>Feature sequence001 2169 160 gene locus_tag LOCUS_0010 2169 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 2766 2173 gene locus_tag LOCUS_0020 gene sigH 2766 2173 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_0020 3496 2774 gene locus_tag LOCUS_0030 gene rlmB 3496 2774 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_0030 3900 3508 gene locus_tag LOCUS_0040 3900 3508 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_0040 4997 3903 gene locus_tag LOCUS_0050 gene ychF 4997 3903 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_0050 11781 5068 gene locus_tag LOCUS_0060 11781 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 12018 14744 gene locus_tag LOCUS_0070 gene secA 12018 14744 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895216.1 protein_id gnl|my_center|LOCUS_0070 14856 15116 gene locus_tag LOCUS_0080 14856 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 15240 15401 gene locus_tag LOCUS_0090 gene rpmG 15240 15401 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100510685.1 protein_id gnl|my_center|LOCUS_0090 15417 15806 gene locus_tag LOCUS_0100 15417 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 15818 16456 gene locus_tag LOCUS_0110 gene nusG 15818 16456 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_0110 16573 17001 gene locus_tag LOCUS_0120 gene rplK 16573 17001 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_0120 17012 17692 gene locus_tag LOCUS_0130 gene rplA 17012 17692 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_0130 26311 17789 gene locus_tag LOCUS_0140 26311 17789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 26499 27584 gene locus_tag LOCUS_0150 26499 27584 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_0150 28613 27687 gene locus_tag LOCUS_0160 gene rihC 28613 27687 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127280.1 protein_id gnl|my_center|LOCUS_0160 29323 28658 gene locus_tag LOCUS_0170 29323 28658 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429111.1 protein_id gnl|my_center|LOCUS_0170 29435 29971 gene locus_tag LOCUS_0180 29435 29971 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_0180 >Feature sequence002 9550 11238 gene locus_tag LOCUS_0190 9550 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 11382 11663 gene locus_tag LOCUS_0200 11382 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 11678 12085 gene locus_tag LOCUS_0210 gene ssb 11678 12085 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_0210 12132 12395 gene locus_tag LOCUS_0220 12132 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 12413 12616 gene locus_tag LOCUS_0230 gene rpmE 12413 12616 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814855.1 protein_id gnl|my_center|LOCUS_0230 12704 13273 gene locus_tag LOCUS_0240 12704 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 13306 13890 gene locus_tag LOCUS_0250 13306 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 14070 15758 gene locus_tag LOCUS_0260 14070 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 15739 16824 gene locus_tag LOCUS_0270 gene prfA 15739 16824 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_0270 17313 16870 gene locus_tag LOCUS_0280 gene rplI 17313 16870 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_0280 17423 17737 gene locus_tag LOCUS_0290 17423 17737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 17808 19172 gene locus_tag LOCUS_0300 17808 19172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 19869 19213 gene locus_tag LOCUS_0310 19869 19213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 19983 21506 gene locus_tag LOCUS_0320 19983 21506 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966489.1 protein_id gnl|my_center|LOCUS_0320 21538 22461 gene locus_tag LOCUS_0330 gene dusB 21538 22461 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_0330 22508 23689 gene locus_tag LOCUS_0340 22508 23689 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422650.1 protein_id gnl|my_center|LOCUS_0340 23686 24432 gene locus_tag LOCUS_0350 gene tpiA 23686 24432 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583495.1 protein_id gnl|my_center|LOCUS_0350 24505 25617 gene locus_tag LOCUS_0360 24505 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 25620 25949 gene locus_tag LOCUS_0370 25620 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 25963 26286 gene locus_tag LOCUS_0380 25963 26286 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_0380 26288 26878 gene locus_tag LOCUS_0390 gene recR 26288 26878 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_0390 >Feature sequence003 175 537 gene locus_tag LOCUS_0400 gene spoVAE 175 537 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 protein_id gnl|my_center|LOCUS_0400 634 1284 gene locus_tag LOCUS_0410 gene yunB 634 1284 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075141567.1 protein_id gnl|my_center|LOCUS_0410 1362 3140 gene locus_tag LOCUS_0420 gene dnaG 1362 3140 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_0420 3127 4188 gene locus_tag LOCUS_0430 gene rpoD 3127 4188 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_0430 4199 4897 gene locus_tag LOCUS_0440 4199 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 5081 7459 gene locus_tag LOCUS_0450 gene recJ 5081 7459 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861665.1 protein_id gnl|my_center|LOCUS_0450 7440 9551 gene locus_tag LOCUS_0460 7440 9551 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_0460 9548 10948 gene locus_tag LOCUS_0470 9548 10948 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_0470 11084 11344 gene locus_tag LOCUS_0480 gene rpsO 11084 11344 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_0480 11405 13522 gene locus_tag LOCUS_0490 gene pnp 11405 13522 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_0490 14727 13600 gene locus_tag LOCUS_0500 14727 13600 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965651.1 protein_id gnl|my_center|LOCUS_0500 14797 15063 gene locus_tag LOCUS_0510 14797 15063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 15190 15639 gene locus_tag LOCUS_0520 15190 15639 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_0520 15689 17158 gene locus_tag LOCUS_0530 gene lysS 15689 17158 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 protein_id gnl|my_center|LOCUS_0530 17158 17775 gene locus_tag LOCUS_0540 gene nth 17158 17775 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_0540 17826 19094 gene locus_tag LOCUS_0550 gene obgE 17826 19094 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_0550 19106 19402 gene locus_tag LOCUS_0560 gene yhbY 19106 19402 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_0560 20114 19425 gene locus_tag LOCUS_0570 20114 19425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 20339 20668 gene locus_tag LOCUS_0580 20339 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 20687 21115 gene locus_tag LOCUS_0590 20687 21115 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_0590 21112 21534 gene locus_tag LOCUS_0600 gene rpiB 21112 21534 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_0600 21543 22331 gene locus_tag LOCUS_0610 21543 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 22332 23336 gene locus_tag LOCUS_0620 gene gap 22332 23336 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963725.1 protein_id gnl|my_center|LOCUS_0620 23348 23656 gene locus_tag LOCUS_0630 23348 23656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 23658 24032 gene locus_tag LOCUS_0640 23658 24032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 24118 25392 gene locus_tag LOCUS_0650 gene tig 24118 25392 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048204.1 protein_id gnl|my_center|LOCUS_0650 25510 26103 gene locus_tag LOCUS_0660 gene clpP 25510 26103 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_0660 >Feature sequence004 790 398 gene locus_tag LOCUS_0670 790 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 1155 787 gene locus_tag LOCUS_0680 1155 787 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419170.1 protein_id gnl|my_center|LOCUS_0680 1687 1208 gene locus_tag LOCUS_0690 1687 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 2238 1699 gene locus_tag LOCUS_0700 2238 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 2734 2231 gene locus_tag LOCUS_0710 2734 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 3872 2751 gene locus_tag LOCUS_0720 gene spoIIIAE 3872 2751 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946110.1 protein_id gnl|my_center|LOCUS_0720 4336 3944 gene locus_tag LOCUS_0730 gene spoIIIAD 4336 3944 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_0730 4545 4351 gene locus_tag LOCUS_0740 4545 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 5048 4554 gene locus_tag LOCUS_0750 5048 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 5962 5057 gene locus_tag LOCUS_0760 gene spoIIIAA 5962 5057 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_0760 6655 6095 gene locus_tag LOCUS_0770 gene efp 6655 6095 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_0770 7564 6704 gene locus_tag LOCUS_0780 7564 6704 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_0780 8421 7579 gene locus_tag LOCUS_0790 gene truB 8421 7579 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_0790 9387 8422 gene locus_tag LOCUS_0800 9387 8422 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082036.1 protein_id gnl|my_center|LOCUS_0800 9745 9380 gene locus_tag LOCUS_0810 9745 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 12334 9830 gene locus_tag LOCUS_0820 gene infB 12334 9830 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388357.1 protein_id gnl|my_center|LOCUS_0820 12629 12345 gene locus_tag LOCUS_0830 12629 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 12873 12610 gene locus_tag LOCUS_0840 12873 12610 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_0840 14061 12901 gene locus_tag LOCUS_0850 gene nusA 14061 12901 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_0850 14534 14073 gene locus_tag LOCUS_0860 14534 14073 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_0860 16207 14657 gene locus_tag LOCUS_0870 16207 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 17395 16217 gene locus_tag LOCUS_0880 17395 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 18388 17420 gene locus_tag LOCUS_0890 18388 17420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 19086 18385 gene locus_tag LOCUS_0900 19086 18385 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_0900 19680 19114 gene locus_tag LOCUS_0910 gene frr 19680 19114 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_0910 20480 19824 gene locus_tag LOCUS_0920 gene tsf 20480 19824 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_0920 21370 20483 gene locus_tag LOCUS_0930 gene rpsB 21370 20483 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_0930 22639 21623 gene locus_tag LOCUS_0940 gene secF 22639 21623 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167586.1 protein_id gnl|my_center|LOCUS_0940 >Feature sequence005 2502 1018 gene locus_tag LOCUS_0950 2502 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 2681 2511 gene locus_tag LOCUS_0960 2681 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 3169 2795 gene locus_tag LOCUS_0970 3169 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 3657 3166 gene locus_tag LOCUS_0980 3657 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 3749 7090 gene locus_tag LOCUS_0990 3749 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 7653 7135 gene locus_tag LOCUS_1000 7653 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 8407 7775 gene locus_tag LOCUS_1010 gene tsaB 8407 7775 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_1010 8856 8404 gene locus_tag LOCUS_1020 gene tsaE 8856 8404 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_1020 9481 8828 gene locus_tag LOCUS_1030 9481 8828 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987352.1 protein_id gnl|my_center|LOCUS_1030 10072 9494 gene locus_tag LOCUS_1040 10072 9494 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_1040 