LOCUS_03820 86481 85222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 88340 86559 gene locus_tag LOCUS_03830 88340 86559 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767204.1 protein_id gnl|my_center|LOCUS_03830 91655 88527 gene locus_tag LOCUS_03840 91655 88527 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767205.1 protein_id gnl|my_center|LOCUS_03840 91786 94281 gene locus_tag LOCUS_03850 91786 94281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 94278 95729 gene locus_tag LOCUS_03860 94278 95729 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108647.1 protein_id gnl|my_center|LOCUS_03860 97984 95837 gene locus_tag LOCUS_03870 97984 95837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 99299 97986 gene locus_tag LOCUS_03880 99299 97986 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_03880 102136 99335 gene locus_tag LOCUS_03890 102136 99335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 102213 104525 gene locus_tag LOCUS_03900 102213 104525 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_03900 104522 106744 gene locus_tag LOCUS_03910 104522 106744 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474357.1 protein_id gnl|my_center|LOCUS_03910 108217 106748 gene locus_tag LOCUS_03920 108217 106748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 109856 108234 gene locus_tag LOCUS_03930 109856 108234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 113498 109869 gene locus_tag LOCUS_03940 113498 109869 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_03940 113865 117458 gene locus_tag LOCUS_03950 113865 117458 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_03950 117472 119109 gene locus_tag LOCUS_03960 117472 119109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 119119 120543 gene locus_tag LOCUS_03970 119119 120543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 120647 121561 gene locus_tag LOCUS_03980 120647 121561 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_03980 123926 121554 gene locus_tag LOCUS_03990 gene bglX 123926 121554 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_03990 126322 123941 gene locus_tag LOCUS_04000 126322 123941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 127787 126333 gene locus_tag LOCUS_04010 127787 126333 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_04010 128695 127784 gene locus_tag LOCUS_04020 128695 127784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 128766 130259 gene locus_tag LOCUS_04030 128766 130259 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_04030 130265 131758 gene locus_tag LOCUS_04040 130265 131758 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_04040 131758 132342 gene locus_tag LOCUS_04050 131758 132342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 132342 134510 gene locus_tag LOCUS_04060 132342 134510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 134540 136111 gene locus_tag LOCUS_04070 134540 136111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 136129 138921 gene locus_tag LOCUS_04080 136129 138921 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_04080 140792 138936 gene locus_tag LOCUS_04090 gene htpG 140792 138936 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_04090 141695 140856 gene locus_tag LOCUS_04100 141695 140856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 141830 143500 gene locus_tag LOCUS_04110 141830 143500 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_04110 143500 145197 gene locus_tag LOCUS_04120 143500 145197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 145333 145611 gene locus_tag LOCUS_04130 145333 145611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 145861 146949 gene locus_tag LOCUS_04140 145861 146949 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_04140 146950 148476 gene locus_tag LOCUS_04150 gene guaA 146950 148476 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_04150 148499 149860 gene locus_tag LOCUS_04160 148499 149860 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_04160 149857 150390 gene locus_tag LOCUS_04170 149857 150390 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 protein_id gnl|my_center|LOCUS_04170 150431 151156 gene locus_tag LOCUS_04180 150431 151156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 151170 152498 gene locus_tag LOCUS_04190 151170 152498 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_04190 152633 154060 gene locus_tag LOCUS_04200 152633 154060 CDS product DUF4419 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109248.1 protein_id gnl|my_center|LOCUS_04200 154075 156255 gene locus_tag LOCUS_04210 gene uvrB 154075 156255 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_04210 157108 156236 gene locus_tag LOCUS_04220 157108 156236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 158311 157286 gene locus_tag LOCUS_04230 158311 157286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 159356 158295 gene locus_tag LOCUS_04240 159356 158295 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080828.1 protein_id gnl|my_center|LOCUS_04240 159522 159875 gene locus_tag LOCUS_04250 159522 159875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 160409 160056 gene locus_tag LOCUS_04260 160409 160056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 162715 160472 gene locus_tag LOCUS_04270 162715 160472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 163801 163031 gene locus_tag LOCUS_04280 163801 163031 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_04280 165876 163798 gene locus_tag LOCUS_04290 165876 163798 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_04290 166957 165914 gene locus_tag LOCUS_04300 gene mltG 166957 165914 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_04300 167919 166954 gene locus_tag LOCUS_04310 167919 166954 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_04310 168856 167891 gene locus_tag LOCUS_04320 168856 167891 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_04320 170620 168863 gene locus_tag LOCUS_04330 gene rpsA 170620 168863 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_04330 170777 171385 gene locus_tag LOCUS_04340 gene pnuC 170777 171385 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_04340 171389 172153 gene locus_tag LOCUS_04350 gene agaR 171389 172153 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423633.1 protein_id gnl|my_center|LOCUS_04350 173556 172159 gene locus_tag LOCUS_04360 173556 172159 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_04360 174609 173557 gene locus_tag LOCUS_04370 174609 173557 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_04370 176645 174612 gene locus_tag LOCUS_04380 176645 174612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 179896 176702 gene locus_tag LOCUS_04390 179896 176702 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_04390 179965 181770 gene locus_tag LOCUS_04400 179965 181770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 183816 181774 gene locus_tag LOCUS_04410 183816 181774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 184743 183817 gene locus_tag LOCUS_04420 184743 183817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 185929 184745 gene locus_tag LOCUS_04430 185929 184745 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_04430 188517 185926 gene locus_tag LOCUS_04440 188517 185926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 190568 188523 gene locus_tag LOCUS_04450 190568 188523 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_04450 191696 190716 gene locus_tag LOCUS_04460 191696 190716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 194272 192140 gene locus_tag LOCUS_04470 194272 192140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 194430 194275 gene locus_tag LOCUS_04480 194430 194275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 196609 194444 gene locus_tag LOCUS_04490 196609 194444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 197156 196578 gene locus_tag LOCUS_04500 197156 196578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 198047 197160 gene locus_tag LOCUS_04510 198047 197160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 201389 198060 gene locus_tag LOCUS_04520 201389 198060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 203356 201389 gene locus_tag LOCUS_04530 203356 201389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 205054 203369 gene locus_tag LOCUS_04540 205054 203369 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_04540 208006 205067 gene locus_tag LOCUS_04550 208006 205067 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_04550 208942 208064 gene locus_tag LOCUS_04560 208942 208064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 209202 212390 gene locus_tag LOCUS_04570 209202 212390 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_04570 212525 214396 gene locus_tag LOCUS_04580 212525 214396 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203551.1 protein_id gnl|my_center|LOCUS_04580 214393 216213 gene locus_tag LOCUS_04590 214393 216213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 216218 220084 gene locus_tag LOCUS_04600 216218 220084 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097677775.1 protein_id gnl|my_center|LOCUS_04600 220152 223229 gene locus_tag LOCUS_04610 220152 223229 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_04610 223240 225102 gene locus_tag LOCUS_04620 223240 225102 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761944.1 protein_id gnl|my_center|LOCUS_04620 225122 227857 gene locus_tag LOCUS_04630 225122 227857 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108499.1 protein_id gnl|my_center|LOCUS_04630 227870 229567 gene locus_tag LOCUS_04640 227870 229567 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761942.1 protein_id gnl|my_center|LOCUS_04640 229647 231197 gene locus_tag LOCUS_04650 229647 231197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 231218 233449 gene locus_tag LOCUS_04660 231218 233449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 233531 235081 gene locus_tag LOCUS_04670 233531 235081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 235078 236937 gene locus_tag LOCUS_04680 235078 236937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 236927 237991 gene locus_tag LOCUS_04690 236927 237991 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_04690 237991 241131 gene locus_tag LOCUS_04700 237991 241131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 241134 245018 gene locus_tag LOCUS_04710 241134 245018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 245011 246333 gene locus_tag LOCUS_04720 245011 246333 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_04720 246330 248030 gene locus_tag LOCUS_04730 246330 248030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 249638 248040 gene locus_tag LOCUS_04740 249638 248040 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695757.1 protein_id gnl|my_center|LOCUS_04740 250254 249640 gene locus_tag LOCUS_04750 gene recR 250254 249640 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_04750 250390 251337 gene locus_tag LOCUS_04760 gene corA 250390 251337 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_04760 251359 252498 gene locus_tag LOCUS_04770 251359 252498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 253087 252518 gene locus_tag LOCUS_04780 gene nadD 253087 252518 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_04780 253593 253084 gene locus_tag LOCUS_04790 gene gmk 253593 253084 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_04790 253804 255192 gene locus_tag LOCUS_04800 253804 255192 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309917.1 protein_id gnl|my_center|LOCUS_04800 255204 256592 gene locus_tag LOCUS_04810 gene lpdA 255204 256592 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_04810 256596 259079 gene locus_tag LOCUS_04820 256596 259079 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_04820 259083 260174 gene locus_tag LOCUS_04830 259083 260174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 260171 262135 gene locus_tag LOCUS_04840 260171 262135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 262232 263497 gene locus_tag LOCUS_04850 262232 263497 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582809.1 protein_id gnl|my_center|LOCUS_04850 263494 264798 gene locus_tag LOCUS_04860 263494 264798 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_04860 265525 264800 gene locus_tag LOCUS_04870 gene phoN2 265525 264800 CDS product PAP2 family phosphatase PhoN2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850662.1 protein_id gnl|my_center|LOCUS_04870 265994 265542 gene locus_tag LOCUS_04880 265994 265542 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_04880 267423 266167 gene locus_tag LOCUS_04890 gene codB 267423 266167 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 protein_id gnl|my_center|LOCUS_04890 268372 267416 gene locus_tag LOCUS_04900 268372 267416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 268921 268703 gene locus_tag LOCUS_04910 268921 268703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 269403 268918 gene locus_tag LOCUS_04920 269403 268918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 270946 269792 gene locus_tag LOCUS_04930 gene lysA 270946 269792 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_04930 271972 270998 gene locus_tag LOCUS_04940 271972 270998 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679211.1 protein_id gnl|my_center|LOCUS_04940 272553 271969 gene locus_tag LOCUS_04950 272553 271969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 272641 273642 gene locus_tag LOCUS_04960 272641 273642 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_04960 274096 273695 gene locus_tag LOCUS_04970 274096 273695 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_04970 275019 274333 gene locus_tag LOCUS_04980 gene radC 275019 274333 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_04980 275270 275719 gene locus_tag LOCUS_04990 gene mraZ 275270 275719 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_04990 275732 276634 gene locus_tag LOCUS_05000 gene rsmH 275732 276634 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_05000 276638 276991 gene locus_tag LOCUS_05010 276638 276991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 276993 278903 gene locus_tag LOCUS_05020 276993 278903 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_05020 278900 280303 gene locus_tag LOCUS_05030 278900 280303 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_05030 280303 281454 gene locus_tag LOCUS_05040 gene mraY 280303 281454 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_05040 281465 282805 gene locus_tag LOCUS_05050 gene murD 281465 282805 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_05050 282807 284183 gene locus_tag LOCUS_05060 282807 284183 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_05060 284161 285297 gene locus_tag LOCUS_05070 gene murG 284161 285297 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_05070 285299 286654 gene locus_tag LOCUS_05080 gene murC 285299 286654 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_05080 286651 287373 gene locus_tag LOCUS_05090 286651 287373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 287385 288845 gene locus_tag LOCUS_05100 gene ftsA 287385 288845 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_05100 288858 290111 gene locus_tag LOCUS_05110 288858 290111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 290108 291664 gene locus_tag LOCUS_05120 gene gltX 290108 291664 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_05120 291661 292092 gene locus_tag LOCUS_05130 gene rpiB 291661 292092 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_05130 293297 292089 gene locus_tag LOCUS_05140 293297 292089 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766767.1 protein_id gnl|my_center|LOCUS_05140 293784 293287 gene locus_tag LOCUS_05150 293784 293287 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_05150 294517 293837 gene locus_tag LOCUS_05160 294517 293837 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992089.1 protein_id gnl|my_center|LOCUS_05160 294643 296106 gene locus_tag LOCUS_05170 294643 296106 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_05170 296624 296304 gene locus_tag LOCUS_05180 296624 296304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 296834 296986 gene locus_tag LOCUS_05190 296834 296986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 296991 297173 gene locus_tag LOCUS_05200 296991 297173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 297867 297214 gene locus_tag LOCUS_05210 297867 297214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 298711 299073 gene locus_tag LOCUS_05220 298711 299073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 299316 299231 gene locus_tag LOCUS_t00110 299316 299231 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 299763 299365 gene locus_tag LOCUS_05230 299763 299365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 300377 299868 gene locus_tag LOCUS_05240 300377 299868 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800526.1 protein_id gnl|my_center|LOCUS_05240 302005 300416 gene locus_tag LOCUS_05250 302005 300416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 302147 303412 gene locus_tag LOCUS_05260 302147 303412 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_05260 304202 303399 gene locus_tag LOCUS_05270 gene deoC 304202 303399 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_05270 304960 304205 gene locus_tag LOCUS_05280 304960 304205 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_05280 305574 304957 gene locus_tag LOCUS_05290 305574 304957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 308025 305581 gene locus_tag LOCUS_05300 gene pheT 308025 305581 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_05300 308918 308028 gene locus_tag LOCUS_05310 gene ftsY 308918 308028 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_05310 309080 308922 gene locus_tag LOCUS_05320 309080 308922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 309288 309100 gene locus_tag LOCUS_05330 gene rpmG 309288 309100 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_05330 309506 309300 gene locus_tag LOCUS_05340 gene rpmB 309506 309300 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_05340 310817 309555 gene locus_tag LOCUS_05350 310817 309555 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_05350 311174 310830 gene locus_tag LOCUS_05360 gene rplT 311174 310830 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_05360 311381 311187 gene locus_tag LOCUS_05370 gene rpmI 311381 311187 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_05370 312024 311431 gene locus_tag LOCUS_05380 gene infC 312024 311431 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_05380 313956 312025 gene locus_tag LOCUS_05390 gene thrS 313956 312025 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_05390 314015 314557 gene locus_tag LOCUS_05400 314015 314557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 314557 315507 gene locus_tag LOCUS_05410 314557 315507 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence03 277 351 gene locus_tag LOCUS_t00120 277 351 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 364 437 gene locus_tag LOCUS_t00130 364 437 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 546 1919 gene locus_tag LOCUS_05420 546 1919 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_05420 3514 1916 gene locus_tag LOCUS_05430 3514 1916 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_05430 3580 4791 gene locus_tag LOCUS_05440 3580 4791 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723690.1 protein_id gnl|my_center|LOCUS_05440 5641 4793 gene locus_tag LOCUS_05450 5641 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 6351 5641 gene locus_tag LOCUS_05460 6351 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6442 8802 gene locus_tag LOCUS_05470 gene feoB 6442 8802 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 protein_id gnl|my_center|LOCUS_05470 9940 8795 gene locus_tag LOCUS_05480 9940 8795 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_05480 11301 9937 gene locus_tag LOCUS_05490 11301 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 11374 11967 gene locus_tag LOCUS_05500 11374 11967 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_05500 11969 13210 gene locus_tag LOCUS_05510 11969 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 13324 14595 gene locus_tag LOCUS_05520 13324 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 14944 14519 gene locus_tag LOCUS_05530 gene tsaE 14944 14519 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_05530 15265 16506 gene locus_tag LOCUS_05540 15265 16506 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05540 16726 17142 gene locus_tag LOCUS_05550 16726 17142 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_05550 17161 18087 gene locus_tag LOCUS_05560 17161 18087 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_05560 18556 18080 gene locus_tag LOCUS_05570 18556 18080 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_05570 18992 18564 gene locus_tag LOCUS_05580 18992 18564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 19983 18985 gene locus_tag LOCUS_05590 19983 18985 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_05590 20040 21044 gene locus_tag LOCUS_05600 20040 21044 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_05600 21085 21159 gene locus_tag LOCUS_t00140 21085 21159 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22433 21537 gene locus_tag LOCUS_05610 22433 21537 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_05610 22515 23930 gene locus_tag LOCUS_05620 gene rhaB 22515 23930 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_05620 23937 25187 gene locus_tag LOCUS_05630 23937 25187 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536410.1 protein_id gnl|my_center|LOCUS_05630 25573 26547 gene locus_tag LOCUS_05640 25573 26547 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108679.1 protein_id gnl|my_center|LOCUS_05640 26567 30667 gene locus_tag LOCUS_05650 26567 30667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 30671 30985 gene locus_tag LOCUS_05660 30671 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 31027 34359 gene locus_tag LOCUS_05670 31027 34359 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_05670 34399 36210 gene locus_tag LOCUS_05680 34399 36210 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_05680 36215 38665 gene locus_tag LOCUS_05690 36215 38665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 38670 40274 gene locus_tag LOCUS_05700 38670 40274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 40271 41230 gene locus_tag LOCUS_05710 40271 41230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 41236 42612 gene locus_tag LOCUS_05720 41236 42612 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_05720 43504 42686 gene locus_tag LOCUS_05730 43504 42686 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_05730 44408 43509 gene locus_tag LOCUS_05740 gene rbsK 44408 43509 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_05740 44501 45205 gene locus_tag LOCUS_05750 44501 45205 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_05750 45212 46738 gene locus_tag LOCUS_05760 gene cysS 45212 46738 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_05760 46723 47484 gene locus_tag LOCUS_05770 46723 47484 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_05770 51851 47598 gene locus_tag LOCUS_05780 gene rpoC 51851 47598 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_05780 55697 51876 gene locus_tag LOCUS_05790 gene rpoB 55697 51876 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_05790 56177 55803 gene locus_tag LOCUS_05800 gene rplL 56177 55803 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_05800 56735 56211 gene locus_tag LOCUS_05810 gene rplJ 56735 56211 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_05810 57452 56748 gene locus_tag LOCUS_05820 gene rplA 57452 56748 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_05820 57908 57465 gene locus_tag LOCUS_05830 gene rplK 57908 57465 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_05830 58484 57918 gene locus_tag LOCUS_05840 gene nusG 58484 57918 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_05840 58742 58497 gene locus_tag LOCUS_05850 58742 58497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 58840 58769 gene locus_tag LOCUS_t00150 58840 58769 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 60088 58892 gene locus_tag LOCUS_05860 gene tuf 60088 58892 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_05860 60192 60120 gene locus_tag LOCUS_t00160 60192 60120 