11739 10081 gene locus_tag LOCUS_1050 11739 10081 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_1050 12748 11822 gene locus_tag LOCUS_1060 12748 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 13365 12904 gene locus_tag LOCUS_1070 gene greA 13365 12904 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_1070 13495 13899 gene locus_tag LOCUS_1080 13495 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 14441 13983 gene locus_tag LOCUS_1090 gene rlmH 14441 13983 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548590.1 protein_id gnl|my_center|LOCUS_1090 15589 14438 gene locus_tag LOCUS_1100 15589 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 16601 15636 gene locus_tag LOCUS_1110 16601 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 16680 17129 gene locus_tag LOCUS_1120 gene tadA 16680 17129 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931378.1 protein_id gnl|my_center|LOCUS_1120 17615 17139 gene locus_tag LOCUS_1130 17615 17139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 17731 18513 gene locus_tag LOCUS_1140 17731 18513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966607.1 protein_id gnl|my_center|LOCUS_1140 >Feature sequence006 2613 100 gene locus_tag LOCUS_1150 2613 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 3372 2614 gene locus_tag LOCUS_1160 3372 2614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_1160 6312 3433 gene locus_tag LOCUS_1170 6312 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 10282 6362 gene locus_tag LOCUS_1180 10282 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 11906 10467 gene locus_tag LOCUS_1190 11906 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 12658 12002 gene locus_tag LOCUS_1200 12658 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 13628 12693 gene locus_tag LOCUS_1210 gene rsmH 13628 12693 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_1210 16145 13638 gene locus_tag LOCUS_1220 16145 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 >Feature sequence007 1255 2286 gene locus_tag LOCUS_1230 1255 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 2301 2678 gene locus_tag LOCUS_1240 2301 2678 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_1240 5384 2739 gene locus_tag LOCUS_1250 gene ppdK 5384 2739 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_1250 6243 5485 gene locus_tag LOCUS_1260 6243 5485 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_1260 6628 6299 gene locus_tag LOCUS_1270 6628 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 7889 6615 gene locus_tag LOCUS_1280 7889 6615 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272568.1 protein_id gnl|my_center|LOCUS_1280 8073 10253 gene locus_tag LOCUS_1290 8073 10253 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_1290 10387 10884 gene locus_tag LOCUS_1300 10387 10884 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965977.1 protein_id gnl|my_center|LOCUS_1300 10979 11560 gene locus_tag LOCUS_1310 10979 11560 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262167.1 protein_id gnl|my_center|LOCUS_1310 11578 13926 gene locus_tag LOCUS_1320 11578 13926 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_1320 15529 13958 gene locus_tag LOCUS_1330 15529 13958 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_1330 16674 15526 gene locus_tag LOCUS_1340 16674 15526 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_1340 16800 18077 gene locus_tag LOCUS_1350 gene mtaB 16800 18077 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_1350 >Feature sequence008 500 1015 gene locus_tag LOCUS_1360 gene rplJ 500 1015 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_1360 1060 1437 gene locus_tag LOCUS_1370 gene rplL 1060 1437 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_1370 1580 2446 gene locus_tag LOCUS_1380 1580 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 3039 2479 gene locus_tag LOCUS_1390 3039 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 4497 3127 gene locus_tag LOCUS_1400 gene cysS 4497 3127 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_1400 4960 4577 gene locus_tag LOCUS_1410 4960 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 5058 7295 gene locus_tag LOCUS_1420 5058 7295 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_1420 7298 8026 gene locus_tag LOCUS_1430 7298 8026 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860641.1 protein_id gnl|my_center|LOCUS_1430 8238 8164 gene locus_tag LOCUS_t0010 8238 8164 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8843 8346 gene locus_tag LOCUS_1440 8843 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 9392 8862 gene locus_tag LOCUS_1450 9392 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 9937 9449 gene locus_tag LOCUS_1460 9937 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 11270 9945 gene locus_tag LOCUS_1470 11270 9945 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039147.1 protein_id gnl|my_center|LOCUS_1470 12191 11478 gene locus_tag LOCUS_1480 12191 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 12581 12306 gene locus_tag LOCUS_1490 12581 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 13548 12658 gene locus_tag LOCUS_1500 13548 12658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 14092 13529 gene locus_tag LOCUS_1510 14092 13529 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016449.1 protein_id gnl|my_center|LOCUS_1510 14553 14089 gene locus_tag LOCUS_1520 14553 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 14967 14629 gene locus_tag LOCUS_1530 14967 14629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 15123 15314 gene locus_tag LOCUS_1540 15123 15314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 15470 15805 gene locus_tag LOCUS_1550 15470 15805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 15940 16332 gene locus_tag LOCUS_1560 15940 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 16469 16783 gene locus_tag LOCUS_1570 16469 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 16839 17261 gene locus_tag LOCUS_1580 16839 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 17414 17587 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tggacctactggtgctactgg >Feature sequence009 <1 609 gene locus_tag LOCUS_1590 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081814.1:50S ribosomal protein L24 619 1170 gene locus_tag LOCUS_1600 gene rplE 619 1170 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_1600 1179 1364 gene locus_tag LOCUS_1610 1179 1364 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_1610 1379 1777 gene locus_tag LOCUS_1620 gene rpsH 1379 1777 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357687.1 protein_id gnl|my_center|LOCUS_1620 1787 2335 gene locus_tag LOCUS_1630 gene rplF 1787 2335 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183035.1 protein_id gnl|my_center|LOCUS_1630 2349 2717 gene locus_tag LOCUS_1640 gene rplR 2349 2717 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645500.1 protein_id gnl|my_center|LOCUS_1640 2727 3332 gene locus_tag LOCUS_1650 2727 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 3345 3539 gene locus_tag LOCUS_1660 gene rpmD 3345 3539 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_1660 3540 3989 gene locus_tag LOCUS_1670 gene rplO 3540 3989 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943467.1 protein_id gnl|my_center|LOCUS_1670 3993 5279 gene locus_tag LOCUS_1680 gene secY 3993 5279 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_1680 5377 6003 gene locus_tag LOCUS_1690 5377 6003 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_1690 6003 6746 gene locus_tag LOCUS_1700 gene map 6003 6746 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_1700 6759 7028 gene locus_tag LOCUS_1710 6759 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 7021 7245 gene locus_tag LOCUS_1720 gene infA 7021 7245 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421127.1 protein_id gnl|my_center|LOCUS_1720 7401 7778 gene locus_tag LOCUS_1730 gene rpsM 7401 7778 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_1730 7791 8192 gene locus_tag LOCUS_1740 gene rpsK 7791 8192 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966387.1 protein_id gnl|my_center|LOCUS_1740 8207 8833 gene locus_tag LOCUS_1750 gene rpsD 8207 8833 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_1750 8849 9799 gene locus_tag LOCUS_1760 8849 9799 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_1760 9820 10329 gene locus_tag LOCUS_1770 gene rplQ 9820 10329 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894521.1 protein_id gnl|my_center|LOCUS_1770 10503 10952 gene locus_tag LOCUS_1780 gene dtd 10503 10952 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373094.1 protein_id gnl|my_center|LOCUS_1780 11029 11790 gene locus_tag LOCUS_1790 11029 11790 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_1790 11797 12762 gene locus_tag LOCUS_1800 gene whiA 11797 12762 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438915.1 protein_id gnl|my_center|LOCUS_1800 12774 16427 gene locus_tag LOCUS_1810 12774 16427 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_1810 >Feature sequence010 <1 2479 gene locus_tag LOCUS_1820 <1 2479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase 2561 2758 gene locus_tag LOCUS_1830 2561 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 2875 5049 gene locus_tag LOCUS_1840 gene priA 2875 5049 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_1840 5062 5535 gene locus_tag LOCUS_1850 gene def 5062 5535 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_1850 5551 6465 gene locus_tag LOCUS_1860 gene fmt 5551 6465 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583791.1 protein_id gnl|my_center|LOCUS_1860 6465 7493 gene locus_tag LOCUS_1870 gene rlmN 6465 7493 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_1870 7495 8331 gene locus_tag LOCUS_1880 gene rsgA 7495 8331 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460520.1 protein_id gnl|my_center|LOCUS_1880 8341 9006 gene locus_tag LOCUS_1890 gene rpe 8341 9006 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545731.1 protein_id gnl|my_center|LOCUS_1890 9328 9095 gene locus_tag LOCUS_1900 9328 9095 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869518.1 protein_id gnl|my_center|LOCUS_1900 9453 10967 gene locus_tag LOCUS_1910 9453 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 11094 11576 gene locus_tag LOCUS_1920 11094 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 11585 12277 gene locus_tag LOCUS_1930 gene sleB 11585 12277 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_1930 12286 13707 gene locus_tag LOCUS_1940 gene ypeB 12286 13707 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 protein_id gnl|my_center|LOCUS_1940 14088 13813 gene locus_tag LOCUS_1950 gene spoVG 14088 13813 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_1950 14190 14960 gene locus_tag LOCUS_1960 14190 14960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 protein_id gnl|my_center|LOCUS_1960 14948 16366 gene locus_tag LOCUS_1970 14948 16366 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_1970 >Feature sequence011 1250 1708 gene locus_tag LOCUS_1980 1250 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 2260 1811 gene locus_tag LOCUS_1990 2260 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 3395 2286 gene locus_tag LOCUS_2000 gene metK 3395 2286 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_2000 3609 3406 gene locus_tag LOCUS_2010 3609 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 4502 3807 gene locus_tag LOCUS_2020 4502 3807 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249007.1 protein_id gnl|my_center|LOCUS_2020 5219 4671 gene locus_tag LOCUS_2030 5219 4671 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_2030 6584 5283 gene locus_tag LOCUS_2040 6584 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 7605 6706 gene locus_tag LOCUS_2050 7605 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 7745 7669 gene locus_tag LOCUS_t0020 7745 7669 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8348 7839 gene locus_tag LOCUS_2060 8348 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 8493 9380 gene locus_tag LOCUS_2070 8493 9380 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_2070 9989 9414 gene locus_tag LOCUS_2080 9989 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 10476 10072 gene locus_tag LOCUS_2090 10476 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 10641 11021 gene locus_tag LOCUS_2100 10641 11021 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 protein_id gnl|my_center|LOCUS_2100 11052 11675 gene locus_tag LOCUS_2110 11052 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 11687 12637 gene locus_tag LOCUS_2120 11687 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 13883 12672 gene locus_tag LOCUS_2130 13883 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 14241 14167 gene locus_tag LOCUS_t0030 14241 14167 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14396 15280 gene locus_tag LOCUS_2140 gene prmC 14396 15280 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_2140 >Feature sequence012 756 199 gene locus_tag LOCUS_2150 756 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 847 1566 gene locus_tag LOCUS_2160 847 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 2525 1605 gene locus_tag LOCUS_2170 2525 1605 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438084.1 protein_id gnl|my_center|LOCUS_2170 2658 3641 gene locus_tag LOCUS_2180 gene pta 2658 3641 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_2180 3641 4837 gene locus_tag LOCUS_2190 gene ackA 3641 4837 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_2190 4922 5113 gene locus_tag LOCUS_2200 gene rpmF 4922 5113 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774376.1 protein_id gnl|my_center|LOCUS_2200 5325 6332 gene locus_tag LOCUS_2210 gene plsX 5325 6332 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_2210 6336 6953 gene locus_tag LOCUS_2220 gene rnc 6336 6953 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_2220 6971 10552 gene locus_tag LOCUS_2230 gene smc 6971 10552 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965058.1 protein_id gnl|my_center|LOCUS_2230 10555 11451 gene locus_tag LOCUS_2240 gene ftsY 10555 11451 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941793.1 protein_id gnl|my_center|LOCUS_2240 11593 12309 gene locus_tag LOCUS_2250 gene sigK 11593 12309 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_2250 12411 13775 gene locus_tag LOCUS_2260 12411 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 >Feature sequence013 313 1140 gene locus_tag LOCUS_2270 gene soj 313 1140 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_2270 1133 2089 gene locus_tag LOCUS_2280 1133 2089 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_2280 2292 2834 gene locus_tag LOCUS_2290 2292 2834 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_2290 2990 3298 gene locus_tag LOCUS_2300 2990 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 5140 3362 gene locus_tag LOCUS_2310 5140 3362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_2310 6893 5142 gene locus_tag LOCUS_2320 6893 5142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_2320 7515 6988 gene locus_tag LOCUS_2330 7515 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 7995 7558 gene locus_tag LOCUS_2340 7995 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 9105 8005 gene locus_tag LOCUS_2350 gene dnaN 9105 8005 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_2350 10730 9378 gene locus_tag LOCUS_2360 gene dnaA 10730 9378 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_2360 10888 11949 gene locus_tag LOCUS_2370 gene recF 10888 11949 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_2370 11981 12469 gene locus_tag LOCUS_2380 11981 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 13575 12511 gene locus_tag LOCUS_2390 gene trpS 13575 12511 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760790.1 protein_id gnl|my_center|LOCUS_2390 >Feature sequence014 570 193 gene locus_tag LOCUS_2400 570 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 662 1024 gene locus_tag LOCUS_2410 662 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 1101 3059 gene locus_tag LOCUS_2420 gene uvrB 1101 3059 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_2420 3274 4455 gene locus_tag LOCUS_2430 3274 4455 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_2430 4503 5018 gene locus_tag LOCUS_2440 4503 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 5542 8373 gene locus_tag LOCUS_2450 gene uvrA 5542 8373 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963825.1 protein_id gnl|my_center|LOCUS_2450 11001 8401 gene locus_tag LOCUS_2460 11001 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 11936 11154 gene locus_tag LOCUS_2470 11936 11154 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_2470 12348 13928 gene locus_tag LOCUS_2480 gene metG 12348 13928 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_2480 14474 13962 gene locus_tag LOCUS_2490 gene nrdG 14474 13962 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_2490 >Feature sequence015 173 97 gene locus_tag LOCUS_t0040 173 97 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 889 233 gene locus_tag LOCUS_2500 889 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 1653 3614 gene locus_tag LOCUS_2510 gene gyrB 1653 3614 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_2510 3631 3930 gene locus_tag LOCUS_2520 3631 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 3967 6549 gene locus_tag LOCUS_2530 gene gyrA 3967 6549 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_2530 6700 8763 gene locus_tag LOCUS_2540 6700 8763 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108037.1 protein_id gnl|my_center|LOCUS_2540 9164 10474 gene locus_tag LOCUS_2550 gene hisS 9164 10474 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_2550 10549 12387 gene locus_tag LOCUS_2560 gene uvrC 10549 12387 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_2560 12479 13666 gene locus_tag LOCUS_2570 12479 13666 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_2570 >Feature sequence016 4274 3453 gene locus_tag LOCUS_2580 4274 3453 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204953390.1 protein_id gnl|my_center|LOCUS_2580 4462 4755 gene locus_tag LOCUS_2590 4462 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 4767 5969 gene locus_tag LOCUS_2600 4767 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 5966 6256 gene locus_tag LOCUS_2610 5966 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 6359 7204 gene locus_tag LOCUS_2620 6359 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 7207 8304 gene locus_tag LOCUS_2630 7207 8304 CDS product YidE/YbjL duplication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280515.1 protein_id gnl|my_center|LOCUS_2630 8321 10903 gene locus_tag LOCUS_2640 8321 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 11004 11840 gene locus_tag LOCUS_2650 11004 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 11857 13788 gene locus_tag LOCUS_2660 11857 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 >Feature sequence017 1060 26 gene locus_tag LOCUS_2670 1060 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 1704 1090 gene locus_tag LOCUS_2680 1704 1090 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439452.1 protein_id gnl|my_center|LOCUS_2680 2920 1715 gene locus_tag LOCUS_2690 2920 1715 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_2690 3627 2920 gene locus_tag LOCUS_2700 3627 2920 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986387.1 protein_id gnl|my_center|LOCUS_2700 4789 3629 gene locus_tag LOCUS_2710 4789 3629 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965357.1 protein_id gnl|my_center|LOCUS_2710 5186 4773 gene locus_tag LOCUS_2720 5186 4773 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428254.1 protein_id gnl|my_center|LOCUS_2720 5757 5188 gene locus_tag LOCUS_2730 5757 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 6515 5754 gene locus_tag LOCUS_2740 6515 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 6614 6889 gene locus_tag LOCUS_2750 gene rpsT 6614 6889 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_2750 7020 7583 gene locus_tag LOCUS_2760 7020 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 8159 7623 gene locus_tag LOCUS_2770 gene raiA 8159 7623 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_2770 10665 8197 gene locus_tag LOCUS_2780 10665 8197 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_2780 11677 10670 gene locus_tag LOCUS_2790 11677 10670 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966467.1 protein_id gnl|my_center|LOCUS_2790 <13748 11883 gene locus_tag LOCUS_2800 <13748 11883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947999.1:Tex family protein >Feature sequence018 372 563 gene locus_tag LOCUS_2810 372 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 610 960 gene locus_tag LOCUS_2820 gene rplS 610 960 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_2820 1010 1690 gene locus_tag LOCUS_2830 1010 1690 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_2830 1801 3336 gene locus_tag LOCUS_2840 1801 3336 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_2840 3355 4431 gene locus_tag LOCUS_2850 gene dprA 3355 4431 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_2850 4445 6499 gene locus_tag LOCUS_2860 gene topA 4445 6499 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_2860 6503 7762 gene locus_tag LOCUS_2870 gene trmFO 6503 7762 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183430.1 protein_id gnl|my_center|LOCUS_2870 7746 8285 gene locus_tag LOCUS_2880 gene hslV 7746 8285 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357489.1 protein_id gnl|my_center|LOCUS_2880 8287 9582 gene locus_tag LOCUS_2890 gene hslU 8287 9582 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081401.1 protein_id gnl|my_center|LOCUS_2890 9592 10269 gene locus_tag LOCUS_2900 9592 10269 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_2900 10266 10574 gene locus_tag LOCUS_2910 gene trxA 10266 10574 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830148.1 protein_id gnl|my_center|LOCUS_2910 10735 11910 gene locus_tag LOCUS_2920 gene nifS 10735 11910 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_2920 11913 12290 gene locus_tag LOCUS_2930 11913 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 12372 12542 gene locus_tag LOCUS_2940 12372 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 >Feature sequence019 1092 418 gene locus_tag LOCUS_2950 1092 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 1813 2391 gene locus_tag LOCUS_2960 1813 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 2506 2910 gene locus_tag LOCUS_2970 2506 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 2990 3385 gene locus_tag LOCUS_2980 2990 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 3400 3753 gene locus_tag LOCUS_2990 3400 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 3979 4053 gene locus_tag LOCUS_t0050 3979 4053 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4479 4566 gene locus_tag LOCUS_t0060 4479 4566 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4686 5417 gene locus_tag LOCUS_3000 4686 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 5419 5919 gene locus_tag LOCUS_3010 5419 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 6782 5955 gene locus_tag LOCUS_3020 6782 5955 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_3020 6864 7115 gene locus_tag LOCUS_3030 6864 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 7124 7471 gene locus_tag LOCUS_3040 7124 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 7471 7626 gene locus_tag LOCUS_3050 7471 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 >Feature sequence020 751 1551 gene locus_tag LOCUS_3060 751 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 1564 2289 gene locus_tag LOCUS_3070 gene sigE 1564 2289 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_3070 2411 3184 gene locus_tag LOCUS_3080 gene sigG 2411 3184 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_3080 