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 60273 60201 gene locus_tag LOCUS_t00170 60273 60201 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 60389 60309 gene locus_tag LOCUS_t00180 60389 60309 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 60499 60425 gene locus_tag LOCUS_t00190 60499 60425 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 62413 60542 gene locus_tag LOCUS_05870 gene dxs 62413 60542 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_05870 63653 62427 gene locus_tag LOCUS_05880 63653 62427 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_05880 65103 63739 gene locus_tag LOCUS_05890 65103 63739 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_05890 65684 65115 gene locus_tag LOCUS_05900 65684 65115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 66404 65724 gene locus_tag LOCUS_05910 66404 65724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 66501 67304 gene locus_tag LOCUS_05920 66501 67304 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_05920 67308 68150 gene locus_tag LOCUS_05930 gene kduI 67308 68150 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_05930 68313 69095 gene locus_tag LOCUS_05940 68313 69095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 69098 71839 gene locus_tag LOCUS_05950 69098 71839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 71933 73399 gene locus_tag LOCUS_05960 71933 73399 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_05960 73396 75048 gene locus_tag LOCUS_05970 73396 75048 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474328.1 protein_id gnl|my_center|LOCUS_05970 75119 76393 gene locus_tag LOCUS_05980 75119 76393 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760990.1 protein_id gnl|my_center|LOCUS_05980 76390 78357 gene locus_tag LOCUS_05990 76390 78357 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_05990 78395 81649 gene locus_tag LOCUS_06000 78395 81649 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_06000 81662 83512 gene locus_tag LOCUS_06010 81662 83512 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_06010 83525 86383 gene locus_tag LOCUS_06020 83525 86383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 86449 87864 gene locus_tag LOCUS_06030 gene uxaC 86449 87864 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_06030 87886 89325 gene locus_tag LOCUS_06040 87886 89325 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761512.1 protein_id gnl|my_center|LOCUS_06040 89412 90980 gene locus_tag LOCUS_06050 89412 90980 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_06050 91474 90977 gene locus_tag LOCUS_06060 91474 90977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 93680 92625 gene locus_tag LOCUS_06070 93680 92625 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_06070 93777 94802 gene locus_tag LOCUS_06080 93777 94802 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_06080 94808 95473 gene locus_tag LOCUS_06090 94808 95473 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_06090 95518 96003 gene locus_tag LOCUS_06100 95518 96003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 96000 96503 gene locus_tag LOCUS_06110 96000 96503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 96518 99004 gene locus_tag LOCUS_06120 96518 99004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 99027 100763 gene locus_tag LOCUS_06130 99027 100763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 100823 102289 gene locus_tag LOCUS_06140 100823 102289 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_06140 102554 103246 gene locus_tag LOCUS_06150 102554 103246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 103305 104846 gene locus_tag LOCUS_06160 gene lysS 103305 104846 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_06160 104824 105867 gene locus_tag LOCUS_06170 gene asnA 104824 105867 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_06170 105864 106799 gene locus_tag LOCUS_06180 105864 106799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 106796 107650 gene locus_tag LOCUS_06190 106796 107650 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_06190 107723 108457 gene locus_tag LOCUS_06200 107723 108457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 109291 108461 gene locus_tag LOCUS_06210 109291 108461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 111267 109291 gene locus_tag LOCUS_06220 111267 109291 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_06220 111778 111293 gene locus_tag LOCUS_06230 111778 111293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 113097 111775 gene locus_tag LOCUS_06240 113097 111775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 113212 113139 gene locus_tag LOCUS_t00200 113212 113139 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 113811 113362 gene locus_tag LOCUS_06250 gene smpB 113811 113362 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_06250 113889 114758 gene locus_tag LOCUS_06260 gene miaA 113889 114758 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_06260 114755 115702 gene locus_tag LOCUS_06270 114755 115702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 116242 115796 gene locus_tag LOCUS_06280 116242 115796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 116930 117958 gene locus_tag LOCUS_06290 116930 117958 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_06290 119363 118077 gene locus_tag LOCUS_06300 gene metK 119363 118077 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_06300 119486 122758 gene locus_tag LOCUS_06310 119486 122758 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_06310 122776 125478 gene locus_tag LOCUS_06320 122776 125478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 125613 128372 gene locus_tag LOCUS_06330 125613 128372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 128379 129848 gene locus_tag LOCUS_06340 128379 129848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 129873 130949 gene locus_tag LOCUS_06350 129873 130949 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_06350 130995 133892 gene locus_tag LOCUS_06360 130995 133892 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_06360 133897 135090 gene locus_tag LOCUS_06370 133897 135090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 135094 137115 gene locus_tag LOCUS_06380 135094 137115 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090481.1 protein_id gnl|my_center|LOCUS_06380 137184 137930 gene locus_tag LOCUS_06390 gene gpmA 137184 137930 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789269.1 protein_id gnl|my_center|LOCUS_06390 138855 137998 gene locus_tag LOCUS_06400 138855 137998 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_06400 139386 138952 gene locus_tag LOCUS_06410 139386 138952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 139640 139383 gene locus_tag LOCUS_06420 139640 139383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 141699 139642 gene locus_tag LOCUS_06430 gene rnr 141699 139642 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_06430 141903 143084 gene locus_tag LOCUS_06440 141903 143084 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_06440 144912 143071 gene locus_tag LOCUS_06450 144912 143071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108191.1 protein_id gnl|my_center|LOCUS_06450 147998 144909 gene locus_tag LOCUS_06460 147998 144909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 148077 149897 gene locus_tag LOCUS_06470 148077 149897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 151551 149872 gene locus_tag LOCUS_06480 151551 149872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 152063 151560 gene locus_tag LOCUS_06490 152063 151560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 152830 152096 gene locus_tag LOCUS_06500 152830 152096 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636852.1 protein_id gnl|my_center|LOCUS_06500 153066 152827 gene locus_tag LOCUS_06510 153066 152827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 156716 153426 gene locus_tag LOCUS_06520 156716 153426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 159843 156721 gene locus_tag LOCUS_06530 159843 156721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 160758 159847 gene locus_tag LOCUS_06540 160758 159847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 162076 160763 gene locus_tag LOCUS_06550 162076 160763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 162852 162079 gene locus_tag LOCUS_06560 162852 162079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 163459 162881 gene locus_tag LOCUS_06570 163459 162881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 164892 163465 gene locus_tag LOCUS_06580 164892 163465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 165009 165209 gene locus_tag LOCUS_06590 165009 165209 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816072.1 protein_id gnl|my_center|LOCUS_06590 166578 165172 gene locus_tag LOCUS_06600 166578 165172 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_06600 167198 166743 gene locus_tag LOCUS_06610 gene bcp 167198 166743 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_06610 167604 167203 gene locus_tag LOCUS_06620 167604 167203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 167652 168227 gene locus_tag LOCUS_06630 167652 168227 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765028.1 protein_id gnl|my_center|LOCUS_06630 168243 168431 gene locus_tag LOCUS_06640 168243 168431 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_06640 168658 169428 gene locus_tag LOCUS_06650 168658 169428 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656803.1 protein_id gnl|my_center|LOCUS_06650 169480 170109 gene locus_tag LOCUS_06660 169480 170109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 170651 171121 gene locus_tag LOCUS_06670 170651 171121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 172181 171162 gene locus_tag LOCUS_06680 172181 171162 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689382.1 protein_id gnl|my_center|LOCUS_06680 172387 172737 gene locus_tag LOCUS_06690 172387 172737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 172793 173554 gene locus_tag LOCUS_06700 172793 173554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 173700 174851 gene locus_tag LOCUS_06710 173700 174851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 174899 175933 gene locus_tag LOCUS_06720 174899 175933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 175937 176269 gene locus_tag LOCUS_06730 175937 176269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 176808 176218 gene locus_tag LOCUS_06740 176808 176218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 177397 176813 gene locus_tag LOCUS_06750 177397 176813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 178111 177476 gene locus_tag LOCUS_06760 178111 177476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 179056 178397 gene locus_tag LOCUS_06770 gene clpP 179056 178397 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_06770 179646 179113 gene locus_tag LOCUS_06780 179646 179113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 180811 179669 gene locus_tag LOCUS_06790 180811 179669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 181891 180812 gene locus_tag LOCUS_06800 181891 180812 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121735.1 protein_id gnl|my_center|LOCUS_06800 183583 181895 gene locus_tag LOCUS_06810 183583 181895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 184690 183614 gene locus_tag LOCUS_06820 gene clpX 184690 183614 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228071.1 protein_id gnl|my_center|LOCUS_06820 185242 184733 gene locus_tag LOCUS_06830 185242 184733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 185778 185317 gene locus_tag LOCUS_06840 185778 185317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 186228 185908 gene locus_tag LOCUS_06850 186228 185908 CDS product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725735.1 protein_id gnl|my_center|LOCUS_06850 187373 186246 gene locus_tag LOCUS_06860 187373 186246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 187612 187370 gene locus_tag LOCUS_06870 187612 187370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 187744 188424 gene locus_tag LOCUS_06880 187744 188424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 188429 189376 gene locus_tag LOCUS_06890 188429 189376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 189393 189911 gene locus_tag LOCUS_06900 189393 189911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 189898 191133 gene locus_tag LOCUS_06910 189898 191133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 191281 191556 gene locus_tag LOCUS_06920 191281 191556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 191613 193397 gene locus_tag LOCUS_06930 191613 193397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 193387 194283 gene locus_tag LOCUS_06940 193387 194283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 194424 196346 gene locus_tag LOCUS_06950 194424 196346 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970453.1 protein_id gnl|my_center|LOCUS_06950 197016 199466 gene locus_tag LOCUS_06960 197016 199466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 199468 205611 gene locus_tag LOCUS_06970 199468 205611 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970454.1 protein_id gnl|my_center|LOCUS_06970 206309 205671 gene locus_tag LOCUS_06980 206309 205671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 206817 206323 gene locus_tag LOCUS_06990 206817 206323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 207271 207804 gene locus_tag LOCUS_07000 207271 207804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 207970 208566 gene locus_tag LOCUS_07010 207970 208566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 209464 208613 gene locus_tag LOCUS_07020 209464 208613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 209562 210425 gene locus_tag LOCUS_07030 209562 210425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 210484 210693 gene locus_tag LOCUS_07040 210484 210693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 210695 210925 gene locus_tag LOCUS_07050 210695 210925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 210976 211404 gene locus_tag LOCUS_07060 210976 211404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 211411 211593 gene locus_tag LOCUS_07070 211411 211593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 211695 213839 gene locus_tag LOCUS_07080 211695 213839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 213855 214742 gene locus_tag LOCUS_07090 213855 214742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 215235 214903 gene locus_tag LOCUS_07100 215235 214903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 215368 215790 gene locus_tag LOCUS_07110 215368 215790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 215919 216419 gene locus_tag LOCUS_07120 215919 216419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 216443 217714 gene locus_tag LOCUS_07130 216443 217714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 217802 220210 gene locus_tag LOCUS_07140 217802 220210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 220212 220466 gene locus_tag LOCUS_07150 220212 220466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 221713 224430 gene locus_tag LOCUS_07160 221713 224430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 224437 224856 gene locus_tag LOCUS_07170 224437 224856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 225045 225692 gene locus_tag LOCUS_07180 225045 225692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 225689 226777 gene locus_tag LOCUS_07190 225689 226777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 226829 227452 gene locus_tag LOCUS_07200 226829 227452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 227474 228493 gene locus_tag LOCUS_07210 227474 228493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 228518 229576 gene locus_tag LOCUS_07220 228518 229576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 229637 230683 gene locus_tag LOCUS_07230 229637 230683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 230703 231758 gene locus_tag LOCUS_07240 230703 231758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 231758 232651 gene locus_tag LOCUS_07250 231758 232651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 232648 233337 gene locus_tag LOCUS_07260 232648 233337 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_07260 233361 234260 gene locus_tag LOCUS_07270 233361 234260 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_07270 235382 234267 gene locus_tag LOCUS_07280 235382 234267 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_07280 236466 235393 gene locus_tag LOCUS_07290 gene rsgA 236466 235393 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_07290 237452 236469 gene locus_tag LOCUS_07300 237452 236469 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_07300 237494 237901 gene locus_tag LOCUS_07310 237494 237901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 237984 241055 gene locus_tag LOCUS_07320 237984 241055 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_07320 241068 242576 gene locus_tag LOCUS_07330 241068 242576 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291422.1 protein_id gnl|my_center|LOCUS_07330 242554 243039 gene locus_tag LOCUS_07340 242554 243039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 243059 244672 gene locus_tag LOCUS_07350 243059 244672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 244735 247527 gene locus_tag LOCUS_07360 244735 247527 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_07360 247530 250442 gene locus_tag LOCUS_07370 247530 250442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 250446 251765 gene locus_tag LOCUS_07380 250446 251765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 252760 252008 gene locus_tag LOCUS_07390 252760 252008 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051401.1 protein_id gnl|my_center|LOCUS_07390 254385 252778 gene locus_tag LOCUS_07400 254385 252778 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_07400 255720 254398 gene locus_tag LOCUS_07410 255720 254398 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_07410 257648 255924 gene locus_tag LOCUS_07420 257648 255924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 257737 258039 gene locus_tag LOCUS_07430 257737 258039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 258180 259070 gene locus_tag LOCUS_07440 258180 259070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 260295 259138 gene locus_tag LOCUS_07450 260295 259138 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_07450 260418 260609 gene locus_tag LOCUS_07460 260418 260609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 261420 260587 gene locus_tag LOCUS_07470 261420 260587 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566975.1 protein_id gnl|my_center|LOCUS_07470 262286 261417 gene locus_tag LOCUS_07480 262286 261417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 262943 262293 gene locus_tag LOCUS_07490 262943 262293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 263035 266280 gene locus_tag LOCUS_07500 263035 266280 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_07500 266277 267548 gene locus_tag LOCUS_07510 266277 267548 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_07510 268615 267545 gene locus_tag LOCUS_07520 268615 267545 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_07520 269775 268612 gene locus_tag LOCUS_07530 269775 268612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 270953 269787 gene locus_tag LOCUS_07540 270953 269787 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_07540 271792 270950 gene locus_tag LOCUS_07550 271792 270950 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_07550 273182 271797 gene locus_tag LOCUS_07560 gene glpT 273182 271797 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_07560 273244 275262 gene locus_tag LOCUS_07570 273244 275262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_07570 275270 275593 gene locus_tag LOCUS_07580 275270 275593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 275596 277086 gene locus_tag LOCUS_07590 275596 277086 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_07590 277156 278469 gene locus_tag LOCUS_07600 gene xylA 277156 278469 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787643.1 protein_id gnl|my_center|LOCUS_07600 278472 279884 gene locus_tag LOCUS_07610 gene xylE 278472 279884 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_07610 279881 281617 gene locus_tag LOCUS_07620 279881 281617 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_07620 282813 281611 gene locus_tag LOCUS_07630 282813 281611 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_07630 282899 283771 gene locus_tag LOCUS_07640 282899 283771 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_07640 283856 285232 gene locus_tag LOCUS_07650 283856 285232 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_07650 285237 286346 gene locus_tag LOCUS_07660 285237 286346 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_07660 286354 287517 gene locus_tag LOCUS_07670 286354 287517 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_07670 287522 288865 gene locus_tag LOCUS_07680 287522 288865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_07680 289027 291153 gene locus_tag LOCUS_07690 289027 291153 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_07690 291167 291337 gene locus_tag LOCUS_07700 291167 291337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 291918 291295 gene locus_tag LOCUS_07710 291918 291295 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_07710 292015 292173 gene locus_tag LOCUS_07720 292015 292173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 292197 295076 gene locus_tag LOCUS_07730 gene uvrA 292197 295076 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405104.1 protein_id gnl|my_center|LOCUS_07730 295073 296080 gene locus_tag LOCUS_07740 295073 296080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 296794 296075 gene locus_tag LOCUS_07750 296794 296075 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228812.1 protein_id gnl|my_center|LOCUS_07750 296880 297491 gene locus_tag LOCUS_07760 296880 297491 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_07760 297512 298153 gene locus_tag LOCUS_07770 297512 298153 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_07770 298159 300081 gene locus_tag LOCUS_07780 298159 300081 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_07780 300095 301366 gene locus_tag LOCUS_07790 300095 301366 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_07790 301370 302329 gene locus_tag LOCUS_07800 301370 302329 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_07800 302357 303049 gene locus_tag LOCUS_07810 302357 303049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 303207 304598 gene locus_tag LOCUS_07820 303207 304598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 304699 305901 gene locus_tag LOCUS_07830 304699 305901 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence04 567 28 gene locus_tag LOCUS_07840 567 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1502 1429 gene locus_tag LOCUS_t00210 1502 1429 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1573 3354 gene locus_tag LOCUS_07850 1573 3354 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765908.1 protein_id gnl|my_center|LOCUS_07850 3354 4313 gene locus_tag LOCUS_07860 3354 4313 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_07860 5681 4413 gene locus_tag LOCUS_07870 gene miaB 5681 4413 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_07870 5766 6233 gene locus_tag LOCUS_07880 5766 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6230 6778 gene locus_tag LOCUS_07890 6230 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6780 8189 gene locus_tag LOCUS_07900 gene rpoN 6780 8189 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_07900 8839 8186 gene locus_tag LOCUS_07910 gene upp 8839 8186 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_07910 9268 8843 gene locus_tag LOCUS_07920 9268 8843 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_07920 9337 10257 gene locus_tag LOCUS_07930 gene trxB 9337 10257 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_07930 10254 11045 gene locus_tag LOCUS_07940 10254 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 11079 11396 gene locus_tag LOCUS_07950 11079 11396 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_07950 11401 13050 gene locus_tag LOCUS_07960 gene recN 11401 13050 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_07960 