3334 4791 gene locus_tag LOCUS_3090 3334 4791 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546343.1 protein_id gnl|my_center|LOCUS_3090 5634 5191 gene locus_tag LOCUS_3100 gene nrdR 5634 5191 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_3100 5744 5986 gene locus_tag LOCUS_3110 5744 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 5983 8064 gene locus_tag LOCUS_3120 gene feoB 5983 8064 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832356.1 protein_id gnl|my_center|LOCUS_3120 8493 8311 gene locus_tag LOCUS_3130 8493 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 8694 9044 gene locus_tag LOCUS_3140 8694 9044 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_3140 9059 10690 gene locus_tag LOCUS_3150 9059 10690 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_3150 10791 11555 gene locus_tag LOCUS_3160 10791 11555 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_3160 12241 11588 gene locus_tag LOCUS_3170 12241 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 >Feature sequence021 748 1200 gene locus_tag LOCUS_3180 748 1200 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_3180 1212 2876 gene locus_tag LOCUS_3190 gene recN 1212 2876 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986438.1 protein_id gnl|my_center|LOCUS_3190 2934 4145 gene locus_tag LOCUS_3200 gene spoIVB 2934 4145 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_3200 4209 5204 gene locus_tag LOCUS_3210 4209 5204 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_3210 6338 5298 gene locus_tag LOCUS_3220 6338 5298 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_3220 6568 7857 gene locus_tag LOCUS_3230 gene serS 6568 7857 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_3230 7870 8853 gene locus_tag LOCUS_3240 7870 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 9615 9025 gene locus_tag LOCUS_3250 9615 9025 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883304.1 protein_id gnl|my_center|LOCUS_3250 9789 11597 gene locus_tag LOCUS_3260 9789 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 11600 12022 gene locus_tag LOCUS_3270 11600 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 12044 12226 gene locus_tag LOCUS_3280 12044 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 <12999 12490 gene locus_tag LOCUS_3290 <12999 12490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392595.1:ribonuclease Y >Feature sequence022 2701 1676 gene locus_tag LOCUS_3300 2701 1676 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048162.1 protein_id gnl|my_center|LOCUS_3300 2813 3064 gene locus_tag LOCUS_3310 2813 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3310 3095 3349 gene locus_tag LOCUS_3320 3095 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3320 3460 4125 gene locus_tag LOCUS_3330 3460 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 4237 7134 gene locus_tag LOCUS_3340 4237 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 7149 8471 gene locus_tag LOCUS_3350 gene rimO 7149 8471 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965119.1 protein_id gnl|my_center|LOCUS_3350 8468 9157 gene locus_tag LOCUS_3360 gene pgsA 8468 9157 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_3360 9159 10166 gene locus_tag LOCUS_3370 gene recA 9159 10166 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113623.1 protein_id gnl|my_center|LOCUS_3370 10298 11614 gene locus_tag LOCUS_3380 10298 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 >Feature sequence023 277 1365 gene locus_tag LOCUS_3390 277 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 1380 2516 gene locus_tag LOCUS_3400 1380 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 2684 3208 gene locus_tag LOCUS_3410 2684 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 3354 3488 gene locus_tag LOCUS_3420 3354 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 3463 3834 gene locus_tag LOCUS_3430 3463 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 3872 5233 gene locus_tag LOCUS_3440 3872 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 5248 6054 gene locus_tag LOCUS_3450 5248 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 6691 6083 gene locus_tag LOCUS_3460 6691 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 6807 7223 gene locus_tag LOCUS_3470 6807 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 7298 8638 gene locus_tag LOCUS_3480 gene mnmE 7298 8638 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_3480 9345 8668 gene locus_tag LOCUS_3490 9345 8668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 9532 11424 gene locus_tag LOCUS_3500 gene mnmG 9532 11424 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_3500 >Feature sequence024 278 736 gene locus_tag LOCUS_3510 278 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 2141 897 gene locus_tag LOCUS_3520 2141 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 2312 3187 gene locus_tag LOCUS_3530 2312 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 3321 7343 gene locus_tag LOCUS_3540 3321 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 7386 8735 gene locus_tag LOCUS_3550 7386 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 8910 11300 gene locus_tag LOCUS_3560 8910 11300 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965553.1 protein_id gnl|my_center|LOCUS_3560 >Feature sequence025 270 2546 gene locus_tag LOCUS_3570 gene spoIIE 270 2546 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 protein_id gnl|my_center|LOCUS_3570 2666 3997 gene locus_tag LOCUS_3580 gene tilS 2666 3997 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966480.1 protein_id gnl|my_center|LOCUS_3580 4088 4822 gene locus_tag LOCUS_3590 4088 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 4941 5513 gene locus_tag LOCUS_3600 4941 5513 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_3600 5602 7500 gene locus_tag LOCUS_3610 5602 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 7616 7927 gene locus_tag LOCUS_3620 7616 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 8005 8778 gene locus_tag LOCUS_3630 8005 8778 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_3630 8859 10487 gene locus_tag LOCUS_3640 8859 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 10484 11068 gene locus_tag LOCUS_3650 10484 11068 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964553.1 protein_id gnl|my_center|LOCUS_3650 11150 11821 gene locus_tag LOCUS_3660 11150 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 >Feature sequence026 1739 942 gene locus_tag LOCUS_3670 1739 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 2447 1938 gene locus_tag LOCUS_3680 2447 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 2835 2557 gene locus_tag LOCUS_3690 2835 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 3862 2828 gene locus_tag LOCUS_3700 3862 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 4566 4003 gene locus_tag LOCUS_3710 4566 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 5453 4575 gene locus_tag LOCUS_3720 5453 4575 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286075.1 protein_id gnl|my_center|LOCUS_3720 5639 7126 gene locus_tag LOCUS_3730 5639 7126 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_3730 7766 7158 gene locus_tag LOCUS_3740 7766 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 8083 7853 gene locus_tag LOCUS_3750 8083 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 8220 9806 gene locus_tag LOCUS_3760 8220 9806 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_3760 9922 10689 gene locus_tag LOCUS_3770 9922 10689 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943610.1 protein_id gnl|my_center|LOCUS_3770 10742 11410 gene locus_tag LOCUS_3780 10742 11410 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_3780 >Feature sequence027 1708 458 gene locus_tag LOCUS_3790 1708 458 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829506.1 protein_id gnl|my_center|LOCUS_3790 2194 2118 gene locus_tag LOCUS_t0070 2194 2118 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3188 2280 gene locus_tag LOCUS_3800 3188 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 4142 3258 gene locus_tag LOCUS_3810 4142 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 4957 4250 gene locus_tag LOCUS_3820 4957 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 5074 5949 gene locus_tag LOCUS_3830 gene dapA 5074 5949 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_3830 6603 5962 gene locus_tag LOCUS_3840 gene dapB 6603 5962 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081877.1 protein_id gnl|my_center|LOCUS_3840 7517 6612 gene locus_tag LOCUS_3850 7517 6612 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_3850 8517 7519 gene locus_tag LOCUS_3860 8517 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 9488 8514 gene locus_tag LOCUS_3870 9488 8514 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357473.1 protein_id gnl|my_center|LOCUS_3870 10329 9559 gene locus_tag LOCUS_3880 10329 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 <10995 10397 gene locus_tag LOCUS_3890 <10995 10397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000597238.1:SAV1866 family putative multidrug efflux ABC transporter >Feature sequence028 697 137 gene locus_tag LOCUS_3900 697 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 1826 795 gene locus_tag LOCUS_3910 gene alr 1826 795 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475712.1 protein_id gnl|my_center|LOCUS_3910 2074 1859 gene locus_tag LOCUS_3920 2074 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 2896 2114 gene locus_tag LOCUS_3930 2896 2114 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_3930 3566 2973 gene locus_tag LOCUS_3940 3566 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 3704 7408 gene locus_tag LOCUS_3950 3704 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 7516 10143 gene locus_tag LOCUS_3960 7516 10143 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_3960 >Feature sequence029 534 271 gene locus_tag LOCUS_3970 gene rpsQ 534 271 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_3970 739 521 gene locus_tag LOCUS_3980 gene rpmC 739 521 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_3980 1160 729 gene locus_tag LOCUS_3990 gene rplP 1160 729 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_3990 1842 1147 gene locus_tag LOCUS_4000 gene rpsC 1842 1147 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_4000 2234 1845 gene locus_tag LOCUS_4010 gene rplV 2234 1845 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906302.1 protein_id gnl|my_center|LOCUS_4010 2529 2245 gene locus_tag LOCUS_4020 gene rpsS 2529 2245 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102083.1 protein_id gnl|my_center|LOCUS_4020 3371 2541 gene locus_tag LOCUS_4030 gene rplB 3371 2541 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_4030 3691 3389 gene locus_tag LOCUS_4040 gene rplW 3691 3389 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_4040 4317 3691 gene locus_tag LOCUS_4050 gene rplD 4317 3691 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_4050 4965 4330 gene locus_tag LOCUS_4060 gene rplC 4965 4330 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_4060 5294 4986 gene locus_tag LOCUS_4070 gene rpsJ 5294 4986 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_4070 6333 5653 gene locus_tag LOCUS_4080 6333 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 7175 6471 gene locus_tag LOCUS_4090 gene recO 7175 6471 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047994.1 protein_id gnl|my_center|LOCUS_4090 7330 7178 gene locus_tag LOCUS_4100 7330 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 7704 7779 gene locus_tag LOCUS_t0080 7704 7779 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8748 8104 gene locus_tag LOCUS_4110 8748 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 >Feature sequence030 624 280 gene locus_tag LOCUS_4120 624 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 1492 677 gene locus_tag LOCUS_4130 1492 677 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_4130 1904 1566 gene locus_tag LOCUS_4140 1904 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 2706 1957 gene locus_tag LOCUS_4150 gene spo0A 2706 1957 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_4150 5327 2922 gene locus_tag LOCUS_4160 5327 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 8863 5531 gene locus_tag LOCUS_4170 gene addA 8863 5531 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476466.1 protein_id gnl|my_center|LOCUS_4170 <10708 8853 gene locus_tag LOCUS_4180 <10708 8853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000058551.1:helicase-exonuclease AddAB subunit AddB >Feature sequence031 939 736 gene locus_tag LOCUS_4190 939 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 1257 1075 gene locus_tag LOCUS_4200 1257 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 1493 1936 gene locus_tag LOCUS_4210 1493 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 2754 1951 gene locus_tag LOCUS_4220 2754 1951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393844.1 protein_id gnl|my_center|LOCUS_4220 3509 2754 gene locus_tag LOCUS_4230 3509 2754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_4230 3642 3932 gene locus_tag LOCUS_4240 3642 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 3922 4143 gene locus_tag LOCUS_4250 3922 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 4136 5983 gene locus_tag LOCUS_4260 4136 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 5986 6663 gene locus_tag LOCUS_4270 5986 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 6702 7904 gene locus_tag LOCUS_4280 6702 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 7979 8296 gene locus_tag LOCUS_4290 7979 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 8287 8835 gene locus_tag LOCUS_4300 8287 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 8835 10322 gene locus_tag LOCUS_4310 8835 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 >Feature sequence032 1276 1010 gene locus_tag LOCUS_4320 1276 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 1372 1623 gene locus_tag LOCUS_4330 1372 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 2272 1625 gene locus_tag LOCUS_4340 gene ftsE 2272 1625 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_4340 2850 2344 gene locus_tag LOCUS_4350 2850 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 3245 2901 gene locus_tag LOCUS_4360 3245 2901 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_4360 4060 3245 gene locus_tag LOCUS_4370 gene ylqF 4060 3245 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_4370 4815 4147 gene locus_tag LOCUS_4380 gene trmD 4815 4147 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384686.1 protein_id gnl|my_center|LOCUS_4380 5297 4812 gene locus_tag LOCUS_4390 gene rimM 5297 4812 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_4390 5530 5300 gene locus_tag LOCUS_4400 5530 5300 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_4400 5791 5543 gene locus_tag LOCUS_4410 gene rpsP 5791 5543 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870158.1 protein_id gnl|my_center|LOCUS_4410 7178 5868 gene locus_tag LOCUS_4420 gene ffh 7178 5868 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_4420 7465 7187 gene locus_tag LOCUS_4430 7465 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 8319 7555 gene locus_tag LOCUS_4440 8319 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 9097 8330 gene locus_tag LOCUS_4450 9097 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 10282 9188 gene locus_tag LOCUS_4460 gene hemW 10282 9188 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583471.1 protein_id gnl|my_center|LOCUS_4460 >Feature sequence033 1386 268 gene locus_tag LOCUS_4470 1386 268 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_4470 3773 1383 gene locus_tag LOCUS_4480 gene pheT 3773 1383 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_4480 4802 3783 gene locus_tag LOCUS_4490 gene pheS 4802 3783 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388219.1 protein_id gnl|my_center|LOCUS_4490 5169 6038 gene locus_tag LOCUS_4500 5169 6038 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584158.1 protein_id gnl|my_center|LOCUS_4500 7441 6053 gene locus_tag LOCUS_4510 gene asnS 7441 6053 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430444.1 protein_id gnl|my_center|LOCUS_4510 9194 7455 gene locus_tag LOCUS_4520 gene aspS 9194 7455 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_4520 9336 9417 gene locus_tag LOCUS_t0090 9336 9417 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9528 9962 gene locus_tag LOCUS_4530 9528 9962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 >Feature sequence034 <1 757 gene locus_tag LOCUS_4540 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922118.1:glycosyltransferase family 2 protein 778 2022 gene locus_tag LOCUS_4550 778 2022 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_4550 2012 3019 gene locus_tag LOCUS_4560 2012 3019 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_4560 3009 3731 gene locus_tag LOCUS_4570 3009 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 3740 4864 gene locus_tag LOCUS_4580 3740 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_4580 6090 4903 gene locus_tag LOCUS_4590 6090 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 6306 6785 gene locus_tag LOCUS_4600 6306 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4600 >Feature sequence035 5923 9318 gene locus_tag LOCUS_4610 5923 9318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 >Feature sequence036 438 1913 gene locus_tag LOCUS_4620 gene spoIVA 438 1913 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_4620 2064 5573 gene locus_tag LOCUS_4630 2064 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 5696 7924 gene locus_tag LOCUS_4640 gene pcrA 5696 7924 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_4640 >Feature sequence037 2667 2194 gene locus_tag LOCUS_4650 gene rpsG 2667 2194 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810168.1 protein_id gnl|my_center|LOCUS_4650 3082 2702 gene locus_tag LOCUS_4660 gene rpsL 3082 2702 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081846.1 protein_id gnl|my_center|LOCUS_4660 4112 3402 gene locus_tag LOCUS_4670 4112 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 5422 4193 gene locus_tag LOCUS_4680 gene ftsZ 5422 4193 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_4680 6700 5576 gene locus_tag LOCUS_4690 gene ftsA 6700 5576 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964999.1 protein_id gnl|my_center|LOCUS_4690 6881 7948 gene locus_tag LOCUS_4700 6881 7948 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_4700 8850 7975 gene locus_tag LOCUS_4710 8850 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 >Feature sequence038 1442 291 gene locus_tag LOCUS_4720 gene dacF 1442 291 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_4720 2834 2166 gene locus_tag LOCUS_4730 gene cmk 2834 2166 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081716.1 protein_id gnl|my_center|LOCUS_4730 3223 2843 gene locus_tag LOCUS_4740 3223 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 4293 3226 gene locus_tag LOCUS_4750 4293 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 4423 6078 gene locus_tag LOCUS_4760 4423 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 6089 6490 gene locus_tag LOCUS_4770 6089 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4770 7193 6534 gene locus_tag LOCUS_4780 7193 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4780 8093 7314 gene locus_tag LOCUS_4790 8093 7314 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965719.1 protein_id gnl|my_center|LOCUS_4790 8651 8145 gene locus_tag LOCUS_4800 8651 8145 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994781.1 protein_id gnl|my_center|LOCUS_4800 8917 8842 gene locus_tag LOCUS_t0100 8917 8842 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 1454 798 gene locus_tag LOCUS_4810 1454 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 1776 1522 gene locus_tag LOCUS_4820 gene spoIIID 1776 1522 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014795808.1 protein_id gnl|my_center|LOCUS_4820 2186 1950 gene locus_tag LOCUS_4830 gene acpP 2186 1950 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_4830 2844 2281 gene locus_tag LOCUS_4840 2844 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 3375 2917 gene locus_tag LOCUS_4850 3375 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 3803 3426 gene locus_tag LOCUS_4860 3803 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 4406 3849 gene locus_tag LOCUS_4870 4406 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 5931 4429 gene locus_tag LOCUS_4880 5931 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 7741 6017 gene locus_tag LOCUS_4890 7741 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 <8907 7881 gene locus_tag LOCUS_4900 <8907 7881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425912.1:transcription-repair coupling factor >Feature sequence040 1602 679 gene locus_tag LOCUS_4910 gene trxB 1602 679 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080734.1 protein_id gnl|my_center|LOCUS_4910 2138 1719 gene locus_tag LOCUS_4920 gene rpsI 2138 1719 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567483.1 protein_id gnl|my_center|LOCUS_4920 2581 2138 gene locus_tag LOCUS_4930 gene rplM 2581 2138 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_4930 3104 4210 gene locus_tag LOCUS_4940 3104 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 4227 8495 gene locus_tag LOCUS_4950 4227 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 >Feature sequence041 1636 248 gene locus_tag LOCUS_4960 1636 248 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_4960 3521 1941 gene locus_tag LOCUS_4970 3521 1941 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272056.1 protein_id gnl|my_center|LOCUS_4970 >Feature sequence042 347 1096 gene locus_tag LOCUS_4980 gene sufC 347 1096 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_4980 1089 2489 gene locus_tag LOCUS_4990 gene sufB 1089 2489 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_4990 2491 3537 gene locus_tag LOCUS_5000 gene sufD 2491 3537 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_5000 3518 4735 gene locus_tag LOCUS_5010 3518 4735 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_5010 4740 5177 gene locus_tag LOCUS_5020 4740 5177 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_5020 6030 5179 gene locus_tag LOCUS_5030 6030 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5030 6701 6105 gene locus_tag LOCUS_5040 6701 6105 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810244.1 protein_id gnl|my_center|LOCUS_5040 7302 7676 gene locus_tag LOCUS_5050 7302 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 >Feature sequence043 1402 311 gene locus_tag LOCUS_5060 1402 311 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_5060 1779 1525 gene locus_tag LOCUS_5070 1779 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 4324 1793 gene locus_tag LOCUS_5080 4324 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 4623 5033 gene locus_tag LOCUS_5090 4623 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 5900 5061 gene locus_tag LOCUS_5100 5900 5061 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459581.1 protein_id gnl|my_center|LOCUS_5100 6028 6891 gene locus_tag LOCUS_5110 6028 6891 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_5110 6971 8605 gene locus_tag LOCUS_5120 6971 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 >Feature sequence044 926 336 gene locus_tag LOCUS_5130 926 336 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476167.1 protein_id gnl|my_center|LOCUS_5130 1041 1403 gene locus_tag LOCUS_5140 1041 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 1417 2034 gene locus_tag LOCUS_5150 gene lspA 1417 2034 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_5150 2018 2914 gene locus_tag LOCUS_5160 2018 2914 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_5160 3325 2942 gene locus_tag LOCUS_5170 3325 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 3829 3443 gene locus_tag LOCUS_5180 3829 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 4125 3937 gene locus_tag LOCUS_5190 4125 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 4417 8475 gene locus_tag LOCUS_5200 4417 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 8679 8509 gene locus_tag LOCUS_5210 8679 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 >Feature sequence045 281 207 gene locus_tag LOCUS_t0110 281 207 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 390 1217 gene locus_tag LOCUS_5220 390 1217 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_5220 1233 2330 gene locus_tag LOCUS_5230 1233 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 2383 2850 gene locus_tag LOCUS_5240 2383 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 2847 4808 gene locus_tag LOCUS_5250 gene tkt 2847 4808 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_5250 4902 5846 gene locus_tag LOCUS_5260 4902 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 5854 6759 gene locus_tag LOCUS_5270 5854 6759 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130718.1 protein_id gnl|my_center|LOCUS_5270 <8517 6783 gene locus_tag LOCUS_5280 <8517 6783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391612.