14634 13042 gene locus_tag LOCUS_07970 14634 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 15779 14655 gene locus_tag LOCUS_07980 15779 14655 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_07980 16392 15781 gene locus_tag LOCUS_07990 16392 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 17164 16451 gene locus_tag LOCUS_08000 17164 16451 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_08000 17228 18046 gene locus_tag LOCUS_08010 17228 18046 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_08010 18090 18728 gene locus_tag LOCUS_08020 18090 18728 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_08020 18732 21305 gene locus_tag LOCUS_08030 18732 21305 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_08030 21318 21884 gene locus_tag LOCUS_08040 21318 21884 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766991.1 protein_id gnl|my_center|LOCUS_08040 21932 23773 gene locus_tag LOCUS_08050 21932 23773 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_08050 23775 24794 gene locus_tag LOCUS_08060 23775 24794 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_08060 24844 26163 gene locus_tag LOCUS_08070 gene gdhA 24844 26163 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_08070 26264 27712 gene locus_tag LOCUS_08080 26264 27712 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_08080 27723 28982 gene locus_tag LOCUS_08090 27723 28982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_08090 30271 28985 gene locus_tag LOCUS_08100 30271 28985 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_08100 31623 30271 gene locus_tag LOCUS_08110 31623 30271 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_08110 32583 31669 gene locus_tag LOCUS_08120 32583 31669 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_08120 32740 34296 gene locus_tag LOCUS_08130 32740 34296 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_08130 34303 35289 gene locus_tag LOCUS_08140 34303 35289 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_08140 35291 36460 gene locus_tag LOCUS_08150 35291 36460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925917.1 protein_id gnl|my_center|LOCUS_08150 36463 37749 gene locus_tag LOCUS_08160 36463 37749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_08160 37839 38396 gene locus_tag LOCUS_08170 37839 38396 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_08170 38400 39584 gene locus_tag LOCUS_08180 gene dnaJ 38400 39584 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_08180 39700 40083 gene locus_tag LOCUS_08190 gene rplS 39700 40083 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_08190 40096 40170 gene locus_tag LOCUS_t00220 40096 40170 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40592 40374 gene locus_tag LOCUS_08200 40592 40374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 41029 40583 gene locus_tag LOCUS_08210 41029 40583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 42552 41044 gene locus_tag LOCUS_08220 42552 41044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 43202 42558 gene locus_tag LOCUS_08230 43202 42558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 44702 43215 gene locus_tag LOCUS_08240 44702 43215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 44856 47594 gene locus_tag LOCUS_08250 44856 47594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 47591 48244 gene locus_tag LOCUS_08260 47591 48244 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222996.1 protein_id gnl|my_center|LOCUS_08260 48521 49390 gene locus_tag LOCUS_08270 48521 49390 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_08270 49387 51444 gene locus_tag LOCUS_08280 49387 51444 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963110.1 protein_id gnl|my_center|LOCUS_08280 52547 51423 gene locus_tag LOCUS_08290 gene lpxB 52547 51423 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_08290 53383 52544 gene locus_tag LOCUS_08300 gene surE 53383 52544 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_08300 53527 54594 gene locus_tag LOCUS_08310 gene gap 53527 54594 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_08310 55445 54801 gene locus_tag LOCUS_08320 55445 54801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 56061 55468 gene locus_tag LOCUS_08330 56061 55468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 57774 56137 gene locus_tag LOCUS_08340 57774 56137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 58903 57845 gene locus_tag LOCUS_08350 58903 57845 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_08350 59019 60077 gene locus_tag LOCUS_08360 59019 60077 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 protein_id gnl|my_center|LOCUS_08360 60091 61422 gene locus_tag LOCUS_08370 gene glpT 60091 61422 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_08370 61419 61559 gene locus_tag LOCUS_08380 61419 61559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 61607 63538 gene locus_tag LOCUS_08390 61607 63538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 63726 66542 gene locus_tag LOCUS_08400 63726 66542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 66752 70117 gene locus_tag LOCUS_08410 66752 70117 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_08410 70145 71962 gene locus_tag LOCUS_08420 70145 71962 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_08420 71970 73277 gene locus_tag LOCUS_08430 71970 73277 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_08430 73252 74991 gene locus_tag LOCUS_08440 73252 74991 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_08440 74988 76088 gene locus_tag LOCUS_08450 74988 76088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 76189 77703 gene locus_tag LOCUS_08460 76189 77703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 77712 78533 gene locus_tag LOCUS_08470 77712 78533 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042772.1 protein_id gnl|my_center|LOCUS_08470 78540 79934 gene locus_tag LOCUS_08480 78540 79934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 79931 81127 gene locus_tag LOCUS_08490 79931 81127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 81130 85887 gene locus_tag LOCUS_08500 81130 85887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 85880 87646 gene locus_tag LOCUS_08510 85880 87646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 87630 88736 gene locus_tag LOCUS_08520 87630 88736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 88780 89451 gene locus_tag LOCUS_08530 88780 89451 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_08530 89429 90052 gene locus_tag LOCUS_08540 89429 90052 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_08540 90933 90073 gene locus_tag LOCUS_08550 90933 90073 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066484172.1 protein_id gnl|my_center|LOCUS_08550 90977 92923 gene locus_tag LOCUS_08560 90977 92923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 94850 92895 gene locus_tag LOCUS_08570 94850 92895 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_08570 96314 94938 gene locus_tag LOCUS_08580 96314 94938 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_08580 98119 96311 gene locus_tag LOCUS_08590 98119 96311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 99480 98119 gene locus_tag LOCUS_08600 gene trkA 99480 98119 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_08600 100528 99488 gene locus_tag LOCUS_08610 100528 99488 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_08610 101153 100530 gene locus_tag LOCUS_08620 101153 100530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 102906 101443 gene locus_tag LOCUS_08630 102906 101443 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_08630 104374 102908 gene locus_tag LOCUS_08640 104374 102908 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_08640 104951 104364 gene locus_tag LOCUS_08650 104951 104364 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_08650 105681 104944 gene locus_tag LOCUS_08660 105681 104944 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_08660 107370 105688 gene locus_tag LOCUS_08670 107370 105688 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_08670 107512 108414 gene locus_tag LOCUS_08680 107512 108414 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_08680 108416 109411 gene locus_tag LOCUS_08690 108416 109411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 109423 110874 gene locus_tag LOCUS_08700 109423 110874 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_08700 111062 113248 gene locus_tag LOCUS_08710 gene nrdD 111062 113248 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_08710 113389 113994 gene locus_tag LOCUS_08720 113389 113994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 114267 114695 gene locus_tag LOCUS_08730 114267 114695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 114779 115213 gene locus_tag LOCUS_08740 gene rpsF 114779 115213 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_08740 115217 115483 gene locus_tag LOCUS_08750 gene rpsR 115217 115483 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_08750 115493 115942 gene locus_tag LOCUS_08760 gene rplI 115493 115942 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_08760 117764 116067 gene locus_tag LOCUS_08770 117764 116067 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_08770 118354 117773 gene locus_tag LOCUS_08780 118354 117773 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947974.1 protein_id gnl|my_center|LOCUS_08780 120267 118354 gene locus_tag LOCUS_08790 120267 118354 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_08790 120639 120292 gene locus_tag LOCUS_08800 120639 120292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 121645 120881 gene locus_tag LOCUS_08810 gene agaR 121645 120881 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423633.1 protein_id gnl|my_center|LOCUS_08810 123081 121657 gene locus_tag LOCUS_08820 123081 121657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 123343 124566 gene locus_tag LOCUS_08830 123343 124566 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_08830 124567 126363 gene locus_tag LOCUS_08840 124567 126363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 126360 128210 gene locus_tag LOCUS_08850 126360 128210 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695564.1 protein_id gnl|my_center|LOCUS_08850 128227 129057 gene locus_tag LOCUS_08860 gene murQ 128227 129057 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760452.1 protein_id gnl|my_center|LOCUS_08860 129082 132150 gene locus_tag LOCUS_08870 129082 132150 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_08870 132163 134190 gene locus_tag LOCUS_08880 132163 134190 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765815.1 protein_id gnl|my_center|LOCUS_08880 134252 135400 gene locus_tag LOCUS_08890 134252 135400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 135520 136842 gene locus_tag LOCUS_08900 135520 136842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 136842 138941 gene locus_tag LOCUS_08910 136842 138941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 138946 139818 gene locus_tag LOCUS_08920 138946 139818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 139815 140663 gene locus_tag LOCUS_08930 139815 140663 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_08930 140667 141857 gene locus_tag LOCUS_08940 gene gluP 140667 141857 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785331.1 protein_id gnl|my_center|LOCUS_08940 142486 143538 gene locus_tag LOCUS_08950 142486 143538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 143540 144874 gene locus_tag LOCUS_08960 143540 144874 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_08960 144879 147743 gene locus_tag LOCUS_08970 144879 147743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 148013 147834 gene locus_tag LOCUS_08980 148013 147834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 148494 148853 gene locus_tag LOCUS_08990 148494 148853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 149774 148854 gene locus_tag LOCUS_09000 149774 148854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 151507 150095 gene locus_tag LOCUS_09010 151507 150095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 152220 151522 gene locus_tag LOCUS_09020 152220 151522 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687752.1 protein_id gnl|my_center|LOCUS_09020 152337 152705 gene locus_tag LOCUS_09030 152337 152705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 156565 153035 gene locus_tag LOCUS_09040 gene nifJ 156565 153035 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_09040 157554 156664 gene locus_tag LOCUS_09050 gene fabD 157554 156664 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_09050 157635 157707 gene locus_tag LOCUS_t00230 157635 157707 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 157872 159254 gene locus_tag LOCUS_09060 157872 159254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 159257 160024 gene locus_tag LOCUS_09070 159257 160024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 160187 161953 gene locus_tag LOCUS_09080 160187 161953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 163556 161901 gene locus_tag LOCUS_09090 163556 161901 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762692.1 protein_id gnl|my_center|LOCUS_09090 163730 164014 gene locus_tag LOCUS_09100 163730 164014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 164027 164278 gene locus_tag LOCUS_09110 164027 164278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 167121 164548 gene locus_tag LOCUS_09120 167121 164548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 167373 168305 gene locus_tag LOCUS_09130 167373 168305 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_09130 168439 168600 gene locus_tag LOCUS_09140 168439 168600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 168608 170647 gene locus_tag LOCUS_09150 168608 170647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 170889 173549 gene locus_tag LOCUS_09160 170889 173549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 174400 175017 gene locus_tag LOCUS_09170 174400 175017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 177972 175105 gene locus_tag LOCUS_09180 177972 175105 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_09180 178243 179322 gene locus_tag LOCUS_09190 178243 179322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 179969 180391 gene locus_tag LOCUS_09200 179969 180391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 180780 180709 gene locus_tag LOCUS_t00240 180780 180709 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 180863 184141 gene locus_tag LOCUS_09210 gene secA 180863 184141 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_09210 184163 184576 gene locus_tag LOCUS_09220 184163 184576 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909388.1 protein_id gnl|my_center|LOCUS_09220 184952 184587 gene locus_tag LOCUS_09230 184952 184587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 185179 185526 gene locus_tag LOCUS_09240 gene ssb 185179 185526 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_09240 185570 187414 gene locus_tag LOCUS_09250 185570 187414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 187411 188487 gene locus_tag LOCUS_09260 187411 188487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 188484 189284 gene locus_tag LOCUS_09270 188484 189284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 189296 190111 gene locus_tag LOCUS_09280 189296 190111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 190116 191096 gene locus_tag LOCUS_09290 190116 191096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 191108 192772 gene locus_tag LOCUS_09300 191108 192772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 192826 195351 gene locus_tag LOCUS_09310 192826 195351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 196615 195332 gene locus_tag LOCUS_09320 196615 195332 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_09320 196680 197810 gene locus_tag LOCUS_09330 gene tgt 196680 197810 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_09330 197807 198883 gene locus_tag LOCUS_09340 197807 198883 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_09340 198883 199317 gene locus_tag LOCUS_09350 gene dut 198883 199317 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_09350 199314 200702 gene locus_tag LOCUS_09360 199314 200702 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_09360 201277 200705 gene locus_tag LOCUS_09370 201277 200705 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_09370 201850 201284 gene locus_tag LOCUS_09380 gene hpt 201850 201284 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_09380 201987 203567 gene locus_tag LOCUS_09390 201987 203567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 204751 203564 gene locus_tag LOCUS_09400 204751 203564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 204810 205898 gene locus_tag LOCUS_09410 204810 205898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 208791 205882 gene locus_tag LOCUS_09420 208791 205882 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_09420 210158 208803 gene locus_tag LOCUS_09430 gene gdhA 210158 208803 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_09430 211653 210208 gene locus_tag LOCUS_09440 211653 210208 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_09440 211720 212712 gene locus_tag LOCUS_09450 gene obgE 211720 212712 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_09450 212709 213353 gene locus_tag LOCUS_09460 212709 213353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 213355 214158 gene locus_tag LOCUS_09470 213355 214158 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_09470 214148 215083 gene locus_tag LOCUS_09480 214148 215083 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_09480 215083 215964 gene locus_tag LOCUS_09490 215083 215964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 215970 217322 gene locus_tag LOCUS_09500 215970 217322 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_09500 218746 217325 gene locus_tag LOCUS_09510 218746 217325 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_09510 219165 218752 gene locus_tag LOCUS_09520 219165 218752 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_09520 220899 219190 gene locus_tag LOCUS_09530 220899 219190 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_09530 221504 220896 gene locus_tag LOCUS_09540 221504 220896 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681263.1 protein_id gnl|my_center|LOCUS_09540 222851 221535 gene locus_tag LOCUS_09550 222851 221535 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_09550 224595 222841 gene locus_tag LOCUS_09560 224595 222841 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538526.1 protein_id gnl|my_center|LOCUS_09560 225179 224592 gene locus_tag LOCUS_09570 225179 224592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 225780 225172 gene locus_tag LOCUS_09580 225780 225172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538528.1 protein_id gnl|my_center|LOCUS_09580 225939 226421 gene locus_tag LOCUS_09590 225939 226421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 226414 226893 gene locus_tag LOCUS_09600 226414 226893 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785783.1 protein_id gnl|my_center|LOCUS_09600 226890 227294 gene locus_tag LOCUS_09610 226890 227294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 227291 227773 gene locus_tag LOCUS_09620 227291 227773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 227851 229422 gene locus_tag LOCUS_09630 227851 229422 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719496.1 protein_id gnl|my_center|LOCUS_09630 229415 232048 gene locus_tag LOCUS_09640 229415 232048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 232045 234534 gene locus_tag LOCUS_09650 232045 234534 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109376.1 protein_id gnl|my_center|LOCUS_09650 234541 235227 gene locus_tag LOCUS_09660 234541 235227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 238402 235202 gene locus_tag LOCUS_09670 gene carB 238402 235202 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_09670 239550 238399 gene locus_tag LOCUS_09680 gene carA 239550 238399 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107319.1 protein_id gnl|my_center|LOCUS_09680 240841 239543 gene locus_tag LOCUS_09690 gene argH 240841 239543 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_09690 241910 240822 gene locus_tag LOCUS_09700 241910 240822 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_09700 242647 241907 gene locus_tag LOCUS_09710 gene argB 242647 241907 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_09710 243768 242644 gene locus_tag LOCUS_09720 243768 242644 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_09720 244734 243772 gene locus_tag LOCUS_09730 gene argC 244734 243772 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_09730 245929 244727 gene locus_tag LOCUS_09740 245929 244727 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_09740 246489 245926 gene locus_tag LOCUS_09750 246489 245926 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_09750 248168 246714 gene locus_tag LOCUS_09760 248168 246714 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_09760 249274 248204 gene locus_tag LOCUS_09770 249274 248204 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_09770 249765 249274 gene locus_tag LOCUS_09780 249765 249274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 249847 250557 gene locus_tag LOCUS_09790 249847 250557 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979943.1 protein_id gnl|my_center|LOCUS_09790 250554 251624 gene locus_tag LOCUS_09800 250554 251624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 251615 252643 gene locus_tag LOCUS_09810 251615 252643 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_09810 252643 252981 gene locus_tag LOCUS_09820 252643 252981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 252978 254795 gene locus_tag LOCUS_09830 252978 254795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 256767 254779 gene locus_tag LOCUS_09840 256767 254779 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796342.1 protein_id gnl|my_center|LOCUS_09840 258625 256775 gene locus_tag LOCUS_09850 gene glmS 258625 256775 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_09850 260499 258682 gene locus_tag LOCUS_09860 260499 258682 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_09860 260677 260602 gene locus_tag LOCUS_t00250 260677 260602 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 260826 261200 gene locus_tag LOCUS_09870 260826 261200 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_09870 262233 261523 gene locus_tag LOCUS_09880 262233 261523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 262513 262319 gene locus_tag LOCUS_09890 262513 262319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 262878 262543 gene locus_tag LOCUS_09900 262878 262543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 263281 262916 gene locus_tag LOCUS_09910 263281 262916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence05 3940 233 gene locus_tag LOCUS_09920 gene dnaE 3940 233 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_09920 4530 3949 gene locus_tag LOCUS_09930 4530 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 5405 4641 gene locus_tag LOCUS_09940 5405 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6087 5425 gene locus_tag LOCUS_09950 6087 5425 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_09950 7096 6107 gene locus_tag LOCUS_09960 gene thiL 7096 6107 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_09960 9094 7097 gene locus_tag LOCUS_09970 9094 7097 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_09970 10181 9081 gene locus_tag LOCUS_09980 10181 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 11156 10194 gene locus_tag LOCUS_09990 11156 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 12999 11161 gene locus_tag LOCUS_10000 12999 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 15409 13022 gene locus_tag LOCUS_10010 15409 13022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 16362 15406 gene locus_tag LOCUS_10020 16362 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 17863 16367 gene locus_tag LOCUS_10030 17863 16367 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_10030 20939 17868 gene locus_tag LOCUS_10040 20939 17868 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_10040 21994 20951 gene locus_tag LOCUS_10050 21994 20951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 24497 22002 gene locus_tag LOCUS_10060 24497 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 