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence046 <1 2251 gene locus_tag LOCUS_5290 <1 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 2761 5580 gene locus_tag LOCUS_5300 2761 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 6575 5598 gene locus_tag LOCUS_5310 6575 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 7835 6846 gene locus_tag LOCUS_5320 7835 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 >Feature sequence047 2491 191 gene locus_tag LOCUS_5330 2491 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 3857 2607 gene locus_tag LOCUS_5340 3857 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 4963 3854 gene locus_tag LOCUS_5350 4963 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 6386 4956 gene locus_tag LOCUS_5360 6386 4956 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_5360 7343 6438 gene locus_tag LOCUS_5370 7343 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 >Feature sequence048 4631 1521 gene locus_tag LOCUS_5380 4631 1521 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_5380 5589 4621 gene locus_tag LOCUS_5390 5589 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 5615 6484 gene locus_tag LOCUS_5400 5615 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 6551 7369 gene locus_tag LOCUS_5410 6551 7369 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680804.1 protein_id gnl|my_center|LOCUS_5410 >Feature sequence049 3869 1386 gene locus_tag LOCUS_5420 gene gyrA 3869 1386 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282851.1 protein_id gnl|my_center|LOCUS_5420 5854 3902 gene locus_tag LOCUS_5430 gene gyrB 5854 3902 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_5430 6086 7141 gene locus_tag LOCUS_5440 6086 7141 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_5440 >Feature sequence050 2226 793 gene locus_tag LOCUS_5450 2226 793 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975977.1 protein_id gnl|my_center|LOCUS_5450 2391 3095 gene locus_tag LOCUS_5460 2391 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 3601 3092 gene locus_tag LOCUS_5470 3601 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 3907 3992 gene locus_tag LOCUS_t0120 3907 3992 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4577 4389 gene locus_tag LOCUS_5480 4577 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 5186 4590 gene locus_tag LOCUS_5490 gene lexA 5186 4590 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_5490 5652 5287 gene locus_tag LOCUS_5500 5652 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 6371 5775 gene locus_tag LOCUS_5510 6371 5775 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965084.1 protein_id gnl|my_center|LOCUS_5510 6491 7021 gene locus_tag LOCUS_5520 6491 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358943.1 protein_id gnl|my_center|LOCUS_5520 >Feature sequence051 66 140 gene locus_tag LOCUS_t0130 66 140 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 249 324 gene locus_tag LOCUS_t0140 249 324 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 736 1362 gene locus_tag LOCUS_5530 736 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 2920 1418 gene locus_tag LOCUS_5540 gene gpmI 2920 1418 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_5540 >Feature sequence052 307 1275 gene locus_tag LOCUS_5550 307 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5550 1278 2285 gene locus_tag LOCUS_5560 1278 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 2296 3933 gene locus_tag LOCUS_5570 2296 3933 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_5570 3992 4189 gene locus_tag LOCUS_5580 3992 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 5176 4685 gene locus_tag LOCUS_5590 5176 4685 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_5590 5329 6093 gene locus_tag LOCUS_5600 5329 6093 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_5600 >Feature sequence053 1225 509 gene locus_tag LOCUS_5610 1225 509 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081858.1 protein_id gnl|my_center|LOCUS_5610 1637 1338 gene locus_tag LOCUS_5620 1637 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 3190 1775 gene locus_tag LOCUS_5630 3190 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 4776 3193 gene locus_tag LOCUS_5640 4776 3193 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_5640 5041 5823 gene locus_tag LOCUS_5650 5041 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 >Feature sequence054 472 83 gene locus_tag LOCUS_tm0010 472 83 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 926 483 gene locus_tag LOCUS_5660 gene smpB 926 483 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_5660 3176 1086 gene locus_tag LOCUS_5670 gene rnr 3176 1086 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_5670 3501 3178 gene locus_tag LOCUS_5680 3501 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 3750 3514 gene locus_tag LOCUS_5690 3750 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 4195 3971 gene locus_tag LOCUS_5700 4195 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 6034 4274 gene locus_tag LOCUS_5710 gene glmS 6034 4274 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016400.1 protein_id gnl|my_center|LOCUS_5710 >Feature sequence055 41 964 gene locus_tag LOCUS_5720 41 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 1711 992 gene locus_tag LOCUS_5730 1711 992 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_5730 1981 1715 gene locus_tag LOCUS_5740 1981 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_5740 2524 2129 gene locus_tag LOCUS_5750 2524 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_5750 3465 2515 gene locus_tag LOCUS_5760 3465 2515 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404855.1 protein_id gnl|my_center|LOCUS_5760 <5961 3546 gene locus_tag LOCUS_5770 <5961 3546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948276.1:calcium-translocating P-type ATPase, SERCA-type >Feature sequence056 14 262 gene locus_tag LOCUS_5780 14 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 596 669 gene locus_tag LOCUS_t0150 596 669 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 706 1050 gene locus_tag LOCUS_5790 706 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 1089 1877 gene locus_tag LOCUS_5800 1089 1877 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861405.1 protein_id gnl|my_center|LOCUS_5800 2036 2863 gene locus_tag LOCUS_5810 2036 2863 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_5810 2949 3359 gene locus_tag LOCUS_5820 2949 3359 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_5820 3464 4237 gene locus_tag LOCUS_5830 3464 4237 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_5830 5542 4361 gene locus_tag LOCUS_5840 5542 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 >Feature sequence057 181 107 gene locus_tag LOCUS_t0160 181 107 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 260 186 gene locus_tag LOCUS_t0170 260 186 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 473 826 gene locus_tag LOCUS_5850 473 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 886 1335 gene locus_tag LOCUS_5860 886 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 1451 4051 gene locus_tag LOCUS_5870 1451 4051 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_5870 <5687 4135 gene locus_tag LOCUS_5880 <5687 4135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475586.1:ABC transporter ATP-binding protein/permease >Feature sequence058 >Feature sequence059 3148 509 gene locus_tag LOCUS_5890 3148 509 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_5890 3213 4445 gene locus_tag LOCUS_5900 3213 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 <5634 4474 gene locus_tag LOCUS_5910 <5634 4474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986179.1:VanW family protein >Feature sequence060 1459 5169 gene locus_tag LOCUS_5920 gene rpoB 1459 5169 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_5920 >Feature sequence061 676 329 gene locus_tag LOCUS_5930 676 329 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_5930 875 651 gene locus_tag LOCUS_5940 875 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 1584 973 gene locus_tag LOCUS_5950 1584 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 1947 1594 gene locus_tag LOCUS_5960 1947 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 3185 1944 gene locus_tag LOCUS_5970 gene tyrS 3185 1944 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_5970 4898 3594 gene locus_tag LOCUS_5980 gene eno 4898 3594 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_5980 >Feature sequence062 1857 409 gene locus_tag LOCUS_5990 1857 409 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_5990 4901 1854 gene locus_tag LOCUS_6000 4901 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 >Feature sequence063 1438 71 gene locus_tag LOCUS_6010 1438 71 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_6010 1647 3098 gene locus_tag LOCUS_6020 1647 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 3107 4003 gene locus_tag LOCUS_6030 3107 4003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_6030 4624 4025 gene locus_tag LOCUS_6040 4624 4025 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_6040 5240 4617 gene locus_tag LOCUS_6050 5240 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 5402 5475 gene locus_tag LOCUS_t0180 5402 5475 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 592 966 gene locus_tag LOCUS_6060 592 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6060 980 1174 gene locus_tag LOCUS_6070 gene rpmI 980 1174 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125945.1 protein_id gnl|my_center|LOCUS_6070 1188 1529 gene locus_tag LOCUS_6080 gene rplT 1188 1529 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 protein_id gnl|my_center|LOCUS_6080 1529 2263 gene locus_tag LOCUS_6090 1529 2263 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_6090 2266 3000 gene locus_tag LOCUS_6100 2266 3000 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_6100 3154 3435 gene locus_tag LOCUS_6110 3154 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6110 3562 3960 gene locus_tag LOCUS_6120 3562 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 4039 4527 gene locus_tag LOCUS_6130 gene ruvC 4039 4527 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_6130 4536 5123 gene locus_tag LOCUS_6140 gene ruvA 4536 5123 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_6140 >Feature sequence065 840 1961 gene locus_tag LOCUS_6150 840 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 2043 2957 gene locus_tag LOCUS_6160 gene lgt 2043 2957 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812530.1 protein_id gnl|my_center|LOCUS_6160 3502 3311 gene locus_tag LOCUS_6170 3502 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 3474 4229 gene locus_tag LOCUS_6180 3474 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 5001 4264 gene locus_tag LOCUS_6190 5001 4264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_6190 5169 5085 gene locus_tag LOCUS_t0190 5169 5085 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5275 5201 gene locus_tag LOCUS_t0200 5275 5201 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence066 3 782 gene locus_tag LOCUS_6200 3 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 1235 1966 gene locus_tag LOCUS_6210 1235 1966 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360173.1 protein_id gnl|my_center|LOCUS_6210 >Feature sequence067 476 60 gene locus_tag LOCUS_6220 gene ruvX 476 60 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_6220 3065 546 gene locus_tag LOCUS_6230 gene polA 3065 546 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_6230 3412 3110 gene locus_tag LOCUS_6240 3412 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 4504 3470 gene locus_tag LOCUS_6250 4504 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 4891 4505 gene locus_tag LOCUS_6260 4891 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 >Feature sequence068 544 1389 gene locus_tag LOCUS_6270 gene folD 544 1389 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_6270 1391 2221 gene locus_tag LOCUS_6280 1391 2221 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_6280 2230 2727 gene locus_tag LOCUS_6290 2230 2727 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_6290 4212 2740 gene locus_tag LOCUS_6300 4212 2740 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881134.1 protein_id gnl|my_center|LOCUS_6300 <5252 4218 gene locus_tag LOCUS_6310 <5252 4218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002468311.1:D-alanine--D-alanine ligase >Feature sequence069 1329 217 gene locus_tag LOCUS_6320 gene yqfD 1329 217 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047998.1 protein_id gnl|my_center|LOCUS_6320 1595 1332 gene locus_tag LOCUS_6330 1595 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 2158 1646 gene locus_tag LOCUS_6340 2158 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 3183 2158 gene locus_tag LOCUS_6350 gene floA 3183 2158 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_6350 4103 3282 gene locus_tag LOCUS_6360 4103 3282 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 protein_id gnl|my_center|LOCUS_6360 4437 4162 gene locus_tag LOCUS_6370 gene rpmA 4437 4162 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905747.1 protein_id gnl|my_center|LOCUS_6370 4753 4430 gene locus_tag LOCUS_6380 4753 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 5072 4764 gene locus_tag LOCUS_6390 gene rplU 5072 4764 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_6390 >Feature sequence070 1948 1190 gene locus_tag LOCUS_6400 1948 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 2080 2955 gene locus_tag LOCUS_6410 2080 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 3024 4181 gene locus_tag LOCUS_6420 3024 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 4610 4254 gene locus_tag LOCUS_6430 4610 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 5098 4631 gene locus_tag LOCUS_6440 5098 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 >Feature sequence071 636 187 gene locus_tag LOCUS_6450 636 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 2448 706 gene locus_tag LOCUS_6460 gene thrS 2448 706 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 protein_id gnl|my_center|LOCUS_6460 3477 2710 gene locus_tag LOCUS_6470 3477 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 3604 4356 gene locus_tag LOCUS_6480 3604 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 4552 4403 gene locus_tag LOCUS_6490 4552 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 >Feature sequence072 1264 140 gene locus_tag LOCUS_6500 gene dnaJ 1264 140 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_6500 3254 1428 gene locus_tag LOCUS_6510 gene dnaK 3254 1428 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_6510 3777 3259 gene locus_tag LOCUS_6520 gene grpE 3777 3259 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_6520 4770 3778 gene locus_tag LOCUS_6530 gene hrcA 4770 3778 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_6530 >Feature sequence073 720 938 gene locus_tag LOCUS_6540 720 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6540 950 2344 gene locus_tag LOCUS_6550 950 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 2408 4264 gene locus_tag LOCUS_6560 2408 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039938459.1 protein_id gnl|my_center|LOCUS_6560 4382 4306 gene locus_tag LOCUS_t0210 4382 4306 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 611 535 gene locus_tag LOCUS_t0220 611 535 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 815 2086 gene locus_tag LOCUS_6570 815 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 2182 2766 gene locus_tag LOCUS_6580 gene yihA 2182 2766 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_6580 2768 4003 gene locus_tag LOCUS_6590 2768 4003 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880115.1 protein_id gnl|my_center|LOCUS_6590 4074 4640 gene locus_tag LOCUS_6600 4074 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 >Feature sequence075 1208 2044 gene locus_tag LOCUS_6610 1208 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 2049 2561 gene locus_tag LOCUS_6620 gene pth 2049 2561 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_6620 >Feature sequence076 2422 596 gene locus_tag LOCUS_6630 2422 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 4025 2442 gene locus_tag LOCUS_6640 4025 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 >Feature sequence077 2569 698 gene locus_tag LOCUS_6650 gene mutL 2569 698 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_6650 <4597 2572 gene locus_tag LOCUS_6660 <4597 2572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965142.1:DNA mismatch repair protein MutS >Feature sequence078 1395 313 gene locus_tag LOCUS_6670 1395 313 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_6670 1506 2609 gene locus_tag LOCUS_6680 1506 2609 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438374.1 protein_id gnl|my_center|LOCUS_6680 3083 2661 gene locus_tag LOCUS_6690 3083 2661 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_6690 3629 3126 gene locus_tag LOCUS_6700 gene greA 3629 3126 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596757.1 protein_id gnl|my_center|LOCUS_6700 4270 3839 gene locus_tag LOCUS_6710 4270 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 >Feature sequence079 2264 1659 gene locus_tag LOCUS_6720 2264 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 3299 2448 gene locus_tag LOCUS_6730 3299 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6730 4452 3367 gene locus_tag LOCUS_6740 4452 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6740 >Feature sequence080 687 121 gene locus_tag LOCUS_6750 687 121 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010664.1 protein_id gnl|my_center|LOCUS_6750 1395 796 gene locus_tag LOCUS_6760 gene cwlD 1395 796 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_6760 1636 2718 gene locus_tag LOCUS_6770 1636 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 2836 3417 gene locus_tag LOCUS_6780 2836 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 3478 4164 gene locus_tag LOCUS_6790 3478 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 4275 4365 gene locus_tag LOCUS_t0230 4275 4365 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 <1 1454 gene locus_tag LOCUS_6800 <1 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011166393.1:DUF853 family protein >Feature sequence082 <1 701 gene locus_tag LOCUS_6810 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001230819.1:NAD-dependent epimerase/dehydratase family protein 716 1636 gene locus_tag LOCUS_6820 716 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6820 2447 2782 gene locus_tag LOCUS_6830 2447 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6830 >Feature sequence083 3750 2410 gene locus_tag LOCUS_6840 3750 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 >Feature sequence084 1146 433 gene locus_tag LOCUS_6850 1146 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 2300 1143 gene locus_tag LOCUS_6860 2300 1143 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 protein_id gnl|my_center|LOCUS_6860 3702 2413 gene locus_tag LOCUS_6870 gene glmM 3702 2413 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521495.1 protein_id gnl|my_center|LOCUS_6870 <4232 3713 gene locus_tag LOCUS_6880 <4232 3713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048387.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence085 1585 1301 gene locus_tag LOCUS_6890 1585 1301 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_6890 1846 2526 gene locus_tag LOCUS_6900 1846 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6900 3229 2555 gene locus_tag LOCUS_6910 3229 2555 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_6910 4006 3242 gene locus_tag LOCUS_6920 4006 3242 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898387.1 protein_id gnl|my_center|LOCUS_6920 >Feature sequence086 427 29 gene locus_tag LOCUS_6930 427 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 1143 424 gene locus_tag LOCUS_6940 1143 424 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_6940 2728 1181 gene locus_tag LOCUS_6950 gene spoVB 2728 1181 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_6950 2790 2945 gene locus_tag LOCUS_6960 2790 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6960 3405 2938 gene locus_tag LOCUS_6970 3405 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 >Feature sequence087 1707 583 gene locus_tag LOCUS_6980 gene miaB 1707 583 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_6980 1836 4058 gene locus_tag LOCUS_6990 1836 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 >Feature sequence088 735 514 gene locus_tag LOCUS_7000 735 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 1861 785 gene locus_tag LOCUS_7010 gene mnmA 1861 785 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_7010 2448 1858 gene locus_tag LOCUS_7020 2448 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 3893 2505 gene locus_tag LOCUS_7030 3893 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7030 >Feature sequence089 141 398 gene locus_tag LOCUS_7040 141 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 530 847 gene locus_tag LOCUS_7050 530 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323447.1 protein_id gnl|my_center|LOCUS_7050 1043 1186 gene locus_tag LOCUS_7060 1043 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7060 1226 1489 gene locus_tag LOCUS_7070 1226 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 1683 2033 gene locus_tag LOCUS_7080 1683 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 2236 2664 gene locus_tag LOCUS_7090 2236 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7090 2791 3192 gene locus_tag LOCUS_7100 2791 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 3329 3670 gene locus_tag LOCUS_7110 3329 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 >Feature sequence090 1443 259 gene locus_tag LOCUS_7120 1443 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 2062 1469 gene locus_tag LOCUS_7130 2062 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 2690 2049 gene locus_tag LOCUS_7140 2690 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 3023 2709 gene locus_tag LOCUS_7150 3023 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 >Feature sequence091 1563 484 gene locus_tag LOCUS_7160 1563 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 2098 1655 gene locus_tag LOCUS_7170 2098 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7170 3616 2666 gene locus_tag LOCUS_7180 3616 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7180 >Feature sequence092 40 462 gene locus_tag LOCUS_7190 40 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 462 1157 gene locus_tag LOCUS_7200 462 1157 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_7200 1284 2651 gene locus_tag LOCUS_7210 1284 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7210 2756 3514 gene