26238 24508 gene locus_tag LOCUS_10070 26238 24508 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_10070 29521 26243 gene locus_tag LOCUS_10080 29521 26243 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_10080 30397 29579 gene locus_tag LOCUS_10090 30397 29579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 30501 31040 gene locus_tag LOCUS_10100 30501 31040 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_10100 32397 31030 gene locus_tag LOCUS_10110 32397 31030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 34117 32579 gene locus_tag LOCUS_10120 34117 32579 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_10120 34571 34146 gene locus_tag LOCUS_10130 gene folK 34571 34146 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_10130 34937 34575 gene locus_tag LOCUS_10140 34937 34575 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722920.1 protein_id gnl|my_center|LOCUS_10140 35343 34930 gene locus_tag LOCUS_10150 35343 34930 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_10150 36593 35340 gene locus_tag LOCUS_10160 gene csdA 36593 35340 CDS product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095477927.1 protein_id gnl|my_center|LOCUS_10160 36632 37225 gene locus_tag LOCUS_10170 gene ruvA 36632 37225 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_10170 39091 37226 gene locus_tag LOCUS_10180 gene mnmG 39091 37226 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_10180 39576 39091 gene locus_tag LOCUS_10190 gene ybeY 39576 39091 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108739.1 protein_id gnl|my_center|LOCUS_10190 39645 40334 gene locus_tag LOCUS_10200 39645 40334 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_10200 40393 41586 gene locus_tag LOCUS_10210 gene hflX 40393 41586 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_10210 42321 41578 gene locus_tag LOCUS_10220 42321 41578 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_10220 44274 42328 gene locus_tag LOCUS_10230 44274 42328 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_10230 45359 44334 gene locus_tag LOCUS_10240 gene ruvB 45359 44334 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_10240 45600 48758 gene locus_tag LOCUS_10250 gene mfd 45600 48758 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_10250 48781 49521 gene locus_tag LOCUS_10260 48781 49521 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_10260 49499 50830 gene locus_tag LOCUS_10270 49499 50830 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_10270 50823 52175 gene locus_tag LOCUS_10280 50823 52175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 52267 52836 gene locus_tag LOCUS_10290 52267 52836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 52892 54979 gene locus_tag LOCUS_10300 52892 54979 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_10300 55596 54976 gene locus_tag LOCUS_10310 55596 54976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 57219 55609 gene locus_tag LOCUS_10320 57219 55609 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431748.1 protein_id gnl|my_center|LOCUS_10320 58052 57222 gene locus_tag LOCUS_10330 58052 57222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 58525 58049 gene locus_tag LOCUS_10340 58525 58049 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_10340 59167 58529 gene locus_tag LOCUS_10350 59167 58529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 60007 59180 gene locus_tag LOCUS_10360 60007 59180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 61387 60020 gene locus_tag LOCUS_10370 61387 60020 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201962.1 protein_id gnl|my_center|LOCUS_10370 63007 61409 gene locus_tag LOCUS_10380 63007 61409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 63670 63008 gene locus_tag LOCUS_10390 63670 63008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 64922 63819 gene locus_tag LOCUS_10400 gene ychF 64922 63819 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_10400 65130 66200 gene locus_tag LOCUS_10410 65130 66200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 66304 67446 gene locus_tag LOCUS_10420 gene galK 66304 67446 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_10420 68048 67443 gene locus_tag LOCUS_10430 68048 67443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 69155 68088 gene locus_tag LOCUS_10440 69155 68088 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_10440 70062 69193 gene locus_tag LOCUS_10450 gene prmC 70062 69193 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_10450 72116 70374 gene locus_tag LOCUS_10460 72116 70374 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_10460 72177 75125 gene locus_tag LOCUS_10470 72177 75125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_10470 75457 76869 gene locus_tag LOCUS_10480 75457 76869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 76871 77947 gene locus_tag LOCUS_10490 76871 77947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 78002 79348 gene locus_tag LOCUS_10500 78002 79348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 79348 79626 gene locus_tag LOCUS_10510 79348 79626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 79991 80176 gene locus_tag LOCUS_10520 79991 80176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 80194 82047 gene locus_tag LOCUS_10530 80194 82047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 84224 82173 gene locus_tag LOCUS_10540 gene clpB 84224 82173 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_10540 84320 85534 gene locus_tag LOCUS_10550 84320 85534 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_10550 85531 86034 gene locus_tag LOCUS_10560 85531 86034 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_10560 86028 86636 gene locus_tag LOCUS_10570 86028 86636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 86640 86984 gene locus_tag LOCUS_10580 86640 86984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 87093 88742 gene locus_tag LOCUS_10590 87093 88742 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_10590 88805 89179 gene locus_tag LOCUS_10600 gene rpsL 88805 89179 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_10600 89213 89689 gene locus_tag LOCUS_10610 gene rpsG 89213 89689 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_10610 89709 91826 gene locus_tag LOCUS_10620 gene fusA 89709 91826 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_10620 91843 92148 gene locus_tag LOCUS_10630 gene rpsJ 91843 92148 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_10630 92189 92263 gene locus_tag LOCUS_t00260 92189 92263 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 93789 92488 gene locus_tag LOCUS_10640 93789 92488 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_10640 94335 95336 gene locus_tag LOCUS_10650 94335 95336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 95353 96540 gene locus_tag LOCUS_10660 95353 96540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 96537 97340 gene locus_tag LOCUS_10670 96537 97340 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964274.1 protein_id gnl|my_center|LOCUS_10670 97575 97784 gene locus_tag LOCUS_10680 97575 97784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 97778 98902 gene locus_tag LOCUS_10690 97778 98902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 99090 98920 gene locus_tag LOCUS_10700 99090 98920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 99691 99604 gene locus_tag LOCUS_t00270 99691 99604 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 101461 99758 gene locus_tag LOCUS_10710 101461 99758 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_10710 101510 101929 gene locus_tag LOCUS_10720 101510 101929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 101933 102970 gene locus_tag LOCUS_10730 gene pheS 101933 102970 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_10730 103160 105910 gene locus_tag LOCUS_10740 103160 105910 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005829323.1 protein_id gnl|my_center|LOCUS_10740 105920 107161 gene locus_tag LOCUS_10750 105920 107161 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312956.1 protein_id gnl|my_center|LOCUS_10750 107168 108694 gene locus_tag LOCUS_10760 107168 108694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004327091.1 protein_id gnl|my_center|LOCUS_10760 108698 110734 gene locus_tag LOCUS_10770 108698 110734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651733.1 protein_id gnl|my_center|LOCUS_10770 110731 112824 gene locus_tag LOCUS_10780 110731 112824 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108060.1 protein_id gnl|my_center|LOCUS_10780 112821 114293 gene locus_tag LOCUS_10790 112821 114293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 114290 114667 gene locus_tag LOCUS_10800 114290 114667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 115803 114688 gene locus_tag LOCUS_10810 115803 114688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 116584 115805 gene locus_tag LOCUS_10820 116584 115805 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209967.1 protein_id gnl|my_center|LOCUS_10820 117203 116598 gene locus_tag LOCUS_10830 117203 116598 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766706.1 protein_id gnl|my_center|LOCUS_10830 117669 117596 gene locus_tag LOCUS_t00280 117669 117596 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 117750 118754 gene locus_tag LOCUS_10840 gene rhaT 117750 118754 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_10840 119151 118822 gene locus_tag LOCUS_10850 119151 118822 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112957.1 protein_id gnl|my_center|LOCUS_10850 120096 119212 gene locus_tag LOCUS_10860 120096 119212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 120165 122474 gene locus_tag LOCUS_10870 120165 122474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 122479 123429 gene locus_tag LOCUS_10880 122479 123429 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 protein_id gnl|my_center|LOCUS_10880 124498 123452 gene locus_tag LOCUS_10890 124498 123452 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763957.1 protein_id gnl|my_center|LOCUS_10890 127098 124504 gene locus_tag LOCUS_10900 127098 124504 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_10900 128263 127388 gene locus_tag LOCUS_10910 128263 127388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 128478 128699 gene locus_tag LOCUS_10920 128478 128699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 129451 128657 gene locus_tag LOCUS_10930 129451 128657 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_10930 130506 129448 gene locus_tag LOCUS_10940 130506 129448 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_10940 130582 131076 gene locus_tag LOCUS_10950 130582 131076 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_10950 131063 131668 gene locus_tag LOCUS_10960 131063 131668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 131655 132923 gene locus_tag LOCUS_10970 131655 132923 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_10970 132945 135557 gene locus_tag LOCUS_10980 gene mutS 132945 135557 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_10980 135550 136869 gene locus_tag LOCUS_10990 135550 136869 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_10990 137241 136900 gene locus_tag LOCUS_11000 137241 136900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 137561 137244 gene locus_tag LOCUS_11010 137561 137244 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798232.1 protein_id gnl|my_center|LOCUS_11010 138160 137855 gene locus_tag LOCUS_11020 138160 137855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 138482 140419 gene locus_tag LOCUS_11030 138482 140419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 140457 140804 gene locus_tag LOCUS_11040 140457 140804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 140809 143439 gene locus_tag LOCUS_11050 140809 143439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 144225 143458 gene locus_tag LOCUS_11060 144225 143458 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_11060 145094 144222 gene locus_tag LOCUS_11070 gene dapA 145094 144222 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081879.1 protein_id gnl|my_center|LOCUS_11070 145753 145091 gene locus_tag LOCUS_11080 gene dapB 145753 145091 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_11080 146751 145876 gene locus_tag LOCUS_11090 gene rsmA 146751 145876 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_11090 149116 146753 gene locus_tag LOCUS_11100 149116 146753 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_11100 149191 149682 gene locus_tag LOCUS_11110 149191 149682 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795316.1 protein_id gnl|my_center|LOCUS_11110 149675 150796 gene locus_tag LOCUS_11120 149675 150796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 151711 150788 gene locus_tag LOCUS_11130 151711 150788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 153085 151727 gene locus_tag LOCUS_11140 153085 151727 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172575.1 protein_id gnl|my_center|LOCUS_11140 153553 153095 gene locus_tag LOCUS_11150 153553 153095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 154878 153571 gene locus_tag LOCUS_11160 gene murA 154878 153571 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_11160 155980 154880 gene locus_tag LOCUS_11170 gene murB 155980 154880 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_11170 156678 156046 gene locus_tag LOCUS_11180 156678 156046 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_11180 158443 156671 gene locus_tag LOCUS_11190 gene aspS 158443 156671 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_11190 159404 158517 gene locus_tag LOCUS_11200 159404 158517 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_11200 160469 159411 gene locus_tag LOCUS_11210 160469 159411 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_11210 162433 160466 gene locus_tag LOCUS_11220 162433 160466 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766212.1 protein_id gnl|my_center|LOCUS_11220 163127 162498 gene locus_tag LOCUS_11230 163127 162498 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_11230 163528 163130 gene locus_tag LOCUS_11240 163528 163130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 163711 163914 gene locus_tag LOCUS_11250 163711 163914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 163960 166107 gene locus_tag LOCUS_11260 163960 166107 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_11260 166140 167399 gene locus_tag LOCUS_11270 166140 167399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 167389 168537 gene locus_tag LOCUS_11280 167389 168537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 168534 169202 gene locus_tag LOCUS_11290 168534 169202 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765259.1 protein_id gnl|my_center|LOCUS_11290 169195 170100 gene locus_tag LOCUS_11300 169195 170100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 170097 171191 gene locus_tag LOCUS_11310 gene vioA 170097 171191 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198210.1 protein_id gnl|my_center|LOCUS_11310 171207 173351 gene locus_tag LOCUS_11320 171207 173351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 173452 173994 gene locus_tag LOCUS_11330 173452 173994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 174019 174645 gene locus_tag LOCUS_11340 174019 174645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 175367 174651 gene locus_tag LOCUS_11350 175367 174651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764091.1 protein_id gnl|my_center|LOCUS_11350 175406 176455 gene locus_tag LOCUS_11360 175406 176455 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_11360 177435 176452 gene locus_tag LOCUS_11370 177435 176452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 178522 177437 gene locus_tag LOCUS_11380 178522 177437 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_11380 178880 178515 gene locus_tag LOCUS_11390 178880 178515 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_11390 181333 178880 gene locus_tag LOCUS_11400 181333 178880 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_11400 182127 181330 gene locus_tag LOCUS_11410 gene cdaA 182127 181330 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_11410 182282 182878 gene locus_tag LOCUS_11420 gene rplC 182282 182878 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_11420 182881 183507 gene locus_tag LOCUS_11430 gene rplD 182881 183507 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_11430 183516 183806 gene locus_tag LOCUS_11440 gene rplW 183516 183806 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_11440 183821 184645 gene locus_tag LOCUS_11450 gene rplB 183821 184645 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_11450 184728 184934 gene locus_tag LOCUS_11460 gene rpsS 184728 184934 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_11460 184937 185353 gene locus_tag LOCUS_11470 gene rplV 184937 185353 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_11470 185356 186111 gene locus_tag LOCUS_11480 gene rpsC 185356 186111 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_11480 186187 187995 gene locus_tag LOCUS_11490 gene uvrC 186187 187995 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_11490 187973 188719 gene locus_tag LOCUS_11500 gene pnuC 187973 188719 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 protein_id gnl|my_center|LOCUS_11500 188781 189035 gene locus_tag LOCUS_11510 188781 189035 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779510.1 protein_id gnl|my_center|LOCUS_11510 189634 189089 gene locus_tag LOCUS_11520 189634 189089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 191297 189648 gene locus_tag LOCUS_11530 191297 189648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 192119 191301 gene locus_tag LOCUS_11540 192119 191301 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_11540 192230 193084 gene locus_tag LOCUS_11550 192230 193084 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_11550 193088 193312 gene locus_tag LOCUS_11560 193088 193312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 193309 194106 gene locus_tag LOCUS_11570 193309 194106 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_11570 194107 194892 gene locus_tag LOCUS_11580 194107 194892 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767009.1 protein_id gnl|my_center|LOCUS_11580 195641 194889 gene locus_tag LOCUS_11590 195641 194889 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_11590 195935 196306 gene locus_tag LOCUS_11600 gene rplP 195935 196306 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_11600 196328 196522 gene locus_tag LOCUS_11610 gene rpmC 196328 196522 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_11610 196525 196779 gene locus_tag LOCUS_11620 gene rpsQ 196525 196779 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_11620 196782 197147 gene locus_tag LOCUS_11630 gene rplN 196782 197147 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_11630 197160 197477 gene locus_tag LOCUS_11640 gene rplX 197160 197477 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_11640 197480 198073 gene locus_tag LOCUS_11650 gene rplE 197480 198073 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_11650 198079 198348 gene locus_tag LOCUS_11660 gene rpsN 198079 198348 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_11660 198369 198764 gene locus_tag LOCUS_11670 gene rpsH 198369 198764 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_11670 198785 199345 gene locus_tag LOCUS_11680 gene rplF 198785 199345 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_11680 199360 199722 gene locus_tag LOCUS_11690 gene rplR 199360 199722 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_11690 199734 200252 gene locus_tag LOCUS_11700 gene rpsE 199734 200252 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_11700 200265 200447 gene locus_tag LOCUS_11710 gene rpmD 200265 200447 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_11710 200462 200914 gene locus_tag LOCUS_11720 gene rplO 200462 200914 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_11720 200917 202254 gene locus_tag LOCUS_11730 gene secY 200917 202254 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_11730 202278 203057 gene locus_tag LOCUS_11740 gene map 202278 203057 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_11740 203071 203289 gene locus_tag LOCUS_11750 gene infA 203071 203289 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_11750 203452 203826 gene locus_tag LOCUS_11760 gene rpsM 203452 203826 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_11760 203840 204226 gene locus_tag LOCUS_11770 gene rpsK 203840 204226 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_11770 204246 204848 gene locus_tag LOCUS_11780 gene rpsD 204246 204848 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_11780 204868 205875 gene locus_tag LOCUS_11790 204868 205875 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_11790 205878 206372 gene locus_tag LOCUS_11800 205878 206372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 206454 208661 gene locus_tag LOCUS_11810 206454 208661 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_11810 208668 210599 gene locus_tag LOCUS_11820 208668 210599 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_11820 210601 211395 gene locus_tag LOCUS_11830 gene nagB 210601 211395 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 protein_id gnl|my_center|LOCUS_11830 211400 212791 gene locus_tag LOCUS_11840 gene radA 211400 212791 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_11840 212784 214172 gene locus_tag LOCUS_11850 212784 214172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 215245 214169 gene locus_tag LOCUS_11860 gene aroB 215245 214169 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257969.1 protein_id gnl|my_center|LOCUS_11860 215304 215389 gene locus_tag LOCUS_t00290 215304 215389 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 215644 218412 gene locus_tag LOCUS_11870 215644 218412 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 protein_id gnl|my_center|LOCUS_11870 218943 218407 gene locus_tag LOCUS_11880 218943 218407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 219831 218983 gene locus_tag LOCUS_11890 219831 218983 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_11890 220192 220806 gene locus_tag LOCUS_11900 220192 220806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 220815 222278 gene locus_tag LOCUS_11910 220815 222278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 223678 222275 gene locus_tag LOCUS_11920 223678 222275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 224511 223675 gene locus_tag LOCUS_11930 224511 223675 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_11930 225140 224508 gene locus_tag LOCUS_11940 225140 224508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_11940 225328 225507 gene locus_tag LOCUS_11950 225328 225507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 225670 227094 gene locus_tag LOCUS_11960 225670 227094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 227277 228335 gene locus_tag LOCUS_11970 227277 228335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 229402 228521 gene locus_tag LOCUS_11980 229402 228521 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11980 229934 231751 gene locus_tag LOCUS_11990 229934 231751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 231767 233767 gene locus_tag LOCUS_12000 231767 233767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 234612 233764 gene locus_tag LOCUS_12010 234612 233764 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_12010 235988 234609 gene locus_tag LOCUS_12020 235988 234609 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_12020 237199 235985 gene locus_tag LOCUS_12030 237199 235985 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_12030 237253 238593 gene locus_tag LOCUS_12040 237253 238593 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_12040 238620 239498 gene locus_tag LOCUS_12050 238620 239498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_12050 239491 239916 gene locus_tag LOCUS_12060 239491 239916 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_12060 239913 240179 gene locus_tag LOCUS_12070 239913 240179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 240245 241801 gene locus_tag LOCUS_12080 240245 241801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_12080 241872 242438 gene locus_tag LOCUS_12090 241872 242438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 242445 243053 gene locus_tag LOCUS_12100 242445 243053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 243050 244369 gene locus_tag LOCUS_12110 243050 244369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 244398 245084 gene locus_tag LOCUS_12120 244398 245084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_12120 245097 246167 gene locus_tag LOCUS_12130 245097 246167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 246180 246890 gene locus_tag LOCUS_12140 246180 246890 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_12140 247293 246898 gene locus_tag LOCUS_12150 247293 246898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence06 2744 1785 gene locus_tag LOCUS_12160 2744 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 3054 2734 gene locus_tag LOCUS_12170 3054 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 4425 3337 gene locus_tag LOCUS_12180 4425 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4856 4494 gene locus_tag LOCUS_12190 4856 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6684 4948 gene locus_tag LOCUS_12200 6684 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 7153 7314 gene locus_tag LOCUS_12210 7153 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7388 8281 gene locus_tag LOCUS_12220 7388 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8376 9683 gene locus_tag LOCUS_12230 gene gmd 8376 9683 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_12230 9680 10624 gene locus_tag LOCUS_12240 9680 10624 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_12240 10659 11864 gene locus_tag LOCUS_12250 10659 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 11939 12274 gene locus_tag LOCUS_12260 11939 12274 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788139.1 protein_id gnl|my_center|LOCUS_12260 12908 12660 gene locus_tag LOCUS_12270 12908 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 13170 12991 gene locus_tag LOCUS_12280 13170 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 13425 13757 gene locus_tag LOCUS_12290 13425 13757 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788139.1 protein_id gnl|my_center|LOCUS_12290 14169 15689 gene locus_tag LOCUS_12300 14169 15689 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_12300 15744 15914 gene locus_tag LOCUS_12310 15744 15914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 15965 17092 gene locus_tag LOCUS_12320 15965 17092 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_12320 17142 17417 gene locus_tag LOCUS_12330 17142 17417 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_12330 17423 17653 gene locus_tag LOCUS_12340 17423 17653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 17702 20155 gene locus_tag LOCUS_12350 17702 20155 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_12350 21643 20156 gene locus_tag LOCUS_12360 21643 20156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 21727 22749 gene locus_tag LOCUS_12370 21727 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 22793 24772 gene locus_tag LOCUS_12380 22793 24772 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_12380 25179 25937 gene locus_tag LOCUS_12390 25179 25937 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_12390 26095 28281 gene locus_tag LOCUS_12400 26095 28281 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_12400 29281 28604 gene locus_tag LOCUS_12410 gene trmD 29281 28604 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_12410 29355 31079 gene locus_tag LOCUS_12420 29355 31079 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_12420 31083 32966 gene locus_tag LOCUS_12430 gene yidC 31083 32966 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_12430 32966 33622 gene locus_tag LOCUS_12440 32966 33622 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_12440 33628 35928 gene locus_tag LOCUS_12450 33628 35928 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_12450 35925 37220 gene locus_tag LOCUS_12460 35925 37220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 37432 38796 gene locus_tag LOCUS_12470 37432 38796 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760379.1 protein_id gnl|my_center|LOCUS_12470 39108 39881 gene locus_tag LOCUS_12480 39108 39881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 40485 39868 gene locus_tag LOCUS_12490 40485 39868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 40548 41015 gene locus_tag LOCUS_12500 40548 41015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 41072 42172 gene locus_tag LOCUS_12510 41072 42172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 42169 42546 gene locus_tag LOCUS_12520 gene gcvH 42169 42546 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026899.1 protein_id gnl|my_center|LOCUS_12520 42596 43849 gene locus_tag LOCUS_12530 42596 43849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 43846 45240 gene locus_tag LOCUS_12540 gene gcvPB 43846 45240 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_12540 45246 46361 gene locus_tag LOCUS_12550 45246 46361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 47003 46356 gene locus_tag LOCUS_12560 gene tsaA 47003 46356 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_12560 48198 46993 gene locus_tag LOCUS_12570 48198 46993 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_12570 48294 51353 gene locus_tag LOCUS_12580 48294 51353 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_12580 51354 53606 gene locus_tag LOCUS_12590 51354 53606 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_12590 54173 53607 gene locus_tag LOCUS_12600 54173 53607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 55703 54177 gene locus_tag LOCUS_12610 55703 54177 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_12610 57095 55803 gene locus_tag LOCUS_12620 57095 55803 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_12620 57898 57092 gene locus_tag LOCUS_12630 57898 57092 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762999.1 protein_id gnl|my_center|LOCUS_12630 58671 57898 gene locus_tag LOCUS_12640 58671 57898 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107691.1 protein_id gnl|my_center|LOCUS_12640 60058 58664 gene locus_tag LOCUS_12650 gene potA 60058 58664 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_12650 61066 60059 gene locus_tag LOCUS_12660 61066 60059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 61159 62829 gene locus_tag LOCUS_12670 61159 62829 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_12670 62836 64590 gene locus_tag LOCUS_12680 62836 64590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_12680 64587 66623 gene locus_tag LOCUS_12690 64587 66623 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389613.1 protein_id gnl|my_center|LOCUS_12690 67132 66626 gene locus_tag LOCUS_12700 gene queF 67132 66626 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_12700 67769 67086 gene locus_tag LOCUS_12710 67769 67086 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762200.1 protein_id gnl|my_center|LOCUS_12710 69972 67840 gene locus_tag LOCUS_12720 69972 67840 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_12720 70038 71186 gene locus_tag LOCUS_12730 70038 71186 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_12730 71241 72074 gene locus_tag LOCUS_12740 71241 72074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 72133 73263 gene locus_tag LOCUS_12750 72133 73263 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_12750 73244 74440 gene locus_tag LOCUS_12760 73244 74440 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_12760 76076 74391 gene locus_tag LOCUS_12770 76076 74391 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_12770 77679 76078 gene locus_tag LOCUS_12780 77679 76078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 78595 77747 gene locus_tag LOCUS_12790 78595 77747 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_12790 78655 79833 gene locus_tag LOCUS_12800 gene pncB 78655 79833 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766265.1 protein_id gnl|my_center|LOCUS_12800 79830 81536 gene locus_tag LOCUS_12810 79830 81536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 81533 82699 gene locus_tag LOCUS_12820 81533 82699 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_12820 82696 84504 gene locus_tag LOCUS_12830 82696 84504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 84504 85262 gene locus_tag LOCUS_12840 84504 85262 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_12840 85255 87603 gene locus_tag LOCUS_12850 85255 87603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 87692 89062 gene locus_tag LOCUS_12860 87692 89062 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_12860 89070 91640 gene locus_tag LOCUS_12870 89070 91640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 92716 91637 gene locus_tag LOCUS_12880 92716 91637 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099535.1 protein_id gnl|my_center|LOCUS_12880 92652 93644 gene locus_tag LOCUS_12890 92652 93644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 95115 93631 gene locus_tag LOCUS_12900 95115 93631 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055963.1 protein_id gnl|my_center|LOCUS_12900 95207 96667 gene locus_tag LOCUS_12910 95207 96667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 96679 98859 gene locus_tag LOCUS_12920 96679 98859 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_12920 99554 98856 gene locus_tag LOCUS_12930 99554 98856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 100748 99555 gene locus_tag LOCUS_12940 100748 99555 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_12940 101896 100751 gene locus_tag LOCUS_12950 101896 100751 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107809.1 protein_id gnl|my_center|LOCUS_12950 102125 101862 gene locus_tag LOCUS_12960 102125 101862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 102010 102585 gene locus_tag LOCUS_12970 102010 102585 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_12970 102965 102582 gene locus_tag LOCUS_12980 102965 102582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 103003 104508 gene locus_tag LOCUS_12990 103003 104508 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203639.1 protein_id gnl|my_center|LOCUS_12990 104512 105858 gene locus_tag LOCUS_13000 104512 105858 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_13000 105895 107028 gene locus_tag LOCUS_13010 105895 107028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 107028 107816 gene locus_tag LOCUS_13020 107028 107816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 107785 108978 gene locus_tag LOCUS_13030 107785 108978 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_13030 109010 109462 gene locus_tag LOCUS_13040 gene dtd 109010 109462 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_13040 109464 112478 gene locus_tag LOCUS_13050 109464 112478 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_13050 112534 112607 gene locus_tag LOCUS_t00300 112534 112607 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 112836 112633 gene locus_tag LOCUS_13060 112836 112633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 113636 112833 gene locus_tag LOCUS_13070 113636 112833 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_13070 113725 114057 gene locus_tag LOCUS_13080 113725 114057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 114563 114072 gene locus_tag LOCUS_13090 114563 114072 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_13090 115734 115111 gene locus_tag LOCUS_13100 115734 115111 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_13100 115919 116107 gene locus_tag LOCUS_13110 115919 116107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 117780 116329 gene locus_tag LOCUS_13120 117780 116329 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109309.1 protein_id gnl|my_center|LOCUS_13120 118142 118513 gene locus_tag LOCUS_13130 118142 118513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 119324 118953 gene locus_tag LOCUS_13140 119324 118953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 120192 119743 gene locus_tag LOCUS_13150 120192 119743 CDS product 5'-3'-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468869.1 protein_id gnl|my_center|LOCUS_13150 120758 120192 gene locus_tag LOCUS_13160 120758 120192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 121441 120755 gene locus_tag LOCUS_13170 121441 120755 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_13170 126948 121438 gene locus_tag LOCUS_13180 126948 121438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 128516 126945 gene locus_tag LOCUS_13190 128516 126945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071655.1 protein_id gnl|my_center|LOCUS_13190 132616 128528 gene locus_tag LOCUS_13200 132616 128528 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071654.1 protein_id gnl|my_center|LOCUS_13200 133993 132638 gene locus_tag LOCUS_13210 133993 132638 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_13210 136013 133995 gene locus_tag LOCUS_13220 136013 133995 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_13220 136223 136444 gene locus_tag LOCUS_13230 136223 136444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 136390 136710 gene locus_tag LOCUS_13240 136390 136710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 136836 136675 gene locus_tag LOCUS_13250 136836 136675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 138175 136826 gene locus_tag LOCUS_13260 gene mnmE 138175 136826 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202306.1 protein_id gnl|my_center|LOCUS_13260 139963 138179 gene locus_tag LOCUS_13270 139963 138179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 142781 140052 gene locus_tag LOCUS_13280 142781 140052 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_13280 142853 143929 gene locus_tag LOCUS_13290 142853 143929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 144146 145570 gene locus_tag LOCUS_13300 gene dnaA 144146 145570 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_13300 145589 147013 gene locus_tag LOCUS_13310 145589 147013 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_13310 146998 147651 gene locus_tag LOCUS_13320 gene rpe 146998 147651 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111648.1 protein_id gnl|my_center|LOCUS_13320 148333 147599 gene locus_tag LOCUS_13330 148333 147599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 148356 150251 gene locus_tag LOCUS_13340 gene ftsH 148356 150251 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_13340 150251 150904 gene locus_tag LOCUS_13350 150251 150904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 150907 151563 gene locus_tag LOCUS_13360 150907 151563 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_13360 152809 151544 gene locus_tag LOCUS_13370 152809 151544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 153575 152772 gene locus_tag LOCUS_13380 153575 152772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 155368 153572 gene locus_tag LOCUS_13390 155368 153572 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_13390 157524 155365 gene locus_tag LOCUS_13400 157524 155365 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760913.1 protein_id gnl|my_center|LOCUS_13400 158450 157521 gene locus_tag LOCUS_13410 158450 157521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 160511 158454 gene locus_tag LOCUS_13420 gene ligA 160511 158454 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_13420 161702 160521 gene locus_tag LOCUS_13430 gene pfp 161702 160521 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_13430 161842 162705 gene locus_tag LOCUS_13440 161842 162705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 163964 162636 gene locus_tag LOCUS_13450 163964 162636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 164659 163955 gene locus_tag LOCUS_13460 164659 163955 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_13460 164719 166857 gene locus_tag LOCUS_13470 164719 166857 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_13470 168157 166868 gene locus_tag LOCUS_13480 168157 166868 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_13480 169296 168157 gene locus_tag LOCUS_13490 169296 168157 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_13490 169393 169923 gene locus_tag LOCUS_13500 169393 169923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 169923 170537 gene locus_tag LOCUS_13510 169923 170537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 171817 170534 gene locus_tag LOCUS_13520 171817 170534 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_13520 172765 171830 gene locus_tag LOCUS_13530 172765 171830 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_13530 174185 172776 gene locus_tag LOCUS_13540 gene rlmD 174185 172776 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_13540 175682 174195 gene locus_tag LOCUS_13550 175682 174195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 175903 175679 gene locus_tag LOCUS_13560 175903 175679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 175880 177178 gene locus_tag LOCUS_13570 gene cls 175880 177178 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_13570 177233 178159 gene locus_tag LOCUS_13580 177233 178159 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_13580 178749 178156 gene locus_tag LOCUS_13590 gene folE 178749 178156 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932463.1 protein_id gnl|my_center|LOCUS_13590 179744 178818 gene locus_tag LOCUS_13600 179744 178818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 180824 179772 gene locus_tag LOCUS_13610 180824 179772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 182091 180961 gene locus_tag LOCUS_13620 182091 180961 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_13620 183301 182093 gene locus_tag LOCUS_13630 183301 182093 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_13630 183803 184213 gene locus_tag LOCUS_13640 183803 184213 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_13640 184220 185518 gene locus_tag LOCUS_13650 184220 185518 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_13650 186574 185600 gene locus_tag LOCUS_13660 186574 185600 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230328.1 protein_id gnl|my_center|LOCUS_13660 188490 186583 gene locus_tag LOCUS_13670 188490 186583 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_13670 188894 188487 gene locus_tag LOCUS_13680 188894 188487 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121782.1 protein_id gnl|my_center|LOCUS_13680 191530 188891 gene locus_tag LOCUS_13690 191530 188891 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_13690 192110 191514 gene locus_tag LOCUS_13700 192110 191514 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_13700 192638 192114 gene locus_tag LOCUS_13710 192638 192114 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_13710 192961 192638 gene locus_tag LOCUS_13720 192961 192638 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791533.1 protein_id gnl|my_center|LOCUS_13720 193578 193171 gene locus_tag LOCUS_13730 193578 193171 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_13730 193693 193620 gene locus_tag LOCUS_t00310 193693 193620 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 193811 195421 gene locus_tag LOCUS_13740 193811 195421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 195520 197430 gene locus_tag LOCUS_13750 195520 197430 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_13750 197433 198269 gene locus_tag LOCUS_13760 197433 198269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 198764 198270 gene locus_tag LOCUS_13770 198764 198270 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_13770 199212 198787 gene locus_tag LOCUS_13780 199212 198787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460150.1 protein_id gnl|my_center|LOCUS_13780 199288 199980 gene locus_tag LOCUS_13790 199288 199980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 199973 200695 gene locus_tag LOCUS_13800 199973 200695 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775494.1 protein_id gnl|my_center|LOCUS_13800 201223 201245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence07 1677 130 gene locus_tag LOCUS_13810 1677 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1986 1681 gene locus_tag LOCUS_13820 gene cas2 1986 1681 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_13820 2939 2013 gene locus_tag LOCUS_13830 gene cas1 2939 2013 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_13830 7002 2932 gene locus_tag LOCUS_13840 gene cas9 7002 2932 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 protein_id gnl|my_center|LOCUS_13840 7334 8683 gene locus_tag LOCUS_13850 7334 8683 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202532.1 protein_id gnl|my_center|LOCUS_13850 11283 10411 gene locus_tag LOCUS_13860 11283 10411 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267503.1 protein_id gnl|my_center|LOCUS_13860 12860 11280 gene locus_tag LOCUS_13870 12860 11280 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_13870 13264 12857 gene locus_tag LOCUS_13880 13264 12857 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_13880 14931 13264 gene locus_tag LOCUS_13890 14931 13264 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_13890 16138 14921 gene locus_tag LOCUS_13900 16138 14921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 16237 17154 gene locus_tag LOCUS_13910 16237 17154 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785907.1 protein_id gnl|my_center|LOCUS_13910 18111 17155 gene locus_tag LOCUS_13920 18111 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 18870 18178 gene locus_tag LOCUS_13930 18870 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 19323 19251 gene locus_tag LOCUS_t00320 19323 19251 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19515 19333 gene locus_tag LOCUS_13940 gene rpmF 19515 19333 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_13940 20046 19537 gene locus_tag LOCUS_13950 20046 19537 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_13950 21875 20070 gene locus_tag LOCUS_13960 gene typA 21875 20070 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_13960 23211 22024 gene locus_tag LOCUS_13970 23211 22024 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791792.1 protein_id gnl|my_center|LOCUS_13970 25914 23341 gene locus_tag LOCUS_13980 25914 23341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 26729 25941 gene locus_tag LOCUS_13990 26729 25941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 27727 26729 gene locus_tag LOCUS_14000 27727 26729 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_14000 28710 27727 gene locus_tag LOCUS_14010 28710 27727 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_14010 29641 28700 gene locus_tag LOCUS_14020 29641 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 30519 29638 gene locus_tag LOCUS_14030 30519 29638 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_14030 31511 30519 gene locus_tag LOCUS_14040 31511 30519 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_14040 31535 32605 gene locus_tag LOCUS_14050 31535 32605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 32607 33569 gene locus_tag LOCUS_14060 32607 33569 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_14060 33987 33763 gene locus_tag LOCUS_14070 33987 33763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 34156 35004 gene locus_tag LOCUS_14080 34156 35004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 35686 36411 gene locus_tag LOCUS_14090 35686 36411 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_14090 36411 36824 gene locus_tag LOCUS_14100 36411 36824 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_14100 36827 37609 gene locus_tag LOCUS_14110 36827 37609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 37667 38941 gene locus_tag LOCUS_14120 37667 38941 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_14120 38941 39822 gene locus_tag LOCUS_14130 gene era 38941 39822 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_14130 39850 42690 gene locus_tag LOCUS_14140 39850 42690 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_14140 42690 43355 gene locus_tag LOCUS_14150 gene aroK 42690 43355 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_14150 43722 43369 gene locus_tag LOCUS_14160 43722 43369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 44068 43799 gene locus_tag LOCUS_14170 44068 43799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 45003 44146 gene locus_tag LOCUS_14180 45003 44146 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_14180 45812 45009 gene locus_tag LOCUS_14190 gene murQ 45812 45009 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801650.1 protein_id gnl|my_center|LOCUS_14190 47542 45809 gene locus_tag LOCUS_14200 gene recJ 47542 45809 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_14200 48504 47686 gene locus_tag LOCUS_14210 gene trmB 48504 47686 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_14210 49138 48491 gene locus_tag LOCUS_14220 49138 48491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 50650 49520 gene locus_tag LOCUS_14230 50650 49520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 51587 50655 gene locus_tag LOCUS_14240 51587 50655 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_14240 52558 51584 gene locus_tag LOCUS_14250 52558 51584 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_14250 53088 52558 gene locus_tag LOCUS_14260 53088 52558 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_14260 53751 53098 gene locus_tag LOCUS_14270 53751 53098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 54064 53753 gene locus_tag LOCUS_14280 gene trxA 54064 53753 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_14280 54378 54085 gene locus_tag LOCUS_14290 54378 54085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_14290 57479 54375 gene locus_tag LOCUS_14300 57479 54375 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_14300 58512 57484 gene locus_tag LOCUS_14310 58512 57484 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_14310 59981 58509 gene locus_tag LOCUS_14320 59981 58509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 60473 60051 gene locus_tag LOCUS_14330 60473 60051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 61770 60451 gene locus_tag LOCUS_14340 61770 60451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 62671 61784 gene locus_tag LOCUS_14350 gene lgt 62671 61784 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_14350 63093 62668 gene locus_tag LOCUS_14360 63093 62668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 65047 63101 gene locus_tag LOCUS_14370 65047 63101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 65103 65178 gene locus_tag LOCUS_t00330 65103 65178 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 65242 65511 gene locus_tag LOCUS_14380 65242 65511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 67000 65708 gene locus_tag LOCUS_14390 67000 65708 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_14390 67946 67104 gene locus_tag LOCUS_14400 67946 67104 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_14400 71437 68021 gene locus_tag LOCUS_14410 71437 68021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 73801 71438 gene locus_tag LOCUS_14420 73801 71438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 75980 73890 gene locus_tag LOCUS_14430 75980 73890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 77215 75986 gene locus_tag LOCUS_14440 77215 75986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 78330 77215 gene locus_tag LOCUS_14450 78330 77215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 79865 78432 gene locus_tag LOCUS_14460 79865 78432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 81062 79899 gene locus_tag LOCUS_14470 81062 79899 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203742.1 protein_id gnl|my_center|LOCUS_14470 82319 81150 gene locus_tag LOCUS_14480 82319 81150 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203742.1 protein_id gnl|my_center|LOCUS_14480 83488 82370 gene locus_tag LOCUS_14490 83488 82370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 85464 83485 gene locus_tag LOCUS_14500 85464 83485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 85893 86981 gene locus_tag LOCUS_14510 85893 86981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 86981 88261 gene locus_tag LOCUS_14520 86981 88261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 88258 88641 gene locus_tag LOCUS_14530 88258 88641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 89717 88692 gene locus_tag LOCUS_14540 89717 88692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 89815 89741 gene locus_tag LOCUS_t00340 89815 89741 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 89879 90544 gene locus_tag LOCUS_14550 89879 90544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_14550 91138 92124 gene locus_tag LOCUS_14560 91138 92124 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856169.1 protein_id gnl|my_center|LOCUS_14560 94811 92121 gene locus_tag LOCUS_14570 94811 92121 CDS product beta galactosidase jelly roll domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108903.1 protein_id gnl|my_center|LOCUS_14570 95985 95098 gene locus_tag LOCUS_14580 95985 95098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 97221 96235 gene locus_tag LOCUS_14590 97221 96235 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_14590 97328 97966 gene locus_tag LOCUS_14600 97328 97966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 98755 98150 gene locus_tag LOCUS_14610 98755 98150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 99065 98760 gene locus_tag LOCUS_14620 99065 98760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 99599 99075 gene locus_tag LOCUS_14630 99599 99075 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_14630 100610 99657 gene locus_tag LOCUS_14640 100610 99657 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_14640 101451 100612 gene locus_tag LOCUS_14650 101451 100612 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_14650 102385 101501 gene locus_tag LOCUS_14660 102385 101501 CDS product DUF4886 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119653.1 protein_id gnl|my_center|LOCUS_14660 102447 103103 gene locus_tag LOCUS_14670 gene ubiE 102447 103103 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_14670 104439 103486 gene locus_tag LOCUS_14680 gene menA 104439 103486 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962643.1 protein_id gnl|my_center|LOCUS_14680 105299 104508 gene locus_tag LOCUS_14690 gene tatC 105299 104508 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_14690 105529 105299 gene locus_tag LOCUS_14700 105529 105299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 107311 105536 gene locus_tag LOCUS_14710 gene lepA 107311 105536 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_14710 107998 107489 gene locus_tag LOCUS_14720 107998 107489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 108477 108130 gene locus_tag LOCUS_14730 108477 108130 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_14730 108516 109220 gene locus_tag LOCUS_14740 108516 109220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 109231 109974 gene locus_tag LOCUS_14750 109231 109974 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_14750 109975 110448 gene locus_tag LOCUS_14760 109975 110448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 110445 110675 gene locus_tag LOCUS_14770 gene yidD 110445 110675 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_14770 110894 113995 gene locus_tag LOCUS_14780 110894 113995 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_14780 114001 114990 gene locus_tag LOCUS_14790 114001 114990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 115200 116471 gene locus_tag LOCUS_14800 115200 116471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 117790 116537 gene locus_tag LOCUS_14810 117790 116537 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_14810 117839 118387 gene locus_tag LOCUS_14820 117839 118387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 119865 118474 gene locus_tag LOCUS_14830 119865 118474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 121804 120419 gene locus_tag LOCUS_14840 gene gltA 121804 120419 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_14840 122651 121815 gene locus_tag LOCUS_14850 122651 121815 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_14850 123603 123097 gene locus_tag LOCUS_14860 123603 123097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 124546 123716 gene locus_tag LOCUS_14870 124546 123716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 125310 124546 gene locus_tag LOCUS_14880 125310 124546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 125729 125322 gene locus_tag LOCUS_14890 125729 125322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 126358 125759 gene locus_tag LOCUS_14900 gene rsxA 126358 125759 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_14900 126946 126365 gene locus_tag LOCUS_14910 126946 126365 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_14910 127531 126950 gene locus_tag LOCUS_14920 127531 126950 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_14920 128487 127534 gene locus_tag LOCUS_14930 128487 127534 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_14930 129971 128484 gene locus_tag LOCUS_14940 gene rsxC 129971 128484 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_14940 131017 129968 gene locus_tag LOCUS_14950 131017 129968 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_14950 131430 131014 gene locus_tag LOCUS_14960 131430 131014 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793421.1 protein_id gnl|my_center|LOCUS_14960 132879 131437 gene locus_tag LOCUS_14970 gene dnaB 132879 131437 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_14970 133698 132886 gene locus_tag LOCUS_14980 133698 132886 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_14980 134509 133706 gene locus_tag LOCUS_14990 134509 133706 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_14990 134823 134506 gene locus_tag LOCUS_15000 134823 134506 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760912.1 protein_id gnl|my_center|LOCUS_15000 135780 134827 gene locus_tag LOCUS_15010 135780 134827 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_15010 136742 135777 gene locus_tag LOCUS_15020 136742 135777 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_15020 139363 136739 gene locus_tag LOCUS_15030 139363 136739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 141978 139360 gene locus_tag LOCUS_15040 gene alaS 141978 139360 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_15040 142086 143366 gene locus_tag LOCUS_15050 142086 143366 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_15050 143368 144294 gene locus_tag LOCUS_15060 143368 144294 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_15060 144291 145589 gene locus_tag LOCUS_15070 gene purB 144291 145589 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_15070 146071 149286 gene locus_tag LOCUS_15080 146071 149286 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_15080 149297 150940 gene locus_tag LOCUS_15090 149297 150940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 150967 151851 gene locus_tag LOCUS_15100 150967 151851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 151915 152880 gene locus_tag LOCUS_15110 151915 152880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 152889 155465 gene locus_tag LOCUS_15120 152889 155465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 156114 155470 gene locus_tag LOCUS_15130 156114 155470 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_15130 157280 156111 gene locus_tag LOCUS_15140 157280 156111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 158872 157286 gene locus_tag LOCUS_15150 gene atpA 158872 157286 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107412.1 protein_id gnl|my_center|LOCUS_15150 159345 158869 gene locus_tag LOCUS_15160 159345 158869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 159820 159323 gene locus_tag LOCUS_15170 gene atpF 159820 159323 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_15170 160081 159824 gene locus_tag LOCUS_15180 160081 159824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 161184 160102 gene locus_tag LOCUS_15190 gene atpB 161184 160102 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_15190 161411 161181 gene locus_tag LOCUS_15200 gene atpC 161411 161181 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_15200 162925 161408 gene locus_tag LOCUS_15210 gene atpD 162925 161408 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_15210 165550 163106 gene locus_tag LOCUS_15220 gene galB 165550 163106 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_15220 169425 165550 gene locus_tag LOCUS_15230 169425 165550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 171506 169422 gene locus_tag LOCUS_15240 171506 169422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 173551 171503 gene locus_tag LOCUS_15250 173551 171503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 175404 173548 gene locus_tag LOCUS_15260 175404 173548 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_15260 177833 175401 gene locus_tag LOCUS_15270 177833 175401 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201935.1 protein_id gnl|my_center|LOCUS_15270 179403 177835 gene locus_tag LOCUS_15280 179403 177835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 181088 179466 gene locus_tag LOCUS_15290 181088 179466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 181270 181085 gene locus_tag LOCUS_15300 181270 181085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 182927 181242 gene locus_tag LOCUS_15310 182927 181242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 184617 182914 gene locus_tag LOCUS_15320 184617 182914 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_15320 187695 184630 gene locus_tag LOCUS_15330 187695 184630 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765142.1 protein_id gnl|my_center|LOCUS_15330 189263 187725 gene locus_tag LOCUS_15340 189263 187725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 190772 189267 gene locus_tag LOCUS_15350 190772 189267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 194721 190882 gene locus_tag LOCUS_15360 194721 190882 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence08 669 16 gene locus_tag LOCUS_15370 gene wlbG 669 16 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807105.1 protein_id gnl|my_center|LOCUS_15370 1592 813 gene locus_tag LOCUS_15380 1592 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3237 1597 gene locus_tag LOCUS_15390 3237 1597 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_15390 4996 3212 gene locus_tag LOCUS_15400 4996 3212 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922436.1 protein_id gnl|my_center|LOCUS_15400 5232 5002 gene locus_tag LOCUS_15410 5232 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 6533 5325 gene locus_tag LOCUS_15420 6533 5325 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_15420 7169 7648 gene locus_tag LOCUS_15430 7169 7648 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793703.1 protein_id gnl|my_center|LOCUS_15430 8158 7751 gene locus_tag LOCUS_15440 8158 7751 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_15440 9274 8162 gene locus_tag LOCUS_15450 9274 8162 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_15450 10284 9295 gene locus_tag LOCUS_15460 10284 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 11071 10289 gene locus_tag LOCUS_15470 11071 10289 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083199050.1 protein_id gnl|my_center|LOCUS_15470 11972 11112 gene locus_tag LOCUS_15480 11972 11112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 13407 12391 gene locus_tag LOCUS_15490 13407 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 14870 13410 gene locus_tag LOCUS_15500 14870 13410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 15636 15037 gene locus_tag LOCUS_15510 15636 15037 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261028.1 protein_id gnl|my_center|LOCUS_15510 16000 15614 gene locus_tag LOCUS_15520 16000 15614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 18333 16888 gene locus_tag LOCUS_15530 18333 16888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 19374 18337 gene locus_tag LOCUS_15540 19374 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 20060 19371 gene locus_tag LOCUS_15550 20060 19371 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_15550 21220 20057 gene locus_tag LOCUS_15560 gene neuC 21220 20057 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_15560 22224 21217 gene locus_tag LOCUS_15570 gene neuB 22224 21217 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_15570 23281 22229 gene locus_tag LOCUS_15580 23281 22229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 24311 23286 gene locus_tag LOCUS_15590 gene rfbB 24311 23286 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889301.1 protein_id gnl|my_center|LOCUS_15590 25350 24334 gene locus_tag LOCUS_15600 25350 24334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 26630 25350 gene locus_tag LOCUS_15610 26630 25350 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_15610 26695 26859 gene locus_tag LOCUS_15620 26695 26859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 28545 27718 gene locus_tag LOCUS_15630 28545 27718 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021650009.1 protein_id gnl|my_center|LOCUS_15630 29686 28553 gene locus_tag LOCUS_15640 29686 28553 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_15640 31402 30833 gene locus_tag LOCUS_15650 gene rfbC 31402 30833 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_15650 32322 31411 gene locus_tag LOCUS_15660 gene rfbA 32322 31411 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_15660 33096 32341 gene locus_tag LOCUS_15670 33096 32341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 33702 33295 gene locus_tag LOCUS_15680 33702 33295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 34713 33928 gene locus_tag LOCUS_15690 34713 33928 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287698.1 protein_id gnl|my_center|LOCUS_15690 35390 34713 gene locus_tag LOCUS_15700 35390 34713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 35932 35390 gene locus_tag LOCUS_15710 35932 35390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 36351 35929 gene locus_tag LOCUS_15720 36351 35929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 37146 36823 gene locus_tag LOCUS_15730 37146 36823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 37576 37160 gene locus_tag LOCUS_15740 37576 37160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 40833 37588 gene locus_tag LOCUS_15750 40833 37588 CDS product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291481.1 protein_id gnl|my_center|LOCUS_15750 41902 41147 gene locus_tag LOCUS_15760 41902 41147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 42427 42134 gene locus_tag LOCUS_15770 42427 42134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 43423 42827 gene locus_tag LOCUS_15780 43423 42827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 44650 43439 gene locus_tag LOCUS_15790 44650 43439 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_15790 46128 44857 gene locus_tag LOCUS_15800 46128 44857 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_15800 46679 46173 gene locus_tag LOCUS_15810 46679 46173 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238395.1 protein_id gnl|my_center|LOCUS_15810 47192 46725 gene locus_tag LOCUS_15820 47192 46725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 48271 47396 gene locus_tag LOCUS_15830 gene rfbA 48271 47396 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_15830 48743 48288 gene locus_tag LOCUS_15840 48743 48288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 50376 49072 gene locus_tag LOCUS_15850 gene rimO 50376 49072 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_15850 51310 50363 gene locus_tag LOCUS_15860 51310 50363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 52224 51307 gene locus_tag LOCUS_15870 52224 51307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 52572 52231 gene locus_tag LOCUS_15880 gene yajC 52572 52231 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_15880 53493 52579 gene locus_tag LOCUS_15890 gene nusB 53493 52579 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_15890 53581 53931 gene locus_tag LOCUS_15900 53581 53931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 53931 55208 gene locus_tag LOCUS_15910 53931 55208 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_15910 55213 56040 gene locus_tag LOCUS_15920 55213 56040 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_15920 56042 56866 gene locus_tag LOCUS_15930 56042 56866 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_15930 58933 56942 gene locus_tag LOCUS_15940 58933 56942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 60475 58940 gene locus_tag LOCUS_15950 gene rny 60475 58940 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_15950 60987 60682 gene locus_tag LOCUS_15960 60987 60682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 61246 60977 gene locus_tag LOCUS_15970 61246 60977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 62400 61321 gene locus_tag LOCUS_15980 62400 61321 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_15980 62908 62501 gene locus_tag LOCUS_15990 62908 62501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 62994 64316 gene locus_tag LOCUS_16000 gene ffh 62994 64316 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_16000 66043 64313 gene locus_tag LOCUS_16010 66043 64313 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_16010 67998 66043 gene locus_tag LOCUS_16020 67998 66043 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_16020 68038 68835 gene locus_tag LOCUS_16030 68038 68835 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_16030 69318 68971 gene locus_tag LOCUS_16040 69318 68971 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_16040 70125 69322 gene locus_tag LOCUS_16050 70125 69322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 70948 70118 gene locus_tag LOCUS_16060 70948 70118 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_16060 71041 72198 gene locus_tag LOCUS_16070 71041 72198 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_16070 73073 72321 gene locus_tag LOCUS_16080 73073 72321 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_16080 73751 73077 gene locus_tag LOCUS_16090 73751 73077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 75278 73854 gene locus_tag LOCUS_16100 75278 73854 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_16100 76334 75303 gene locus_tag LOCUS_16110 gene pdxB 76334 75303 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_16110 76657 76331 gene locus_tag LOCUS_16120 76657 76331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 77744 76650 gene locus_tag LOCUS_16130 gene recF 77744 76650 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_16130 77806 79368 gene locus_tag LOCUS_16140 77806 79368 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_16140 79368 79775 gene locus_tag LOCUS_16150 79368 79775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 79772 80248 gene locus_tag LOCUS_16160 79772 80248 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_16160 80251 81393 gene locus_tag LOCUS_16170 80251 81393 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_16170 82620 81430 gene locus_tag LOCUS_16180 gene kbl 82620 81430 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_16180 82689 83645 gene locus_tag LOCUS_16190 82689 83645 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_16190 84716 83658 gene locus_tag LOCUS_16200 gene clpX 84716 83658 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764111.1 protein_id gnl|my_center|LOCUS_16200 85387 84716 gene locus_tag LOCUS_16210 gene clpP 85387 84716 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_16210 86381 85389 gene locus_tag LOCUS_16220 86381 85389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 88402 86378 gene locus_tag LOCUS_16230 88402 86378 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_16230 89220 88399 gene locus_tag LOCUS_16240 89220 88399 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_16240 90504 89242 gene locus_tag LOCUS_16250 90504 89242 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_16250 92535 90520 gene locus_tag LOCUS_16260 gene gyrB 92535 90520 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_16260 94174 92588 gene locus_tag LOCUS_16270 94174 92588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 97122 94171 gene locus_tag LOCUS_16280 97122 94171 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_16280 97216 97884 gene locus_tag LOCUS_16290 97216 97884 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_16290 97881 98510 gene locus_tag LOCUS_16300 gene nth 97881 98510 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_16300 100185 98503 gene locus_tag LOCUS_16310 100185 98503 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_16310 101961 100198 gene locus_tag LOCUS_16320 101961 100198 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963251.1 protein_id gnl|my_center|LOCUS_16320 103391 101958 gene locus_tag LOCUS_16330 103391 101958 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_16330 104846 103392 gene locus_tag LOCUS_16340 104846 103392 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_16340 105664 104846 gene locus_tag LOCUS_16350 105664 104846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 105740 106906 gene locus_tag LOCUS_16360 105740 106906 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_16360 106921 109887 gene locus_tag LOCUS_16370 106921 109887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 112061 109884 gene locus_tag LOCUS_16380 112061 109884 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_16380 112965 112063 gene locus_tag LOCUS_16390 112965 112063 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_16390 113801 112986 gene locus_tag LOCUS_16400 113801 112986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 113891 115066 gene locus_tag LOCUS_16410 113891 115066 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_16410 115161 115298 gene locus_tag LOCUS_16420 115161 115298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 118640 115410 gene locus_tag LOCUS_16430 118640 115410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 121225 118640 gene locus_tag LOCUS_16440 121225 118640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 122901 121222 gene locus_tag LOCUS_16450 122901 121222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 124544 122913 gene locus_tag LOCUS_16460 124544 122913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 126790 124592 gene locus_tag LOCUS_16470 126790 124592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 127865 126819 gene locus_tag LOCUS_16480 127865 126819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 129409 127862 gene locus_tag LOCUS_16490 129409 127862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 129686 131338 gene locus_tag LOCUS_16500 129686 131338 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_16500 131335 132864 gene locus_tag LOCUS_16510 131335 132864 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_16510 132861 133979 gene locus_tag LOCUS_16520 132861 133979 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_16520 133976 134974 gene locus_tag LOCUS_16530 133976 134974 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_16530 134964 136073 gene locus_tag LOCUS_16540 134964 136073 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167408.1 protein_id gnl|my_center|LOCUS_16540 136070 138256 gene locus_tag LOCUS_16550 136070 138256 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108899.1 protein_id gnl|my_center|LOCUS_16550 138258 139424 gene locus_tag LOCUS_16560 138258 139424 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 protein_id gnl|my_center|LOCUS_16560 139424 140368 gene locus_tag LOCUS_16570 139424 140368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 140549 140474 gene locus_tag LOCUS_t00350 140549 140474 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 140613 142277 gene locus_tag LOCUS_16580 gene sppA 140613 142277 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_16580 142277 143014 gene locus_tag LOCUS_16590 142277 143014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 143813 143016 gene locus_tag LOCUS_16600 143813 143016 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_16600 144656 143817 gene locus_tag LOCUS_16610 144656 143817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 145978 144638 gene locus_tag LOCUS_16620 145978 144638 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_16620 146834 145959 gene locus_tag LOCUS_16630 146834 145959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_16630 146896 147936 gene locus_tag LOCUS_16640 gene holA 146896 147936 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_16640 147929 148345 gene locus_tag LOCUS_16650 147929 148345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 148333 149763 gene locus_tag LOCUS_16660 148333 149763 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_16660 149754 150716 gene locus_tag LOCUS_16670 gene xerC 149754 150716 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_16670 150700 150996 gene locus_tag LOCUS_16680 150700 150996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 151000 151950 gene locus_tag LOCUS_16690 151000 151950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 152094 152006 gene locus_tag LOCUS_t00360 152094 152006 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 152198 153193 gene locus_tag LOCUS_16700 152198 153193 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_16700 153640 153246 gene locus_tag LOCUS_tm00010 153640 153246 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 154980 153667 gene locus_tag LOCUS_16710 154980 153667 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_16710 155024 156502 gene locus_tag LOCUS_16720 gene glpK 155024 156502 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_16720 156507 157244 gene locus_tag LOCUS_16730 156507 157244 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987068.1 protein_id gnl|my_center|LOCUS_16730 157377 157302 gene locus_tag LOCUS_t00370 157377 157302 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 158149 157427 gene locus_tag LOCUS_16740 158149 157427 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_16740 158610 158149 gene locus_tag LOCUS_16750 158610 158149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 160782 158647 gene locus_tag LOCUS_16760 160782 158647 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_16760 162510 160786 gene locus_tag LOCUS_16770 162510 160786 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_16770 162889 162518 gene locus_tag LOCUS_16780 162889 162518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 164679 162949 gene locus_tag LOCUS_16790 gene argS 164679 162949 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_16790 165541 164681 gene locus_tag LOCUS_16800 165541 164681 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_16800 167002 165548 gene locus_tag LOCUS_16810 167002 165548 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_16810 167136 168257 gene locus_tag LOCUS_16820 gene dnaN 167136 168257 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_16820 168271 169245 gene locus_tag LOCUS_16830 168271 169245 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_16830 169245 169796 gene locus_tag LOCUS_16840 169245 169796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 169793 171202 gene locus_tag LOCUS_16850 gene nhaA 169793 171202 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_16850 171237 171309 gene locus_tag LOCUS_t00380 171237 171309 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 581 192 gene locus_tag LOCUS_16860 581 192 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460531.1 protein_id gnl|my_center|LOCUS_16860 982 2352 gene locus_tag LOCUS_16870 982 2352 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_16870 2444 2974 gene locus_tag LOCUS_16880 2444 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3296 2964 gene locus_tag LOCUS_16890 3296 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3630 3992 gene locus_tag LOCUS_16900 3630 3992 CDS product DUF3853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809723.1 protein_id gnl|my_center|LOCUS_16900 3998 5302 gene locus_tag LOCUS_16910 3998 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 5510 5809 gene locus_tag LOCUS_16920 5510 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 5813 6817 gene locus_tag LOCUS_16930 5813 6817 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108662.1 protein_id gnl|my_center|LOCUS_16930 6831 7382 gene locus_tag LOCUS_16940 6831 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 8788 7457 gene locus_tag LOCUS_16950 gene glpT 8788 7457 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456512.1 protein_id gnl|my_center|LOCUS_16950 9786 8791 gene locus_tag LOCUS_16960 9786 8791 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785429.1 protein_id gnl|my_center|LOCUS_16960 10393 9779 gene locus_tag LOCUS_16970 10393 9779 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_16970 12339 10390 gene locus_tag LOCUS_16980 12339 10390 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_16980 12663 16163 gene locus_tag LOCUS_16990 12663 16163 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_16990 16176 18083 gene locus_tag LOCUS_17000 16176 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 18085 19284 gene locus_tag LOCUS_17010 18085 19284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 19284 21473 gene locus_tag LOCUS_17020 19284 21473 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_17020 24955 21455 gene locus_tag LOCUS_17030 24955 21455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 26642 24948 gene locus_tag LOCUS_17040 26642 24948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 29849 26853 gene locus_tag LOCUS_17050 29849 26853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 31784 30120 gene locus_tag LOCUS_17060 31784 30120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 33552 31888 gene locus_tag LOCUS_17070 33552 31888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 33837 37145 gene locus_tag LOCUS_17080 33837 37145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 37157 38707 gene locus_tag LOCUS_17090 37157 38707 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830048.1 protein_id gnl|my_center|LOCUS_17090 39923 38769 gene locus_tag LOCUS_17100 39923 38769 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_17100 41855 40206 gene locus_tag LOCUS_17110 41855 40206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 42138 45236 gene locus_tag LOCUS_17120 42138 45236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 45229 47196 gene locus_tag LOCUS_17130 45229 47196 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 protein_id gnl|my_center|LOCUS_17130 49219 47159 gene locus_tag LOCUS_17140 49219 47159 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_17140 49404 49598 gene locus_tag LOCUS_17150 49404 49598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 50208 49798 gene locus_tag LOCUS_17160 50208 49798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 50959 50874 gene locus_tag LOCUS_t00390 50959 50874 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 51080 51922 gene locus_tag LOCUS_17170 51080 51922 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_17170 51938 54169 gene locus_tag LOCUS_17180 51938 54169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_17180 54217 54807 gene locus_tag LOCUS_17190 54217 54807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 55440 54898 gene locus_tag LOCUS_17200 55440 54898 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_17200 55845 55444 gene locus_tag LOCUS_17210 55845 55444 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_17210 59289 55855 gene locus_tag LOCUS_17220 gene ileS 59289 55855 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_17220 59343 59837 gene locus_tag LOCUS_17230 59343 59837 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796780.1 protein_id gnl|my_center|LOCUS_17230 59830 60519 gene locus_tag LOCUS_17240 gene tsaB 59830 60519 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_17240 61593 60511 gene locus_tag LOCUS_17250 61593 60511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 62008 61604 gene locus_tag LOCUS_17260 62008 61604 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_17260 62482 62012 gene locus_tag LOCUS_17270 gene greA 62482 62012 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_17270 63397 62534 gene locus_tag LOCUS_17280 63397 62534 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_17280 65949 63388 gene locus_tag LOCUS_17290 65949 63388 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_17290 67108 65933 gene locus_tag LOCUS_17300 67108 65933 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_17300 68404 67112 gene locus_tag LOCUS_17310 68404 67112 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_17310 70344 68401 gene locus_tag LOCUS_17320 70344 68401 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_17320 72345 70348 gene locus_tag LOCUS_17330 72345 70348 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_17330 72529 72347 gene locus_tag LOCUS_17340 72529 72347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 73651 72551 gene locus_tag LOCUS_17350 gene xseA 73651 72551 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_17350 74964 73654 gene locus_tag LOCUS_17360 gene der 74964 73654 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_17360 75191 74961 gene locus_tag LOCUS_17370 75191 74961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 76163 75192 gene locus_tag LOCUS_17380 76163 75192 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_17380 76782 76186 gene locus_tag LOCUS_17390 gene yihA 76782 76186 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_17390 80197 76811 gene locus_tag LOCUS_17400 80197 76811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 80682 80212 gene locus_tag LOCUS_17410 gene rlmH 80682 80212 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_17410 80733 81140 gene locus_tag LOCUS_17420 80733 81140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 81757 81194 gene locus_tag LOCUS_17430 gene efp 81757 81194 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_17430 82741 81815 gene locus_tag LOCUS_17440 82741 81815 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_17440 83445 82741 gene locus_tag LOCUS_17450 gene cmk 83445 82741 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_17450 84587 83442 gene locus_tag LOCUS_17460 84587 83442 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_17460 85396 84584 gene locus_tag LOCUS_17470 gene lptB 85396 84584 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_17470 87194 85386 gene locus_tag LOCUS_17480 87194 85386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 87266 87913 gene locus_tag LOCUS_17490 87266 87913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 87915 88544 gene locus_tag LOCUS_17500 87915 88544 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_17500 89958 88528 gene locus_tag LOCUS_17510 89958 88528 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108647.1 protein_id gnl|my_center|LOCUS_17510 91382 89955 gene locus_tag LOCUS_17520 91382 89955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 92548 91379 gene locus_tag LOCUS_17530 92548 91379 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_17530 93720 92545 gene locus_tag LOCUS_17540 93720 92545 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_17540 95360 93720 gene locus_tag LOCUS_17550 95360 93720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 96889 95363 gene locus_tag LOCUS_17560 96889 95363 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_17560 99969 96889 gene locus_tag LOCUS_17570 99969 96889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_17570 100985 99981 gene locus_tag LOCUS_17580 100985 99981 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_17580 102565 100985 gene locus_tag LOCUS_17590 102565 100985 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_17590 102674 103519 gene locus_tag LOCUS_17600 102674 103519 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_17600 105657 103516 gene locus_tag LOCUS_17610 gene metG 105657 103516 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_17610 107672 105666 gene locus_tag LOCUS_17620 107672 105666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 109911 107680 gene locus_tag LOCUS_17630 gene recQ 109911 107680 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_17630 110540 110109 gene locus_tag LOCUS_17640 110540 110109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 112019 110775 gene locus_tag LOCUS_17650 112019 110775 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_17650 112944 112024 gene locus_tag LOCUS_17660 112944 112024 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_17660 114014 112941 gene locus_tag LOCUS_17670 gene serC 114014 112941 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_17670 114673 114011 gene locus_tag LOCUS_17680 114673 114011 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_17680 114716 115270 gene locus_tag LOCUS_17690 114716 115270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 116547 115267 gene locus_tag LOCUS_17700 116547 115267 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_17700 117817 116564 gene locus_tag LOCUS_17710 117817 116564 CDS product C10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681485.1 protein_id gnl|my_center|LOCUS_17710 118228 117827 gene locus_tag LOCUS_17720 118228 117827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 119967 118363 gene locus_tag LOCUS_17730 119967 118363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence10 268 1458 gene locus_tag LOCUS_17740 268 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2525 2343 gene locus_tag LOCUS_17750 2525 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2869 3831 gene locus_tag LOCUS_17760 2869 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5571 4597 gene locus_tag LOCUS_17770 5571 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6920 5739 gene locus_tag LOCUS_17780 gene hydE 6920 5739 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_17780 7965 6934 gene locus_tag LOCUS_17790 7965 6934 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 protein_id gnl|my_center|LOCUS_17790 8122 8967 gene locus_tag LOCUS_17800 8122 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 9106 10344 gene locus_tag LOCUS_17810 9106 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 11509 10415 gene locus_tag LOCUS_17820 11509 10415 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_17820 11639 12733 gene locus_tag LOCUS_17830 11639 12733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 12836 13537 gene locus_tag LOCUS_17840 12836 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 13628 15070 gene locus_tag LOCUS_17850 gene preA 13628 15070 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 protein_id gnl|my_center|LOCUS_17850 16873 15272 gene locus_tag LOCUS_17860 16873 15272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 18399 16894 gene locus_tag LOCUS_17870 18399 16894 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_17870 20026 18428 gene locus_tag LOCUS_17880 20026 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 20825 20250 gene locus_tag LOCUS_17890 20825 20250 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_17890 21045 21665 gene locus_tag LOCUS_17900 21045 21665 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_17900 21767 22324 gene locus_tag LOCUS_17910 21767 22324 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845619.1 protein_id gnl|my_center|LOCUS_17910 22884 22333 gene locus_tag LOCUS_17920 22884 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 23189 24325 gene locus_tag LOCUS_17930 23189 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 24862 24341 gene locus_tag LOCUS_17940 24862 24341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 25945 25007 gene locus_tag LOCUS_17950 25945 25007 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921645.1 protein_id gnl|my_center|LOCUS_17950 26455 25973 gene locus_tag LOCUS_17960 gene greA 26455 25973 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_17960 27251 26637 gene locus_tag LOCUS_17970 27251 26637 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_17970 27782 27288 gene locus_tag LOCUS_17980 27782 27288 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_17980 29923 28064 gene locus_tag LOCUS_17990 29923 28064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 31331 29979 gene locus_tag LOCUS_18000 31331 29979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 31629 31345 gene locus_tag LOCUS_18010 31629 31345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 32107 34785 gene locus_tag LOCUS_18020 32107 34785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 35108 35614 gene locus_tag LOCUS_18030 35108 35614 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479979.1 protein_id gnl|my_center|LOCUS_18030 36936 35626 gene locus_tag LOCUS_18040 36936 35626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 38021 37095 gene locus_tag LOCUS_18050 38021 37095 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581611.1 protein_id gnl|my_center|LOCUS_18050 38214 38059 gene locus_tag LOCUS_18060 38214 38059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 38704 38219 gene locus_tag LOCUS_18070 38704 38219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 39171 38701 gene locus_tag LOCUS_18080 39171 38701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 39490 39152 gene locus_tag LOCUS_18090 39490 39152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 39900 39502 gene locus_tag LOCUS_18100 39900 39502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 42286 39893 gene locus_tag LOCUS_18110 42286 39893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 43063 42368 gene locus_tag LOCUS_18120 43063 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 45046 43268 gene locus_tag LOCUS_18130 45046 43268 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 protein_id gnl|my_center|LOCUS_18130 45435 45061 gene locus_tag LOCUS_18140 45435 45061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 49605 45502 gene locus_tag LOCUS_18150 49605 45502 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_18150 52484 49611 gene locus_tag LOCUS_18160 52484 49611 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_18160 57662 52491 gene locus_tag LOCUS_18170 57662 52491 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_18170 57877 57674 gene locus_tag LOCUS_18180 57877 57674 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_18180 58399 57998 gene locus_tag LOCUS_18190 58399 57998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 58760 59974 gene locus_tag LOCUS_18200 58760 59974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 60261 59992 gene locus_tag LOCUS_18210 60261 59992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 60583 61101 gene locus_tag LOCUS_18220 60583 61101 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_18220 61149 61958 gene locus_tag LOCUS_18230 61149 61958 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_18230 62030 62215 gene locus_tag LOCUS_18240 62030 62215 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_18240 62322 62486 gene locus_tag LOCUS_18250 62322 62486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 63171 62608 gene locus_tag LOCUS_18260 63171 62608 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_18260 64030 63185 gene locus_tag LOCUS_18270 64030 63185 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_18270 64811 64038 gene locus_tag LOCUS_18280 64811 64038 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_18280 66209 65586 gene locus_tag LOCUS_18290 66209 65586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 67753 66932 gene locus_tag LOCUS_18300 67753 66932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 68264 69145 gene locus_tag LOCUS_18310 68264 69145 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_18310 69178 69582 gene locus_tag LOCUS_18320 69178 69582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence11 242 892 gene locus_tag LOCUS_18330 242 892 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_18330 1131 2267 gene locus_tag LOCUS_18340 1131 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 4666 2264 gene locus_tag LOCUS_18350 4666 2264 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203126.1 protein_id gnl|my_center|LOCUS_18350 4779 5009 gene locus_tag LOCUS_18360 4779 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 5569 5018 gene locus_tag LOCUS_18370 5569 5018 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_18370 6051 5572 gene locus_tag LOCUS_18380 gene ispF 6051 5572 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_18380 6092 6400 gene locus_tag LOCUS_18390 6092 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 6400 8256 gene locus_tag LOCUS_18400 gene mutL 6400 8256 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_18400 8261 8893 gene locus_tag LOCUS_18410 8261 8893 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537041.1 protein_id gnl|my_center|LOCUS_18410 8880 9452 gene locus_tag LOCUS_18420 8880 9452 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_18420 9453 10436 gene locus_tag LOCUS_18430 9453 10436 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_18430 10437 11573 gene locus_tag LOCUS_18440 10437 11573 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_18440 12577 11663 gene locus_tag LOCUS_18450 12577 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 13742 12687 gene locus_tag LOCUS_18460 13742 12687 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919544.1 protein_id gnl|my_center|LOCUS_18460 13963 13760 gene locus_tag LOCUS_18470 13963 13760 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_18470 15333 13966 gene locus_tag LOCUS_18480 15333 13966 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_18480 15931 15338 gene locus_tag LOCUS_18490 15931 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 17340 16036 gene locus_tag LOCUS_18500 17340 16036 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_18500 18674 17337 gene locus_tag LOCUS_18510 18674 17337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 19273 18719 gene locus_tag LOCUS_18520 19273 18719 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_18520 19332 20252 gene locus_tag LOCUS_18530 19332 20252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 20889 20236 gene locus_tag LOCUS_18540 20889 20236 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_18540 21140 22165 gene locus_tag LOCUS_18550 gene galE 21140 22165 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_18550 22174 22692 gene locus_tag LOCUS_18560 22174 22692 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_18560 22746 23984 gene locus_tag LOCUS_18570 22746 23984 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_18570 24214 23981 gene locus_tag LOCUS_18580 24214 23981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 24546 24211 gene locus_tag LOCUS_18590 24546 24211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 24709 24626 gene locus_tag LOCUS_t00400 24709 24626 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24836 25369 gene locus_tag LOCUS_18600 24836 25369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 25371 25853 gene locus_tag LOCUS_18610 25371 25853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 28453 25850 gene locus_tag LOCUS_18620 28453 25850 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_18620 29251 28463 gene locus_tag LOCUS_18630 gene ispE 29251 28463 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_18630 29838 29248 gene locus_tag LOCUS_18640 29838 29248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 30580 29831 gene locus_tag LOCUS_18650 gene sufC 30580 29831 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_18650 32038 30584 gene locus_tag LOCUS_18660 gene sufB 32038 30584 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_18660 32085 33083 gene locus_tag LOCUS_18670 gene aroC 32085 33083 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_18670 34208 33183 gene locus_tag LOCUS_18680 34208 33183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 34342 35682 gene locus_tag LOCUS_18690 34342 35682 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 protein_id gnl|my_center|LOCUS_18690 36394 36816 gene locus_tag LOCUS_18700 36394 36816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 37995 36928 gene locus_tag LOCUS_18710 37995 36928 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_18710 38027 39226 gene locus_tag LOCUS_18720 38027 39226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 39228 40688 gene locus_tag LOCUS_18730 39228 40688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 41374 40670 gene locus_tag LOCUS_18740 41374 40670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 41634 42287 gene locus_tag LOCUS_18750 41634 42287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 42329 43717 gene locus_tag LOCUS_18760 42329 43717 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839227.1 protein_id gnl|my_center|LOCUS_18760 43774 44511 gene locus_tag LOCUS_18770 gene fabG 43774 44511 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_18770 44993 44508 gene locus_tag LOCUS_18780 44993 44508 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_18780 45037 45900 gene locus_tag LOCUS_18790 45037 45900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 45915 48335 gene locus_tag LOCUS_18800 45915 48335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 48332 49195 gene locus_tag LOCUS_18810 48332 49195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 50346 49192 gene locus_tag LOCUS_18820 50346 49192 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767707.1 protein_id gnl|my_center|LOCUS_18820 50460 51002 gene locus_tag LOCUS_18830 50460 51002 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_18830 51002 51439 gene locus_tag LOCUS_18840 51002 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 52043 51504 gene locus_tag LOCUS_18850 52043 51504 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_18850 52164 52664 gene locus_tag LOCUS_18860 52164 52664 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence12 286 213 gene locus_tag LOCUS_t00410 286 213 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 447 1124 gene locus_tag LOCUS_18870 447 1124 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_18870 1127 2908 gene locus_tag LOCUS_18880 1127 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 3707 2910 gene locus_tag LOCUS_18890 3707 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 4837 3779 gene locus_tag LOCUS_18900 4837 3779 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128545.1 protein_id gnl|my_center|LOCUS_18900 6254 4839 gene locus_tag LOCUS_18910 gene glmM 6254 4839 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_18910 6568 6317 gene locus_tag LOCUS_18920 6568 6317 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_18920 6667 6595 gene locus_tag LOCUS_t00420 6667 6595 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6738 7190 gene locus_tag LOCUS_18930 6738 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7190 9040 gene locus_tag LOCUS_18940 7190 9040 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_18940 9037 10404 gene locus_tag LOCUS_18950 9037 10404 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_18950 10406 11407 gene locus_tag LOCUS_18960 10406 11407 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_18960 11420 14107 gene locus_tag LOCUS_18970 11420 14107 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_18970 15432 14104 gene locus_tag LOCUS_18980 15432 14104 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759774.1 protein_id gnl|my_center|LOCUS_18980 15499 16326 gene locus_tag LOCUS_18990 15499 16326 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_18990 16326 19157 gene locus_tag LOCUS_19000 16326 19157 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_19000 20038 19154 gene locus_tag LOCUS_19010 20038 19154 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073748.1 protein_id gnl|my_center|LOCUS_19010 20086 22137 gene locus_tag LOCUS_19020 20086 22137 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_19020 22124 22933 gene locus_tag LOCUS_19030 22124 22933 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_19030 22976 24787 gene locus_tag LOCUS_19040 22976 24787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_19040 24784 25191 gene locus_tag LOCUS_19050 24784 25191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 25199 28132 gene locus_tag LOCUS_19060 25199 28132 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_19060 28137 29543 gene locus_tag LOCUS_19070 gene aspA 28137 29543 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_19070 30486 29554 gene locus_tag LOCUS_19080 30486 29554 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203064.1 protein_id gnl|my_center|LOCUS_19080 30597 30670 gene locus_tag LOCUS_t00430 30597 30670 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30686 30761 gene locus_tag LOCUS_t00440 30686 30761 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 32736 30811 gene locus_tag LOCUS_19090 32736 30811 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_19090 32800 33240 gene locus_tag LOCUS_19100 gene fabZ 32800 33240 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983343.1 protein_id gnl|my_center|LOCUS_19100 33242 33967 gene locus_tag LOCUS_19110 33242 33967 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_19110 35175 33964 gene locus_tag LOCUS_19120 gene glpC 35175 33964 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098021.1 protein_id gnl|my_center|LOCUS_19120 35737 35156 gene locus_tag LOCUS_19130 35737 35156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 37265 35727 gene locus_tag LOCUS_19140 gene glpA 37265 35727 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211491.1 protein_id gnl|my_center|LOCUS_19140 38409 37270 gene locus_tag LOCUS_19150 gene rfbB 38409 37270 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_19150 39929 38457 gene locus_tag LOCUS_19160 39929 38457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_19160 41213 40014 gene locus_tag LOCUS_19170 41213 40014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 44155 41213 gene locus_tag LOCUS_19180 44155 41213 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_19180 45209 44226 gene locus_tag LOCUS_19190 45209 44226 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_19190 45282 47786 gene locus_tag LOCUS_19200 45282 47786 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784143.1 protein_id gnl|my_center|LOCUS_19200 47860 48990 gene locus_tag LOCUS_19210 47860 48990 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836560.1 protein_id gnl|my_center|LOCUS_19210 50905 49004 gene locus_tag LOCUS_19220 50905 49004 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_19220 51084 51305 gene locus_tag LOCUS_19230 51084 51305 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence13 524 1081 gene locus_tag LOCUS_19240 524 1081 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_19240 1078 1647 gene locus_tag LOCUS_19250 1078 1647 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_19250 1644 3308 gene locus_tag LOCUS_19260 1644 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4149 3451 gene locus_tag LOCUS_19270 4149 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5953 4139 gene locus_tag LOCUS_19280 5953 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6755 8212 gene locus_tag LOCUS_19290 6755 8212 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_19290 9416 8418 gene locus_tag LOCUS_19300 gene tsf 9416 8418 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_19300 10292 9429 gene locus_tag LOCUS_19310 gene rpsB 10292 9429 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_19310 10840 10451 gene locus_tag LOCUS_19320 gene rpsI 10840 10451 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_19320 11302 10850 gene locus_tag LOCUS_19330 gene rplM 11302 10850 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_19330 12094 11402 gene locus_tag LOCUS_19340 12094 11402 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_19340 12192 12896 gene locus_tag LOCUS_19350 gene pyrH 12192 12896 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_19350 12972 13541 gene locus_tag LOCUS_19360 gene frr 12972 13541 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_19360 14526 13531 gene locus_tag LOCUS_19370 gene lpxK 14526 13531 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_19370 15523 14501 gene locus_tag LOCUS_19380 gene dusB 15523 14501 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_19380 15573 17366 gene locus_tag LOCUS_19390 15573 17366 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_19390 17828 17367 gene locus_tag LOCUS_19400 17828 17367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 17922 18839 gene locus_tag LOCUS_19410 17922 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 18839 20113 gene locus_tag LOCUS_19420 18839 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 20683 20108 gene locus_tag LOCUS_19430 20683 20108 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_19430 23226 20680 gene locus_tag LOCUS_19440 23226 20680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 23314 24261 gene locus_tag LOCUS_19450 23314 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 24264 26045 gene locus_tag LOCUS_19460 24264 26045 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_19460 26418 26023 gene locus_tag LOCUS_19470 26418 26023 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_19470 26729 26415 gene locus_tag LOCUS_19480 26729 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 27940 26753 gene locus_tag LOCUS_19490 27940 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 29148 28132 gene locus_tag LOCUS_19500 29148 28132 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_19500 31492 29150 gene locus_tag LOCUS_19510 31492 29150 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_19510 31591 33909 gene locus_tag LOCUS_19520 gene topA 31591 33909 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_19520 33913 34398 gene locus_tag LOCUS_19530 33913 34398 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_19530 35080 34391 gene locus_tag LOCUS_19540 35080 34391 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_19540 35153 36175 gene locus_tag LOCUS_19550 35153 36175 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_19550 36179 37006 gene locus_tag LOCUS_19560 gene mreC 36179 37006 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_19560 37003 37521 gene locus_tag LOCUS_19570 37003 37521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 37512 39344 gene locus_tag LOCUS_19580 gene mrdA 37512 39344 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_19580 39328 40620 gene locus_tag LOCUS_19590 gene rodA 39328 40620 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_19590 40671 41273 gene locus_tag LOCUS_19600 40671 41273 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_19600 41384 41962 gene locus_tag LOCUS_19610 41384 41962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 42772 42269 gene locus_tag LOCUS_19620 42772 42269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 43146 42769 gene locus_tag LOCUS_19630 43146 42769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 44093 43143 gene locus_tag LOCUS_19640 44093 43143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 44341 44928 gene locus_tag LOCUS_19650 44341 44928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence14 1524 502 gene locus_tag LOCUS_19660 1524 502 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_19660 3225 1603 gene locus_tag LOCUS_19670 gene groL 3225 1603 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_19670 3505 3239 gene locus_tag LOCUS_19680 3505 3239 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_19680 4948 3596 gene locus_tag LOCUS_19690 4948 3596 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_19690 7217 5043 gene locus_tag LOCUS_19700 7217 5043 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_19700 8609 7278 gene locus_tag LOCUS_19710 gene glpT 8609 7278 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456512.1 protein_id gnl|my_center|LOCUS_19710 8702 9235 gene locus_tag LOCUS_19720 8702 9235 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_19720 9247 9750 gene locus_tag LOCUS_19730 9247 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 12534 9805 gene locus_tag LOCUS_19740 gene ppdK 12534 9805 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_19740 13957 12614 gene locus_tag LOCUS_19750 13957 12614 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_19750 15073 13967 gene locus_tag LOCUS_19760 15073 13967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 15137 16606 gene locus_tag LOCUS_19770 15137 16606 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_19770 16603 21288 gene locus_tag LOCUS_19780 16603 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 21285 22148 gene locus_tag LOCUS_19790 gene truB 21285 22148 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_19790 22485 22141 gene locus_tag LOCUS_19800 22485 22141 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_19800 23853 22522 gene locus_tag LOCUS_19810 23853 22522 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_19810 23914 24843 gene locus_tag LOCUS_19820 23914 24843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 25302 24904 gene locus_tag LOCUS_19830 25302 24904 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_19830 25869 25480 gene locus_tag LOCUS_19840 25869 25480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 25988 26674 gene locus_tag LOCUS_19850 25988 26674 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_19850 27488 26661 gene locus_tag LOCUS_19860 27488 26661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 29963 27597 gene locus_tag LOCUS_19870 gene pnp 29963 27597 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_19870 30326 30051 gene locus_tag LOCUS_19880 gene rpsO 30326 30051 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_19880 32186 30474 gene locus_tag LOCUS_19890 32186 30474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 32247 33764 gene locus_tag LOCUS_19900 32247 33764 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_19900 34236 33832 gene locus_tag LOCUS_19910 34236 33832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 34362 35291 gene locus_tag LOCUS_19920 34362 35291 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_19920 35502 35684 gene locus_tag LOCUS_19930 35502 35684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107961.1 protein_id gnl|my_center|LOCUS_19930 36019 36894 gene locus_tag LOCUS_19940 36019 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence15 258 491 gene locus_tag LOCUS_19950 258 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 479 658 gene locus_tag LOCUS_19960 479 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1445 663 gene locus_tag LOCUS_19970 1445 663 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_19970 2353 1442 gene locus_tag LOCUS_19980 2353 1442 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_19980 3075 2350 gene locus_tag LOCUS_19990 3075 2350 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901989.1 protein_id gnl|my_center|LOCUS_19990 4519 3104 gene locus_tag LOCUS_20000 4519 3104 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_20000 5838 4573 gene locus_tag LOCUS_20010 5838 4573 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_20010 6506 5835 gene locus_tag LOCUS_20020 6506 5835 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 protein_id gnl|my_center|LOCUS_20020 6571 8694 gene locus_tag LOCUS_20030 6571 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 8829 9797 gene locus_tag LOCUS_20040 8829 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 9781 10155 gene locus_tag LOCUS_20050 9781 10155 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_20050 11266 10127 gene locus_tag LOCUS_20060 11266 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_20060 12832 11309 gene locus_tag LOCUS_20070 12832 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 14123 12837 gene locus_tag LOCUS_20080 14123 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 16387 14129 gene locus_tag LOCUS_20090 16387 14129 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_20090 17279 16392 gene locus_tag LOCUS_20100 17279 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 17428 18762 gene locus_tag LOCUS_20110 17428 18762 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_20110 18773 21739 gene locus_tag LOCUS_20120 18773 21739 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_20120 21752 23476 gene locus_tag LOCUS_20130 21752 23476 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_20130 23529 24980 gene locus_tag LOCUS_20140 23529 24980 CDS product DUF5115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767007.1 protein_id gnl|my_center|LOCUS_20140 25044 27041 gene locus_tag LOCUS_20150 25044 27041 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108937.1 protein_id gnl|my_center|LOCUS_20150 27155 28474 gene locus_tag LOCUS_20160 27155 28474 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_20160 28477 30342 gene locus_tag LOCUS_20170 28477 30342 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_20170 31607 30339 gene locus_tag LOCUS_20180 31607 30339 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764708.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence16 1364 177 gene locus_tag LOCUS_20190 gene pepT 1364 177 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_20190 4038 1267 gene locus_tag LOCUS_20200 4038 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5381 4014 gene locus_tag LOCUS_20210 5381 4014 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_20210 6222 5371 gene locus_tag LOCUS_20220 6222 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6787 6323 gene locus_tag LOCUS_20230 6787 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 8343 6901 gene locus_tag LOCUS_20240 gene preA 8343 6901 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_20240 9215 8340 gene locus_tag LOCUS_20250 9215 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 10357 9269 gene locus_tag LOCUS_20260 10357 9269 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107705.1 protein_id gnl|my_center|LOCUS_20260 10523 11989 gene locus_tag LOCUS_20270 gene dacB 10523 11989 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_20270 11991 12518 gene locus_tag LOCUS_20280 11991 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 13604 12513 gene locus_tag LOCUS_20290 13604 12513 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_20290 13669 14274 gene locus_tag LOCUS_20300 13669 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 14439 15713 gene locus_tag LOCUS_20310 14439 15713 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_20310 15777 15848 gene locus_tag LOCUS_t00450 15777 15848 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15882 15958 gene locus_tag LOCUS_t00460 15882 15958 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17069 16146 gene locus_tag LOCUS_20320 17069 16146 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_20320 17213 17569 gene locus_tag LOCUS_20330 17213 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 17579 18139 gene locus_tag LOCUS_20340 17579 18139 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136487.1 protein_id gnl|my_center|LOCUS_20340 19456 18383 gene locus_tag LOCUS_20350 19456 18383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence17 649 1344 gene locus_tag LOCUS_20360 649 1344 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_20360 1356 1886 gene locus_tag LOCUS_20370 1356 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 1888 2724 gene locus_tag LOCUS_20380 1888 2724 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_20380 2732 3577 gene locus_tag LOCUS_20390 2732 3577 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_20390 4536 3574 gene locus_tag LOCUS_20400 4536 3574 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705651.1 protein_id gnl|my_center|LOCUS_20400 4985 4539 gene locus_tag LOCUS_20410 4985 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 5348 4998 gene locus_tag LOCUS_20420 5348 4998 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788387.1 protein_id gnl|my_center|LOCUS_20420 5621 6379 gene locus_tag LOCUS_20430 5621 6379 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_20430 6360 7139 gene locus_tag LOCUS_20440 6360 7139 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_20440 7105 7926 gene locus_tag LOCUS_20450 7105 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_20450 8589 7915 gene locus_tag LOCUS_20460 8589 7915 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_20460 9441 8596 gene locus_tag LOCUS_20470 9441 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence18 182 487 gene locus_tag LOCUS_20480 182 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 571 1764 gene locus_tag LOCUS_20490 gene mobB 571 1764 CDS product conjugal transfer protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108212.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence19 <1 1811 gene locus_tag LOCUS_20500 <1 1811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109421.1:TraG family conjugative transposon ATPase note possible pseudo, frameshifted 1825 1962 gene locus_tag LOCUS_20510 1825 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence20 134 1843 gene locus_tag LOCUS_20520 134 1843 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_20520 2100 2026 gene locus_tag LOCUS_t00470 2100 2026 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 479 553 gene locus_tag LOCUS_t00480 479 553 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 573 827 gene locus_tag LOCUS_20530 gene rpsT 573 827 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783989.1 protein_id gnl|my_center|LOCUS_20530 1019 1093 gene locus_tag LOCUS_t00490 1019 1093 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <2101 1205 gene locus_tag LOCUS_20540 <2101 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203619.1:IS1182-like element ISBf5 family transposase