locus_tag LOCUS_7220 2756 3514 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_7220 >Feature sequence093 >Feature sequence094 68 1174 gene locus_tag LOCUS_7230 68 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 1397 2194 gene locus_tag LOCUS_7240 1397 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7240 2268 2414 gene locus_tag LOCUS_7250 gene scfA 2268 2414 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_7250 >Feature sequence095 256 471 gene locus_tag LOCUS_7260 256 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7260 468 614 gene locus_tag LOCUS_7270 468 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 631 939 gene locus_tag LOCUS_7280 631 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7280 929 1321 gene locus_tag LOCUS_7290 929 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 1324 1728 gene locus_tag LOCUS_7300 1324 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7300 1721 1888 gene locus_tag LOCUS_7310 1721 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 1885 2181 gene locus_tag LOCUS_7320 1885 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 2160 2507 gene locus_tag LOCUS_7330 2160 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 2532 2660 gene locus_tag LOCUS_7340 2532 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 2657 2797 gene locus_tag LOCUS_7350 2657 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7350 2797 2973 gene locus_tag LOCUS_7360 2797 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 2973 3173 gene locus_tag LOCUS_7370 2973 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7370 3183 3398 gene locus_tag LOCUS_7380 3183 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 >Feature sequence096 1397 2239 gene locus_tag LOCUS_7390 1397 2239 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_7390 2239 3663 gene locus_tag LOCUS_7400 gene gltA 2239 3663 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_7400 >Feature sequence097 259 1095 gene locus_tag LOCUS_7410 gene era 259 1095 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964607.1 protein_id gnl|my_center|LOCUS_7410 1988 1122 gene locus_tag LOCUS_7420 gene murB 1988 1122 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898186.1 protein_id gnl|my_center|LOCUS_7420 2059 3408 gene locus_tag LOCUS_7430 gene murC 2059 3408 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_7430 3581 3656 gene locus_tag LOCUS_t0240 3581 3656 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 139 1449 gene locus_tag LOCUS_7440 gene der 139 1449 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_7440 1449 2291 gene locus_tag LOCUS_7450 1449 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 >Feature sequence099 1177 167 gene locus_tag LOCUS_7460 1177 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7460 1369 2427 gene locus_tag LOCUS_7470 gene tsaD 1369 2427 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_7470 >Feature sequence100 1942 815 gene locus_tag LOCUS_7480 1942 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7480 2821 2063 gene locus_tag LOCUS_7490 2821 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 <3573 2830 gene locus_tag LOCUS_7500 <3573 2830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942801.1:histidine kinase >Feature sequence101 1095 151 gene locus_tag LOCUS_7510 gene holA 1095 151 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_7510 3188 1092 gene locus_tag LOCUS_7520 3188 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7520 >Feature sequence102 2990 1173 gene locus_tag LOCUS_7530 2990 1173 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_7530 >Feature sequence103 189 458 gene locus_tag LOCUS_7540 189 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7540 2699 501 gene locus_tag LOCUS_7550 2699 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 >Feature sequence104 7 92 gene locus_tag LOCUS_t0250 7 92 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1963 206 gene locus_tag LOCUS_7560 1963 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7560 3003 1960 gene locus_tag LOCUS_7570 3003 1960 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_7570 >Feature sequence105 1539 2990 gene locus_tag LOCUS_7580 gene cls 1539 2990 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722636.1 protein_id gnl|my_center|LOCUS_7580 3150 3226 gene locus_tag LOCUS_t0260 3150 3226 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 103 1935 gene locus_tag LOCUS_7590 gene typA 103 1935 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_7590 1939 2208 gene locus_tag LOCUS_7600 1939 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7600 >Feature sequence107 <1 873 gene locus_tag LOCUS_7610 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048087.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 925 2055 gene locus_tag LOCUS_7620 gene tgt 925 2055 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_7620 >Feature sequence108 19 882 gene locus_tag LOCUS_7630 19 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7630 1364 903 gene locus_tag LOCUS_7640 1364 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 1542 1961 gene locus_tag LOCUS_7650 1542 1961 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021612.1 protein_id gnl|my_center|LOCUS_7650 2043 2879 gene locus_tag LOCUS_7660 2043 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7660 3206 2910 gene locus_tag LOCUS_7670 3206 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7670 >Feature sequence109 >Feature sequence110 196 272 gene locus_tag LOCUS_t0270 196 272 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1332 445 gene locus_tag LOCUS_7680 1332 445 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_7680 1606 1484 gene locus_tag LOCUS_7690 1606 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7690 <3082 1686 gene locus_tag LOCUS_7700 <3082 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921188.1:arginine--tRNA ligase >Feature sequence111 1373 1167 gene locus_tag LOCUS_7710 1373 1167 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867752.1 protein_id gnl|my_center|LOCUS_7710 1708 1373 gene locus_tag LOCUS_7720 1708 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 2615 1812 gene locus_tag LOCUS_7730 2615 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 2773 2692 gene locus_tag LOCUS_t0280 2773 2692 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 <1 778 gene locus_tag LOCUS_7740 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965382.1:exodeoxyribonuclease VII large subunit 768 2477 gene locus_tag LOCUS_7750 768 2477 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207562.1 protein_id gnl|my_center|LOCUS_7750 2470 2676 gene locus_tag LOCUS_7760 2470 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7760 >Feature sequence113 2098 1394 gene locus_tag LOCUS_7770 2098 1394 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_7770 2937 2083 gene locus_tag LOCUS_7780 2937 2083 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_7780 >Feature sequence114 1937 2665 gene locus_tag LOCUS_7790 1937 2665 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531770.1 protein_id gnl|my_center|LOCUS_7790 >Feature sequence115 673 431 gene locus_tag LOCUS_7800 673 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7800 995 594 gene locus_tag LOCUS_7810 995 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7810 1212 2687 gene locus_tag LOCUS_7820 1212 2687 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_7820 >Feature sequence116 582 358 gene locus_tag LOCUS_7830 582 358 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_7830 721 1404 gene locus_tag LOCUS_7840 721 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7840 >Feature sequence117 >Feature sequence118 993 169 gene locus_tag LOCUS_7850 993 169 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356900.1 protein_id gnl|my_center|LOCUS_7850 1581 1006 gene locus_tag LOCUS_7860 gene rfbC 1581 1006 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_7860 <2720 1819 gene locus_tag LOCUS_7870 <2720 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942917.1:NlpC/P60 family protein >Feature sequence119 674 105 gene locus_tag LOCUS_7880 674 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7880 <2666 786 gene locus_tag LOCUS_7890 <2666 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002505512.1:type IV secretory system conjugative DNA transfer family protein >Feature sequence120 2544 133 gene locus_tag LOCUS_7900 gene leuS 2544 133 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475758.1 protein_id gnl|my_center|LOCUS_7900 >Feature sequence121 <1 637 gene locus_tag LOCUS_7910 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965426.1:phospho-N-acetylmuramoyl-pentapeptide-transferase 634 1947 gene locus_tag LOCUS_7920 gene murD 634 1947 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_7920 >Feature sequence122 115 702 gene locus_tag LOCUS_7930 115 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7930 >Feature sequence123 236 45 gene locus_tag LOCUS_7940 236 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 890 309 gene locus_tag LOCUS_7950 890 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_7950 1710 868 gene locus_tag LOCUS_7960 1710 868 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449069.1 protein_id gnl|my_center|LOCUS_7960 >Feature sequence124 761 78 gene locus_tag LOCUS_7970 761 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7970 1352 876 gene locus_tag LOCUS_7980 1352 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7980 1827 1372 gene locus_tag LOCUS_7990 1827 1372 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_7990 >Feature sequence125 <1 2318 gene locus_tag LOCUS_8000 <1 2318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033492290.1:GIY-YIG nuclease family protein >Feature sequence126 1046 321 gene locus_tag LOCUS_8010 gene sigF 1046 321 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_8010 1491 1039 gene locus_tag LOCUS_8020 gene spoIIAB 1491 1039 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_8020 1809 1501 gene locus_tag LOCUS_8030 gene spoIIAA 1809 1501 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_8030 2019 2094 gene locus_tag LOCUS_t0290 2019 2094 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2112 2188 gene locus_tag LOCUS_t0300 2112 2188 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2233 2309 gene locus_tag LOCUS_t0310 2233 2309 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 373 1029 gene locus_tag LOCUS_8040 373 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8040 1755 1961 gene locus_tag LOCUS_8050 1755 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8050 >Feature sequence128 1818 817 gene locus_tag LOCUS_8060 1818 817 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_8060 >Feature sequence129 1431 238 gene locus_tag LOCUS_8070 1431 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 1727 1446 gene locus_tag LOCUS_8080 1727 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8080 1978 1850 gene locus_tag LOCUS_8090 1978 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8090 >Feature sequence130 1236 790 gene locus_tag LOCUS_8100 gene spoVAC 1236 790 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004728.1 protein_id gnl|my_center|LOCUS_8100 >Feature sequence131 142 558 gene locus_tag LOCUS_8110 142 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8110 688 1173 gene locus_tag LOCUS_8120 688 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8120 1193 1399 gene locus_tag LOCUS_8130 1193 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8130 >Feature sequence132 <1 783 gene locus_tag LOCUS_8140 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000688057.1:dipeptidase 1136 1061 gene locus_tag LOCUS_t0320 1136 1061 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence133 647 378 gene locus_tag LOCUS_8150 647 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8150 1089 661 gene locus_tag LOCUS_8160 1089 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8160 1620 1520 gene locus_tag LOCUS_r0010 1620 1520 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence134