>Feature sequence001 1552 278 gene locus_tag LOCUS_00010 1552 278 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_00010 2182 1553 gene locus_tag LOCUS_00020 2182 1553 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_00020 2679 2185 gene locus_tag LOCUS_00030 gene hacB 2679 2185 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_00030 4273 2765 gene locus_tag LOCUS_00040 4273 2765 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_00040 4408 4971 gene locus_tag LOCUS_00050 4408 4971 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_00050 5990 4968 gene locus_tag LOCUS_00060 5990 4968 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876467.1 protein_id gnl|my_center|LOCUS_00060 7082 5994 gene locus_tag LOCUS_00070 7082 5994 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_00070 8388 7066 gene locus_tag LOCUS_00080 gene wecB 8388 7066 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_00080 8736 8410 gene locus_tag LOCUS_00090 8736 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9620 8745 gene locus_tag LOCUS_00100 gene truA 9620 8745 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_00100 10678 10172 gene locus_tag LOCUS_00110 10678 10172 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892518.1 protein_id gnl|my_center|LOCUS_00110 11589 10732 gene locus_tag LOCUS_00120 11589 10732 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_00120 12571 11582 gene locus_tag LOCUS_00130 12571 11582 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_00130 14246 12624 gene locus_tag LOCUS_00140 14246 12624 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021911.1 protein_id gnl|my_center|LOCUS_00140 14583 15275 gene locus_tag LOCUS_00150 14583 15275 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860384.1 protein_id gnl|my_center|LOCUS_00150 15830 15270 gene locus_tag LOCUS_00160 15830 15270 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892518.1 protein_id gnl|my_center|LOCUS_00160 15977 16924 gene locus_tag LOCUS_00170 15977 16924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_00170 16926 17540 gene locus_tag LOCUS_00180 16926 17540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_00180 18907 17537 gene locus_tag LOCUS_00190 18907 17537 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_00190 19697 19086 gene locus_tag LOCUS_00200 19697 19086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_00200 20634 19687 gene locus_tag LOCUS_00210 20634 19687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_00210 21497 20646 gene locus_tag LOCUS_00220 21497 20646 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_00220 22485 21490 gene locus_tag LOCUS_00230 22485 21490 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_00230 24192 22558 gene locus_tag LOCUS_00240 24192 22558 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 protein_id gnl|my_center|LOCUS_00240 26928 24415 gene locus_tag LOCUS_00250 26928 24415 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_00250 27321 26947 gene locus_tag LOCUS_00260 27321 26947 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_00260 27889 27425 gene locus_tag LOCUS_00270 27889 27425 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876495.1 protein_id gnl|my_center|LOCUS_00270 28648 27926 gene locus_tag LOCUS_00280 28648 27926 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876566.1 protein_id gnl|my_center|LOCUS_00280 32102 28740 gene locus_tag LOCUS_00290 32102 28740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32784 32236 gene locus_tag LOCUS_00300 32784 32236 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_00300 33529 33254 gene locus_tag LOCUS_00310 33529 33254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35887 33569 gene locus_tag LOCUS_00320 35887 33569 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943948.1 protein_id gnl|my_center|LOCUS_00320 36666 35962 gene locus_tag LOCUS_00330 36666 35962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816854.1 protein_id gnl|my_center|LOCUS_00330 36799 37536 gene locus_tag LOCUS_00340 gene hisA 36799 37536 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060911.1 protein_id gnl|my_center|LOCUS_00340 37541 38002 gene locus_tag LOCUS_00350 37541 38002 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_00350 38015 39037 gene locus_tag LOCUS_00360 gene argC 38015 39037 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_00360 39061 39549 gene locus_tag LOCUS_00370 39061 39549 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060912.1 protein_id gnl|my_center|LOCUS_00370 39558 40028 gene locus_tag LOCUS_00380 gene pyrI 39558 40028 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_00380 41238 40033 gene locus_tag LOCUS_00390 41238 40033 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_00390 41349 42719 gene locus_tag LOCUS_00400 41349 42719 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_00400 42720 43277 gene locus_tag LOCUS_00410 42720 43277 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_00410 43287 44315 gene locus_tag LOCUS_00420 43287 44315 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876491.1 protein_id gnl|my_center|LOCUS_00420 45034 44432 gene locus_tag LOCUS_00430 45034 44432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 45371 45928 gene locus_tag LOCUS_00440 45371 45928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 46967 45957 gene locus_tag LOCUS_00450 46967 45957 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876493.1 protein_id gnl|my_center|LOCUS_00450 47042 47677 gene locus_tag LOCUS_00460 47042 47677 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876496.1 protein_id gnl|my_center|LOCUS_00460 49389 47674 gene locus_tag LOCUS_00470 gene ade 49389 47674 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_00470 50612 49392 gene locus_tag LOCUS_00480 50612 49392 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_00480 50852 51592 gene locus_tag LOCUS_00490 50852 51592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52103 51633 gene locus_tag LOCUS_00500 52103 51633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53732 52395 gene locus_tag LOCUS_00510 53732 52395 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644001.1 protein_id gnl|my_center|LOCUS_00510 54682 53816 gene locus_tag LOCUS_00520 gene speB 54682 53816 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 protein_id gnl|my_center|LOCUS_00520 55115 54720 gene locus_tag LOCUS_00530 gene eif5A 55115 54720 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_00530 55309 55767 gene locus_tag LOCUS_00540 55309 55767 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_00540 55767 57617 gene locus_tag LOCUS_00550 55767 57617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 57626 59044 gene locus_tag LOCUS_00560 gene cfbE 57626 59044 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 protein_id gnl|my_center|LOCUS_00560 59155 60024 gene locus_tag LOCUS_00570 gene hemC 59155 60024 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876507.1 protein_id gnl|my_center|LOCUS_00570 60039 60995 gene locus_tag LOCUS_00580 60039 60995 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_00580 61004 61615 gene locus_tag LOCUS_00590 61004 61615 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_00590 61714 62100 gene locus_tag LOCUS_00600 61714 62100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 62112 63041 gene locus_tag LOCUS_00610 62112 63041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876151.1 protein_id gnl|my_center|LOCUS_00610 64697 63024 gene locus_tag LOCUS_00620 64697 63024 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001793440.1 protein_id gnl|my_center|LOCUS_00620 65257 64694 gene locus_tag LOCUS_00630 65257 64694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 65679 65335 gene locus_tag LOCUS_00640 65679 65335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 66616 66053 gene locus_tag LOCUS_00650 66616 66053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66967 66677 gene locus_tag LOCUS_00660 66967 66677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 67395 67042 gene locus_tag LOCUS_00670 67395 67042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 68046 68345 gene locus_tag LOCUS_00680 68046 68345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 68338 69237 gene locus_tag LOCUS_00690 68338 69237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 69658 69260 gene locus_tag LOCUS_00700 69658 69260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 70087 69728 gene locus_tag LOCUS_00710 70087 69728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 70771 70349 gene locus_tag LOCUS_00720 70771 70349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 71402 70842 gene locus_tag LOCUS_00730 71402 70842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 71589 75107 gene locus_tag LOCUS_00740 71589 75107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 75236 75529 gene locus_tag LOCUS_00750 75236 75529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 75949 75674 gene locus_tag LOCUS_00760 75949 75674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 76209 75946 gene locus_tag LOCUS_00770 76209 75946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 77083 76928 gene locus_tag LOCUS_00780 77083 76928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 77625 77203 gene locus_tag LOCUS_00790 77625 77203 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055942.1 protein_id gnl|my_center|LOCUS_00790 79134 77830 gene locus_tag LOCUS_00800 79134 77830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 80303 79137 gene locus_tag LOCUS_00810 80303 79137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 81346 80399 gene locus_tag LOCUS_00820 81346 80399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 83496 81349 gene locus_tag LOCUS_00830 83496 81349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 85366 83498 gene locus_tag LOCUS_00840 85366 83498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 85720 85508 gene locus_tag LOCUS_00850 85720 85508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 86004 85747 gene locus_tag LOCUS_00860 86004 85747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 86304 86029 gene locus_tag LOCUS_00870 86304 86029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 89891 86904 gene locus_tag LOCUS_00880 89891 86904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 93511 90140 gene locus_tag LOCUS_00890 93511 90140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 102366 93766 gene locus_tag LOCUS_00900 102366 93766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 103134 102484 gene locus_tag LOCUS_00910 103134 102484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 103422 103207 gene locus_tag LOCUS_00920 103422 103207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 103986 103483 gene locus_tag LOCUS_00930 103986 103483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 104286 103999 gene locus_tag LOCUS_00940 104286 103999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 104677 104348 gene locus_tag LOCUS_00950 104677 104348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 105058 104765 gene locus_tag LOCUS_00960 105058 104765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 105584 105021 gene locus_tag LOCUS_00970 105584 105021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 105853 105650 gene locus_tag LOCUS_00980 105853 105650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 106094 105966 gene locus_tag LOCUS_00990 106094 105966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 106292 106098 gene locus_tag LOCUS_01000 106292 106098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 >Feature sequence002 372 548 gene locus_tag LOCUS_01010 372 548 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875895.1 protein_id gnl|my_center|LOCUS_01010 563 724 gene locus_tag LOCUS_01020 563 724 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_01020 792 1025 gene locus_tag LOCUS_01030 792 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1064 2854 gene locus_tag LOCUS_01040 gene infB 1064 2854 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_01040 2891 3274 gene locus_tag LOCUS_01050 2891 3274 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_01050 4001 4113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4141 4419 gene locus_tag LOCUS_01060 4141 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 4430 4822 gene locus_tag LOCUS_01070 4430 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875901.1 protein_id gnl|my_center|LOCUS_01070 4858 5442 gene locus_tag LOCUS_01080 gene rpoE 4858 5442 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_01080 5439 5615 gene locus_tag LOCUS_01090 5439 5615 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875904.1 protein_id gnl|my_center|LOCUS_01090 5626 6135 gene locus_tag LOCUS_01100 5626 6135 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875905.1 protein_id gnl|my_center|LOCUS_01100 6153 6485 gene locus_tag LOCUS_01110 6153 6485 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_01110 6495 6647 gene locus_tag LOCUS_01120 6495 6647 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875907.1 protein_id gnl|my_center|LOCUS_01120 6724 8145 gene locus_tag LOCUS_01130 gene argH 6724 8145 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_01130 8232 9062 gene locus_tag LOCUS_01140 8232 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 9103 9288 gene locus_tag LOCUS_01150 9103 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 10482 9466 gene locus_tag LOCUS_01160 10482 9466 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892473.1 protein_id gnl|my_center|LOCUS_01160 10581 11729 gene locus_tag LOCUS_01170 10581 11729 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106004889.1 protein_id gnl|my_center|LOCUS_01170 11754 13040 gene locus_tag LOCUS_01180 11754 13040 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_01180 13238 13026 gene locus_tag LOCUS_01190 13238 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 13586 14377 gene locus_tag LOCUS_01200 13586 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 14402 15526 gene locus_tag LOCUS_01210 14402 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 15742 16521 gene locus_tag LOCUS_01220 15742 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 16521 17318 gene locus_tag LOCUS_01230 16521 17318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 17728 17321 gene locus_tag LOCUS_01240 17728 17321 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020418.1 protein_id gnl|my_center|LOCUS_01240 17902 18717 gene locus_tag LOCUS_01250 17902 18717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 18938 19678 gene locus_tag LOCUS_01260 gene fabG 18938 19678 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176108.1 protein_id gnl|my_center|LOCUS_01260 20183 20725 gene locus_tag LOCUS_01270 gene rnhA 20183 20725 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_01270 20923 21780 gene locus_tag LOCUS_01280 20923 21780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 21901 23040 gene locus_tag LOCUS_01290 21901 23040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 22168 22216 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23115 23741 gene locus_tag LOCUS_01300 23115 23741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 23871 24731 gene locus_tag LOCUS_01310 23871 24731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 24782 24943 gene locus_tag LOCUS_01320 24782 24943 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048196713.1 protein_id gnl|my_center|LOCUS_01320 25037 25156 gene locus_tag LOCUS_01330 25037 25156 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_01330 25899 25300 gene locus_tag LOCUS_01340 25899 25300 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_01340 25967 26377 gene locus_tag LOCUS_01350 25967 26377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 27086 26394 gene locus_tag LOCUS_01360 gene arfB 27086 26394 CDS product 2-amino-5-formylamino-6-ribosylaminopyrimidin-4(3H)-one 5'-monophosphate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876289.1 protein_id gnl|my_center|LOCUS_01360 27576 27094 gene locus_tag LOCUS_01370 27576 27094 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_01370 28138 27632 gene locus_tag LOCUS_01380 28138 27632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 28457 28687 gene locus_tag LOCUS_01390 28457 28687 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_01390 28750 28938 gene locus_tag LOCUS_01400 28750 28938 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_01400 29090 29500 gene locus_tag LOCUS_01410 29090 29500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 29894 29559 gene locus_tag LOCUS_01420 29894 29559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 30031 30747 gene locus_tag LOCUS_01430 gene rncS 30031 30747 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_01430 30740 32206 gene locus_tag LOCUS_01440 30740 32206 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_01440 32236 32943 gene locus_tag LOCUS_01450 32236 32943 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208742.1 protein_id gnl|my_center|LOCUS_01450 32944 33258 gene locus_tag LOCUS_01460 32944 33258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 33698 33934 gene locus_tag LOCUS_01470 33698 33934 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876941.1 protein_id gnl|my_center|LOCUS_01470 33943 34704 gene locus_tag LOCUS_01480 33943 34704 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_01480 34893 35810 gene locus_tag LOCUS_01490 34893 35810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454245.1 protein_id gnl|my_center|LOCUS_01490 35820 36545 gene locus_tag LOCUS_01500 35820 36545 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247643.1 protein_id gnl|my_center|LOCUS_01500 37342 36767 gene locus_tag LOCUS_01510 gene pdxT 37342 36767 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875829.1 protein_id gnl|my_center|LOCUS_01510 38229 37345 gene locus_tag LOCUS_01520 gene pdxS 38229 37345 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876304.1 protein_id gnl|my_center|LOCUS_01520 38568 38840 gene locus_tag LOCUS_01530 38568 38840 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418727.1 protein_id gnl|my_center|LOCUS_01530 39009 40355 gene locus_tag LOCUS_01540 gene asnB 39009 40355 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060813.1 protein_id gnl|my_center|LOCUS_01540 40459 40674 gene locus_tag LOCUS_01550 40459 40674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 40686 41171 gene locus_tag LOCUS_01560 40686 41171 CDS product allosteric regulator of homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060814.1 protein_id gnl|my_center|LOCUS_01560 41180 42199 gene locus_tag LOCUS_01570 41180 42199 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876056.1 protein_id gnl|my_center|LOCUS_01570 42228 43439 gene locus_tag LOCUS_01580 42228 43439 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_01580 43441 44076 gene locus_tag LOCUS_01590 43441 44076 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_01590 44081 45436 gene locus_tag LOCUS_01600 44081 45436 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943751.1 protein_id gnl|my_center|LOCUS_01600 45638 45805 gene locus_tag LOCUS_01610 45638 45805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 45815 46591 gene locus_tag LOCUS_01620 45815 46591 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_01620 46612 47115 gene locus_tag LOCUS_01630 46612 47115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 47348 48880 gene locus_tag LOCUS_01640 gene pyrG 47348 48880 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 protein_id gnl|my_center|LOCUS_01640 49155 49003 gene locus_tag LOCUS_01650 49155 49003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 49214 49846 gene locus_tag LOCUS_01660 49214 49846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 49847 50272 gene locus_tag LOCUS_01670 49847 50272 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060817.1 protein_id gnl|my_center|LOCUS_01670 50351 51157 gene locus_tag LOCUS_01680 50351 51157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 51162 51842 gene locus_tag LOCUS_01690 51162 51842 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_01690 52382 51843 gene locus_tag LOCUS_01700 52382 51843 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060819.1 protein_id gnl|my_center|LOCUS_01700 53126 52389 gene locus_tag LOCUS_01710 53126 52389 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876074.1 protein_id gnl|my_center|LOCUS_01710 53506 53123 gene locus_tag LOCUS_01720 53506 53123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 53834 54877 gene locus_tag LOCUS_01730 53834 54877 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_01730 54879 56384 gene locus_tag LOCUS_01740 54879 56384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 57137 56379 gene locus_tag LOCUS_01750 57137 56379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 57241 58269 gene locus_tag LOCUS_01760 57241 58269 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060820.1 protein_id gnl|my_center|LOCUS_01760 58798 58313 gene locus_tag LOCUS_01770 gene tsaA 58798 58313 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_01770 59133 59339 gene locus_tag LOCUS_01780 59133 59339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01780 59367 59573 gene locus_tag LOCUS_01790 59367 59573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 59723 59589 gene locus_tag LOCUS_01800 59723 59589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 60163 59726 gene locus_tag LOCUS_01810 60163 59726 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875788.1 protein_id gnl|my_center|LOCUS_01810 60745 60212 gene locus_tag LOCUS_01820 60745 60212 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 protein_id gnl|my_center|LOCUS_01820 61464 60757 gene locus_tag LOCUS_01830 61464 60757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 61588 62253 gene locus_tag LOCUS_01840 61588 62253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 62269 62781 gene locus_tag LOCUS_01850 62269 62781 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 protein_id gnl|my_center|LOCUS_01850 62974 63501 gene locus_tag LOCUS_01860 62974 63501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875767.1 protein_id gnl|my_center|LOCUS_01860 65130 63607 gene locus_tag LOCUS_01870 65130 63607 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770801.1 protein_id gnl|my_center|LOCUS_01870 66009 65518 gene locus_tag LOCUS_01880 66009 65518 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383720.1 protein_id gnl|my_center|LOCUS_01880 67785 66103 gene locus_tag LOCUS_01890 67785 66103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 67934 68839 gene locus_tag LOCUS_01900 67934 68839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 68851 69726 gene locus_tag LOCUS_01910 68851 69726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 69751 70530 gene locus_tag LOCUS_01920 69751 70530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 70834 73089 gene locus_tag LOCUS_01930 70834 73089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 73104 75467 gene locus_tag LOCUS_01940 73104 75467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 75655 75801 gene locus_tag LOCUS_01950 75655 75801 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876192.1 protein_id gnl|my_center|LOCUS_01950 75891 76643 gene locus_tag LOCUS_01960 75891 76643 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_01960 76698 77765 gene locus_tag LOCUS_01970 76698 77765 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496958.1 protein_id gnl|my_center|LOCUS_01970 77775 79274 gene locus_tag LOCUS_01980 77775 79274 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875946.1 protein_id gnl|my_center|LOCUS_01980 79508 79861 gene locus_tag LOCUS_01990 79508 79861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 79871 80263 gene locus_tag LOCUS_02000 79871 80263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 80340 80384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 80395 81630 gene locus_tag LOCUS_02010 80395 81630 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_02010 81627 84374 gene locus_tag LOCUS_02020 gene rad50 81627 84374 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846723.1 protein_id gnl|my_center|LOCUS_02020 84796 84401 gene locus_tag LOCUS_02030 84796 84401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 84912 86195 gene locus_tag LOCUS_02040 84912 86195 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876171.1 protein_id gnl|my_center|LOCUS_02040 86263 87453 gene locus_tag LOCUS_02050 86263 87453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296325.1 protein_id gnl|my_center|LOCUS_02050 87478 88092 gene locus_tag LOCUS_02060 87478 88092 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060837.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence003 514 245 gene locus_tag LOCUS_02070 514 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 565 969 gene locus_tag LOCUS_02080 565 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 1353 4823 gene locus_tag LOCUS_02090 1353 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 4930 5202 gene locus_tag LOCUS_02100 4930 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5680 6396 gene locus_tag LOCUS_02110 5680 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6695 8563 gene locus_tag LOCUS_02120 6695 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 8987 9355 gene locus_tag LOCUS_02130 8987 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 14869 9707 gene locus_tag LOCUS_02140 14869 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 17051 14880 gene locus_tag LOCUS_02150 17051 14880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 18918 17257 gene locus_tag LOCUS_02160 18918 17257 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061109.1 protein_id gnl|my_center|LOCUS_02160 20879 18954 gene locus_tag LOCUS_02170 20879 18954 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061138.1 protein_id gnl|my_center|LOCUS_02170 23389 20960 gene locus_tag LOCUS_02180 23389 20960 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860926.1 protein_id gnl|my_center|LOCUS_02180 25877 23376 gene locus_tag LOCUS_02190 25877 23376 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_02190 25958 26536 gene locus_tag LOCUS_02200 gene tmk 25958 26536 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877367.1 protein_id gnl|my_center|LOCUS_02200 26542 27090 gene locus_tag LOCUS_02210 26542 27090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020871.1 protein_id gnl|my_center|LOCUS_02210 28087 27080 gene locus_tag LOCUS_02220 gene mtaA 28087 27080 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_02220 29690 28077 gene locus_tag LOCUS_02230 29690 28077 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065863.1 protein_id gnl|my_center|LOCUS_02230 30524 29697 gene locus_tag LOCUS_02240 gene mtaC 30524 29697 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021627.1 protein_id gnl|my_center|LOCUS_02240 31921 30536 gene locus_tag LOCUS_02250 gene mtaB 31921 30536 CDS product methanol--corrinoid protein co-methyltransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024271.1 protein_id gnl|my_center|LOCUS_02250 33354 32416 gene locus_tag LOCUS_02260 gene mtrH 33354 32416 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_02260 34091 33882 gene locus_tag LOCUS_02270 34091 33882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 35054 34092 gene locus_tag LOCUS_02280 35054 34092 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877369.1 protein_id gnl|my_center|LOCUS_02280 36070 35063 gene locus_tag LOCUS_02290 36070 35063 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 protein_id gnl|my_center|LOCUS_02290 36361 36140 gene locus_tag LOCUS_02300 36361 36140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 38603 36600 gene locus_tag LOCUS_02310 38603 36600 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_02310 38742 39161 gene locus_tag LOCUS_02320 38742 39161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 39787 39158 gene locus_tag LOCUS_02330 gene rrmJ 39787 39158 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_02330 40319 39789 gene locus_tag LOCUS_02340 40319 39789 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_02340 40648 41739 gene locus_tag LOCUS_02350 40648 41739 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 protein_id gnl|my_center|LOCUS_02350 42208 41756 gene locus_tag LOCUS_02360 42208 41756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 42594 42226 gene locus_tag LOCUS_02370 42594 42226 CDS product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061141.1 protein_id gnl|my_center|LOCUS_02370 45259 42662 gene locus_tag LOCUS_02380 45259 42662 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_02380 45545 45673 gene locus_tag LOCUS_02390 45545 45673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02390 45728 46315 gene locus_tag LOCUS_02400 45728 46315 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02400 46389 47237 gene locus_tag LOCUS_02410 46389 47237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 48065 47229 gene locus_tag LOCUS_02420 48065 47229 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_02420 48809 48111 gene locus_tag LOCUS_02430 48809 48111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 48891 49370 gene locus_tag LOCUS_02440 48891 49370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 50149 49367 gene locus_tag LOCUS_02450 gene nucS 50149 49367 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061145.1 protein_id gnl|my_center|LOCUS_02450 50423 51223 gene locus_tag LOCUS_02460 50423 51223 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877422.1 protein_id gnl|my_center|LOCUS_02460 51225 51500 gene locus_tag LOCUS_02470 51225 51500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892859.1 protein_id gnl|my_center|LOCUS_02470 51583 52572 gene locus_tag LOCUS_02480 51583 52572 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089417.1 protein_id gnl|my_center|LOCUS_02480 53513 52596 gene locus_tag LOCUS_02490 gene nadA 53513 52596 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_02490 54294 53506 gene locus_tag LOCUS_02500 54294 53506 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877432.1 protein_id gnl|my_center|LOCUS_02500 55201 54299 gene locus_tag LOCUS_02510 gene rnz 55201 54299 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_02510 55273 56094 gene locus_tag LOCUS_02520 gene nadC 55273 56094 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979217.1 protein_id gnl|my_center|LOCUS_02520 57614 56097 gene locus_tag LOCUS_02530 57614 56097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 57936 59018 gene locus_tag LOCUS_02540 gene carA 57936 59018 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060942.1 protein_id gnl|my_center|LOCUS_02540 59036 62212 gene locus_tag LOCUS_02550 gene carB 59036 62212 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_02550 62844 62230 gene locus_tag LOCUS_02560 62844 62230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 62938 64092 gene locus_tag LOCUS_02570 62938 64092 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_02570 64135 64557 gene locus_tag LOCUS_02580 64135 64557 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876624.1 protein_id gnl|my_center|LOCUS_02580 64600 65439 gene locus_tag LOCUS_02590 64600 65439 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_02590 65450 65905 gene locus_tag LOCUS_02600 65450 65905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 66699 66037 gene locus_tag LOCUS_02610 66699 66037 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_02610 67907 66705 gene locus_tag LOCUS_02620 67907 66705 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_02620 68603 67911 gene locus_tag LOCUS_02630 68603 67911 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_02630 68602 69621 gene locus_tag LOCUS_02640 68602 69621 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485766.1 protein_id gnl|my_center|LOCUS_02640 69679 69900 gene locus_tag LOCUS_02650 69679 69900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 70076 70846 gene locus_tag LOCUS_02660 70076 70846 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262657.1 protein_id gnl|my_center|LOCUS_02660 72060 70867 gene locus_tag LOCUS_02670 gene cytX 72060 70867 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705129.1 protein_id gnl|my_center|LOCUS_02670 73190 72222 gene locus_tag LOCUS_02680 73190 72222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence004 283 990 gene locus_tag LOCUS_02690 283 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 2423 987 gene locus_tag LOCUS_02700 2423 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 2586 3554 gene locus_tag LOCUS_02710 2586 3554 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881122.1 protein_id gnl|my_center|LOCUS_02710 3721 4206 gene locus_tag LOCUS_02720 3721 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4209 4652 gene locus_tag LOCUS_02730 4209 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4940 4665 gene locus_tag LOCUS_02740 4940 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5137 4946 gene locus_tag LOCUS_02750 5137 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 5437 6438 gene locus_tag LOCUS_02760 gene msrB 5437 6438 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462050.1 protein_id gnl|my_center|LOCUS_02760 6444 6842 gene locus_tag LOCUS_02770 6444 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7813 6839 gene locus_tag LOCUS_02780 7813 6839 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250971.1 protein_id gnl|my_center|LOCUS_02780 9170 7839 gene locus_tag LOCUS_02790 9170 7839 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_02790 9246 9872 gene locus_tag LOCUS_02800 9246 9872 CDS product CatA-like O-acetyltransferase, family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705203.1 protein_id gnl|my_center|LOCUS_02800 10104 9877 gene locus_tag LOCUS_02810 10104 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 10554 10204 gene locus_tag LOCUS_02820 10554 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 10914 10585 gene locus_tag LOCUS_02830 10914 10585 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_02830 11539 11057 gene locus_tag LOCUS_02840 11539 11057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 12235 11546 gene locus_tag LOCUS_02850 gene npdG 12235 11546 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_02850 12795 12244 gene locus_tag LOCUS_02860 12795 12244 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004289236.1 protein_id gnl|my_center|LOCUS_02860 13176 12832 gene locus_tag LOCUS_02870 13176 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 14645 13293 gene locus_tag LOCUS_02880 gene cca 14645 13293 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_02880 15207 14650 gene locus_tag LOCUS_02890 gene thpR 15207 14650 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_02890 16348 15218 gene locus_tag LOCUS_02900 16348 15218 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_02900 17149 16358 gene locus_tag LOCUS_02910 17149 16358 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_02910 17773 17360 gene locus_tag LOCUS_02920 17773 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 18681 17824 gene locus_tag LOCUS_02930 18681 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 19305 18790 gene locus_tag LOCUS_02940 19305 18790 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876217.1 protein_id gnl|my_center|LOCUS_02940 20143 19298 gene locus_tag LOCUS_02950 20143 19298 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892274.1 protein_id gnl|my_center|LOCUS_02950 20913 20407 gene locus_tag LOCUS_02960 20913 20407 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_02960 22312 21089 gene locus_tag LOCUS_02970 22312 21089 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060773.1 protein_id gnl|my_center|LOCUS_02970 22453 23064 gene locus_tag LOCUS_02980 22453 23064 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060848.1 protein_id gnl|my_center|LOCUS_02980 23864 23172 gene locus_tag LOCUS_02990 23864 23172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 24367 23870 gene locus_tag LOCUS_03000 24367 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 25157 24489 gene locus_tag LOCUS_03010 25157 24489 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875874.1 protein_id gnl|my_center|LOCUS_03010 26161 25166 gene locus_tag LOCUS_03020 26161 25166 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060851.1 protein_id gnl|my_center|LOCUS_03020 26686 26216 gene locus_tag LOCUS_03030 26686 26216 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060850.1 protein_id gnl|my_center|LOCUS_03030 28271 26694 gene locus_tag LOCUS_03040 28271 26694 CDS product DUF530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876227.1 protein_id gnl|my_center|LOCUS_03040 30275 28284 gene locus_tag LOCUS_03050 gene metG 30275 28284 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876226.1 protein_id gnl|my_center|LOCUS_03050 30596 31927 gene locus_tag LOCUS_03060 gene priL 30596 31927 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876225.1 protein_id gnl|my_center|LOCUS_03060 32412 32131 gene locus_tag LOCUS_03070 32412 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 32387 33901 gene locus_tag LOCUS_03080 32387 33901 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889552.1 protein_id gnl|my_center|LOCUS_03080 34439 33924 gene locus_tag LOCUS_03090 34439 33924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 34635 34498 gene locus_tag LOCUS_03100 34635 34498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 34971 34645 gene locus_tag LOCUS_03110 34971 34645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 35136 35258 gene locus_tag LOCUS_03120 35136 35258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 35349 36326 gene locus_tag LOCUS_03130 gene priS 35349 36326 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061231.1 protein_id gnl|my_center|LOCUS_03130 36328 36585 gene locus_tag LOCUS_03140 36328 36585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 37168 36593 gene locus_tag LOCUS_03150 37168 36593 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060967.1 protein_id gnl|my_center|LOCUS_03150 38314 37196 gene locus_tag LOCUS_03160 gene cofH 38314 37196 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060905.1 protein_id gnl|my_center|LOCUS_03160 38516 39007 gene locus_tag LOCUS_03170 gene comD 38516 39007 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_03170 39012 39551 gene locus_tag LOCUS_03180 gene comE 39012 39551 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876831.1 protein_id gnl|my_center|LOCUS_03180 39640 39903 gene locus_tag LOCUS_03190 39640 39903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence005 584 177 gene locus_tag LOCUS_03200 584 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 2876 861 gene locus_tag LOCUS_03210 2876 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3387 2887 gene locus_tag LOCUS_03220 3387 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3983 3420 gene locus_tag LOCUS_03230 3983 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4152 4018 gene locus_tag LOCUS_03240 4152 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4370 4149 gene locus_tag LOCUS_03250 4370 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4692 4351 gene locus_tag LOCUS_03260 4692 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 5001 4843 gene locus_tag LOCUS_03270 5001 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 5235 5050 gene locus_tag LOCUS_03280 5235 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 5936 6430 gene locus_tag LOCUS_03290 5936 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 7841 6708 gene locus_tag LOCUS_03300 7841 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 7948 8295 gene locus_tag LOCUS_03310 7948 8295 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870247.1 protein_id gnl|my_center|LOCUS_03310 9246 8317 gene locus_tag LOCUS_03320 9246 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 9451 9717 gene locus_tag LOCUS_03330 9451 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 9742 11889 gene locus_tag LOCUS_03340 9742 11889 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_03340 11977 12726 gene locus_tag LOCUS_03350 11977 12726 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_03350 12736 13488 gene locus_tag LOCUS_03360 12736 13488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_03360 14259 13525 gene locus_tag LOCUS_03370 gene thiD 14259 13525 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876253.1 protein_id gnl|my_center|LOCUS_03370 14934 14260 gene locus_tag LOCUS_03380 gene cofC 14934 14260 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_03380 16342 14942 gene locus_tag LOCUS_03390 gene proS 16342 14942 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 protein_id gnl|my_center|LOCUS_03390 16511 17554 gene locus_tag LOCUS_03400 16511 17554 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_03400 17555 17992 gene locus_tag LOCUS_03410 17555 17992 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 protein_id gnl|my_center|LOCUS_03410 17993 18679 gene locus_tag LOCUS_03420 gene rpiA 17993 18679 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_03420 18688 18912 gene locus_tag LOCUS_03430 18688 18912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 21968 19011 gene locus_tag LOCUS_03440 21968 19011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 22300 24045 gene locus_tag LOCUS_03450 22300 24045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 24108 24512 gene locus_tag LOCUS_03460 24108 24512 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876409.1 protein_id gnl|my_center|LOCUS_03460 26329 24671 gene locus_tag LOCUS_03470 gene pheT 26329 24671 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 protein_id gnl|my_center|LOCUS_03470 26708 26352 gene locus_tag LOCUS_03480 26708 26352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 26865 29579 gene locus_tag LOCUS_03490 gene valS 26865 29579 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_03490 30174 29572 gene locus_tag LOCUS_03500 30174 29572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 30804 32126 gene locus_tag LOCUS_03510 gene aroA 30804 32126 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_03510 32119 32748 gene locus_tag LOCUS_03520 32119 32748 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_03520 32903 33850 gene locus_tag LOCUS_03530 gene cysK 32903 33850 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_03530 33910 34614 gene locus_tag LOCUS_03540 gene cysE 33910 34614 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_03540 34626 35006 gene locus_tag LOCUS_03550 34626 35006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 35085 35156 gene locus_tag LOCUS_t00010 35085 35156 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 35189 36535 gene locus_tag LOCUS_03560 gene cysS 35189 36535 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence006 694 1287 gene locus_tag LOCUS_03570 694 1287 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061000.1 protein_id gnl|my_center|LOCUS_03570 1284 1799 gene locus_tag LOCUS_03580 1284 1799 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_03580 1796 2497 gene locus_tag LOCUS_03590 1796 2497 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_03590 2561 3496 gene locus_tag LOCUS_03600 2561 3496 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 protein_id gnl|my_center|LOCUS_03600 3519 4319 gene locus_tag LOCUS_03610 3519 4319 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_03610 4457 5158 gene locus_tag LOCUS_03620 gene pheA 4457 5158 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_03620 5220 5948 gene locus_tag LOCUS_03630 5220 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5968 6507 gene locus_tag LOCUS_03640 5968 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6530 7042 gene locus_tag LOCUS_03650 6530 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03650 7074 7688 gene locus_tag LOCUS_03660 7074 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03660 13228 8858 gene locus_tag LOCUS_03670 13228 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 13947 13306 gene locus_tag LOCUS_03680 13947 13306 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_03680 15102 13951 gene locus_tag LOCUS_03690 15102 13951 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876838.1 protein_id gnl|my_center|LOCUS_03690 15222 15761 gene locus_tag LOCUS_03700 15222 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 15786 16697 gene locus_tag LOCUS_03710 15786 16697 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 protein_id gnl|my_center|LOCUS_03710 16701 17501 gene locus_tag LOCUS_03720 16701 17501 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061285.1 protein_id gnl|my_center|LOCUS_03720 17517 18539 gene locus_tag LOCUS_03730 17517 18539 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876835.1 protein_id gnl|my_center|LOCUS_03730 18540 20330 gene locus_tag LOCUS_03740 gene polB1 18540 20330 CDS product DNA polymerase PolB subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876832.1 protein_id gnl|my_center|LOCUS_03740 23146 20354 gene locus_tag LOCUS_03750 23146 20354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 25371 23356 gene locus_tag LOCUS_03760 25371 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 27486 25411 gene locus_tag LOCUS_03770 27486 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 28676 27648 gene locus_tag LOCUS_03780 gene comC 28676 27648 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_03780 29723 28704 gene locus_tag LOCUS_03790 gene purM 29723 28704 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_03790 31754 29841 gene locus_tag LOCUS_03800 31754 29841 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_03800 32498 31884 gene locus_tag LOCUS_03810 gene psmB 32498 31884 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_03810 32715 33425 gene locus_tag LOCUS_03820 32715 33425 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_03820 34500 33412 gene locus_tag LOCUS_03830 gene cofG 34500 33412 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496498.1 protein_id gnl|my_center|LOCUS_03830 34943 34503 gene locus_tag LOCUS_03840 34943 34503 CDS product DUF2120 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061284.1 protein_id gnl|my_center|LOCUS_03840 35902 34955 gene locus_tag LOCUS_03850 gene mptA 35902 34955 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876820.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence007 56 454 gene locus_tag LOCUS_03860 56 454 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 protein_id gnl|my_center|LOCUS_03860 426 1340 gene locus_tag LOCUS_03870 426 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 1427 1909 gene locus_tag LOCUS_03880 gene cfbA 1427 1909 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061042.1 protein_id gnl|my_center|LOCUS_03880 1975 2898 gene locus_tag LOCUS_03890 gene thiL 1975 2898 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877008.1 protein_id gnl|my_center|LOCUS_03890 2885 3757 gene locus_tag LOCUS_03900 gene amrS 2885 3757 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877007.1 protein_id gnl|my_center|LOCUS_03900 5049 3793 gene locus_tag LOCUS_03910 5049 3793 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_03910 6082 5057 gene locus_tag LOCUS_03920 gene purE 6082 5057 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061041.1 protein_id gnl|my_center|LOCUS_03920 8296 6143 gene locus_tag LOCUS_03930 8296 6143 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_03930 8455 10149 gene locus_tag LOCUS_03940 8455 10149 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877004.1 protein_id gnl|my_center|LOCUS_03940 11123 10185 gene locus_tag LOCUS_03950 11123 10185 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877003.1 protein_id gnl|my_center|LOCUS_03950 11547 11131 gene locus_tag LOCUS_03960 gene ribH 11547 11131 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_03960 12693 11686 gene locus_tag LOCUS_03970 12693 11686 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_03970 13147 12668 gene locus_tag LOCUS_03980 13147 12668 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 protein_id gnl|my_center|LOCUS_03980 14397 13153 gene locus_tag LOCUS_03990 gene hacA 14397 13153 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_03990 14497 15720 gene locus_tag LOCUS_04000 14497 15720 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201963.1 protein_id gnl|my_center|LOCUS_04000 16958 15717 gene locus_tag LOCUS_04010 gene cap8O 16958 15717 CDS product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 protein_id gnl|my_center|LOCUS_04010 17034 17873 gene locus_tag LOCUS_04020 gene rfbD 17034 17873 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_04020 17870 18322 gene locus_tag LOCUS_04030 17870 18322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 18327 18560 gene locus_tag LOCUS_04040 18327 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 18609 19481 gene locus_tag LOCUS_04050 gene rfbA 18609 19481 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_04050 19483 20040 gene locus_tag LOCUS_04060 gene rfbC 19483 20040 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_04060 20052 21059 gene locus_tag LOCUS_04070 gene rfbB 20052 21059 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_04070 21412 21678 gene locus_tag LOCUS_04080 21412 21678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 21689 21970 gene locus_tag LOCUS_04090 21689 21970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 21988 23079 gene locus_tag LOCUS_04100 21988 23079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 23081 24040 gene locus_tag LOCUS_04110 23081 24040 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446968.1 protein_id gnl|my_center|LOCUS_04110 24042 25001 gene locus_tag LOCUS_04120 24042 25001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 25015 25872 gene locus_tag LOCUS_04130 25015 25872 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965618.1 protein_id gnl|my_center|LOCUS_04130 25922 27325 gene locus_tag LOCUS_04140 25922 27325 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_04140 27479 30100 gene locus_tag LOCUS_04150 27479 30100 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115891889.1 protein_id gnl|my_center|LOCUS_04150 30124 31059 gene locus_tag LOCUS_04160 gene radA 30124 31059 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876995.1 protein_id gnl|my_center|LOCUS_04160 31567 31196 gene locus_tag LOCUS_04170 31567 31196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 32308 31667 gene locus_tag LOCUS_04180 32308 31667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 32910 32608 gene locus_tag LOCUS_04190 32910 32608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 32813 33118 gene locus_tag LOCUS_04200 32813 33118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 33725 33243 gene locus_tag LOCUS_04210 33725 33243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04210 33813 34718 gene locus_tag LOCUS_04220 33813 34718 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_04220 >Feature sequence008 2151 397 gene locus_tag LOCUS_04230 2151 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 2491 4029 gene locus_tag LOCUS_04240 2491 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 6149 4284 gene locus_tag LOCUS_04250 gene gatE 6149 4284 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876346.1 protein_id gnl|my_center|LOCUS_04250 7469 6159 gene locus_tag LOCUS_04260 gene gatD 7469 6159 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876345.1 protein_id gnl|my_center|LOCUS_04260 8924 7479 gene locus_tag LOCUS_04270 8924 7479 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_04270 10053 8938 gene locus_tag LOCUS_04280 gene vorB 10053 8938 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060884.1 protein_id gnl|my_center|LOCUS_04280 10338 10054 gene locus_tag LOCUS_04290 10338 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12021 10351 gene locus_tag LOCUS_04300 12021 10351 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_04300 12594 12043 gene locus_tag LOCUS_04310 12594 12043 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_04310 12825 13196 gene locus_tag LOCUS_04320 12825 13196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 14013 13210 gene locus_tag LOCUS_04330 14013 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 14317 14703 gene locus_tag LOCUS_04340 14317 14703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 14700 15197 gene locus_tag LOCUS_04350 14700 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061212.1 protein_id gnl|my_center|LOCUS_04350 15202 15450 gene locus_tag LOCUS_04360 15202 15450 CDS product DUF2109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060804.1 protein_id gnl|my_center|LOCUS_04360 15457 15720 gene locus_tag LOCUS_04370 15457 15720 CDS product DUF2108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892391.1 protein_id gnl|my_center|LOCUS_04370 15713 15973 gene locus_tag LOCUS_04380 15713 15973 CDS product EhaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060805.1 protein_id gnl|my_center|LOCUS_04380 15970 16563 gene locus_tag LOCUS_04390 15970 16563 CDS product DUF2106 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261153.1 protein_id gnl|my_center|LOCUS_04390 16563 17258 gene locus_tag LOCUS_04400 16563 17258 CDS product EhaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060806.1 protein_id gnl|my_center|LOCUS_04400 17268 17939 gene locus_tag LOCUS_04410 17268 17939 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060807.1 protein_id gnl|my_center|LOCUS_04410 17949 18164 gene locus_tag LOCUS_04420 17949 18164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 18174 19046 gene locus_tag LOCUS_04430 18174 19046 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876032.1 protein_id gnl|my_center|LOCUS_04430 19043 19297 gene locus_tag LOCUS_04440 19043 19297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 19306 19608 gene locus_tag LOCUS_04450 19306 19608 CDS product DUF2104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876034.1 protein_id gnl|my_center|LOCUS_04450 19618 20010 gene locus_tag LOCUS_04460 19618 20010 CDS product DUF1959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876035.1 protein_id gnl|my_center|LOCUS_04460 20051 20500 gene locus_tag LOCUS_04470 20051 20500 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876036.1 protein_id gnl|my_center|LOCUS_04470 20497 21621 gene locus_tag LOCUS_04480 20497 21621 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876037.1 protein_id gnl|my_center|LOCUS_04480 21622 22650 gene locus_tag LOCUS_04490 21622 22650 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876038.1 protein_id gnl|my_center|LOCUS_04490 22656 24014 gene locus_tag LOCUS_04500 gene mvhB 22656 24014 CDS product polyferredoxin protein MvhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876757.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04500 24019 25065 gene locus_tag LOCUS_04510 24019 25065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876041.1 protein_id gnl|my_center|LOCUS_04510 25085 25975 gene locus_tag LOCUS_04520 25085 25975 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876042.1 protein_id gnl|my_center|LOCUS_04520 25985 26917 gene locus_tag LOCUS_04530 25985 26917 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876043.1 protein_id gnl|my_center|LOCUS_04530 26951 27778 gene locus_tag LOCUS_04540 26951 27778 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060810.1 protein_id gnl|my_center|LOCUS_04540 27795 28430 gene locus_tag LOCUS_04550 27795 28430 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876045.1 protein_id gnl|my_center|LOCUS_04550 28916 29713 gene locus_tag LOCUS_04560 28916 29713 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_04560 29728 31431 gene locus_tag LOCUS_04570 29728 31431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 31549 31986 gene locus_tag LOCUS_04580 31549 31986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 32197 33282 gene locus_tag LOCUS_04590 32197 33282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 33282 33431 gene locus_tag LOCUS_04600 33282 33431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence009 551 426 gene locus_tag LOCUS_04610 551 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2488 554 gene locus_tag LOCUS_04620 2488 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2724 3740 gene locus_tag LOCUS_04630 2724 3740 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_04630 3774 4610 gene locus_tag LOCUS_04640 3774 4610 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_04640 5110 4607 gene locus_tag LOCUS_04650 5110 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6200 5127 gene locus_tag LOCUS_04660 6200 5127 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876803.1 protein_id gnl|my_center|LOCUS_04660 6304 7428 gene locus_tag LOCUS_04670 6304 7428 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060948.1 protein_id gnl|my_center|LOCUS_04670 8628 7429 gene locus_tag LOCUS_04680 gene hemA 8628 7429 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060949.1 protein_id gnl|my_center|LOCUS_04680 9245 8628 gene locus_tag LOCUS_04690 9245 8628 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060950.1 protein_id gnl|my_center|LOCUS_04690 9729 9247 gene locus_tag LOCUS_04700 9729 9247 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876645.1 protein_id gnl|my_center|LOCUS_04700 10014 10706 gene locus_tag LOCUS_04710 10014 10706 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_04710 12313 10712 gene locus_tag LOCUS_04720 gene atwA 12313 10712 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060951.1 protein_id gnl|my_center|LOCUS_04720 13118 12387 gene locus_tag LOCUS_04730 13118 12387 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876647.1 protein_id gnl|my_center|LOCUS_04730 13888 13127 gene locus_tag LOCUS_04740 13888 13127 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_04740 14814 13909 gene locus_tag LOCUS_04750 gene cofD 14814 13909 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060952.1 protein_id gnl|my_center|LOCUS_04750 15588 14824 gene locus_tag LOCUS_04760 gene cofE 15588 14824 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_04760 16250 15624 gene locus_tag LOCUS_04770 gene purO 16250 15624 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_04770 16675 16265 gene locus_tag LOCUS_04780 16675 16265 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876652.1 protein_id gnl|my_center|LOCUS_04780 17523 16684 gene locus_tag LOCUS_04790 17523 16684 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876653.1 protein_id gnl|my_center|LOCUS_04790 18225 17611 gene locus_tag LOCUS_04800 gene rnhB 18225 17611 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_04800 19344 18271 gene locus_tag LOCUS_04810 19344 18271 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_04810 19985 19347 gene locus_tag LOCUS_04820 19985 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876656.1 protein_id gnl|my_center|LOCUS_04820 20391 21086 gene locus_tag LOCUS_04830 20391 21086 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060953.1 protein_id gnl|my_center|LOCUS_04830 21144 22301 gene locus_tag LOCUS_04840 21144 22301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 22338 23060 gene locus_tag LOCUS_04850 22338 23060 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876661.1 protein_id gnl|my_center|LOCUS_04850 23060 23431 gene locus_tag LOCUS_04860 23060 23431 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_04860 24590 23433 gene locus_tag LOCUS_04870 gene mfnA 24590 23433 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496377.1 protein_id gnl|my_center|LOCUS_04870 26929 24650 gene locus_tag LOCUS_04880 gene ppsA 26929 24650 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_04880 27565 27083 gene locus_tag LOCUS_04890 gene rplJ 27565 27083 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876743.1 protein_id gnl|my_center|LOCUS_04890 27752 28015 gene locus_tag LOCUS_04900 27752 28015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 28224 29273 gene locus_tag LOCUS_04910 28224 29273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 30314 29262 gene locus_tag LOCUS_04920 30314 29262 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876750.1 protein_id gnl|my_center|LOCUS_04920 30433 31689 gene locus_tag LOCUS_04930 gene pyrC 30433 31689 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060972.1 protein_id gnl|my_center|LOCUS_04930 32969 31734 gene locus_tag LOCUS_04940 gene mvhB 32969 31734 CDS product polyferredoxin protein MvhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876757.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence010 582 2075 gene locus_tag LOCUS_04950 582 2075 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 protein_id gnl|my_center|LOCUS_04950 2196 2990 gene locus_tag LOCUS_04960 2196 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3704 3045 gene locus_tag LOCUS_04970 3704 3045 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 protein_id gnl|my_center|LOCUS_04970 3960 3697 gene locus_tag LOCUS_04980 3960 3697 CDS product energy-converting hydrogenase B subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061002.1 protein_id gnl|my_center|LOCUS_04980 4969 3971 gene locus_tag LOCUS_04990 4969 3971 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876861.1 protein_id gnl|my_center|LOCUS_04990 6100 4973 gene locus_tag LOCUS_05000 6100 4973 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061003.1 protein_id gnl|my_center|LOCUS_05000 6559 6113 gene locus_tag LOCUS_05010 6559 6113 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876863.1 protein_id gnl|my_center|LOCUS_05010 7045 6560 gene locus_tag LOCUS_05020 7045 6560 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061004.1 protein_id gnl|my_center|LOCUS_05020 8452 7046 gene locus_tag LOCUS_05030 8452 7046 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 protein_id gnl|my_center|LOCUS_05030 8713 8465 gene locus_tag LOCUS_05040 8713 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876866.1 protein_id gnl|my_center|LOCUS_05040 9189 8713 gene locus_tag LOCUS_05050 9189 8713 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876867.1 protein_id gnl|my_center|LOCUS_05050 9464 9186 gene locus_tag LOCUS_05060 9464 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061006.1 protein_id gnl|my_center|LOCUS_05060 9792 9457 gene locus_tag LOCUS_05070 9792 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 11243 9789 gene locus_tag LOCUS_05080 gene ehbF 11243 9789 CDS product energy conserving hydrogenase EhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876870.1 protein_id gnl|my_center|LOCUS_05080 11622 11236 gene locus_tag LOCUS_05090 11622 11236 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 protein_id gnl|my_center|LOCUS_05090 11855 11622 gene locus_tag LOCUS_05100 11855 11622 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 protein_id gnl|my_center|LOCUS_05100 12279 11857 gene locus_tag LOCUS_05110 12279 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 12542 12276 gene locus_tag LOCUS_05120 12542 12276 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876874.1 protein_id gnl|my_center|LOCUS_05120 12894 12580 gene locus_tag LOCUS_05130 12894 12580 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876875.1 protein_id gnl|my_center|LOCUS_05130 13190 14152 gene locus_tag LOCUS_05140 13190 14152 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103809.1 protein_id gnl|my_center|LOCUS_05140 14865 14149 gene locus_tag LOCUS_05150 14865 14149 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876876.1 protein_id gnl|my_center|LOCUS_05150 15076 15558 gene locus_tag LOCUS_05160 15076 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 16383 15628 gene locus_tag LOCUS_05170 16383 15628 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061008.1 protein_id gnl|my_center|LOCUS_05170 16415 18337 gene locus_tag LOCUS_05180 16415 18337 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877242.1 protein_id gnl|my_center|LOCUS_05180 18678 19856 gene locus_tag LOCUS_05190 18678 19856 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061009.1 protein_id gnl|my_center|LOCUS_05190 22244 19923 gene locus_tag LOCUS_05200 22244 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 22361 23086 gene locus_tag LOCUS_05210 22361 23086 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_05210 23752 23036 gene locus_tag LOCUS_05220 gene sfsA 23752 23036 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963470.1 protein_id gnl|my_center|LOCUS_05220 25280 23739 gene locus_tag LOCUS_05230 25280 23739 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876880.1 protein_id gnl|my_center|LOCUS_05230 25350 26483 gene locus_tag LOCUS_05240 25350 26483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 27332 26670 gene locus_tag LOCUS_05250 gene fhcD 27332 26670 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061010.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05250 28793 27726 gene locus_tag LOCUS_05260 28793 27726 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_05260 29208 28861 gene locus_tag LOCUS_05270 29208 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 29207 30310 gene locus_tag LOCUS_05280 29207 30310 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_05280 30368 31018 gene locus_tag LOCUS_05290 30368 31018 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_05290 31690 31007 gene locus_tag LOCUS_05300 31690 31007 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_05300 32251 31844 gene locus_tag LOCUS_05310 gene hjc 32251 31844 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876892.1 protein_id gnl|my_center|LOCUS_05310 32432 32357 gene locus_tag LOCUS_t00020 32432 32357 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 32544 32461 gene locus_tag LOCUS_t00030 32544 32461 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32676 32600 gene locus_tag LOCUS_t00040 32676 32600 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 881 564 gene locus_tag LOCUS_05320 881 564 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 protein_id gnl|my_center|LOCUS_05320 1369 950 gene locus_tag LOCUS_05330 1369 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1734 1462 gene locus_tag LOCUS_05340 1734 1462 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_05340 2437 1793 gene locus_tag LOCUS_05350 2437 1793 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_05350 3165 2455 gene locus_tag LOCUS_05360 3165 2455 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261160.1 protein_id gnl|my_center|LOCUS_05360 5243 3372 gene locus_tag LOCUS_05370 5243 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 5476 6777 gene locus_tag LOCUS_05380 5476 6777 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 protein_id gnl|my_center|LOCUS_05380 6787 7218 gene locus_tag LOCUS_05390 6787 7218 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875801.1 protein_id gnl|my_center|LOCUS_05390 8298 7312 gene locus_tag LOCUS_05400 8298 7312 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 protein_id gnl|my_center|LOCUS_05400 9040 8390 gene locus_tag LOCUS_05410 9040 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876163.1 protein_id gnl|my_center|LOCUS_05410 9578 9078 gene locus_tag LOCUS_05420 9578 9078 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_05420 9661 10455 gene locus_tag LOCUS_05430 gene nudC 9661 10455 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966666.1 protein_id gnl|my_center|LOCUS_05430 11638 10475 gene locus_tag LOCUS_05440 11638 10475 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_05440 12143 11625 gene locus_tag LOCUS_05450 12143 11625 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964859.1 protein_id gnl|my_center|LOCUS_05450 13020 12238 gene locus_tag LOCUS_05460 13020 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 13386 13126 gene locus_tag LOCUS_05470 13386 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 14078 13458 gene locus_tag LOCUS_05480 14078 13458 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681344.1 protein_id gnl|my_center|LOCUS_05480 14718 14083 gene locus_tag LOCUS_05490 14718 14083 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681344.1 protein_id gnl|my_center|LOCUS_05490 15359 14727 gene locus_tag LOCUS_05500 15359 14727 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681344.1 protein_id gnl|my_center|LOCUS_05500 16776 15499 gene locus_tag LOCUS_05510 gene serS 16776 15499 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_05510 17303 16932 gene locus_tag LOCUS_05520 17303 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 17467 17709 gene locus_tag LOCUS_05530 17467 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 18242 17892 gene locus_tag LOCUS_05540 18242 17892 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_05540 18521 19267 gene locus_tag LOCUS_05550 18521 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 19953 19264 gene locus_tag LOCUS_05560 19953 19264 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202235.1 protein_id gnl|my_center|LOCUS_05560 20339 19962 gene locus_tag LOCUS_05570 20339 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 20338 20553 gene locus_tag LOCUS_05580 20338 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 21022 20651 gene locus_tag LOCUS_05590 21022 20651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 21519 21028 gene locus_tag LOCUS_05600 21519 21028 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_05600 22316 21522 gene locus_tag LOCUS_05610 gene cfbC 22316 21522 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876281.1 protein_id gnl|my_center|LOCUS_05610 23556 22309 gene locus_tag LOCUS_05620 23556 22309 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060867.1 protein_id gnl|my_center|LOCUS_05620 24983 23562 gene locus_tag LOCUS_05630 gene purF 24983 23562 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_05630 25950 25057 gene locus_tag LOCUS_05640 25950 25057 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876285.1 protein_id gnl|my_center|LOCUS_05640 26928 25960 gene locus_tag LOCUS_05650 gene galE 26928 25960 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_05650 28116 26938 gene locus_tag LOCUS_05660 28116 26938 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061196.1 protein_id gnl|my_center|LOCUS_05660 28289 28122 gene locus_tag LOCUS_05670 28289 28122 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061197.1 protein_id gnl|my_center|LOCUS_05670 28827 28402 gene locus_tag LOCUS_05680 28827 28402 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875792.1 protein_id gnl|my_center|LOCUS_05680 30534 28828 gene locus_tag LOCUS_05690 30534 28828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060755.1 protein_id gnl|my_center|LOCUS_05690 30622 30918 gene locus_tag LOCUS_05700 30622 30918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 31466 30924 gene locus_tag LOCUS_05710 31466 30924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 <32325 31567 gene locus_tag LOCUS_05720 <32325 31567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583837.1:excinuclease ABC subunit UvrC >Feature sequence012 1206 13 gene locus_tag LOCUS_05730 gene rpoA2 1206 13 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876678.1 protein_id gnl|my_center|LOCUS_05730 4430 1215 gene locus_tag LOCUS_05740 4430 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 4782 4456 gene locus_tag LOCUS_05750 4782 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05750 6221 4734 gene locus_tag LOCUS_05760 gene rpoB 6221 4734 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876676.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05760 7784 6240 gene locus_tag LOCUS_05770 7784 6240 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060959.1 protein_id gnl|my_center|LOCUS_05770 8263 8030 gene locus_tag LOCUS_05780 8263 8030 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_05780 8469 8397 gene locus_tag LOCUS_t00050 8469 8397 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8678 8603 gene locus_tag LOCUS_t00060 8678 8603 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8904 8831 gene locus_tag LOCUS_t00070 8904 8831 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9020 9886 gene locus_tag LOCUS_05790 gene thiM 9020 9886 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_05790 9883 10503 gene locus_tag LOCUS_05800 gene thiE 9883 10503 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_05800 10698 11600 gene locus_tag LOCUS_05810 10698 11600 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_05810 12938 11724 gene locus_tag LOCUS_05820 gene pgk 12938 11724 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_05820 13619 12951 gene locus_tag LOCUS_05830 gene tpiA 13619 12951 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876672.1 protein_id gnl|my_center|LOCUS_05830 14544 13666 gene locus_tag LOCUS_05840 14544 13666 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_05840 15415 14546 gene locus_tag LOCUS_05850 15415 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 15547 16464 gene locus_tag LOCUS_05860 gene twy1 15547 16464 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061270.1 protein_id gnl|my_center|LOCUS_05860 17688 16576 gene locus_tag LOCUS_05870 gene sucC 17688 16576 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876667.1 protein_id gnl|my_center|LOCUS_05870 18245 17697 gene locus_tag LOCUS_05880 18245 17697 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 protein_id gnl|my_center|LOCUS_05880 19117 18254 gene locus_tag LOCUS_05890 gene korB 19117 18254 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_05890 20248 19118 gene locus_tag LOCUS_05900 20248 19118 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_05900 20525 20259 gene locus_tag LOCUS_05910 20525 20259 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869641.1 protein_id gnl|my_center|LOCUS_05910 20661 21155 gene locus_tag LOCUS_05920 20661 21155 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669045.1 protein_id gnl|my_center|LOCUS_05920 21727 21152 gene locus_tag LOCUS_05930 21727 21152 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_05930 22541 21807 gene locus_tag LOCUS_05940 22541 21807 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876749.1 protein_id gnl|my_center|LOCUS_05940 22822 23847 gene locus_tag LOCUS_05950 22822 23847 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_05950 24383 23844 gene locus_tag LOCUS_05960 24383 23844 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061280.1 protein_id gnl|my_center|LOCUS_05960 25441 24659 gene locus_tag LOCUS_05970 gene cobS 25441 24659 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876736.1 protein_id gnl|my_center|LOCUS_05970 26517 25444 gene locus_tag LOCUS_05980 26517 25444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 26602 27771 gene locus_tag LOCUS_05990 gene larC 26602 27771 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_05990 27768 28445 gene locus_tag LOCUS_06000 gene queC 27768 28445 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_06000 29057 28446 gene locus_tag LOCUS_06010 29057 28446 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_06010 30219 29203 gene locus_tag LOCUS_06020 30219 29203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 30273 30902 gene locus_tag LOCUS_06030 30273 30902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 31015 31734 gene locus_tag LOCUS_06040 31015 31734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence013 4497 3469 gene locus_tag LOCUS_06050 4497 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06050 5811 4723 gene locus_tag LOCUS_06060 5811 4723 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_06060 7521 5821 gene locus_tag LOCUS_06070 gene top6B 7521 5821 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876638.1 protein_id gnl|my_center|LOCUS_06070 8578 7961 gene locus_tag LOCUS_06080 8578 7961 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_06080 9245 8895 gene locus_tag LOCUS_06090 9245 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 9522 10268 gene locus_tag LOCUS_06100 9522 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10581 10772 gene locus_tag LOCUS_06110 10581 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 11139 11345 gene locus_tag LOCUS_06120 11139 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 11596 11856 gene locus_tag LOCUS_06130 11596 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 11892 12179 gene locus_tag LOCUS_06140 11892 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 12841 12227 gene locus_tag LOCUS_06150 12841 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 13845 13072 gene locus_tag LOCUS_06160 13845 13072 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_06160 14216 13875 gene locus_tag LOCUS_06170 gene eif1A 14216 13875 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 protein_id gnl|my_center|LOCUS_06170 14288 15511 gene locus_tag LOCUS_06180 14288 15511 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060944.1 protein_id gnl|my_center|LOCUS_06180 15538 15999 gene locus_tag LOCUS_06190 15538 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 16008 16256 gene locus_tag LOCUS_06200 16008 16256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 17582 16272 gene locus_tag LOCUS_06210 17582 16272 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_06210 18295 17591 gene locus_tag LOCUS_06220 18295 17591 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_06220 19352 18303 gene locus_tag LOCUS_06230 gene hypD 19352 18303 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_06230 19435 21099 gene locus_tag LOCUS_06240 19435 21099 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986975.1 protein_id gnl|my_center|LOCUS_06240 21108 22160 gene locus_tag LOCUS_06250 21108 22160 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986974.1 protein_id gnl|my_center|LOCUS_06250 22376 22197 gene locus_tag LOCUS_06260 22376 22197 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_06260 24025 22478 gene locus_tag LOCUS_06270 24025 22478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 25875 24163 gene locus_tag LOCUS_06280 25875 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 26730 25888 gene locus_tag LOCUS_06290 26730 25888 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876722.1 protein_id gnl|my_center|LOCUS_06290 26890 27984 gene locus_tag LOCUS_06300 26890 27984 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_06300 28153 29865 gene locus_tag LOCUS_06310 gene oadA 28153 29865 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876731.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence014 718 422 gene locus_tag LOCUS_06320 718 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 1115 696 gene locus_tag LOCUS_06330 1115 696 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485784.1 protein_id gnl|my_center|LOCUS_06330 1184 1897 gene locus_tag LOCUS_06340 1184 1897 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877099.1 protein_id gnl|my_center|LOCUS_06340 2785 1991 gene locus_tag LOCUS_06350 2785 1991 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877103.1 protein_id gnl|my_center|LOCUS_06350 2898 4268 gene locus_tag LOCUS_06360 gene gatA 2898 4268 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 protein_id gnl|my_center|LOCUS_06360 4329 4730 gene locus_tag LOCUS_06370 4329 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 4855 6348 gene locus_tag LOCUS_06380 4855 6348 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061066.1 protein_id gnl|my_center|LOCUS_06380 6348 6764 gene locus_tag LOCUS_06390 6348 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 7448 6765 gene locus_tag LOCUS_06400 gene ribB 7448 6765 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_06400 8077 7703 gene locus_tag LOCUS_06410 gene ribK 8077 7703 CDS product CTP-dependent riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496379.1 protein_id gnl|my_center|LOCUS_06410 8300 9946 gene locus_tag LOCUS_06420 8300 9946 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_06420 11252 9936 gene locus_tag LOCUS_06430 11252 9936 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_06430 11501 11295 gene locus_tag LOCUS_06440 11501 11295 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877844.1 protein_id gnl|my_center|LOCUS_06440 11745 12605 gene locus_tag LOCUS_06450 gene hisG 11745 12605 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877116.1 protein_id gnl|my_center|LOCUS_06450 12611 13546 gene locus_tag LOCUS_06460 gene pyrB 12611 13546 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877025.1 protein_id gnl|my_center|LOCUS_06460 14702 13539 gene locus_tag LOCUS_06470 gene cdc6-1 14702 13539 CDS product ORC1-type DNA replication protein Cdc6-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_06470 15810 15328 gene locus_tag LOCUS_06480 15810 15328 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877022.1 protein_id gnl|my_center|LOCUS_06480 15994 15821 gene locus_tag LOCUS_06490 15994 15821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 16230 16910 gene locus_tag LOCUS_06500 16230 16910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 16907 17923 gene locus_tag LOCUS_06510 16907 17923 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877020.1 protein_id gnl|my_center|LOCUS_06510 18189 17941 gene locus_tag LOCUS_06520 18189 17941 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_06520 18348 18515 gene locus_tag LOCUS_06530 18348 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 19099 18512 gene locus_tag LOCUS_06540 19099 18512 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 protein_id gnl|my_center|LOCUS_06540 20884 19112 gene locus_tag LOCUS_06550 20884 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 21034 21708 gene locus_tag LOCUS_06560 21034 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 21727 22800 gene locus_tag LOCUS_06570 gene cobJ 21727 22800 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877015.1 protein_id gnl|my_center|LOCUS_06570 22811 23404 gene locus_tag LOCUS_06580 22811 23404 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877014.1 protein_id gnl|my_center|LOCUS_06580 23450 24712 gene locus_tag LOCUS_06590 23450 24712 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_06590 25585 24719 gene locus_tag LOCUS_06600 25585 24719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 26522 25578 gene locus_tag LOCUS_06610 26522 25578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence015 286 828 gene locus_tag LOCUS_06620 286 828 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020390.1 protein_id gnl|my_center|LOCUS_06620 979 1218 gene locus_tag LOCUS_06630 979 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1263 1682 gene locus_tag LOCUS_06640 1263 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1973 1677 gene locus_tag LOCUS_06650 1973 1677 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070760.1 protein_id gnl|my_center|LOCUS_06650 2094 3950 gene locus_tag LOCUS_06660 2094 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 4115 5071 gene locus_tag LOCUS_06670 4115 5071 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875827.1 protein_id gnl|my_center|LOCUS_06670 5376 6278 gene locus_tag LOCUS_06680 5376 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 6288 6875 gene locus_tag LOCUS_06690 6288 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6903 8045 gene locus_tag LOCUS_06700 6903 8045 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 protein_id gnl|my_center|LOCUS_06700 8052 8471 gene locus_tag LOCUS_06710 8052 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 8483 8929 gene locus_tag LOCUS_06720 gene dtd 8483 8929 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173028.1 protein_id gnl|my_center|LOCUS_06720 9573 8926 gene locus_tag LOCUS_06730 9573 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 9720 10094 gene locus_tag LOCUS_06740 9720 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 10123 10593 gene locus_tag LOCUS_06750 10123 10593 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_06750 10844 11503 gene locus_tag LOCUS_06760 10844 11503 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016997.1 protein_id gnl|my_center|LOCUS_06760 12107 11505 gene locus_tag LOCUS_06770 12107 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 12766 12182 gene locus_tag LOCUS_06780 12766 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 12841 13290 gene locus_tag LOCUS_06790 12841 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 13363 14130 gene locus_tag LOCUS_06800 13363 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 14146 17670 gene locus_tag LOCUS_06810 14146 17670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 17676 17804 gene locus_tag LOCUS_06820 17676 17804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 18312 18971 gene locus_tag LOCUS_06830 18312 18971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 19796 18963 gene locus_tag LOCUS_06840 19796 18963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 19902 20402 gene locus_tag LOCUS_06850 19902 20402 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948618.1 protein_id gnl|my_center|LOCUS_06850 20423 21877 gene locus_tag LOCUS_06860 20423 21877 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456709.1 protein_id gnl|my_center|LOCUS_06860 21964 22293 gene locus_tag LOCUS_06870 21964 22293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 23336 22290 gene locus_tag LOCUS_06880 23336 22290 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949061.1 protein_id gnl|my_center|LOCUS_06880 23431 23853 gene locus_tag LOCUS_06890 23431 23853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 24041 23850 gene locus_tag LOCUS_06900 24041 23850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 24115 24474 gene locus_tag LOCUS_06910 24115 24474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence016 125 1543 gene locus_tag LOCUS_06920 125 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6924 1630 gene locus_tag LOCUS_06930 6924 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7322 7107 gene locus_tag LOCUS_06940 7322 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7865 7443 gene locus_tag LOCUS_06950 7865 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8055 8846 gene locus_tag LOCUS_06960 8055 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 9165 11231 gene locus_tag LOCUS_06970 9165 11231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 11368 11583 gene locus_tag LOCUS_06980 11368 11583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11624 11887 gene locus_tag LOCUS_06990 11624 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12737 12078 gene locus_tag LOCUS_07000 12737 12078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 13350 12919 gene locus_tag LOCUS_07010 13350 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 13514 14221 gene locus_tag LOCUS_07020 13514 14221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 14419 15078 gene locus_tag LOCUS_07030 14419 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 15143 15646 gene locus_tag LOCUS_07040 15143 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 16193 15753 gene locus_tag LOCUS_07050 16193 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 16782 16198 gene locus_tag LOCUS_07060 16782 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 17323 16793 gene locus_tag LOCUS_07070 17323 16793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 17474 17665 gene locus_tag LOCUS_07080 17474 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 18261 17881 gene locus_tag LOCUS_07090 18261 17881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 18306 19124 gene locus_tag LOCUS_07100 18306 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 19342 21747 gene locus_tag LOCUS_07110 19342 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 21953 22486 gene locus_tag LOCUS_07120 21953 22486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence017 494 545 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1389 21080 gene locus_tag LOCUS_07130 1389 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence018 366 106 gene locus_tag LOCUS_07140 366 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1184 780 gene locus_tag LOCUS_07150 1184 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1425 1637 gene locus_tag LOCUS_07160 1425 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1640 1774 gene locus_tag LOCUS_07170 1640 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1767 2189 gene locus_tag LOCUS_07180 1767 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2916 2179 gene locus_tag LOCUS_07190 2916 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3279 3569 gene locus_tag LOCUS_07200 3279 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3584 3877 gene locus_tag LOCUS_07210 3584 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3896 4351 gene locus_tag LOCUS_07220 3896 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 4364 4666 gene locus_tag LOCUS_07230 4364 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 4791 7556 gene locus_tag LOCUS_07240 4791 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 7569 8279 gene locus_tag LOCUS_07250 7569 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 10326 8632 gene locus_tag LOCUS_07260 10326 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 11702 10368 gene locus_tag LOCUS_07270 gene gdhA 11702 10368 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_07270 12175 12411 gene locus_tag LOCUS_07280 12175 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 13652 12408 gene locus_tag LOCUS_07290 gene prf1 13652 12408 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_07290 13761 14738 gene locus_tag LOCUS_07300 gene dusB 13761 14738 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023223.1 protein_id gnl|my_center|LOCUS_07300 15695 14727 gene locus_tag LOCUS_07310 15695 14727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 15789 16307 gene locus_tag LOCUS_07320 15789 16307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 16625 16281 gene locus_tag LOCUS_07330 16625 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 16806 17195 gene locus_tag LOCUS_07340 16806 17195 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876631.1 protein_id gnl|my_center|LOCUS_07340 17200 19629 gene locus_tag LOCUS_07350 17200 19629 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060943.1 protein_id gnl|my_center|LOCUS_07350 19626 20420 gene locus_tag LOCUS_07360 gene cobK 19626 20420 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 protein_id gnl|my_center|LOCUS_07360 20513 20428 gene locus_tag LOCUS_t00080 20513 20428 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20856 20548 gene locus_tag LOCUS_07370 gene rpsJ 20856 20548 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence019 50 766 gene locus_tag LOCUS_07380 gene mtxX 50 766 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875870.1 protein_id gnl|my_center|LOCUS_07380 804 1484 gene locus_tag LOCUS_07390 gene uppS 804 1484 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875871.1 protein_id gnl|my_center|LOCUS_07390 1488 2249 gene locus_tag LOCUS_07400 1488 2249 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_07400 2614 2246 gene locus_tag LOCUS_07410 2614 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2779 2615 gene locus_tag LOCUS_07420 2779 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 3304 2933 gene locus_tag LOCUS_07430 3304 2933 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875873.1 protein_id gnl|my_center|LOCUS_07430 3826 3329 gene locus_tag LOCUS_07440 3826 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330367.1 protein_id gnl|my_center|LOCUS_07440 4218 3823 gene locus_tag LOCUS_07450 4218 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4317 5069 gene locus_tag LOCUS_07460 gene cobM 4317 5069 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_07460 5810 5106 gene locus_tag LOCUS_07470 5810 5106 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_07470 6765 5821 gene locus_tag LOCUS_07480 6765 5821 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 protein_id gnl|my_center|LOCUS_07480 7076 6762 gene locus_tag LOCUS_07490 7076 6762 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876414.1 protein_id gnl|my_center|LOCUS_07490 7536 7078 gene locus_tag LOCUS_07500 7536 7078 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876415.1 protein_id gnl|my_center|LOCUS_07500 8631 7549 gene locus_tag LOCUS_07510 8631 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060897.1 protein_id gnl|my_center|LOCUS_07510 8745 8672 gene locus_tag LOCUS_t00090 8745 8672 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9832 8801 gene locus_tag LOCUS_07520 9832 8801 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 protein_id gnl|my_center|LOCUS_07520 10527 9853 gene locus_tag LOCUS_07530 gene hypB 10527 9853 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_07530 11031 10528 gene locus_tag LOCUS_07540 11031 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11087 12226 gene locus_tag LOCUS_07550 11087 12226 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_07550 12334 12786 gene locus_tag LOCUS_07560 12334 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 15706 12818 gene locus_tag LOCUS_07570 15706 12818 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_07570 15993 15781 gene locus_tag LOCUS_07580 15993 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 16094 18556 gene locus_tag LOCUS_07590 16094 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence020 <1 1057 gene locus_tag LOCUS_07600 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877475.1:class I SAM-dependent methyltransferase family protein 1591 1085 gene locus_tag LOCUS_07610 1591 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1989 1663 gene locus_tag LOCUS_07620 1989 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3304 2375 gene locus_tag LOCUS_07630 gene mtnA 3304 2375 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061163.1 protein_id gnl|my_center|LOCUS_07630 4458 3538 gene locus_tag LOCUS_07640 4458 3538 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226902.1 protein_id gnl|my_center|LOCUS_07640 5423 4557 gene locus_tag LOCUS_07650 gene nifB 5423 4557 CDS product FeMo cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877473.1 protein_id gnl|my_center|LOCUS_07650 6049 5489 gene locus_tag LOCUS_07660 6049 5489 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877472.1 protein_id gnl|my_center|LOCUS_07660 7307 6066 gene locus_tag LOCUS_07670 7307 6066 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877471.1 protein_id gnl|my_center|LOCUS_07670 7767 7312 gene locus_tag LOCUS_07680 7767 7312 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_07680 8248 7781 gene locus_tag LOCUS_07690 8248 7781 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061162.1 protein_id gnl|my_center|LOCUS_07690 9200 8220 gene locus_tag LOCUS_07700 9200 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 9708 9187 gene locus_tag LOCUS_07710 9708 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 9838 10587 gene locus_tag LOCUS_07720 9838 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 11372 10584 gene locus_tag LOCUS_07730 11372 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 12352 11378 gene locus_tag LOCUS_07740 12352 11378 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_07740 13488 12367 gene locus_tag LOCUS_07750 13488 12367 CDS product DUF2117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869557.1 protein_id gnl|my_center|LOCUS_07750 13991 13485 gene locus_tag LOCUS_07760 13991 13485 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877464.1 protein_id gnl|my_center|LOCUS_07760 14265 14966 gene locus_tag LOCUS_07770 14265 14966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 14286 14344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14972 15769 gene locus_tag LOCUS_07780 14972 15769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 15776 16075 gene locus_tag LOCUS_07790 15776 16075 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_07790 16090 16596 gene locus_tag LOCUS_07800 16090 16596 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061158.1 protein_id gnl|my_center|LOCUS_07800 17171 16635 gene locus_tag LOCUS_07810 gene pyrE 17171 16635 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 protein_id gnl|my_center|LOCUS_07810 17405 17172 gene locus_tag LOCUS_07820 17405 17172 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877461.1 protein_id gnl|my_center|LOCUS_07820 17553 18941 gene locus_tag LOCUS_07830 gene xseA 17553 18941 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_07830 18941 19159 gene locus_tag LOCUS_07840 18941 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence021 <1 691 gene locus_tag LOCUS_07850 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876684.1:translation elongation factor EF-1 subunit alpha note possible pseudo, frameshifted 634 1089 gene locus_tag LOCUS_07860 634 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07860 1157 1432 gene locus_tag LOCUS_07870 gene rpsJ 1157 1432 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_07870 1467 1552 gene locus_tag LOCUS_t00100 1467 1552 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2350 1565 gene locus_tag LOCUS_07880 gene cobK 2350 1565 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 protein_id gnl|my_center|LOCUS_07880 4776 2347 gene locus_tag LOCUS_07890 4776 2347 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060943.1 protein_id gnl|my_center|LOCUS_07890 5170 4781 gene locus_tag LOCUS_07900 5170 4781 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876631.1 protein_id gnl|my_center|LOCUS_07900 5351 5698 gene locus_tag LOCUS_07910 5351 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6181 5663 gene locus_tag LOCUS_07920 6181 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6374 7252 gene locus_tag LOCUS_07930 6374 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7328 8572 gene locus_tag LOCUS_07940 gene prf1 7328 8572 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_07940 8837 8610 gene locus_tag LOCUS_07950 8837 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 9341 10675 gene locus_tag LOCUS_07960 gene gdhA 9341 10675 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_07960 11031 11627 gene locus_tag LOCUS_07970 11031 11627 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766601.1 protein_id gnl|my_center|LOCUS_07970 11764 11624 gene locus_tag LOCUS_07980 11764 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 12646 14052 gene locus_tag LOCUS_07990 12646 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 14554 14624 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15471 18578 gene locus_tag LOCUS_08000 15471 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence022 377 1045 gene locus_tag LOCUS_08010 377 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1035 2237 gene locus_tag LOCUS_08020 1035 2237 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875779.1 protein_id gnl|my_center|LOCUS_08020 2338 3051 gene locus_tag LOCUS_08030 2338 3051 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 protein_id gnl|my_center|LOCUS_08030 3065 4549 gene locus_tag LOCUS_08040 gene guaB 3065 4549 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_08040 4813 5082 gene locus_tag LOCUS_08050 gene rpl37A 4813 5082 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 protein_id gnl|my_center|LOCUS_08050 5366 5746 gene locus_tag LOCUS_08060 5366 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5739 6002 gene locus_tag LOCUS_08070 5739 6002 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876317.1 protein_id gnl|my_center|LOCUS_08070 6032 6379 gene locus_tag LOCUS_08080 6032 6379 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876316.1 protein_id gnl|my_center|LOCUS_08080 6416 6700 gene locus_tag LOCUS_08090 6416 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 7278 7967 gene locus_tag LOCUS_08100 7278 7967 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 protein_id gnl|my_center|LOCUS_08100 8138 7959 gene locus_tag LOCUS_08110 8138 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 8261 9109 gene locus_tag LOCUS_08120 8261 9109 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_08120 9149 9970 gene locus_tag LOCUS_08130 9149 9970 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_08130 10130 14626 gene locus_tag LOCUS_08140 10130 14626 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876126.1 protein_id gnl|my_center|LOCUS_08140 14610 17492 gene locus_tag LOCUS_08150 14610 17492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence023 59 424 gene locus_tag LOCUS_08160 59 424 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_08160 585 1010 gene locus_tag LOCUS_08170 585 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1023 3284 gene locus_tag LOCUS_08180 1023 3284 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060894.1 protein_id gnl|my_center|LOCUS_08180 3302 4189 gene locus_tag LOCUS_08190 3302 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 4193 5170 gene locus_tag LOCUS_08200 4193 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 5460 5167 gene locus_tag LOCUS_08210 5460 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 5640 6254 gene locus_tag LOCUS_08220 5640 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6264 6998 gene locus_tag LOCUS_08230 6264 6998 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 protein_id gnl|my_center|LOCUS_08230 6985 7344 gene locus_tag LOCUS_08240 6985 7344 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876326.1 protein_id gnl|my_center|LOCUS_08240 7564 8337 gene locus_tag LOCUS_08250 gene psmA 7564 8337 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_08250 8363 9064 gene locus_tag LOCUS_08260 8363 9064 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_08260 9095 10018 gene locus_tag LOCUS_08270 gene rrp4 9095 10018 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 protein_id gnl|my_center|LOCUS_08270 10058 10750 gene locus_tag LOCUS_08280 gene rrp41 10058 10750 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 protein_id gnl|my_center|LOCUS_08280 10763 11548 gene locus_tag LOCUS_08290 gene rrp42 10763 11548 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_08290 12174 11545 gene locus_tag LOCUS_08300 12174 11545 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892791.1 protein_id gnl|my_center|LOCUS_08300 12960 12196 gene locus_tag LOCUS_08310 12960 12196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_08310 13541 12978 gene locus_tag LOCUS_08320 gene cbiT 13541 12978 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875785.1 protein_id gnl|my_center|LOCUS_08320 14090 13542 gene locus_tag LOCUS_08330 14090 13542 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_08330 15325 14099 gene locus_tag LOCUS_08340 15325 14099 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 protein_id gnl|my_center|LOCUS_08340 15648 15328 gene locus_tag LOCUS_08350 15648 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 15926 17143 gene locus_tag LOCUS_08360 15926 17143 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_08360 17154 17492 gene locus_tag LOCUS_08370 17154 17492 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence024 868 308 gene locus_tag LOCUS_08380 868 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1213 1545 gene locus_tag LOCUS_08390 1213 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08390 1836 1675 gene locus_tag LOCUS_08400 1836 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2207 2569 gene locus_tag LOCUS_08410 2207 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2737 2985 gene locus_tag LOCUS_08420 2737 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 3029 3595 gene locus_tag LOCUS_08430 3029 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3588 5252 gene locus_tag LOCUS_08440 3588 5252 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109317.1 protein_id gnl|my_center|LOCUS_08440 7095 5245 gene locus_tag LOCUS_08450 7095 5245 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_08450 7847 7236 gene locus_tag LOCUS_08460 7847 7236 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_08460 8813 7857 gene locus_tag LOCUS_08470 8813 7857 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_08470 9697 8828 gene locus_tag LOCUS_08480 gene hemC 9697 8828 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876507.1 protein_id gnl|my_center|LOCUS_08480 11241 9823 gene locus_tag LOCUS_08490 gene cfbE 11241 9823 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 protein_id gnl|my_center|LOCUS_08490 13096 11243 gene locus_tag LOCUS_08500 13096 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 13610 13098 gene locus_tag LOCUS_08510 13610 13098 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_08510 13806 14204 gene locus_tag LOCUS_08520 gene eif5A 13806 14204 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_08520 14238 15104 gene locus_tag LOCUS_08530 gene speB 14238 15104 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 protein_id gnl|my_center|LOCUS_08530 15137 15958 gene locus_tag LOCUS_08540 15137 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 16052 16828 gene locus_tag LOCUS_08550 16052 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 16900 17262 gene locus_tag LOCUS_08560 16900 17262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence025 <1 4879 gene locus_tag LOCUS_08570 <1 4879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876698.1:DUF11 domain-containing protein 5504 6040 gene locus_tag LOCUS_08580 5504 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6104 9343 gene locus_tag LOCUS_08590 6104 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 9590 10405 gene locus_tag LOCUS_08600 9590 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 11734 12105 gene locus_tag LOCUS_08610 11734 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08610 12137 12358 gene locus_tag LOCUS_08620 12137 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 12508 12565 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12591 12809 gene locus_tag LOCUS_08630 12591 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence026 12139 5522 gene locus_tag LOCUS_08640 12139 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 12240 15089 gene locus_tag LOCUS_08650 12240 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 15413 15426 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15890 16888 gene locus_tag LOCUS_08660 15890 16888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence027 178 1611 gene locus_tag LOCUS_08670 178 1611 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_08670 1959 2885 gene locus_tag LOCUS_08680 1959 2885 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876611.1 protein_id gnl|my_center|LOCUS_08680 2885 3073 gene locus_tag LOCUS_08690 2885 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3720 3088 gene locus_tag LOCUS_08700 3720 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5614 3713 gene locus_tag LOCUS_08710 5614 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5991 5614 gene locus_tag LOCUS_08720 5991 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6374 7786 gene locus_tag LOCUS_08730 6374 7786 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_08730 8597 7875 gene locus_tag LOCUS_08740 8597 7875 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868627.1 protein_id gnl|my_center|LOCUS_08740 8758 9162 gene locus_tag LOCUS_08750 8758 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 9228 9992 gene locus_tag LOCUS_08760 9228 9992 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_08760 9992 10705 gene locus_tag LOCUS_08770 9992 10705 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_08770 10714 11382 gene locus_tag LOCUS_08780 10714 11382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 13013 11439 gene locus_tag LOCUS_08790 gene serA 13013 11439 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061266.1 protein_id gnl|my_center|LOCUS_08790 13292 13546 gene locus_tag LOCUS_08800 13292 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08800 13551 14345 gene locus_tag LOCUS_08810 13551 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061265.1 protein_id gnl|my_center|LOCUS_08810 14728 14342 gene locus_tag LOCUS_08820 14728 14342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 15675 14737 gene locus_tag LOCUS_08830 15675 14737 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876598.1 protein_id gnl|my_center|LOCUS_08830 15732 17006 gene locus_tag LOCUS_08840 15732 17006 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence028 176 508 gene locus_tag LOCUS_08850 176 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 648 1229 gene locus_tag LOCUS_08860 648 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1263 1763 gene locus_tag LOCUS_08870 1263 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1774 3786 gene locus_tag LOCUS_08880 1774 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4052 4453 gene locus_tag LOCUS_08890 4052 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4646 6931 gene locus_tag LOCUS_08900 4646 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 7383 7183 gene locus_tag LOCUS_08910 7383 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 8316 7495 gene locus_tag LOCUS_08920 8316 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 9481 8318 gene locus_tag LOCUS_08930 9481 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 9653 9453 gene locus_tag LOCUS_08940 9653 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 10873 9749 gene locus_tag LOCUS_08950 10873 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 12375 10966 gene locus_tag LOCUS_08960 12375 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 13017 12439 gene locus_tag LOCUS_08970 13017 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 13281 13033 gene locus_tag LOCUS_08980 13281 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13648 13454 gene locus_tag LOCUS_08990 13648 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 15268 13820 gene locus_tag LOCUS_09000 15268 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 15768 15493 gene locus_tag LOCUS_09010 15768 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence029 <1 3959 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcacaatccttgttttagtagaaatgtctttgcaat 5273 4269 gene locus_tag LOCUS_09020 gene cas1 5273 4269 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_09020 5551 5270 gene locus_tag LOCUS_09030 5551 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 6213 5551 gene locus_tag LOCUS_09040 6213 5551 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_09040 7299 6226 gene locus_tag LOCUS_09050 gene csm5 7299 6226 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876702.1 protein_id gnl|my_center|LOCUS_09050 8253 7300 gene locus_tag LOCUS_09060 gene csm4 8253 7300 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876703.1 protein_id gnl|my_center|LOCUS_09060 8999 8265 gene locus_tag LOCUS_09070 gene csm3 8999 8265 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876704.1 protein_id gnl|my_center|LOCUS_09070 9463 9002 gene locus_tag LOCUS_09080 gene csm2 9463 9002 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296332.1 protein_id gnl|my_center|LOCUS_09080 11967 9469 gene locus_tag LOCUS_09090 gene cas10 11967 9469 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261170.1 protein_id gnl|my_center|LOCUS_09090 13303 12026 gene locus_tag LOCUS_09100 13303 12026 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876700.1 protein_id gnl|my_center|LOCUS_09100 14568 13306 gene locus_tag LOCUS_09110 14568 13306 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876700.1 protein_id gnl|my_center|LOCUS_09110 14867 14655 gene locus_tag LOCUS_09120 14867 14655 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896137.1 protein_id gnl|my_center|LOCUS_09120 16067 14868 gene locus_tag LOCUS_09130 16067 14868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence030 578 1852 gene locus_tag LOCUS_09140 578 1852 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_09140 2150 2269 gene locus_tag LOCUS_09150 2150 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2845 2477 gene locus_tag LOCUS_09160 2845 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3143 2838 gene locus_tag LOCUS_09170 3143 2838 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877809.1 protein_id gnl|my_center|LOCUS_09170 4567 3776 gene locus_tag LOCUS_09180 4567 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 4785 4564 gene locus_tag LOCUS_09190 4785 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5334 6008 gene locus_tag LOCUS_09200 5334 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6005 6262 gene locus_tag LOCUS_09210 6005 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 6322 6753 gene locus_tag LOCUS_09220 6322 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6750 7259 gene locus_tag LOCUS_09230 6750 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8220 7369 gene locus_tag LOCUS_09240 8220 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9117 8236 gene locus_tag LOCUS_09250 9117 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 10213 9239 gene locus_tag LOCUS_09260 10213 9239 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_09260 11108 10218 gene locus_tag LOCUS_09270 11108 10218 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_09270 11967 11128 gene locus_tag LOCUS_09280 11967 11128 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 protein_id gnl|my_center|LOCUS_09280 12095 12511 gene locus_tag LOCUS_09290 12095 12511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 13810 12632 gene locus_tag LOCUS_09300 13810 12632 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence031 <1 1107 gene locus_tag LOCUS_09310 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877198.1:phosphoglucosamine mutase 1207 1956 gene locus_tag LOCUS_09320 1207 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3066 1978 gene locus_tag LOCUS_09330 3066 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3922 3071 gene locus_tag LOCUS_09340 3922 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4759 3935 gene locus_tag LOCUS_09350 4759 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 5247 4756 gene locus_tag LOCUS_09360 5247 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 5904 7175 gene locus_tag LOCUS_09370 5904 7175 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_09370 7188 7670 gene locus_tag LOCUS_09380 7188 7670 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869802.1 protein_id gnl|my_center|LOCUS_09380 7674 8774 gene locus_tag LOCUS_09390 gene hisC 7674 8774 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877195.1 protein_id gnl|my_center|LOCUS_09390 8775 9485 gene locus_tag LOCUS_09400 8775 9485 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061096.1 protein_id gnl|my_center|LOCUS_09400 9495 10631 gene locus_tag LOCUS_09410 9495 10631 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892639.1 protein_id gnl|my_center|LOCUS_09410 12153 10789 gene locus_tag LOCUS_09420 gene glmM 12153 10789 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877192.1 protein_id gnl|my_center|LOCUS_09420 12618 12220 gene locus_tag LOCUS_09430 12618 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 12698 13336 gene locus_tag LOCUS_09440 12698 13336 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682109.1 protein_id gnl|my_center|LOCUS_09440 14991 13333 gene locus_tag LOCUS_09450 14991 13333 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061094.1 protein_id gnl|my_center|LOCUS_09450 15800 14991 gene locus_tag LOCUS_09460 15800 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence032 1288 2253 gene locus_tag LOCUS_09470 1288 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2250 2948 gene locus_tag LOCUS_09480 2250 2948 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061278.1 protein_id gnl|my_center|LOCUS_09480 3075 3350 gene locus_tag LOCUS_09490 3075 3350 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_09490 3354 3794 gene locus_tag LOCUS_09500 3354 3794 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548931.1 protein_id gnl|my_center|LOCUS_09500 3803 4228 gene locus_tag LOCUS_09510 3803 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5797 4229 gene locus_tag LOCUS_09520 5797 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 6311 8386 gene locus_tag LOCUS_09530 6311 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 8557 11424 gene locus_tag LOCUS_09540 8557 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence033 4377 3502 gene locus_tag LOCUS_09550 4377 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4805 5899 gene locus_tag LOCUS_09560 4805 5899 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 protein_id gnl|my_center|LOCUS_09560 6681 6085 gene locus_tag LOCUS_09570 6681 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 7458 6682 gene locus_tag LOCUS_09580 7458 6682 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_09580 9349 8045 gene locus_tag LOCUS_09590 9349 8045 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877086.1 protein_id gnl|my_center|LOCUS_09590 9396 10454 gene locus_tag LOCUS_09600 9396 10454 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 protein_id gnl|my_center|LOCUS_09600 10460 11119 gene locus_tag LOCUS_09610 10460 11119 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_09610 11402 11127 gene locus_tag LOCUS_09620 gene albA 11402 11127 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_09620 13130 11601 gene locus_tag LOCUS_09630 13130 11601 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_09630 14353 13154 gene locus_tag LOCUS_09640 14353 13154 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_09640 15519 14365 gene locus_tag LOCUS_09650 15519 14365 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence034 344 586 gene locus_tag LOCUS_09660 344 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 646 1206 gene locus_tag LOCUS_09670 646 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1306 1755 gene locus_tag LOCUS_09680 1306 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1923 2384 gene locus_tag LOCUS_09690 1923 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2381 3766 gene locus_tag LOCUS_09700 2381 3766 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875834.1 protein_id gnl|my_center|LOCUS_09700 4162 3797 gene locus_tag LOCUS_09710 4162 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4915 4265 gene locus_tag LOCUS_09720 4915 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876771.1 protein_id gnl|my_center|LOCUS_09720 5547 4912 gene locus_tag LOCUS_09730 5547 4912 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876770.1 protein_id gnl|my_center|LOCUS_09730 6333 5548 gene locus_tag LOCUS_09740 6333 5548 CDS product SAM-dependent methyltransferase HcgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876769.1 protein_id gnl|my_center|LOCUS_09740 6819 6337 gene locus_tag LOCUS_09750 6819 6337 CDS product DUF3236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876768.1 protein_id gnl|my_center|LOCUS_09750 7842 6844 gene locus_tag LOCUS_09760 gene hmdB 7842 6844 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876767.1 protein_id gnl|my_center|LOCUS_09760 9003 7975 gene locus_tag LOCUS_09770 gene hmd 9003 7975 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060977.1 protein_id gnl|my_center|LOCUS_09770 9383 10879 gene locus_tag LOCUS_09780 gene hmdC 9383 10879 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876761.1 protein_id gnl|my_center|LOCUS_09780 12205 12567 gene locus_tag LOCUS_09790 12205 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060976.1 protein_id gnl|my_center|LOCUS_09790 12583 13461 gene locus_tag LOCUS_09800 12583 13461 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869499.1 protein_id gnl|my_center|LOCUS_09800 13470 14609 gene locus_tag LOCUS_09810 13470 14609 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943325.1 protein_id gnl|my_center|LOCUS_09810 14619 15020 gene locus_tag LOCUS_09820 14619 15020 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence035 95 19 gene locus_tag LOCUS_t00110 95 19 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 195 122 gene locus_tag LOCUS_t00120 195 122 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 274 201 gene locus_tag LOCUS_t00130 274 201 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 469 1449 gene locus_tag LOCUS_09830 469 1449 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496555.1 protein_id gnl|my_center|LOCUS_09830 1863 3029 gene locus_tag LOCUS_09840 gene gatB 1863 3029 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876897.1 protein_id gnl|my_center|LOCUS_09840 3041 3847 gene locus_tag LOCUS_09850 3041 3847 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 protein_id gnl|my_center|LOCUS_09850 3848 4138 gene locus_tag LOCUS_09860 gene hisE 3848 4138 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876900.1 protein_id gnl|my_center|LOCUS_09860 4162 4929 gene locus_tag LOCUS_09870 4162 4929 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_09870 4944 5744 gene locus_tag LOCUS_09880 4944 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5757 6263 gene locus_tag LOCUS_09890 5757 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 6270 8786 gene locus_tag LOCUS_09900 gene ggaB 6270 8786 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_09900 9687 8926 gene locus_tag LOCUS_09910 gene larB 9687 8926 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_09910 9740 11980 gene locus_tag LOCUS_09920 gene hypF 9740 11980 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868352.1 protein_id gnl|my_center|LOCUS_09920 12607 12035 gene locus_tag LOCUS_09930 12607 12035 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876905.1 protein_id gnl|my_center|LOCUS_09930 12913 13464 gene locus_tag LOCUS_09940 12913 13464 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence036 <1 567 gene locus_tag LOCUS_09950 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948998.1:pyridoxal phosphate-dependent aminotransferase 536 1138 gene locus_tag LOCUS_09960 536 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1511 7324 gene locus_tag LOCUS_09970 1511 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 7420 14505 gene locus_tag LOCUS_09980 7420 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence037 727 341 gene locus_tag LOCUS_09990 727 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1269 835 gene locus_tag LOCUS_10000 gene pfdA 1269 835 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877217.1 protein_id gnl|my_center|LOCUS_10000 2077 1289 gene locus_tag LOCUS_10010 2077 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2368 2123 gene locus_tag LOCUS_10020 2368 2123 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_10020 2502 2332 gene locus_tag LOCUS_10030 2502 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3107 2523 gene locus_tag LOCUS_10040 3107 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877222.1 protein_id gnl|my_center|LOCUS_10040 3478 3113 gene locus_tag LOCUS_10050 3478 3113 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_10050 3937 3500 gene locus_tag LOCUS_10060 3937 3500 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_10060 4241 3984 gene locus_tag LOCUS_10070 4241 3984 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061101.1 protein_id gnl|my_center|LOCUS_10070 4575 4210 gene locus_tag LOCUS_10080 4575 4210 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877226.1 protein_id gnl|my_center|LOCUS_10080 5271 4834 gene locus_tag LOCUS_10090 5271 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5630 5262 gene locus_tag LOCUS_10100 5630 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6320 5775 gene locus_tag LOCUS_10110 6320 5775 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_10110 7434 6340 gene locus_tag LOCUS_10120 7434 6340 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_10120 10193 7485 gene locus_tag LOCUS_10130 10193 7485 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877231.1 protein_id gnl|my_center|LOCUS_10130 12545 10389 gene locus_tag LOCUS_10140 gene topA 12545 10389 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061102.1 protein_id gnl|my_center|LOCUS_10140 12859 12698 gene locus_tag LOCUS_10150 12859 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 14556 12901 gene locus_tag LOCUS_10160 14556 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence038 1451 699 gene locus_tag LOCUS_10170 1451 699 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_10170 2430 1483 gene locus_tag LOCUS_10180 2430 1483 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393471.1 protein_id gnl|my_center|LOCUS_10180 2351 2575 gene locus_tag LOCUS_10190 2351 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3451 3627 gene locus_tag LOCUS_10200 3451 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4005 4766 gene locus_tag LOCUS_10210 4005 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 5079 6092 gene locus_tag LOCUS_10220 5079 6092 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_10220 6310 6131 gene locus_tag LOCUS_10230 6310 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 9167 6312 gene locus_tag LOCUS_10240 9167 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 9853 9347 gene locus_tag LOCUS_10250 9853 9347 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 protein_id gnl|my_center|LOCUS_10250 10154 9855 gene locus_tag LOCUS_10260 10154 9855 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020467.1 protein_id gnl|my_center|LOCUS_10260 10348 11154 gene locus_tag LOCUS_10270 10348 11154 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449069.1 protein_id gnl|my_center|LOCUS_10270 11147 11308 gene locus_tag LOCUS_10280 11147 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 11280 11954 gene locus_tag LOCUS_10290 11280 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10290 14066 11943 gene locus_tag LOCUS_10300 14066 11943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence039 93 1658 gene locus_tag LOCUS_10310 93 1658 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_10310 1720 2412 gene locus_tag LOCUS_10320 1720 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2425 2625 gene locus_tag LOCUS_10330 2425 2625 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870227.1 protein_id gnl|my_center|LOCUS_10330 2665 3243 gene locus_tag LOCUS_10340 gene hisB 2665 3243 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_10340 4188 3349 gene locus_tag LOCUS_10350 4188 3349 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877074.1 protein_id gnl|my_center|LOCUS_10350 4449 4377 gene locus_tag LOCUS_t00140 4449 4377 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4573 5496 gene locus_tag LOCUS_10360 gene ilvE 4573 5496 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_10360 5509 6342 gene locus_tag LOCUS_10370 5509 6342 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_10370 7438 6371 gene locus_tag LOCUS_10380 7438 6371 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061048.1 protein_id gnl|my_center|LOCUS_10380 7934 7431 gene locus_tag LOCUS_10390 7934 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 8026 9615 gene locus_tag LOCUS_10400 8026 9615 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 protein_id gnl|my_center|LOCUS_10400 9671 10222 gene locus_tag LOCUS_10410 9671 10222 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877036.1 protein_id gnl|my_center|LOCUS_10410 10261 10659 gene locus_tag LOCUS_10420 10261 10659 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061047.1 protein_id gnl|my_center|LOCUS_10420 10649 11983 gene locus_tag LOCUS_10430 10649 11983 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330372.1 protein_id gnl|my_center|LOCUS_10430 11985 13172 gene locus_tag LOCUS_10440 11985 13172 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_10440 13226 13906 gene locus_tag LOCUS_10450 13226 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10450 14081 14090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence040 1872 496 gene locus_tag LOCUS_10460 1872 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2034 3281 gene locus_tag LOCUS_10470 2034 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 3283 4059 gene locus_tag LOCUS_10480 3283 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4128 4319 gene locus_tag LOCUS_10490 4128 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4316 4471 gene locus_tag LOCUS_10500 4316 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 4473 4724 gene locus_tag LOCUS_10510 4473 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4758 5021 gene locus_tag LOCUS_10520 4758 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5011 5613 gene locus_tag LOCUS_10530 5011 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5618 6244 gene locus_tag LOCUS_10540 5618 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6268 7140 gene locus_tag LOCUS_10550 6268 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7218 7418 gene locus_tag LOCUS_10560 7218 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7422 8522 gene locus_tag LOCUS_10570 7422 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 8536 8679 gene locus_tag LOCUS_10580 8536 8679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 8696 9973 gene locus_tag LOCUS_10590 8696 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 9982 10248 gene locus_tag LOCUS_10600 9982 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 10336 10578 gene locus_tag LOCUS_10610 10336 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 10639 10878 gene locus_tag LOCUS_10620 10639 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 12261 10885 gene locus_tag LOCUS_10630 12261 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 12778 14466 gene locus_tag LOCUS_10640 12778 14466 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence041 171 1001 gene locus_tag LOCUS_10650 171 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1036 1461 gene locus_tag LOCUS_10660 1036 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1773 2252 gene locus_tag LOCUS_10670 1773 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2264 3202 gene locus_tag LOCUS_10680 2264 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3216 3770 gene locus_tag LOCUS_10690 3216 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3887 4141 gene locus_tag LOCUS_10700 3887 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4391 4789 gene locus_tag LOCUS_10710 4391 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 4896 5702 gene locus_tag LOCUS_10720 4896 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 10583 5910 gene locus_tag LOCUS_10730 10583 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10726 12066 gene locus_tag LOCUS_10740 10726 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 12069 13208 gene locus_tag LOCUS_10750 12069 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence042 629 261 gene locus_tag LOCUS_10760 629 261 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870296.1 protein_id gnl|my_center|LOCUS_10760 937 629 gene locus_tag LOCUS_10770 937 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3566 1488 gene locus_tag LOCUS_10780 3566 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6353 3891 gene locus_tag LOCUS_10790 6353 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 7698 6475 gene locus_tag LOCUS_10800 7698 6475 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_10800 8571 7855 gene locus_tag LOCUS_10810 8571 7855 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_10810 10174 8576 gene locus_tag LOCUS_10820 10174 8576 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102374990.1 protein_id gnl|my_center|LOCUS_10820 11573 10269 gene locus_tag LOCUS_10830 11573 10269 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_10830 12631 11663 gene locus_tag LOCUS_10840 12631 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 13459 12653 gene locus_tag LOCUS_10850 13459 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence043 268 1173 gene locus_tag LOCUS_10860 268 1173 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_10860 1174 1662 gene locus_tag LOCUS_10870 1174 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_10870 1845 2717 gene locus_tag LOCUS_10880 1845 2717 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_10880 2717 3208 gene locus_tag LOCUS_10890 2717 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10890 3299 4717 gene locus_tag LOCUS_10900 3299 4717 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_10900 4714 5616 gene locus_tag LOCUS_10910 4714 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_10910 5621 6295 gene locus_tag LOCUS_10920 5621 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10920 6502 7299 gene locus_tag LOCUS_10930 6502 7299 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_10930 7304 7813 gene locus_tag LOCUS_10940 7304 7813 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_10940 7815 8153 gene locus_tag LOCUS_10950 7815 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8472 8143 gene locus_tag LOCUS_10960 8472 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8573 8884 gene locus_tag LOCUS_10970 8573 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 9050 9295 gene locus_tag LOCUS_10980 9050 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 9307 11310 gene locus_tag LOCUS_10990 9307 11310 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_10990 11374 11538 gene locus_tag LOCUS_11000 11374 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 11612 11770 gene locus_tag LOCUS_11010 11612 11770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 11789 12400 gene locus_tag LOCUS_11020 11789 12400 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876589.1 protein_id gnl|my_center|LOCUS_11020 12416 13570 gene locus_tag LOCUS_11030 12416 13570 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876588.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence044 1027 800 gene locus_tag LOCUS_11040 1027 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4678 1145 gene locus_tag LOCUS_11050 4678 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 5166 4885 gene locus_tag LOCUS_11060 5166 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5675 5286 gene locus_tag LOCUS_11070 5675 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6265 5921 gene locus_tag LOCUS_11080 6265 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6818 7138 gene locus_tag LOCUS_11090 6818 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7113 7565 gene locus_tag LOCUS_11100 7113 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 7895 8377 gene locus_tag LOCUS_11110 gene rplJ 7895 8377 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876743.1 protein_id gnl|my_center|LOCUS_11110 8455 9222 gene locus_tag LOCUS_11120 8455 9222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_11120 9236 9634 gene locus_tag LOCUS_11130 9236 9634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 9588 10679 gene locus_tag LOCUS_11140 9588 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 9603 9629 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13392 10681 gene locus_tag LOCUS_11150 gene ggaB 13392 10681 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence045 1550 702 gene locus_tag LOCUS_11160 1550 702 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_11160 2325 1603 gene locus_tag LOCUS_11170 2325 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2772 3581 gene locus_tag LOCUS_11180 2772 3581 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060918.1 protein_id gnl|my_center|LOCUS_11180 3652 4941 gene locus_tag LOCUS_11190 3652 4941 CDS product TIGR02710 family CRISPR-associated CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876700.1 protein_id gnl|my_center|LOCUS_11190 5808 4957 gene locus_tag LOCUS_11200 5808 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6133 5810 gene locus_tag LOCUS_11210 6133 5810 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706400.1 protein_id gnl|my_center|LOCUS_11210 6334 6143 gene locus_tag LOCUS_11220 6334 6143 CDS product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876513.1 protein_id gnl|my_center|LOCUS_11220 7138 6350 gene locus_tag LOCUS_11230 gene tatD 7138 6350 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459642.1 protein_id gnl|my_center|LOCUS_11230 7824 7147 gene locus_tag LOCUS_11240 gene pyrH 7824 7147 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_11240 7913 8605 gene locus_tag LOCUS_11250 7913 8605 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876566.1 protein_id gnl|my_center|LOCUS_11250 9308 8625 gene locus_tag LOCUS_11260 9308 8625 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913203.1 protein_id gnl|my_center|LOCUS_11260 10494 9364 gene locus_tag LOCUS_11270 10494 9364 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875756.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence046 969 259 gene locus_tag LOCUS_11280 969 259 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935416.1 protein_id gnl|my_center|LOCUS_11280 2989 950 gene locus_tag LOCUS_11290 2989 950 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351383.1 protein_id gnl|my_center|LOCUS_11290 3192 4169 gene locus_tag LOCUS_11300 3192 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 5188 4166 gene locus_tag LOCUS_11310 5188 4166 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721504.1 protein_id gnl|my_center|LOCUS_11310 5885 5181 gene locus_tag LOCUS_11320 5885 5181 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_11320 6916 5891 gene locus_tag LOCUS_11330 6916 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 8188 7004 gene locus_tag LOCUS_11340 gene rfbE 8188 7004 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_11340 8945 8211 gene locus_tag LOCUS_11350 8945 8211 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_11350 9930 9019 gene locus_tag LOCUS_11360 9930 9019 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_11360 10503 9979 gene locus_tag LOCUS_11370 10503 9979 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015753.1 protein_id gnl|my_center|LOCUS_11370 11587 10508 gene locus_tag LOCUS_11380 11587 10508 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_11380 12468 11593 gene locus_tag LOCUS_11390 12468 11593 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_11390 13452 12469 gene locus_tag LOCUS_11400 gene pseB 13452 12469 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015759.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence047 8514 4189 gene locus_tag LOCUS_11410 8514 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 11558 8688 gene locus_tag LOCUS_11420 11558 8688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 12838 11588 gene locus_tag LOCUS_11430 12838 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 <13636 13078 gene locus_tag LOCUS_11440 <13636 13078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990808.1:DUF3344 domain-containing protein >Feature sequence048 2413 635 gene locus_tag LOCUS_11450 2413 635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_11450 3486 2413 gene locus_tag LOCUS_11460 3486 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11460 4123 3467 gene locus_tag LOCUS_11470 4123 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11470 5011 12741 gene locus_tag LOCUS_11480 5011 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence049 <1 723 gene locus_tag LOCUS_11490 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061072.1:NAD+ synthase 736 3591 gene locus_tag LOCUS_11500 gene leuS 736 3591 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_11500 3830 4687 gene locus_tag LOCUS_11510 3830 4687 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922580.1 protein_id gnl|my_center|LOCUS_11510 5731 4688 gene locus_tag LOCUS_11520 5731 4688 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790418.1 protein_id gnl|my_center|LOCUS_11520 6566 5835 gene locus_tag LOCUS_11530 6566 5835 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061045.1 protein_id gnl|my_center|LOCUS_11530 7535 6576 gene locus_tag LOCUS_11540 gene htpX 7535 6576 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055925.1 protein_id gnl|my_center|LOCUS_11540 7682 8629 gene locus_tag LOCUS_11550 7682 8629 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060778.1 protein_id gnl|my_center|LOCUS_11550 8639 9142 gene locus_tag LOCUS_11560 8639 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11560 9153 9623 gene locus_tag LOCUS_11570 9153 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11570 9664 10176 gene locus_tag LOCUS_11580 9664 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11580 10848 10159 gene locus_tag LOCUS_11590 10848 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892482.1 protein_id gnl|my_center|LOCUS_11590 11704 10853 gene locus_tag LOCUS_11600 11704 10853 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence050 603 1841 gene locus_tag LOCUS_11610 603 1841 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_11610 1872 2432 gene locus_tag LOCUS_11620 1872 2432 CDS product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 protein_id gnl|my_center|LOCUS_11620 2429 2743 gene locus_tag LOCUS_11630 2429 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2761 3765 gene locus_tag LOCUS_11640 2761 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3802 4350 gene locus_tag LOCUS_11650 3802 4350 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_11650 4438 5799 gene locus_tag LOCUS_11660 4438 5799 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082217.1 protein_id gnl|my_center|LOCUS_11660 6767 5820 gene locus_tag LOCUS_11670 6767 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7179 6781 gene locus_tag LOCUS_11680 7179 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7308 8330 gene locus_tag LOCUS_11690 gene cfbD 7308 8330 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877132.1 protein_id gnl|my_center|LOCUS_11690 8327 8923 gene locus_tag LOCUS_11700 gene hisH 8327 8923 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_11700 8926 10230 gene locus_tag LOCUS_11710 8926 10230 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061078.1 protein_id gnl|my_center|LOCUS_11710 10310 10747 gene locus_tag LOCUS_11720 10310 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 10796 10871 gene locus_tag LOCUS_t00150 10796 10871 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11015 12118 gene locus_tag LOCUS_11730 gene truD 11015 12118 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877138.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence051 5054 2736 gene locus_tag LOCUS_11740 gene nrdD 5054 2736 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330373.1 protein_id gnl|my_center|LOCUS_11740 8572 5273 gene locus_tag LOCUS_11750 gene polC 8572 5273 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061308.1 protein_id gnl|my_center|LOCUS_11750 8760 9818 gene locus_tag LOCUS_11760 8760 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 9852 10340 gene locus_tag LOCUS_11770 9852 10340 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_11770 10321 10698 gene locus_tag LOCUS_11780 10321 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 12628 11045 gene locus_tag LOCUS_11790 gene lysS 12628 11045 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence052 582 364 gene locus_tag LOCUS_11800 582 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 608 748 gene locus_tag LOCUS_11810 608 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1901 1200 gene locus_tag LOCUS_11820 1901 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3754 2108 gene locus_tag LOCUS_11830 3754 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11830 5325 3757 gene locus_tag LOCUS_11840 5325 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 5684 5523 gene locus_tag LOCUS_11850 5684 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 6077 6343 gene locus_tag LOCUS_11860 6077 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6353 8500 gene locus_tag LOCUS_11870 6353 8500 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_11870 8549 9253 gene locus_tag LOCUS_11880 8549 9253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816854.1 protein_id gnl|my_center|LOCUS_11880 9258 9470 gene locus_tag LOCUS_11890 9258 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 9480 11552 gene locus_tag LOCUS_11900 9480 11552 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307275.1 protein_id gnl|my_center|LOCUS_11900 11930 11610 gene locus_tag LOCUS_11910 11930 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 12389 11985 gene locus_tag LOCUS_11920 12389 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11920 >Feature sequence053 359 529 gene locus_tag LOCUS_11930 359 529 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875681.1 protein_id gnl|my_center|LOCUS_11930 639 800 gene locus_tag LOCUS_11940 639 800 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828720.1 protein_id gnl|my_center|LOCUS_11940 943 2187 gene locus_tag LOCUS_11950 gene eno 943 2187 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_11950 2210 2404 gene locus_tag LOCUS_11960 2210 2404 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_11960 2423 3025 gene locus_tag LOCUS_11970 gene rpsB 2423 3025 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875684.1 protein_id gnl|my_center|LOCUS_11970 3035 3874 gene locus_tag LOCUS_11980 gene amrB 3035 3874 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_11980 3884 4846 gene locus_tag LOCUS_11990 gene mvk 3884 4846 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 protein_id gnl|my_center|LOCUS_11990 4851 5648 gene locus_tag LOCUS_12000 4851 5648 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_12000 5652 6698 gene locus_tag LOCUS_12010 gene fni 5652 6698 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_12010 6702 8045 gene locus_tag LOCUS_12020 6702 8045 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875689.1 protein_id gnl|my_center|LOCUS_12020 8059 9039 gene locus_tag LOCUS_12030 gene idsA 8059 9039 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_12030 9600 10607 gene locus_tag LOCUS_12040 9600 10607 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869499.1 protein_id gnl|my_center|LOCUS_12040 10620 11759 gene locus_tag LOCUS_12050 10620 11759 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943325.1 protein_id gnl|my_center|LOCUS_12050 11769 12173 gene locus_tag LOCUS_12060 11769 12173 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence054 712 236 gene locus_tag LOCUS_12070 712 236 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060987.1 protein_id gnl|my_center|LOCUS_12070 2114 951 gene locus_tag LOCUS_12080 2114 951 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_12080 2222 3325 gene locus_tag LOCUS_12090 2222 3325 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_12090 3637 3332 gene locus_tag LOCUS_12100 3637 3332 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_12100 3688 4563 gene locus_tag LOCUS_12110 3688 4563 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876810.1 protein_id gnl|my_center|LOCUS_12110 5466 4522 gene locus_tag LOCUS_12120 5466 4522 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_12120 6726 5470 gene locus_tag LOCUS_12130 6726 5470 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_12130 7028 6816 gene locus_tag LOCUS_12140 7028 6816 CDS product DUF1922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876808.1 protein_id gnl|my_center|LOCUS_12140 8268 7096 gene locus_tag LOCUS_12150 8268 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 9159 8476 gene locus_tag LOCUS_12160 gene comB 9159 8476 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876806.1 protein_id gnl|my_center|LOCUS_12160 9199 9717 gene locus_tag LOCUS_12170 9199 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060984.1 protein_id gnl|my_center|LOCUS_12170 9780 10703 gene locus_tag LOCUS_12180 9780 10703 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876804.1 protein_id gnl|my_center|LOCUS_12180 11735 10713 gene locus_tag LOCUS_12190 gene mmp10 11735 10713 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876794.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence055 1598 6 gene locus_tag LOCUS_12200 1598 6 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_12200 3093 1612 gene locus_tag LOCUS_12210 3093 1612 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990274.1 protein_id gnl|my_center|LOCUS_12210 3750 10931 gene locus_tag LOCUS_12220 3750 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 >Feature sequence056 <1 555 gene locus_tag LOCUS_12230 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875834.1:MFS transporter 965 552 gene locus_tag LOCUS_12240 965 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1374 958 gene locus_tag LOCUS_12250 1374 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2968 2537 gene locus_tag LOCUS_12260 2968 2537 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_12260 3039 4199 gene locus_tag LOCUS_12270 3039 4199 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_12270 4223 4924 gene locus_tag LOCUS_12280 4223 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 5325 4921 gene locus_tag LOCUS_12290 5325 4921 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023884.1 protein_id gnl|my_center|LOCUS_12290 5456 6739 gene locus_tag LOCUS_12300 gene lysA 5456 6739 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_12300 6749 7609 gene locus_tag LOCUS_12310 gene dapF 6749 7609 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 protein_id gnl|my_center|LOCUS_12310 7779 7615 gene locus_tag LOCUS_12320 7779 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 8377 7793 gene locus_tag LOCUS_12330 8377 7793 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_12330 9254 8382 gene locus_tag LOCUS_12340 gene rsmA 9254 8382 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876939.1 protein_id gnl|my_center|LOCUS_12340 9907 9263 gene locus_tag LOCUS_12350 9907 9263 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_12350 10412 10065 gene locus_tag LOCUS_12360 10412 10065 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_12360 10708 10418 gene locus_tag LOCUS_12370 10708 10418 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876936.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence057 <1 4939 gene locus_tag LOCUS_12380 <1 4939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009967354.1:plipastatin non-ribosomal peptide synthetase PpsD 4954 6648 gene locus_tag LOCUS_12390 4954 6648 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_12390 6746 6985 gene locus_tag LOCUS_12400 6746 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7015 7761 gene locus_tag LOCUS_12410 7015 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12410 7782 8270 gene locus_tag LOCUS_12420 7782 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8544 9089 gene locus_tag LOCUS_12430 8544 9089 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_12430 9838 9140 gene locus_tag LOCUS_12440 9838 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 10560 9859 gene locus_tag LOCUS_12450 10560 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 11008 10574 gene locus_tag LOCUS_12460 11008 10574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 11317 11499 gene locus_tag LOCUS_12470 11317 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence058 1881 58 gene locus_tag LOCUS_12480 1881 58 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877065.1 protein_id gnl|my_center|LOCUS_12480 1980 3335 gene locus_tag LOCUS_12490 gene cfbB 1980 3335 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_12490 3339 4400 gene locus_tag LOCUS_12500 3339 4400 CDS product oligosaccharide repeat unit polymerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877071.1 protein_id gnl|my_center|LOCUS_12500 5285 4386 gene locus_tag LOCUS_12510 5285 4386 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061050.1 protein_id gnl|my_center|LOCUS_12510 5414 6190 gene locus_tag LOCUS_12520 gene surE 5414 6190 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_12520 6339 6196 gene locus_tag LOCUS_12530 6339 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6419 6622 gene locus_tag LOCUS_12540 6419 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 7633 6629 gene locus_tag LOCUS_12550 7633 6629 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061052.1 protein_id gnl|my_center|LOCUS_12550 8686 7694 gene locus_tag LOCUS_12560 gene ilvC 8686 7694 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061053.1 protein_id gnl|my_center|LOCUS_12560 8862 10940 gene locus_tag LOCUS_12570 8862 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 11475 10948 gene locus_tag LOCUS_12580 11475 10948 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence059 <1 642 gene locus_tag LOCUS_12590 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876384.1:4Fe-4S dicluster domain-containing protein 749 1144 gene locus_tag LOCUS_12600 749 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1157 2851 gene locus_tag LOCUS_12610 gene glyS 1157 2851 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061155.1 protein_id gnl|my_center|LOCUS_12610 3636 2860 gene locus_tag LOCUS_12620 3636 2860 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020249.1 protein_id gnl|my_center|LOCUS_12620 3823 4587 gene locus_tag LOCUS_12630 3823 4587 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061154.1 protein_id gnl|my_center|LOCUS_12630 4863 4693 gene locus_tag LOCUS_12640 4863 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 5021 5512 gene locus_tag LOCUS_12650 5021 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 6129 5518 gene locus_tag LOCUS_12660 6129 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7187 6135 gene locus_tag LOCUS_12670 7187 6135 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877439.1 protein_id gnl|my_center|LOCUS_12670 7376 8320 gene locus_tag LOCUS_12680 7376 8320 CDS product 3H domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877437.1 protein_id gnl|my_center|LOCUS_12680 8313 8894 gene locus_tag LOCUS_12690 8313 8894 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877436.1 protein_id gnl|my_center|LOCUS_12690 9343 8903 gene locus_tag LOCUS_12700 9343 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061151.1 protein_id gnl|my_center|LOCUS_12700 <11702 9611 gene locus_tag LOCUS_12710 <11702 9611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876698.1:DUF11 domain-containing protein >Feature sequence060 56 697 gene locus_tag LOCUS_12720 gene rpsE 56 697 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192961070.1 protein_id gnl|my_center|LOCUS_12720 710 1168 gene locus_tag LOCUS_12730 gene rpmD 710 1168 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_12730 1183 1620 gene locus_tag LOCUS_12740 1183 1620 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_12740 1652 3013 gene locus_tag LOCUS_12750 gene secY 1652 3013 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_12750 3054 3629 gene locus_tag LOCUS_12760 3054 3629 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_12760 3640 4218 gene locus_tag LOCUS_12770 3640 4218 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_12770 4335 4601 gene locus_tag LOCUS_12780 4335 4601 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875671.1 protein_id gnl|my_center|LOCUS_12780 4601 5122 gene locus_tag LOCUS_12790 4601 5122 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870161.1 protein_id gnl|my_center|LOCUS_12790 5123 5344 gene locus_tag LOCUS_12800 5123 5344 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875673.1 protein_id gnl|my_center|LOCUS_12800 5413 6378 gene locus_tag LOCUS_12810 5413 6378 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_12810 6553 7110 gene locus_tag LOCUS_12820 6553 7110 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_12820 7124 8914 gene locus_tag LOCUS_12830 7124 8914 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_12830 9010 10722 gene locus_tag LOCUS_12840 9010 10722 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_12840 10878 10964 gene locus_tag LOCUS_t00160 10878 10964 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence061 1153 965 gene locus_tag LOCUS_12850 1153 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 4106 1146 gene locus_tag LOCUS_12860 4106 1146 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_12860 4242 4099 gene locus_tag LOCUS_12870 4242 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4636 4244 gene locus_tag LOCUS_12880 gene mutT 4636 4244 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_12880 6771 4894 gene locus_tag LOCUS_12890 6771 4894 CDS product DUF2357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876141.1 protein_id gnl|my_center|LOCUS_12890 8567 6780 gene locus_tag LOCUS_12900 8567 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 8732 9961 gene locus_tag LOCUS_12910 8732 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10102 10500 gene locus_tag LOCUS_12920 10102 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 10852 10571 gene locus_tag LOCUS_12930 10852 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 11215 11364 gene locus_tag LOCUS_12940 11215 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence062 4951 10611 gene locus_tag LOCUS_12950 4951 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence063 <1 1903 gene locus_tag LOCUS_12960 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877454.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 1908 2492 gene locus_tag LOCUS_12970 gene iorB 1908 2492 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_12970 2548 2826 gene locus_tag LOCUS_12980 2548 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 3420 2989 gene locus_tag LOCUS_12990 3420 2989 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_12990 4730 3429 gene locus_tag LOCUS_13000 4730 3429 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877457.1 protein_id gnl|my_center|LOCUS_13000 4942 6552 gene locus_tag LOCUS_13010 4942 6552 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877458.1 protein_id gnl|my_center|LOCUS_13010 7171 6896 gene locus_tag LOCUS_13020 7171 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7460 7173 gene locus_tag LOCUS_13030 7460 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7621 8340 gene locus_tag LOCUS_13040 7621 8340 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_13040 8392 9777 gene locus_tag LOCUS_13050 8392 9777 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895854.1 protein_id gnl|my_center|LOCUS_13050 10209 9805 gene locus_tag LOCUS_13060 10209 9805 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860716.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence064 <1 1424 gene locus_tag LOCUS_13070 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022072.1:MEDS domain-containing protein 1473 3242 gene locus_tag LOCUS_13080 1473 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3302 3712 gene locus_tag LOCUS_13090 3302 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3719 5464 gene locus_tag LOCUS_13100 3719 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5464 6081 gene locus_tag LOCUS_13110 5464 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6402 6199 gene locus_tag LOCUS_13120 6402 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 6803 6324 gene locus_tag LOCUS_13130 6803 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7394 6804 gene locus_tag LOCUS_13140 7394 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 8091 7402 gene locus_tag LOCUS_13150 8091 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 9336 8101 gene locus_tag LOCUS_13160 9336 8101 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence065 357 7628 gene locus_tag LOCUS_13170 gene ppsB 357 7628 CDS product plipastatin non-ribosomal peptide synthetase PpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247155.1 protein_id gnl|my_center|LOCUS_13170 7702 8205 gene locus_tag LOCUS_13180 7702 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13180 8438 10708 gene locus_tag LOCUS_13190 8438 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence066 1869 343 gene locus_tag LOCUS_13200 1869 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2684 1881 gene locus_tag LOCUS_13210 2684 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence067 697 1620 gene locus_tag LOCUS_13220 gene mer 697 1620 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877358.1 protein_id gnl|my_center|LOCUS_13220 1687 2769 gene locus_tag LOCUS_13230 1687 2769 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870054.1 protein_id gnl|my_center|LOCUS_13230 2812 3135 gene locus_tag LOCUS_13240 2812 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3246 4502 gene locus_tag LOCUS_13250 3246 4502 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892544.1 protein_id gnl|my_center|LOCUS_13250 5226 4489 gene locus_tag LOCUS_13260 5226 4489 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877353.1 protein_id gnl|my_center|LOCUS_13260 6095 5235 gene locus_tag LOCUS_13270 6095 5235 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_13270 6301 6098 gene locus_tag LOCUS_13280 6301 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 7222 6302 gene locus_tag LOCUS_13290 7222 6302 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877348.1 protein_id gnl|my_center|LOCUS_13290 7712 7233 gene locus_tag LOCUS_13300 7712 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13300 8376 7642 gene locus_tag LOCUS_13310 8376 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13310 9232 8378 gene locus_tag LOCUS_13320 9232 8378 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_13320 9358 9732 gene locus_tag LOCUS_13330 9358 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 <10754 9735 gene locus_tag LOCUS_13340 <10754 9735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877347.1:dihydropteroate synthase-like protein >Feature sequence068 <1 755 gene locus_tag LOCUS_13350 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101060.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted 736 751 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 769 4194 gene locus_tag LOCUS_13360 769 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 4092 6218 gene locus_tag LOCUS_13370 4092 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13370 6235 7920 gene locus_tag LOCUS_13380 6235 7920 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_13380 8347 8048 gene locus_tag LOCUS_13390 8347 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 8487 8759 gene locus_tag LOCUS_13400 8487 8759 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_13400 9023 9226 gene locus_tag LOCUS_13410 9023 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 <10664 9246 gene locus_tag LOCUS_13420 <10664 9246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203082.1:SpoIIE family protein phosphatase >Feature sequence069 <1 2160 gene locus_tag LOCUS_13430 <1 2160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060872.1:DUF5814 domain-containing protein 2167 3765 gene locus_tag LOCUS_13440 2167 3765 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207749.1 protein_id gnl|my_center|LOCUS_13440 3774 4220 gene locus_tag LOCUS_13450 3774 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 4616 4194 gene locus_tag LOCUS_13460 4616 4194 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060865.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence070 861 259 gene locus_tag LOCUS_13470 861 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1494 886 gene locus_tag LOCUS_13480 1494 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence071 75 2789 gene locus_tag LOCUS_13490 75 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2767 9063 gene locus_tag LOCUS_13500 2767 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence072 216 37 gene locus_tag LOCUS_13510 216 37 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876922.1 protein_id gnl|my_center|LOCUS_13510 504 226 gene locus_tag LOCUS_13520 504 226 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876923.1 protein_id gnl|my_center|LOCUS_13520 1617 727 gene locus_tag LOCUS_13530 1617 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061021.1 protein_id gnl|my_center|LOCUS_13530 2407 1673 gene locus_tag LOCUS_13540 gene pcn 2407 1673 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876925.1 protein_id gnl|my_center|LOCUS_13540 3262 2492 gene locus_tag LOCUS_13550 gene trpA 3262 2492 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_13550 4439 3255 gene locus_tag LOCUS_13560 gene trpB 4439 3255 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_13560 5035 4436 gene locus_tag LOCUS_13570 5035 4436 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_13570 5804 5028 gene locus_tag LOCUS_13580 gene trpC 5804 5028 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_13580 6817 5810 gene locus_tag LOCUS_13590 gene trpD 6817 5810 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_13590 7398 6814 gene locus_tag LOCUS_13600 7398 6814 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636333.1 protein_id gnl|my_center|LOCUS_13600 8891 7395 gene locus_tag LOCUS_13610 gene trpE 8891 7395 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_13610 9380 8979 gene locus_tag LOCUS_13620 9380 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence073 1420 335 gene locus_tag LOCUS_13630 1420 335 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249900.1 protein_id gnl|my_center|LOCUS_13630 1973 1830 gene locus_tag LOCUS_13640 1973 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 3504 2416 gene locus_tag LOCUS_13650 gene cbiD 3504 2416 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876443.1 protein_id gnl|my_center|LOCUS_13650 3797 3537 gene locus_tag LOCUS_13660 3797 3537 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869805.1 protein_id gnl|my_center|LOCUS_13660 3935 6007 gene locus_tag LOCUS_13670 gene hel308 3935 6007 CDS product ATP-dependent DNA helicase Hel308 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876445.1 protein_id gnl|my_center|LOCUS_13670 6328 6029 gene locus_tag LOCUS_13680 6328 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6622 6350 gene locus_tag LOCUS_13690 6622 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 6733 8397 gene locus_tag LOCUS_13700 6733 8397 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061250.1 protein_id gnl|my_center|LOCUS_13700 8455 9174 gene locus_tag LOCUS_13710 gene deoC 8455 9174 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 protein_id gnl|my_center|LOCUS_13710 9362 9288 gene locus_tag LOCUS_t00170 9362 9288 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 1409 81 gene locus_tag LOCUS_13720 1409 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1587 1979 gene locus_tag LOCUS_13730 1587 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2313 3614 gene locus_tag LOCUS_13740 2313 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3742 4932 gene locus_tag LOCUS_13750 3742 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5283 6665 gene locus_tag LOCUS_13760 5283 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 7293 6847 gene locus_tag LOCUS_13770 7293 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7745 7332 gene locus_tag LOCUS_13780 7745 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7851 7726 gene locus_tag LOCUS_13790 7851 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8091 7942 gene locus_tag LOCUS_13800 8091 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 8522 8103 gene locus_tag LOCUS_13810 8522 8103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 8761 8519 gene locus_tag LOCUS_13820 8761 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 8902 9585 gene locus_tag LOCUS_13830 8902 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence075 312 1148 gene locus_tag LOCUS_13840 312 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2332 1178 gene locus_tag LOCUS_13850 gene thiI 2332 1178 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_13850 6245 2628 gene locus_tag LOCUS_13860 6245 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 6933 6220 gene locus_tag LOCUS_13870 6933 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 <9723 6936 gene locus_tag LOCUS_13880 <9723 6936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS type B sorting domain-containing protein >Feature sequence076 <1 1158 gene locus_tag LOCUS_13890 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061008.1:succinylglutamate desuccinylase/aspartoacylase family protein 1241 2104 gene locus_tag LOCUS_13900 1241 2104 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_13900 2284 3975 gene locus_tag LOCUS_13910 2284 3975 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209580.1 protein_id gnl|my_center|LOCUS_13910 4024 5760 gene locus_tag LOCUS_13920 4024 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 6141 5827 gene locus_tag LOCUS_13930 6141 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 6338 6718 gene locus_tag LOCUS_13940 6338 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6734 7381 gene locus_tag LOCUS_13950 6734 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7527 8342 gene locus_tag LOCUS_13960 7527 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8419 9030 gene locus_tag LOCUS_13970 8419 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 9314 9544 gene locus_tag LOCUS_13980 9314 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence077 3877 185 gene locus_tag LOCUS_13990 3877 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4544 4098 gene locus_tag LOCUS_14000 4544 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5217 4531 gene locus_tag LOCUS_14010 5217 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5512 5336 gene locus_tag LOCUS_14020 5512 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5958 5494 gene locus_tag LOCUS_14030 5958 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 6513 5992 gene locus_tag LOCUS_14040 6513 5992 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_14040 6963 6514 gene locus_tag LOCUS_14050 gene dtd 6963 6514 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691400.1 protein_id gnl|my_center|LOCUS_14050 8019 7006 gene locus_tag LOCUS_14060 8019 7006 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_14060 8714 8022 gene locus_tag LOCUS_14070 8714 8022 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_14070 9112 8927 gene locus_tag LOCUS_14080 9112 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 9546 9109 gene locus_tag LOCUS_14090 9546 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence078 1399 830 gene locus_tag LOCUS_14100 1399 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1642 1412 gene locus_tag LOCUS_14110 1642 1412 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877164.1 protein_id gnl|my_center|LOCUS_14110 2748 1651 gene locus_tag LOCUS_14120 2748 1651 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_14120 3199 2750 gene locus_tag LOCUS_14130 3199 2750 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061085.1 protein_id gnl|my_center|LOCUS_14130 3621 4661 gene locus_tag LOCUS_14140 3621 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4663 5592 gene locus_tag LOCUS_14150 gene moaA 4663 5592 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061083.1 protein_id gnl|my_center|LOCUS_14150 5620 7935 gene locus_tag LOCUS_14160 5620 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 9316 8996 gene locus_tag LOCUS_14170 9316 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 >Feature sequence079 333 950 gene locus_tag LOCUS_14180 333 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1030 1233 gene locus_tag LOCUS_14190 1030 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1237 1575 gene locus_tag LOCUS_14200 1237 1575 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_14200 2205 1627 gene locus_tag LOCUS_14210 2205 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3181 2378 gene locus_tag LOCUS_14220 gene budA 3181 2378 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966250.1 protein_id gnl|my_center|LOCUS_14220 3414 4652 gene locus_tag LOCUS_14230 3414 4652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693428.1 protein_id gnl|my_center|LOCUS_14230 6446 4719 gene locus_tag LOCUS_14240 6446 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 8226 6535 gene locus_tag LOCUS_14250 8226 6535 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209580.1 protein_id gnl|my_center|LOCUS_14250 8864 9244 gene locus_tag LOCUS_14260 8864 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence080 4044 256 gene locus_tag LOCUS_14270 4044 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4304 4495 gene locus_tag LOCUS_14280 4304 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8966 4464 gene locus_tag LOCUS_14290 8966 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence081 8090 1113 gene locus_tag LOCUS_14300 8090 1113 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605281.1 protein_id gnl|my_center|LOCUS_14300 8859 8104 gene locus_tag LOCUS_14310 8859 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence082 4873 5715 gene locus_tag LOCUS_14320 4873 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 5765 6700 gene locus_tag LOCUS_14330 gene dusB 5765 6700 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243741.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence083 499 224 gene locus_tag LOCUS_14340 499 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 762 514 gene locus_tag LOCUS_14350 762 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3364 1895 gene locus_tag LOCUS_14360 3364 1895 CDS product DUF2779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846383.1 protein_id gnl|my_center|LOCUS_14360 4142 3369 gene locus_tag LOCUS_14370 4142 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4580 4257 gene locus_tag LOCUS_14380 4580 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 5081 4617 gene locus_tag LOCUS_14390 5081 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5987 5091 gene locus_tag LOCUS_14400 5987 5091 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_14400 7057 5984 gene locus_tag LOCUS_14410 7057 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 8655 7375 gene locus_tag LOCUS_14420 8655 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence084 798 457 gene locus_tag LOCUS_14430 798 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14430 878 1114 gene locus_tag LOCUS_14440 878 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14440 1074 1427 gene locus_tag LOCUS_14450 1074 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14450 2082 1435 gene locus_tag LOCUS_14460 2082 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4063 2072 gene locus_tag LOCUS_14470 4063 2072 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223224.1 protein_id gnl|my_center|LOCUS_14470 4622 4098 gene locus_tag LOCUS_14480 4622 4098 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080817300.1 protein_id gnl|my_center|LOCUS_14480 5154 4633 gene locus_tag LOCUS_14490 5154 4633 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876446.1 protein_id gnl|my_center|LOCUS_14490 5261 5905 gene locus_tag LOCUS_14500 5261 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 5960 6427 gene locus_tag LOCUS_14510 5960 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457324.1 protein_id gnl|my_center|LOCUS_14510 6548 7000 gene locus_tag LOCUS_14520 gene nikR 6548 7000 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876378.1 protein_id gnl|my_center|LOCUS_14520 7018 7788 gene locus_tag LOCUS_14530 7018 7788 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876377.1 protein_id gnl|my_center|LOCUS_14530 7802 8284 gene locus_tag LOCUS_14540 gene hycI 7802 8284 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence085 559 1371 gene locus_tag LOCUS_14550 559 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2082 1405 gene locus_tag LOCUS_14560 2082 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2404 5640 gene locus_tag LOCUS_14570 gene ileS 2404 5640 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_14570 5650 7791 gene locus_tag LOCUS_14580 gene purL 5650 7791 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876986.1 protein_id gnl|my_center|LOCUS_14580 7813 9030 gene locus_tag LOCUS_14590 7813 9030 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876981.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence086 223 666 gene locus_tag LOCUS_14600 223 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 669 1304 gene locus_tag LOCUS_14610 669 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1294 2457 gene locus_tag LOCUS_14620 1294 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3276 2473 gene locus_tag LOCUS_14630 3276 2473 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966202.1 protein_id gnl|my_center|LOCUS_14630 3538 3900 gene locus_tag LOCUS_14640 3538 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4007 4819 gene locus_tag LOCUS_14650 4007 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5131 6108 gene locus_tag LOCUS_14660 5131 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 6363 7100 gene locus_tag LOCUS_14670 6363 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 7107 7241 gene locus_tag LOCUS_14680 7107 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 7271 7636 gene locus_tag LOCUS_14690 7271 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 7766 7963 gene locus_tag LOCUS_14700 7766 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 8130 8273 gene locus_tag LOCUS_14710 8130 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8365 8547 gene locus_tag LOCUS_14720 8365 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence087 709 20 gene locus_tag LOCUS_14730 709 20 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_14730 1246 719 gene locus_tag LOCUS_14740 1246 719 CDS product DUF2096 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877483.1 protein_id gnl|my_center|LOCUS_14740 1509 1243 gene locus_tag LOCUS_14750 1509 1243 CDS product DUF749 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877482.1 protein_id gnl|my_center|LOCUS_14750 2597 1701 gene locus_tag LOCUS_14760 gene hdrB 2597 1701 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877481.1 protein_id gnl|my_center|LOCUS_14760 3610 2621 gene locus_tag LOCUS_14770 3610 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3794 4537 gene locus_tag LOCUS_14780 3794 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877479.1 protein_id gnl|my_center|LOCUS_14780 4951 4529 gene locus_tag LOCUS_14790 4951 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5866 4955 gene locus_tag LOCUS_14800 5866 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6120 5965 gene locus_tag LOCUS_14810 6120 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 6474 6331 gene locus_tag LOCUS_14820 6474 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6775 7710 gene locus_tag LOCUS_14830 6775 7710 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_14830 8393 8088 gene locus_tag LOCUS_14840 8393 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14840 8898 8386 gene locus_tag LOCUS_14850 8898 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14850 >Feature sequence088 1544 153 gene locus_tag LOCUS_14860 1544 153 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_14860 2047 1601 gene locus_tag LOCUS_14870 2047 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2783 2262 gene locus_tag LOCUS_14880 2783 2262 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_14880 3234 2788 gene locus_tag LOCUS_14890 gene dtd 3234 2788 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 protein_id gnl|my_center|LOCUS_14890 4292 3279 gene locus_tag LOCUS_14900 4292 3279 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_14900 4987 4295 gene locus_tag LOCUS_14910 4987 4295 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_14910 5553 8015 gene locus_tag LOCUS_14920 5553 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_14920 8422 8240 gene locus_tag LOCUS_14930 8422 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 8856 8419 gene locus_tag LOCUS_14940 8856 8419 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060743.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence089 5175 577 gene locus_tag LOCUS_14950 5175 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 5604 5407 gene locus_tag LOCUS_14960 5604 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 6785 6958 gene locus_tag LOCUS_14970 6785 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6960 7343 gene locus_tag LOCUS_14980 6960 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 7774 8694 gene locus_tag LOCUS_14990 7774 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence090 5 1219 gene locus_tag LOCUS_15000 5 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1730 1416 gene locus_tag LOCUS_15010 1730 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2615 1953 gene locus_tag LOCUS_15020 2615 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4257 3004 gene locus_tag LOCUS_15030 4257 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4537 4367 gene locus_tag LOCUS_15040 4537 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7303 4646 gene locus_tag LOCUS_15050 7303 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 8297 7698 gene locus_tag LOCUS_15060 8297 7698 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence091 932 1174 gene locus_tag LOCUS_15070 932 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1242 2264 gene locus_tag LOCUS_15080 1242 2264 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922256.1 protein_id gnl|my_center|LOCUS_15080 2427 2299 gene locus_tag LOCUS_15090 2427 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2537 2547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2710 4059 gene locus_tag LOCUS_15100 gene cfbB 2710 4059 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_15100 4061 4846 gene locus_tag LOCUS_15110 4061 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 4870 5097 gene locus_tag LOCUS_15120 4870 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15120 6041 5136 gene locus_tag LOCUS_15130 6041 5136 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061050.1 protein_id gnl|my_center|LOCUS_15130 6368 7144 gene locus_tag LOCUS_15140 gene surE 6368 7144 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_15140 7311 7150 gene locus_tag LOCUS_15150 7311 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7370 7567 gene locus_tag LOCUS_15160 7370 7567 CDS product LSM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877050.1 protein_id gnl|my_center|LOCUS_15160 8568 7564 gene locus_tag LOCUS_15170 8568 7564 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061052.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence092 1844 483 gene locus_tag LOCUS_15180 1844 483 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_15180 2224 8250 gene locus_tag LOCUS_15190 2224 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence093 902 348 gene locus_tag LOCUS_15200 902 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1359 1111 gene locus_tag LOCUS_15210 1359 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2116 1529 gene locus_tag LOCUS_15220 2116 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3067 2120 gene locus_tag LOCUS_15230 3067 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3523 3266 gene locus_tag LOCUS_15240 3523 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3575 3742 gene locus_tag LOCUS_15250 3575 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 4118 3747 gene locus_tag LOCUS_15260 4118 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 5606 4245 gene locus_tag LOCUS_15270 5606 4245 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_15270 6524 5961 gene locus_tag LOCUS_15280 6524 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 7242 6517 gene locus_tag LOCUS_15290 7242 6517 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769912.1 protein_id gnl|my_center|LOCUS_15290 7571 7245 gene locus_tag LOCUS_15300 7571 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence094 1285 989 gene locus_tag LOCUS_15310 1285 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1380 1551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2231 2743 gene locus_tag LOCUS_15320 2231 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3132 2764 gene locus_tag LOCUS_15330 3132 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3675 3166 gene locus_tag LOCUS_15340 3675 3166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_15340 4705 3704 gene locus_tag LOCUS_15350 4705 3704 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_15350 5403 4711 gene locus_tag LOCUS_15360 5403 4711 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_15360 5709 6623 gene locus_tag LOCUS_15370 5709 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6740 7222 gene locus_tag LOCUS_15380 6740 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8629 7208 gene locus_tag LOCUS_15390 8629 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence095 179 994 gene locus_tag LOCUS_15400 gene mtrC 179 994 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876785.1 protein_id gnl|my_center|LOCUS_15400 1012 1341 gene locus_tag LOCUS_15410 1012 1341 CDS product tetrahydromethanopterin S-methyltransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876784.1 protein_id gnl|my_center|LOCUS_15410 1342 2055 gene locus_tag LOCUS_15420 gene mtrA 1342 2055 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_15420 2069 2275 gene locus_tag LOCUS_15430 gene mtrF 2069 2275 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876782.1 protein_id gnl|my_center|LOCUS_15430 2288 2530 gene locus_tag LOCUS_15440 gene mtrG 2288 2530 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876781.1 protein_id gnl|my_center|LOCUS_15440 2544 3476 gene locus_tag LOCUS_15450 gene mtrH 2544 3476 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_15450 3634 5103 gene locus_tag LOCUS_15460 3634 5103 CDS product methanogenesis marker 14 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060979.1 protein_id gnl|my_center|LOCUS_15460 5120 5728 gene locus_tag LOCUS_15470 5120 5728 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_15470 5784 6050 gene locus_tag LOCUS_15480 5784 6050 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876775.1 protein_id gnl|my_center|LOCUS_15480 6184 6939 gene locus_tag LOCUS_15490 gene sufC 6184 6939 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_15490 6899 8158 gene locus_tag LOCUS_15500 6899 8158 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence096 <1 946 gene locus_tag LOCUS_15510 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876381.1:phenylalanine--tRNA ligase subunit alpha 1524 1534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2237 1545 gene locus_tag LOCUS_15520 2237 1545 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875848.1 protein_id gnl|my_center|LOCUS_15520 2959 2276 gene locus_tag LOCUS_15530 gene polB2 2959 2276 CDS product DNA polymerase PolB subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875847.1 protein_id gnl|my_center|LOCUS_15530 3142 3504 gene locus_tag LOCUS_15540 3142 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3601 3768 gene locus_tag LOCUS_15550 3601 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3781 4062 gene locus_tag LOCUS_15560 3781 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4065 4298 gene locus_tag LOCUS_15570 4065 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 4553 4927 gene locus_tag LOCUS_15580 4553 4927 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_15580 5033 6052 gene locus_tag LOCUS_15590 gene hypE 5033 6052 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_15590 6062 6469 gene locus_tag LOCUS_15600 6062 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 6502 7140 gene locus_tag LOCUS_15610 6502 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 7609 7142 gene locus_tag LOCUS_15620 7609 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 8304 7612 gene locus_tag LOCUS_15630 8304 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence097 632 1237 gene locus_tag LOCUS_15640 632 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1203 1463 gene locus_tag LOCUS_15650 1203 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2023 1478 gene locus_tag LOCUS_15660 2023 1478 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_15660 2261 2863 gene locus_tag LOCUS_15670 2261 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2872 3048 gene locus_tag LOCUS_15680 2872 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4352 3081 gene locus_tag LOCUS_15690 gene hisD 4352 3081 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_15690 6009 4360 gene locus_tag LOCUS_15700 gene ilvD 6009 4360 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061057.1 protein_id gnl|my_center|LOCUS_15700 8290 6293 gene locus_tag LOCUS_15710 8290 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence098 1104 175 gene locus_tag LOCUS_15720 1104 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2035 1115 gene locus_tag LOCUS_15730 2035 1115 CDS product DUF2121 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876390.1 protein_id gnl|my_center|LOCUS_15730 2390 4486 gene locus_tag LOCUS_15740 2390 4486 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15740 4547 4909 gene locus_tag LOCUS_15750 4547 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4906 5532 gene locus_tag LOCUS_15760 4906 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 6524 5553 gene locus_tag LOCUS_15770 6524 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 6885 6685 gene locus_tag LOCUS_15780 6885 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7558 6932 gene locus_tag LOCUS_15790 7558 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 6951 6976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <8285 7596 gene locus_tag LOCUS_15800 <8285 7596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399785.1:bifunctional glutamate--cysteine ligase/glutathione synthetase >Feature sequence099 731 219 gene locus_tag LOCUS_15810 731 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2181 925 gene locus_tag LOCUS_15820 2181 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2347 3129 gene locus_tag LOCUS_15830 2347 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4978 3296 gene locus_tag LOCUS_15840 4978 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 <8282 4989 gene locus_tag LOCUS_15850 <8282 4989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211477902.1:non-ribosomal peptide synthetase >Feature sequence100 1016 774 gene locus_tag LOCUS_15860 1016 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1706 7807 gene locus_tag LOCUS_15870 1706 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence101 1650 262 gene locus_tag LOCUS_15880 1650 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15880 1916 1677 gene locus_tag LOCUS_15890 1916 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1813 2850 gene locus_tag LOCUS_15900 1813 2850 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_15900 2888 3274 gene locus_tag LOCUS_15910 2888 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3587 3294 gene locus_tag LOCUS_15920 3587 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3898 3584 gene locus_tag LOCUS_15930 3898 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 5078 3942 gene locus_tag LOCUS_15940 5078 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 5400 5083 gene locus_tag LOCUS_15950 5400 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5975 5403 gene locus_tag LOCUS_15960 5975 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 6946 6047 gene locus_tag LOCUS_15970 6946 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 7734 6952 gene locus_tag LOCUS_15980 7734 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence102 60 617 gene locus_tag LOCUS_15990 60 617 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 protein_id gnl|my_center|LOCUS_15990 628 1644 gene locus_tag LOCUS_16000 628 1644 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876491.1 protein_id gnl|my_center|LOCUS_16000 1674 2462 gene locus_tag LOCUS_16010 1674 2462 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767591.1 protein_id gnl|my_center|LOCUS_16010 2503 3924 gene locus_tag LOCUS_16020 2503 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4335 3946 gene locus_tag LOCUS_16030 4335 3946 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_16030 5251 4343 gene locus_tag LOCUS_16040 5251 4343 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_16040 5565 6518 gene locus_tag LOCUS_16050 5565 6518 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_16050 7709 6645 gene locus_tag LOCUS_16060 7709 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence103 716 1735 gene locus_tag LOCUS_16070 716 1735 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876254.1 protein_id gnl|my_center|LOCUS_16070 1915 2679 gene locus_tag LOCUS_16080 1915 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2698 3813 gene locus_tag LOCUS_16090 2698 3813 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_16090 4584 3901 gene locus_tag LOCUS_16100 4584 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 4730 7201 gene locus_tag LOCUS_16110 4730 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_16110 7973 7218 gene locus_tag LOCUS_16120 7973 7218 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence104 <1 712 gene locus_tag LOCUS_16130 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061020.1:translation initiation factor IF-2 subunit alpha 719 889 gene locus_tag LOCUS_16140 719 889 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876920.1 protein_id gnl|my_center|LOCUS_16140 893 1663 gene locus_tag LOCUS_16150 893 1663 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_16150 1699 2259 gene locus_tag LOCUS_16160 1699 2259 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_16160 2356 3468 gene locus_tag LOCUS_16170 2356 3468 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876918.1 protein_id gnl|my_center|LOCUS_16170 3544 3470 gene locus_tag LOCUS_t00180 3544 3470 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3672 3598 gene locus_tag LOCUS_t00190 3672 3598 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4290 3757 gene locus_tag LOCUS_16180 4290 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4449 5663 gene locus_tag LOCUS_16190 gene frhA 4449 5663 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061018.1 protein_id gnl|my_center|LOCUS_16190 5684 6256 gene locus_tag LOCUS_16200 gene frhD 5684 6256 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876914.1 protein_id gnl|my_center|LOCUS_16200 6256 7125 gene locus_tag LOCUS_16210 gene frhG 6256 7125 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876913.1 protein_id gnl|my_center|LOCUS_16210 7100 7957 gene locus_tag LOCUS_16220 gene frhB 7100 7957 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876912.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence105 737 588 gene locus_tag LOCUS_16230 737 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1153 890 gene locus_tag LOCUS_16240 1153 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1837 1430 gene locus_tag LOCUS_16250 1837 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1998 2540 gene locus_tag LOCUS_16260 1998 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 3919 3050 gene locus_tag LOCUS_16270 3919 3050 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330368.1 protein_id gnl|my_center|LOCUS_16270 4868 4050 gene locus_tag LOCUS_16280 4868 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6840 4783 gene locus_tag LOCUS_16290 6840 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 8022 6949 gene locus_tag LOCUS_16300 8022 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence106 281 2737 gene locus_tag LOCUS_16310 281 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_16310 3336 2926 gene locus_tag LOCUS_16320 3336 2926 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_16320 5771 3723 gene locus_tag LOCUS_16330 5771 3723 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_16330 6441 7613 gene locus_tag LOCUS_16340 6441 7613 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence107 7896 7324 gene locus_tag LOCUS_16350 7896 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence108 530 1573 gene locus_tag LOCUS_16360 530 1573 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200459.1 protein_id gnl|my_center|LOCUS_16360 2187 1687 gene locus_tag LOCUS_16370 2187 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3320 2382 gene locus_tag LOCUS_16380 3320 2382 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_16380 4206 3430 gene locus_tag LOCUS_16390 4206 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4974 4585 gene locus_tag LOCUS_16400 4974 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5095 5325 gene locus_tag LOCUS_16410 5095 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5347 6234 gene locus_tag LOCUS_16420 gene hmdB 5347 6234 CDS product 5,10-methenyltetrahydromethanopterin hydrogenase cofactor biosynthesis protein HmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876767.1 protein_id gnl|my_center|LOCUS_16420 6661 6239 gene locus_tag LOCUS_16430 6661 6239 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061237.1 protein_id gnl|my_center|LOCUS_16430 7231 6785 gene locus_tag LOCUS_16440 7231 6785 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750468.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence109 323 796 gene locus_tag LOCUS_16450 323 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 733 999 gene locus_tag LOCUS_16460 733 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1417 3063 gene locus_tag LOCUS_16470 1417 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3063 4838 gene locus_tag LOCUS_16480 3063 4838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813953.1 protein_id gnl|my_center|LOCUS_16480 4843 5097 gene locus_tag LOCUS_16490 4843 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 5597 6817 gene locus_tag LOCUS_16500 5597 6817 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_16500 7494 7339 gene locus_tag LOCUS_16510 7494 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence110 680 186 gene locus_tag LOCUS_16520 gene mcrD 680 186 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876755.1 protein_id gnl|my_center|LOCUS_16520 2022 691 gene locus_tag LOCUS_16530 gene mcrB 2022 691 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060974.1 protein_id gnl|my_center|LOCUS_16530 2929 2099 gene locus_tag LOCUS_16540 2929 2099 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877074.1 protein_id gnl|my_center|LOCUS_16540 3615 3376 gene locus_tag LOCUS_16550 3615 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 5515 4307 gene locus_tag LOCUS_16560 5515 4307 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_16560 5752 5985 gene locus_tag LOCUS_16570 5752 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 6535 5963 gene locus_tag LOCUS_16580 6535 5963 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence111 <1 817 gene locus_tag LOCUS_16590 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000086363.1:heavy metal translocating P-type ATPase 1507 896 gene locus_tag LOCUS_16600 1507 896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_16600 2397 1570 gene locus_tag LOCUS_16610 2397 1570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_16610 3261 2410 gene locus_tag LOCUS_16620 3261 2410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_16620 4249 3254 gene locus_tag LOCUS_16630 4249 3254 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_16630 5941 4325 gene locus_tag LOCUS_16640 5941 4325 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 protein_id gnl|my_center|LOCUS_16640 6214 7584 gene locus_tag LOCUS_16650 6214 7584 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence112 406 2406 gene locus_tag LOCUS_16660 406 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2495 3208 gene locus_tag LOCUS_16670 2495 3208 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330364.1 protein_id gnl|my_center|LOCUS_16670 3291 3806 gene locus_tag LOCUS_16680 gene endA 3291 3806 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_16680 3905 5002 gene locus_tag LOCUS_16690 3905 5002 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_16690 5002 5631 gene locus_tag LOCUS_16700 5002 5631 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892541.1 protein_id gnl|my_center|LOCUS_16700 5675 6868 gene locus_tag LOCUS_16710 gene thrC 5675 6868 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_16710 7123 7323 gene locus_tag LOCUS_16720 7123 7323 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876456.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence113 679 392 gene locus_tag LOCUS_16730 679 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1533 796 gene locus_tag LOCUS_16740 1533 796 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876521.1 protein_id gnl|my_center|LOCUS_16740 1961 3208 gene locus_tag LOCUS_16750 gene dnaG 1961 3208 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876524.1 protein_id gnl|my_center|LOCUS_16750 3385 3993 gene locus_tag LOCUS_16760 3385 3993 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_16760 4038 4424 gene locus_tag LOCUS_16770 4038 4424 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061260.1 protein_id gnl|my_center|LOCUS_16770 4484 4557 gene locus_tag LOCUS_t00200 4484 4557 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4586 5770 gene locus_tag LOCUS_16780 4586 5770 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296134.1 protein_id gnl|my_center|LOCUS_16780 5891 5742 gene locus_tag LOCUS_16790 5891 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 6209 6039 gene locus_tag LOCUS_16800 6209 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16800 6706 6215 gene locus_tag LOCUS_16810 6706 6215 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16810 <7509 6735 gene locus_tag LOCUS_16820 <7509 6735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013296141.1:ATP synthase subunit B >Feature sequence114 219 1514 gene locus_tag LOCUS_16830 219 1514 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814826.1 protein_id gnl|my_center|LOCUS_16830 3864 1558 gene locus_tag LOCUS_16840 3864 1558 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065616.1 protein_id gnl|my_center|LOCUS_16840 4802 3861 gene locus_tag LOCUS_16850 4802 3861 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023064.1 protein_id gnl|my_center|LOCUS_16850 5401 4799 gene locus_tag LOCUS_16860 5401 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6664 5414 gene locus_tag LOCUS_16870 6664 5414 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 protein_id gnl|my_center|LOCUS_16870 7493 6720 gene locus_tag LOCUS_16880 gene comA 7493 6720 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877281.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence115 >Feature sequence116 5964 2710 gene locus_tag LOCUS_16890 5964 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 <7340 5942 gene locus_tag LOCUS_16900 <7340 5942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001111655.1:Ig-like domain-containing protein >Feature sequence117 4234 2639 gene locus_tag LOCUS_16910 4234 2639 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061109.1 protein_id gnl|my_center|LOCUS_16910 4750 4244 gene locus_tag LOCUS_16920 4750 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4993 5871 gene locus_tag LOCUS_16930 4993 5871 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228167.1 protein_id gnl|my_center|LOCUS_16930 <7189 6059 gene locus_tag LOCUS_16940 <7189 6059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065244.1:ATP-binding protein >Feature sequence118 2955 4556 gene locus_tag LOCUS_16950 2955 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4680 6206 gene locus_tag LOCUS_16960 4680 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence119 566 745 gene locus_tag LOCUS_16970 566 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1282 830 gene locus_tag LOCUS_16980 1282 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1518 2825 gene locus_tag LOCUS_16990 gene hcp 1518 2825 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750458.1 protein_id gnl|my_center|LOCUS_16990 2829 3158 gene locus_tag LOCUS_17000 2829 3158 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_17000 4138 3323 gene locus_tag LOCUS_17010 4138 3323 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021151.1 protein_id gnl|my_center|LOCUS_17010 5151 4141 gene locus_tag LOCUS_17020 5151 4141 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_17020 5251 6921 gene locus_tag LOCUS_17030 gene gltX 5251 6921 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence120 270 1436 gene locus_tag LOCUS_17040 270 1436 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022050.1 protein_id gnl|my_center|LOCUS_17040 1444 2187 gene locus_tag LOCUS_17050 1444 2187 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_17050 2431 3786 gene locus_tag LOCUS_17060 gene glnA 2431 3786 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877179.1 protein_id gnl|my_center|LOCUS_17060 3838 5520 gene locus_tag LOCUS_17070 3838 5520 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061091.1 protein_id gnl|my_center|LOCUS_17070 5811 5521 gene locus_tag LOCUS_17080 5811 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 6207 5917 gene locus_tag LOCUS_17090 6207 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 <7114 6253 gene locus_tag LOCUS_17100 <7114 6253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877167.1:formylmethanofuran dehydrogenase subunit C >Feature sequence121 <1 1789 gene locus_tag LOCUS_17110 <1 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189024193.1:non-ribosomal peptide synthetase 1828 4098 gene locus_tag LOCUS_17120 1828 4098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307275.1 protein_id gnl|my_center|LOCUS_17120 4429 4845 gene locus_tag LOCUS_17130 4429 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 5965 5279 gene locus_tag LOCUS_17140 5965 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 6593 6027 gene locus_tag LOCUS_17150 6593 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence122 33 2111 gene locus_tag LOCUS_17160 33 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2366 2788 gene locus_tag LOCUS_17170 2366 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3387 3208 gene locus_tag LOCUS_17180 3387 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4465 4307 gene locus_tag LOCUS_17190 4465 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4710 5054 gene locus_tag LOCUS_17200 4710 5054 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876157.1 protein_id gnl|my_center|LOCUS_17200 5056 5514 gene locus_tag LOCUS_17210 5056 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 5568 6056 gene locus_tag LOCUS_17220 5568 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6346 6203 gene locus_tag LOCUS_17230 6346 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence123 1322 336 gene locus_tag LOCUS_17240 1322 336 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122014502.1 protein_id gnl|my_center|LOCUS_17240 1887 2375 gene locus_tag LOCUS_17250 1887 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2396 2737 gene locus_tag LOCUS_17260 2396 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 4063 3170 gene locus_tag LOCUS_17270 4063 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 5568 4186 gene locus_tag LOCUS_17280 5568 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5576 5749 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence124 4179 2725 gene locus_tag LOCUS_17290 4179 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4272 4646 gene locus_tag LOCUS_17300 4272 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4741 >6875 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcacaatccttgttttagtagaaatgtctttgcaat >Feature sequence125 1552 278 gene locus_tag LOCUS_17310 1552 278 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_17310 2181 1555 gene locus_tag LOCUS_17320 2181 1555 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_17320 2685 2197 gene locus_tag LOCUS_17330 gene hacB 2685 2197 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_17330 4285 2780 gene locus_tag LOCUS_17340 4285 2780 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060907.1 protein_id gnl|my_center|LOCUS_17340 4489 4641 gene locus_tag LOCUS_17350 4489 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4605 4772 gene locus_tag LOCUS_17360 4605 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 5014 5574 gene locus_tag LOCUS_17370 5014 5574 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_17370 5753 5595 gene locus_tag LOCUS_17380 5753 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17380 6151 5783 gene locus_tag LOCUS_17390 6151 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17390 6620 6090 gene locus_tag LOCUS_17400 6620 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 >Feature sequence126 2 1183 gene locus_tag LOCUS_17410 2 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1338 1577 gene locus_tag LOCUS_17420 1338 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1564 1761 gene locus_tag LOCUS_17430 1564 1761 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_17430 1978 3198 gene locus_tag LOCUS_17440 1978 3198 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_17440 3195 4088 gene locus_tag LOCUS_17450 gene dapA 3195 4088 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_17450 4101 4922 gene locus_tag LOCUS_17460 gene dapB 4101 4922 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876435.1 protein_id gnl|my_center|LOCUS_17460 4932 5981 gene locus_tag LOCUS_17470 gene asd 4932 5981 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence127 747 43 gene locus_tag LOCUS_17480 gene cobI 747 43 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_17480 876 2612 gene locus_tag LOCUS_17490 876 2612 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876959.1 protein_id gnl|my_center|LOCUS_17490 2687 2613 gene locus_tag LOCUS_t00210 2687 2613 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3703 2714 gene locus_tag LOCUS_17500 3703 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 4024 3713 gene locus_tag LOCUS_17510 4024 3713 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 protein_id gnl|my_center|LOCUS_17510 4523 4101 gene locus_tag LOCUS_17520 4523 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 4832 4551 gene locus_tag LOCUS_17530 4832 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5413 4847 gene locus_tag LOCUS_17540 5413 4847 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876931.1 protein_id gnl|my_center|LOCUS_17540 6495 5491 gene locus_tag LOCUS_17550 gene dph2 6495 5491 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence128 <1 1729 gene locus_tag LOCUS_17560 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:Ig-like domain-containing protein 1860 2120 gene locus_tag LOCUS_17570 1860 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3157 3771 gene locus_tag LOCUS_17580 3157 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4399 5010 gene locus_tag LOCUS_17590 4399 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence129 <1 526 gene locus_tag LOCUS_17600 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023625.1:IS200/IS605 family element RNA-guided endonuclease TnpB 1210 563 gene locus_tag LOCUS_17610 1210 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1378 2688 gene locus_tag LOCUS_17620 gene purD 1378 2688 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_17620 2959 3555 gene locus_tag LOCUS_17630 2959 3555 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_17630 3622 4533 gene locus_tag LOCUS_17640 gene argF 3622 4533 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877056.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence130 >Feature sequence131 <1 1163 gene locus_tag LOCUS_17650 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891610.1:aldo/keto reductase 1253 1603 gene locus_tag LOCUS_17660 1253 1603 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875816.1 protein_id gnl|my_center|LOCUS_17660 1609 2352 gene locus_tag LOCUS_17670 1609 2352 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877328.1 protein_id gnl|my_center|LOCUS_17670 2447 3472 gene locus_tag LOCUS_17680 2447 3472 CDS product Zc3h12a-like ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060764.1 protein_id gnl|my_center|LOCUS_17680 3465 4667 gene locus_tag LOCUS_17690 3465 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060765.1 protein_id gnl|my_center|LOCUS_17690 4689 5126 gene locus_tag LOCUS_17700 4689 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5142 6365 gene locus_tag LOCUS_17710 gene argJ 5142 6365 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence132 993 304 gene locus_tag LOCUS_17720 993 304 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 protein_id gnl|my_center|LOCUS_17720 1679 990 gene locus_tag LOCUS_17730 1679 990 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687954.1 protein_id gnl|my_center|LOCUS_17730 1828 2133 gene locus_tag LOCUS_17740 1828 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2184 3176 gene locus_tag LOCUS_17750 2184 3176 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949061.1 protein_id gnl|my_center|LOCUS_17750 3284 4279 gene locus_tag LOCUS_17760 3284 4279 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483378.1 protein_id gnl|my_center|LOCUS_17760 4477 4632 gene locus_tag LOCUS_17770 4477 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 4625 5416 gene locus_tag LOCUS_17780 4625 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5644 5784 gene locus_tag LOCUS_17790 5644 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence133 155 934 gene locus_tag LOCUS_17800 155 934 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_17800 1432 938 gene locus_tag LOCUS_17810 1432 938 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905642.1 protein_id gnl|my_center|LOCUS_17810 2393 1434 gene locus_tag LOCUS_17820 2393 1434 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_17820 4395 2530 gene locus_tag LOCUS_17830 4395 2530 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_17830 4691 5464 gene locus_tag LOCUS_17840 4691 5464 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_17840 5522 6115 gene locus_tag LOCUS_17850 5522 6115 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925488.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence134 3810 6080 gene locus_tag LOCUS_17860 3810 6080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307275.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence135 534 448 gene locus_tag LOCUS_t00220 534 448 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1238 822 gene locus_tag LOCUS_17870 1238 822 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061234.1 protein_id gnl|my_center|LOCUS_17870 5627 1443 gene locus_tag LOCUS_17880 5627 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence136 16 852 gene locus_tag LOCUS_17890 16 852 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_17890 884 1534 gene locus_tag LOCUS_17900 884 1534 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940990.1 protein_id gnl|my_center|LOCUS_17900 1545 2228 gene locus_tag LOCUS_17910 1545 2228 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_17910 2482 3162 gene locus_tag LOCUS_17920 2482 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3229 4200 gene locus_tag LOCUS_17930 3229 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4511 6001 gene locus_tag LOCUS_17940 4511 6001 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence137 1358 3175 gene locus_tag LOCUS_17950 1358 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence138 196 717 gene locus_tag LOCUS_17960 196 717 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485798.1 protein_id gnl|my_center|LOCUS_17960 822 1151 gene locus_tag LOCUS_17970 822 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1152 2306 gene locus_tag LOCUS_17980 1152 2306 CDS product TIGR03576 family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877510.1 protein_id gnl|my_center|LOCUS_17980 3213 2296 gene locus_tag LOCUS_17990 3213 2296 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877512.1 protein_id gnl|my_center|LOCUS_17990 4722 3229 gene locus_tag LOCUS_18000 4722 3229 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877513.1 protein_id gnl|my_center|LOCUS_18000 4796 5425 gene locus_tag LOCUS_18010 4796 5425 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence139 3518 4729 gene locus_tag LOCUS_18020 3518 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 <6056 4981 gene locus_tag LOCUS_18030 <6056 4981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876731.1:sodium-extruding oxaloacetate decarboxylase subunit alpha >Feature sequence140 <1 555 gene locus_tag LOCUS_18040 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065773.1:PKD domain-containing protein 786 1469 gene locus_tag LOCUS_18050 786 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1655 5674 gene locus_tag LOCUS_18060 1655 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18060 >Feature sequence141 166 1104 gene locus_tag LOCUS_18070 166 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1622 1774 gene locus_tag LOCUS_18080 1622 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3277 1796 gene locus_tag LOCUS_18090 gene cobQ 3277 1796 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061247.1 protein_id gnl|my_center|LOCUS_18090 3909 5882 gene locus_tag LOCUS_18100 gene lonB 3909 5882 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876422.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence142 1534 143 gene locus_tag LOCUS_18110 1534 143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_18110 2014 1571 gene locus_tag LOCUS_18120 2014 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2550 5669 gene locus_tag LOCUS_18130 2550 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence143 486 893 gene locus_tag LOCUS_18140 486 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 981 1265 gene locus_tag LOCUS_18150 981 1265 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061319.1 protein_id gnl|my_center|LOCUS_18150 1381 1456 gene locus_tag LOCUS_t00230 1381 1456 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1590 2102 gene locus_tag LOCUS_18160 1590 2102 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_18160 2374 2096 gene locus_tag LOCUS_18170 2374 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2454 3755 gene locus_tag LOCUS_18180 2454 3755 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 protein_id gnl|my_center|LOCUS_18180 4813 3761 gene locus_tag LOCUS_18190 4813 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 5782 4817 gene locus_tag LOCUS_18200 5782 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877252.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence144 <1 678 gene locus_tag LOCUS_18210 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052261150.1:pseudomurein-binding repeat-containing protein 717 2201 gene locus_tag LOCUS_18220 717 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18220 2594 2217 gene locus_tag LOCUS_18230 2594 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2670 4124 gene locus_tag LOCUS_18240 2670 4124 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986561.1 protein_id gnl|my_center|LOCUS_18240 4521 4306 gene locus_tag LOCUS_18250 4521 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 5756 4656 gene locus_tag LOCUS_18260 5756 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071858617.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence145 979 437 gene locus_tag LOCUS_18270 979 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1409 2656 gene locus_tag LOCUS_18280 gene hacA 1409 2656 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_18280 2662 3144 gene locus_tag LOCUS_18290 2662 3144 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 protein_id gnl|my_center|LOCUS_18290 3116 4126 gene locus_tag LOCUS_18300 3116 4126 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence146 >Feature sequence147 259 1143 gene locus_tag LOCUS_18310 259 1143 CDS product PhoU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877330.1 protein_id gnl|my_center|LOCUS_18310 2017 1175 gene locus_tag LOCUS_18320 2017 1175 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877341.1 protein_id gnl|my_center|LOCUS_18320 2306 2067 gene locus_tag LOCUS_18330 2306 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 2815 2315 gene locus_tag LOCUS_18340 2815 2315 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061134.1 protein_id gnl|my_center|LOCUS_18340 3696 2827 gene locus_tag LOCUS_18350 gene porB 3696 2827 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_18350 4847 3699 gene locus_tag LOCUS_18360 gene porA 4847 3699 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_18360 5103 4861 gene locus_tag LOCUS_18370 gene porD 5103 4861 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence148 310 975 gene locus_tag LOCUS_18380 gene cbiM 310 975 CDS product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870603.1 protein_id gnl|my_center|LOCUS_18380 986 1273 gene locus_tag LOCUS_18390 986 1273 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870602.1 protein_id gnl|my_center|LOCUS_18390 1317 2012 gene locus_tag LOCUS_18400 gene cbiQ 1317 2012 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060748.1 protein_id gnl|my_center|LOCUS_18400 2014 2847 gene locus_tag LOCUS_18410 2014 2847 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877312.1 protein_id gnl|my_center|LOCUS_18410 2983 3441 gene locus_tag LOCUS_18420 gene ribC 2983 3441 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_18420 3455 4159 gene locus_tag LOCUS_18430 3455 4159 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892786.1 protein_id gnl|my_center|LOCUS_18430 4169 4516 gene locus_tag LOCUS_18440 4169 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 4520 5191 gene locus_tag LOCUS_18450 4520 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence149 867 430 gene locus_tag LOCUS_18460 867 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1444 881 gene locus_tag LOCUS_18470 1444 881 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877240.1 protein_id gnl|my_center|LOCUS_18470 2707 1454 gene locus_tag LOCUS_18480 gene hacA 2707 1454 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 protein_id gnl|my_center|LOCUS_18480 3880 2717 gene locus_tag LOCUS_18490 3880 2717 CDS product homocitrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877238.1 protein_id gnl|my_center|LOCUS_18490 4462 3935 gene locus_tag LOCUS_18500 gene cyaB 4462 3935 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_18500 4962 5507 gene locus_tag LOCUS_18510 4962 5507 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877235.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence150 115 648 gene locus_tag LOCUS_18520 115 648 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_18520 2383 683 gene locus_tag LOCUS_18530 gene argS 2383 683 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_18530 2824 2402 gene locus_tag LOCUS_18540 2824 2402 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877058.1 protein_id gnl|my_center|LOCUS_18540 4105 2843 gene locus_tag LOCUS_18550 gene hemL 4105 2843 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_18550 4744 4115 gene locus_tag LOCUS_18560 4744 4115 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060776.1 protein_id gnl|my_center|LOCUS_18560 4800 5024 gene locus_tag LOCUS_18570 4800 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence151 1549 167 gene locus_tag LOCUS_18580 1549 167 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082217.1 protein_id gnl|my_center|LOCUS_18580 2612 1542 gene locus_tag LOCUS_18590 2612 1542 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202469.1 protein_id gnl|my_center|LOCUS_18590 3272 2628 gene locus_tag LOCUS_18600 3272 2628 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095329.1 protein_id gnl|my_center|LOCUS_18600 3824 5131 gene locus_tag LOCUS_18610 3824 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence152 <1 2208 gene locus_tag LOCUS_18620 <1 2208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143485742.1:ATP-dependent helicase 2242 2682 gene locus_tag LOCUS_18630 2242 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2622 2665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2720 3082 gene locus_tag LOCUS_18640 2720 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 3176 3439 gene locus_tag LOCUS_18650 3176 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3862 3999 gene locus_tag LOCUS_18660 3862 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence153 579 4745 gene locus_tag LOCUS_18670 579 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence154 <1 888 gene locus_tag LOCUS_18680 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876051.1:pseudomurein-binding repeat-containing protein 997 1455 gene locus_tag LOCUS_18690 997 1455 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_18690 1558 1749 gene locus_tag LOCUS_18700 1558 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 1759 2766 gene locus_tag LOCUS_18710 1759 2766 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876559.1 protein_id gnl|my_center|LOCUS_18710 2966 2784 gene locus_tag LOCUS_18720 2966 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3165 2959 gene locus_tag LOCUS_18730 3165 2959 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 protein_id gnl|my_center|LOCUS_18730 3348 4514 gene locus_tag LOCUS_18740 3348 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 4514 5233 gene locus_tag LOCUS_18750 4514 5233 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence155 901 443 gene locus_tag LOCUS_18760 901 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1357 2760 gene locus_tag LOCUS_18770 gene pyk 1357 2760 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964354.1 protein_id gnl|my_center|LOCUS_18770 3217 2771 gene locus_tag LOCUS_18780 3217 2771 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016553.1 protein_id gnl|my_center|LOCUS_18780 4311 3280 gene locus_tag LOCUS_18790 4311 3280 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 protein_id gnl|my_center|LOCUS_18790 4978 4325 gene locus_tag LOCUS_18800 gene hypB 4978 4325 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_18800 5374 4997 gene locus_tag LOCUS_18810 gene hypA 5374 4997 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence156 347 273 gene locus_tag LOCUS_t00240 347 273 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 635 561 gene locus_tag LOCUS_t00250 635 561 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1248 766 gene locus_tag LOCUS_18820 1248 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1676 3079 gene locus_tag LOCUS_18830 gene pyk 1676 3079 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964354.1 protein_id gnl|my_center|LOCUS_18830 4237 3206 gene locus_tag LOCUS_18840 4237 3206 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 protein_id gnl|my_center|LOCUS_18840 4904 4251 gene locus_tag LOCUS_18850 gene hypB 4904 4251 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_18850 5300 4923 gene locus_tag LOCUS_18860 gene hypA 5300 4923 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence157 117 731 gene locus_tag LOCUS_18870 117 731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_18870 1038 778 gene locus_tag LOCUS_18880 1038 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1074 2402 gene locus_tag LOCUS_18890 1074 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2649 4268 gene locus_tag LOCUS_18900 2649 4268 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021912.1 protein_id gnl|my_center|LOCUS_18900 4341 5333 gene locus_tag LOCUS_18910 4341 5333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence158 232 1002 gene locus_tag LOCUS_18920 232 1002 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_18920 1115 2164 gene locus_tag LOCUS_18930 1115 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2339 3265 gene locus_tag LOCUS_18940 2339 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3305 3865 gene locus_tag LOCUS_18950 3305 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 3913 4347 gene locus_tag LOCUS_18960 3913 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence159 569 372 gene locus_tag LOCUS_18970 569 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1124 858 gene locus_tag LOCUS_18980 1124 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2328 1126 gene locus_tag LOCUS_18990 gene hmgA 2328 1126 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876201.1 protein_id gnl|my_center|LOCUS_18990 3188 2328 gene locus_tag LOCUS_19000 gene sucD 3188 2328 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750467.1 protein_id gnl|my_center|LOCUS_19000 3925 3200 gene locus_tag LOCUS_19010 3925 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060844.1 protein_id gnl|my_center|LOCUS_19010 4068 4745 gene locus_tag LOCUS_19020 gene aroD 4068 4745 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence160 3158 3588 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatgaacagtttgtgatattaattttaccat >Feature sequence161 507 710 gene locus_tag LOCUS_19030 507 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1155 1337 gene locus_tag LOCUS_19040 1155 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1361 1888 gene locus_tag LOCUS_19050 1361 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1904 2263 gene locus_tag LOCUS_19060 1904 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2339 2653 gene locus_tag LOCUS_19070 2339 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2782 3627 gene locus_tag LOCUS_19080 2782 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence162 <5247 1942 gene locus_tag LOCUS_19090 <5247 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046083384.1:AIDA-I family autotransporter adhesin YfaL/EhaC >Feature sequence163 173 334 gene locus_tag LOCUS_19100 173 334 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877306.1 protein_id gnl|my_center|LOCUS_19100 357 626 gene locus_tag LOCUS_19110 357 626 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_19110 842 4018 gene locus_tag LOCUS_19120 842 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence164 972 121 gene locus_tag LOCUS_19130 972 121 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_19130 1853 996 gene locus_tag LOCUS_19140 1853 996 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101921.1 protein_id gnl|my_center|LOCUS_19140 2360 1935 gene locus_tag LOCUS_19150 2360 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 2480 3088 gene locus_tag LOCUS_19160 2480 3088 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_19160 3106 3645 gene locus_tag LOCUS_19170 3106 3645 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_19170 3658 4050 gene locus_tag LOCUS_19180 3658 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence165 857 519 gene locus_tag LOCUS_19190 857 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2343 1120 gene locus_tag LOCUS_19200 2343 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2864 2409 gene locus_tag LOCUS_19210 2864 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2944 3081 gene locus_tag LOCUS_19220 2944 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 5068 3551 gene locus_tag LOCUS_19230 5068 3551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence166 1340 1143 gene locus_tag LOCUS_19240 1340 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 1388 4951 gene locus_tag LOCUS_19250 1388 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence167 >Feature sequence168 <1 817 gene locus_tag LOCUS_19260 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000086363.1:heavy metal translocating P-type ATPase 1672 1061 gene locus_tag LOCUS_19270 1672 1061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_19270 2579 1662 gene locus_tag LOCUS_19280 2579 1662 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_19280 3443 2592 gene locus_tag LOCUS_19290 3443 2592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_19290 4431 3436 gene locus_tag LOCUS_19300 4431 3436 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021910.1 protein_id gnl|my_center|LOCUS_19300 <5108 4511 gene locus_tag LOCUS_19310 <5108 4511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021913.1:ABC transporter substrate-binding protein >Feature sequence169 >Feature sequence170 986 1801 gene locus_tag LOCUS_19320 gene surE 986 1801 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_19320 2907 1825 gene locus_tag LOCUS_19330 2907 1825 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964643.1 protein_id gnl|my_center|LOCUS_19330 3534 2908 gene locus_tag LOCUS_19340 3534 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 3650 4834 gene locus_tag LOCUS_19350 3650 4834 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905157.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence171 >Feature sequence172 763 218 gene locus_tag LOCUS_19360 763 218 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_19360 1645 932 gene locus_tag LOCUS_19370 1645 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2749 1778 gene locus_tag LOCUS_19380 gene mch 2749 1778 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876411.1 protein_id gnl|my_center|LOCUS_19380 3353 2904 gene locus_tag LOCUS_19390 3353 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 3982 3482 gene locus_tag LOCUS_19400 3982 3482 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_19400 <4973 3983 gene locus_tag LOCUS_19410 <4973 3983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003130350.1:ClC family H(+)/Cl(-) exchange transporter >Feature sequence173 1102 11 gene locus_tag LOCUS_19420 1102 11 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_19420 2126 1086 gene locus_tag LOCUS_19430 2126 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2636 2283 gene locus_tag LOCUS_19440 2636 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3519 2656 gene locus_tag LOCUS_19450 gene truA 3519 2656 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_19450 4675 4169 gene locus_tag LOCUS_19460 4675 4169 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892518.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence174 604 1371 gene locus_tag LOCUS_19470 604 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1382 1516 gene locus_tag LOCUS_19480 1382 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3674 1830 gene locus_tag LOCUS_19490 3674 1830 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_19490 4008 3736 gene locus_tag LOCUS_19500 4008 3736 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_19500 4599 4312 gene locus_tag LOCUS_19510 4599 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence175 >Feature sequence176 1071 1937 gene locus_tag LOCUS_19520 1071 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1934 2284 gene locus_tag LOCUS_19530 1934 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2338 3870 gene locus_tag LOCUS_19540 2338 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4049 4282 gene locus_tag LOCUS_19550 4049 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 4373 4504 gene locus_tag LOCUS_19560 4373 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence177 1470 1144 gene locus_tag LOCUS_19570 1470 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2465 1773 gene locus_tag LOCUS_19580 2465 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2725 3018 gene locus_tag LOCUS_19590 2725 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3245 3317 gene locus_tag LOCUS_t00260 3245 3317 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4118 3714 gene locus_tag LOCUS_19600 4118 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence178 129 587 gene locus_tag LOCUS_19610 129 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1199 930 gene locus_tag LOCUS_19620 1199 930 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_19620 1381 1220 gene locus_tag LOCUS_19630 1381 1220 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877306.1 protein_id gnl|my_center|LOCUS_19630 1520 1383 gene locus_tag LOCUS_19640 1520 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2010 1570 gene locus_tag LOCUS_19650 2010 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19650 2400 2062 gene locus_tag LOCUS_19660 gene pth2 2400 2062 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_19660 2524 4302 gene locus_tag LOCUS_19670 2524 4302 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061122.1 protein_id gnl|my_center|LOCUS_19670 4703 4326 gene locus_tag LOCUS_19680 4703 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence179 954 31 gene locus_tag LOCUS_19690 954 31 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060746.1 protein_id gnl|my_center|LOCUS_19690 1815 970 gene locus_tag LOCUS_19700 1815 970 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060745.1 protein_id gnl|my_center|LOCUS_19700 2946 1957 gene locus_tag LOCUS_19710 2946 1957 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060741.1 protein_id gnl|my_center|LOCUS_19710 3279 3713 gene locus_tag LOCUS_19720 3279 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 <4666 4024 gene locus_tag LOCUS_19730 <4666 4024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458920.1:cation-translocating P-type ATPase >Feature sequence180 370 1167 gene locus_tag LOCUS_19740 370 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 2482 1268 gene locus_tag LOCUS_19750 2482 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 3352 2483 gene locus_tag LOCUS_19760 gene fabG 3352 2483 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_19760 4076 3459 gene locus_tag LOCUS_19770 4076 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence181 786 1346 gene locus_tag LOCUS_19780 786 1346 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892518.1 protein_id gnl|my_center|LOCUS_19780 2033 1341 gene locus_tag LOCUS_19790 2033 1341 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860384.1 protein_id gnl|my_center|LOCUS_19790 2375 3994 gene locus_tag LOCUS_19800 2375 3994 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021911.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence182 371 1819 gene locus_tag LOCUS_19810 371 1819 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_19810 2186 3655 gene locus_tag LOCUS_19820 2186 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 4433 3675 gene locus_tag LOCUS_19830 4433 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 >Feature sequence183 1135 425 gene locus_tag LOCUS_19840 1135 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2895 1651 gene locus_tag LOCUS_19850 2895 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3074 3877 gene locus_tag LOCUS_19860 3074 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3964 4052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4123 4494 gene locus_tag LOCUS_19870 4123 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 >Feature sequence184 1991 549 gene locus_tag LOCUS_19880 1991 549 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_19880 2703 1984 gene locus_tag LOCUS_19890 2703 1984 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815503.1 protein_id gnl|my_center|LOCUS_19890 3293 2712 gene locus_tag LOCUS_19900 3293 2712 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815501.1 protein_id gnl|my_center|LOCUS_19900 4101 3808 gene locus_tag LOCUS_19910 4101 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence185 1990 191 gene locus_tag LOCUS_19920 1990 191 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_19920 3078 2131 gene locus_tag LOCUS_19930 3078 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3928 3191 gene locus_tag LOCUS_19940 3928 3191 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence186 1789 191 gene locus_tag LOCUS_19950 gene ptsP 1789 191 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048342.1 protein_id gnl|my_center|LOCUS_19950 2044 1790 gene locus_tag LOCUS_19960 2044 1790 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_19960 4061 2049 gene locus_tag LOCUS_19970 gene ptsG 4061 2049 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832339.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence187 2354 1056 gene locus_tag LOCUS_19980 gene thiC 2354 1056 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877152.1 protein_id gnl|my_center|LOCUS_19980 3511 2597 gene locus_tag LOCUS_19990 3511 2597 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877153.1 protein_id gnl|my_center|LOCUS_19990 <4297 3680 gene locus_tag LOCUS_20000 <4297 3680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061082.1:LysR family transcriptional regulator >Feature sequence188 1178 2527 gene locus_tag LOCUS_20010 gene purB 1178 2527 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877146.1 protein_id gnl|my_center|LOCUS_20010 2536 3384 gene locus_tag LOCUS_20020 2536 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 <4291 3390 gene locus_tag LOCUS_20030 <4291 3390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877980.1:copper-translocating P-type ATPase CopA >Feature sequence189 >Feature sequence190 237 542 gene locus_tag LOCUS_20040 237 542 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870108.1 protein_id gnl|my_center|LOCUS_20040 535 909 gene locus_tag LOCUS_20050 535 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1133 2260 gene locus_tag LOCUS_20060 1133 2260 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475860.1 protein_id gnl|my_center|LOCUS_20060 3048 2473 gene locus_tag LOCUS_20070 3048 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3312 3638 gene locus_tag LOCUS_20080 3312 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3679 4095 gene locus_tag LOCUS_20090 3679 4095 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence191 533 1498 gene locus_tag LOCUS_20100 gene ftsY 533 1498 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877216.1 protein_id gnl|my_center|LOCUS_20100 1500 2588 gene locus_tag LOCUS_20110 gene pgsA 1500 2588 CDS product capsular polyglutamate synthetase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243306.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence192 3810 610 gene locus_tag LOCUS_20120 3810 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence193 486 238 gene locus_tag LOCUS_20130 486 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1715 489 gene locus_tag LOCUS_20140 1715 489 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060773.1 protein_id gnl|my_center|LOCUS_20140 2537 1755 gene locus_tag LOCUS_20150 2537 1755 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 protein_id gnl|my_center|LOCUS_20150 3544 2702 gene locus_tag LOCUS_20160 3544 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence194 306 187 gene locus_tag LOCUS_20170 306 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 908 3493 gene locus_tag LOCUS_20180 908 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 4019 3807 gene locus_tag LOCUS_20190 4019 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence195 26 550 gene locus_tag LOCUS_20200 26 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1568 552 gene locus_tag LOCUS_20210 1568 552 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721504.1 protein_id gnl|my_center|LOCUS_20210 2271 1561 gene locus_tag LOCUS_20220 2271 1561 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_20220 2865 2278 gene locus_tag LOCUS_20230 2865 2278 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 protein_id gnl|my_center|LOCUS_20230 3865 3263 gene locus_tag LOCUS_20240 3865 3263 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence196 1423 842 gene locus_tag LOCUS_20250 1423 842 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877299.1 protein_id gnl|my_center|LOCUS_20250 1471 2040 gene locus_tag LOCUS_20260 gene pgsA 1471 2040 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_20260 2033 2275 gene locus_tag LOCUS_20270 2033 2275 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877297.1 protein_id gnl|my_center|LOCUS_20270 3288 2272 gene locus_tag LOCUS_20280 3288 2272 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence197 >Feature sequence198 336 3482 gene locus_tag LOCUS_20290 336 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3971 3582 gene locus_tag LOCUS_20300 3971 3582 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence199 58 378 gene locus_tag LOCUS_20310 58 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 362 1939 gene locus_tag LOCUS_20320 gene tgtA 362 1939 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 protein_id gnl|my_center|LOCUS_20320 1948 2616 gene locus_tag LOCUS_20330 1948 2616 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_20330 2705 2780 gene locus_tag LOCUS_t00270 2705 2780 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2969 4006 gene locus_tag LOCUS_20340 2969 4006 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence200 499 1314 gene locus_tag LOCUS_20350 499 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2854 1604 gene locus_tag LOCUS_20360 gene sstT 2854 1604 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_20360 2896 3333 gene locus_tag LOCUS_20370 2896 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 >Feature sequence201 2354 669 gene locus_tag LOCUS_20380 2354 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 <3998 2366 gene locus_tag LOCUS_20390 <3998 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000605281.1:non-ribosomal peptide synthetase >Feature sequence202 >Feature sequence203 1227 1913 gene locus_tag LOCUS_20400 1227 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2111 2254 gene locus_tag LOCUS_20410 2111 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence204 1164 877 gene locus_tag LOCUS_20420 1164 877 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875863.1 protein_id gnl|my_center|LOCUS_20420 1832 1344 gene locus_tag LOCUS_20430 1832 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 3494 2151 gene locus_tag LOCUS_20440 3494 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence205 1008 388 gene locus_tag LOCUS_20450 1008 388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021907.1 protein_id gnl|my_center|LOCUS_20450 2061 1009 gene locus_tag LOCUS_20460 2061 1009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021908.1 protein_id gnl|my_center|LOCUS_20460 2610 2107 gene locus_tag LOCUS_20470 2610 2107 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892518.1 protein_id gnl|my_center|LOCUS_20470 3510 2656 gene locus_tag LOCUS_20480 3510 2656 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021909.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence206 1907 1140 gene locus_tag LOCUS_20490 1907 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876292.1 protein_id gnl|my_center|LOCUS_20490 2083 1916 gene locus_tag LOCUS_20500 2083 1916 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020514.1 protein_id gnl|my_center|LOCUS_20500 2214 2567 gene locus_tag LOCUS_20510 2214 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2625 2708 gene locus_tag LOCUS_t00280 2625 2708 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2710 2782 gene locus_tag LOCUS_t00290 2710 2782 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence207 418 263 gene locus_tag LOCUS_20520 418 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1472 456 gene locus_tag LOCUS_20530 1472 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 1592 3241 gene locus_tag LOCUS_20540 gene thsA 1592 3241 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060772.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence208 1083 514 gene locus_tag LOCUS_20550 1083 514 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_20550 1896 1093 gene locus_tag LOCUS_20560 1896 1093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_20560 2900 1887 gene locus_tag LOCUS_20570 2900 1887 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_20570 <3787 2908 gene locus_tag LOCUS_20580 <3787 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065059.1:iron ABC transporter substrate-binding protein >Feature sequence209 >Feature sequence210 1592 615 gene locus_tag LOCUS_20590 1592 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2735 1932 gene locus_tag LOCUS_20600 2735 1932 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_20600 <3763 3032 gene locus_tag LOCUS_20610 <3763 3032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876313.1:nicotianamine synthase family protein >Feature sequence211 511 1545 gene locus_tag LOCUS_20620 511 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2330 3730 gene locus_tag LOCUS_20630 2330 3730 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022384.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence212 84 449 gene locus_tag LOCUS_20640 84 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 501 2882 gene locus_tag LOCUS_20650 501 2882 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485824.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence213 295 1014 gene locus_tag LOCUS_20660 295 1014 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 protein_id gnl|my_center|LOCUS_20660 1051 2160 gene locus_tag LOCUS_20670 gene cdc6-2 1051 2160 CDS product ORC1-type DNA replication protein Cdc6-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877207.1 protein_id gnl|my_center|LOCUS_20670 2450 2274 gene locus_tag LOCUS_20680 2450 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2539 2841 gene locus_tag LOCUS_20690 2539 2841 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 protein_id gnl|my_center|LOCUS_20690 2875 3195 gene locus_tag LOCUS_20700 2875 3195 CDS product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876159.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence214 478 1347 gene locus_tag LOCUS_20710 478 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1520 2134 gene locus_tag LOCUS_20720 1520 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 3339 2425 gene locus_tag LOCUS_20730 3339 2425 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876955.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence215 148 330 gene locus_tag LOCUS_20740 148 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 479 327 gene locus_tag LOCUS_20750 479 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1488 436 gene locus_tag LOCUS_20760 1488 436 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022711.1 protein_id gnl|my_center|LOCUS_20760 2392 1538 gene locus_tag LOCUS_20770 gene galU 2392 1538 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence216 1319 114 gene locus_tag LOCUS_20780 1319 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2590 1454 gene locus_tag LOCUS_20790 2590 1454 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876367.1 protein_id gnl|my_center|LOCUS_20790 2826 3317 gene locus_tag LOCUS_20800 2826 3317 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence217 >Feature sequence218 1366 1178 gene locus_tag LOCUS_20810 1366 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1649 1422 gene locus_tag LOCUS_20820 1649 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 <3574 1775 gene locus_tag LOCUS_20830 <3574 1775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964349.1:ferrous iron transport protein B >Feature sequence219 <1 811 gene locus_tag LOCUS_20840 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061314.1:alanine--glyoxylate aminotransferase family protein 1244 1663 gene locus_tag LOCUS_20850 1244 1663 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876265.1 protein_id gnl|my_center|LOCUS_20850 1672 2256 gene locus_tag LOCUS_20860 1672 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2246 2488 gene locus_tag LOCUS_20870 2246 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 <3547 2540 gene locus_tag LOCUS_20880 <3547 2540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877210.1:thiamine pyrophosphate-binding protein >Feature sequence220 2188 893 gene locus_tag LOCUS_20890 2188 893 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022675.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence221 243 3374 gene locus_tag LOCUS_20900 243 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence222 489 890 gene locus_tag LOCUS_20910 489 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 894 1079 gene locus_tag LOCUS_20920 894 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 1320 1868 gene locus_tag LOCUS_20930 1320 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2960 1860 gene locus_tag LOCUS_20940 2960 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence223 440 484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 497 1003 gene locus_tag LOCUS_20950 497 1003 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_20950 1460 1011 gene locus_tag LOCUS_20960 1460 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2894 1500 gene locus_tag LOCUS_20970 2894 1500 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_20970 3360 2896 gene locus_tag LOCUS_20980 3360 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence224 1675 1409 gene locus_tag LOCUS_20990 1675 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 2425 2024 gene locus_tag LOCUS_21000 2425 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2789 2523 gene locus_tag LOCUS_21010 2789 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence225 372 518 gene locus_tag LOCUS_21020 372 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 680 1423 gene locus_tag LOCUS_21030 680 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21030 2038 1580 gene locus_tag LOCUS_21040 2038 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2573 2088 gene locus_tag LOCUS_21050 2573 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 3035 2583 gene locus_tag LOCUS_21060 3035 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence226 479 622 gene locus_tag LOCUS_21070 479 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 982 596 gene locus_tag LOCUS_21080 982 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1152 1952 gene locus_tag LOCUS_21090 1152 1952 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060846.1 protein_id gnl|my_center|LOCUS_21090 1998 2825 gene locus_tag LOCUS_21100 1998 2825 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence227 362 1516 gene locus_tag LOCUS_21110 362 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1536 1973 gene locus_tag LOCUS_21120 1536 1973 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681342.1 protein_id gnl|my_center|LOCUS_21120 1995 2963 gene locus_tag LOCUS_21130 1995 2963 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence228 1744 1052 gene locus_tag LOCUS_21140 1744 1052 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876991.1 protein_id gnl|my_center|LOCUS_21140 3019 1751 gene locus_tag LOCUS_21150 gene glyA 3019 1751 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence229 1100 2308 gene locus_tag LOCUS_21160 1100 2308 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_21160 2792 2313 gene locus_tag LOCUS_21170 gene pyrI 2792 2313 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_21170 3293 2799 gene locus_tag LOCUS_21180 3293 2799 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060912.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence230 2838 151 gene locus_tag LOCUS_21190 gene ggaB 2838 151 CDS product poly(glucosyl N-acetylgalactosamine 1-phosphate) glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227939.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence231 479 2356 gene locus_tag LOCUS_21200 479 2356 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858944.1 protein_id gnl|my_center|LOCUS_21200 2531 2665 gene locus_tag LOCUS_21210 2531 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2775 3236 gene locus_tag LOCUS_21220 2775 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence232 <3304 2752 gene locus_tag LOCUS_21230 <3304 2752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877201.1:30S ribosomal protein S3ae >Feature sequence233 77 568 gene locus_tag LOCUS_21240 77 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 578 790 gene locus_tag LOCUS_21250 578 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 801 1343 gene locus_tag LOCUS_21260 801 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1352 2281 gene locus_tag LOCUS_21270 1352 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2291 3100 gene locus_tag LOCUS_21280 2291 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence234 >Feature sequence235 782 1258 gene locus_tag LOCUS_21290 782 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1289 1846 gene locus_tag LOCUS_21300 1289 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 >Feature sequence236 1253 660 gene locus_tag LOCUS_21310 1253 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2017 1568 gene locus_tag LOCUS_21320 2017 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2346 2978 gene locus_tag LOCUS_21330 2346 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence237 1961 2986 gene locus_tag LOCUS_21340 1961 2986 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence238 1401 172 gene locus_tag LOCUS_21350 1401 172 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_21350 2242 1703 gene locus_tag LOCUS_21360 2242 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 >Feature sequence239 2060 1728 gene locus_tag LOCUS_21370 2060 1728 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_21370 2717 2073 gene locus_tag LOCUS_21380 2717 2073 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_21380 <3245 2726 gene locus_tag LOCUS_21390 <3245 2726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052261160.1:DUF2162 domain-containing protein >Feature sequence240 115 2313 gene locus_tag LOCUS_21400 115 2313 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_21400 3205 2549 gene locus_tag LOCUS_21410 3205 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence241 >Feature sequence242 >Feature sequence243 992 420 gene locus_tag LOCUS_21420 992 420 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_21420 1224 982 gene locus_tag LOCUS_21430 1224 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 1405 1737 gene locus_tag LOCUS_21440 1405 1737 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 protein_id gnl|my_center|LOCUS_21440 2396 1773 gene locus_tag LOCUS_21450 2396 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2891 2550 gene locus_tag LOCUS_21460 2891 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence244 912 442 gene locus_tag LOCUS_21470 912 442 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061118.1 protein_id gnl|my_center|LOCUS_21470 1349 1170 gene locus_tag LOCUS_21480 1349 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1887 1483 gene locus_tag LOCUS_21490 1887 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21490 2582 1968 gene locus_tag LOCUS_21500 2582 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21500 >Feature sequence245 656 2128 gene locus_tag LOCUS_21510 656 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2071 2763 gene locus_tag LOCUS_21520 2071 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence246 292 837 gene locus_tag LOCUS_21530 292 837 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_21530 1889 852 gene locus_tag LOCUS_21540 1889 852 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_21540 2614 1931 gene locus_tag LOCUS_21550 gene modB 2614 1931 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360415.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence247 2865 595 gene locus_tag LOCUS_21560 2865 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence248 1180 284 gene locus_tag LOCUS_21570 1180 284 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 protein_id gnl|my_center|LOCUS_21570 1575 2660 gene locus_tag LOCUS_21580 1575 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21580 >Feature sequence249 <1 672 gene locus_tag LOCUS_21590 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876908.1:molecular chaperone DnaJ >Feature sequence250 109 711 gene locus_tag LOCUS_21600 109 711 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868327.1 protein_id gnl|my_center|LOCUS_21600 1447 2721 gene locus_tag LOCUS_21610 1447 2721 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence251 2339 2010 gene locus_tag LOCUS_21620 2339 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 <3065 2348 gene locus_tag LOCUS_21630 <3065 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_115892580.1:tripartite tricarboxylate transporter permease >Feature sequence252 778 86 gene locus_tag LOCUS_21640 778 86 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876991.1 protein_id gnl|my_center|LOCUS_21640 2051 780 gene locus_tag LOCUS_21650 gene glyA 2051 780 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_21650 <3039 2126 gene locus_tag LOCUS_21660 <3039 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114005.1:MFS transporter >Feature sequence253 340 1143 gene locus_tag LOCUS_21670 340 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1154 1996 gene locus_tag LOCUS_21680 gene galU 1154 1996 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_21680 2019 2339 gene locus_tag LOCUS_21690 2019 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21690 >Feature sequence254 206 697 gene locus_tag LOCUS_21700 206 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1634 681 gene locus_tag LOCUS_21710 1634 681 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876360.1 protein_id gnl|my_center|LOCUS_21710 2809 1640 gene locus_tag LOCUS_21720 2809 1640 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence255 1214 153 gene locus_tag LOCUS_21730 1214 153 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061107.1 protein_id gnl|my_center|LOCUS_21730 1487 2404 gene locus_tag LOCUS_21740 1487 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence256 2045 615 gene locus_tag LOCUS_21750 2045 615 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871161.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence257 107 1426 gene locus_tag LOCUS_21760 gene aspS 107 1426 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875865.1 protein_id gnl|my_center|LOCUS_21760 1447 2640 gene locus_tag LOCUS_21770 1447 2640 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439456.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence258 191 1300 gene locus_tag LOCUS_21780 gene ahcY 191 1300 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877244.1 protein_id gnl|my_center|LOCUS_21780 1323 1973 gene locus_tag LOCUS_21790 1323 1973 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061105.1 protein_id gnl|my_center|LOCUS_21790 <2958 2293 gene locus_tag LOCUS_21800 <2958 2293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877241.1:flap endonuclease-1 >Feature sequence259 263 1651 gene locus_tag LOCUS_21810 263 1651 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_21810 1825 2808 gene locus_tag LOCUS_21820 gene fba 1825 2808 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_21820 >Feature sequence260 413 2659 gene locus_tag LOCUS_21830 413 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence261 120 260 gene locus_tag LOCUS_21840 120 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 749 339 gene locus_tag LOCUS_21850 749 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2563 1034 gene locus_tag LOCUS_21860 2563 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence262 8 1156 gene locus_tag LOCUS_21870 8 1156 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_21870 1153 1311 gene locus_tag LOCUS_21880 1153 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1372 1611 gene locus_tag LOCUS_21890 1372 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 1810 1977 gene locus_tag LOCUS_21900 1810 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2054 2545 gene locus_tag LOCUS_21910 2054 2545 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814119.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence263 2570 1713 gene locus_tag LOCUS_21920 2570 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence264 >Feature sequence265 1575 295 gene locus_tag LOCUS_21930 1575 295 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence266 3 542 gene locus_tag LOCUS_21940 3 542 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_21940 576 1496 gene locus_tag LOCUS_21950 gene trxB 576 1496 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_21950 1776 2336 gene locus_tag LOCUS_21960 1776 2336 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060887.1 protein_id gnl|my_center|LOCUS_21960 2339 2596 gene locus_tag LOCUS_21970 2339 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence267 889 188 gene locus_tag LOCUS_21980 889 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1775 891 gene locus_tag LOCUS_21990 1775 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2657 2247 gene locus_tag LOCUS_22000 2657 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence268 >Feature sequence269 <1 591 gene locus_tag LOCUS_22010 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875885.1:PINc/VapC family ATPase 601 1350 gene locus_tag LOCUS_22020 601 1350 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485719.1 protein_id gnl|my_center|LOCUS_22020 2835 1261 gene locus_tag LOCUS_22030 2835 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence270 1397 93 gene locus_tag LOCUS_22040 1397 93 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814809.1 protein_id gnl|my_center|LOCUS_22040 2620 1652 gene locus_tag LOCUS_22050 2620 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence271 512 2143 gene locus_tag LOCUS_22060 512 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence272 >Feature sequence273 2080 338 gene locus_tag LOCUS_22070 2080 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence274 65 1066 gene locus_tag LOCUS_22080 gene dcm 65 1066 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_22080 1776 1063 gene locus_tag LOCUS_22090 1776 1063 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946969.1 protein_id gnl|my_center|LOCUS_22090 2490 1777 gene locus_tag LOCUS_22100 2490 1777 CDS product Eco47II family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946969.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence275 1824 502 gene locus_tag LOCUS_22110 1824 502 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485723.1 protein_id gnl|my_center|LOCUS_22110 2290 2523 gene locus_tag LOCUS_22120 2290 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence276 <1 2113 gene locus_tag LOCUS_22130 <1 2113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006101871.1:DUF4114 domain-containing protein >Feature sequence277 605 2446 gene locus_tag LOCUS_22140 605 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence278 591 88 gene locus_tag LOCUS_22150 591 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1848 1273 gene locus_tag LOCUS_22160 1848 1273 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence279 <1 504 gene locus_tag LOCUS_22170 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870253.1:FprA family A-type flavoprotein 560 766 gene locus_tag LOCUS_22180 560 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22180 766 924 gene locus_tag LOCUS_22190 766 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22190 2412 1468 gene locus_tag LOCUS_22200 2412 1468 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence280 29 874 gene locus_tag LOCUS_22210 29 874 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 protein_id gnl|my_center|LOCUS_22210 1564 1824 gene locus_tag LOCUS_22220 1564 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22220 >Feature sequence281 2172 673 gene locus_tag LOCUS_22230 2172 673 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875946.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence282 >Feature sequence283 659 1312 gene locus_tag LOCUS_22240 659 1312 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_22240 1367 1759 gene locus_tag LOCUS_22250 1367 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2528 2025 gene locus_tag LOCUS_22260 2528 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence284 107 1096 gene locus_tag LOCUS_22270 gene aksF 107 1096 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_22270 1097 2521 gene locus_tag LOCUS_22280 1097 2521 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449576.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence285 86 1003 gene locus_tag LOCUS_22290 86 1003 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_22290 1018 1671 gene locus_tag LOCUS_22300 1018 1671 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence286 102 371 gene locus_tag LOCUS_22310 102 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 377 589 gene locus_tag LOCUS_22320 377 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22320 790 1716 gene locus_tag LOCUS_22330 790 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence287 632 2242 gene locus_tag LOCUS_22340 632 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence288 1285 587 gene locus_tag LOCUS_22350 1285 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 705 740 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1520 1233 gene locus_tag LOCUS_22360 1520 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 2521 1559 gene locus_tag LOCUS_22370 2521 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence289 642 1568 gene locus_tag LOCUS_22380 642 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1604 1906 gene locus_tag LOCUS_22390 1604 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence290 400 1587 gene locus_tag LOCUS_22400 400 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence291 <1 784 gene locus_tag LOCUS_22410 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433862.1:ABC transporter ATP-binding protein 897 1019 gene locus_tag LOCUS_22420 897 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1016 1243 gene locus_tag LOCUS_22430 1016 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22430 1243 2436 gene locus_tag LOCUS_22440 1243 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22440 >Feature sequence292 1057 299 gene locus_tag LOCUS_22450 1057 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2316 1066 gene locus_tag LOCUS_22460 2316 1066 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence293 824 54 gene locus_tag LOCUS_22470 824 54 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876961.1 protein_id gnl|my_center|LOCUS_22470 1354 947 gene locus_tag LOCUS_22480 1354 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1400 1456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1636 2400 gene locus_tag LOCUS_22490 1636 2400 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence294 <1 1017 gene locus_tag LOCUS_22500 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876209.1:Ig-like domain-containing protein >Feature sequence295 1018 1419 gene locus_tag LOCUS_22510 1018 1419 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891857.1 protein_id gnl|my_center|LOCUS_22510 <2418 1431 gene locus_tag LOCUS_22520 <2418 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147299760.1:Mur ligase family protein >Feature sequence296 909 475 gene locus_tag LOCUS_22530 909 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence297 267 2267 gene locus_tag LOCUS_22540 267 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence298 909 127 gene locus_tag LOCUS_22550 909 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 >Feature sequence299 2117 1899 gene locus_tag LOCUS_22560 2117 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence300 1412 411 gene locus_tag LOCUS_22570 gene hemB 1412 411 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060891.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence301 1220 129 gene locus_tag LOCUS_22580 gene pyrG 1220 129 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876058.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22580 1590 1213 gene locus_tag LOCUS_22590 1590 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22590 >Feature sequence302 440 589 gene locus_tag LOCUS_22600 440 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 586 1008 gene locus_tag LOCUS_22610 586 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1755 1009 gene locus_tag LOCUS_22620 gene fdhD 1755 1009 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877156.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence303 1587 358 gene locus_tag LOCUS_22630 1587 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence304 2195 1020 gene locus_tag LOCUS_22640 gene metK 2195 1020 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence305 333 100 gene locus_tag LOCUS_22650 333 100 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 protein_id gnl|my_center|LOCUS_22650 778 326 gene locus_tag LOCUS_22660 778 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1039 779 gene locus_tag LOCUS_22670 1039 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1474 1160 gene locus_tag LOCUS_22680 1474 1160 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876875.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence306 79 960 gene locus_tag LOCUS_22690 79 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1867 1151 gene locus_tag LOCUS_22700 1867 1151 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence307 >Feature sequence308 793 134 gene locus_tag LOCUS_22710 793 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2011 962 gene locus_tag LOCUS_22720 2011 962 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence309 97 1695 gene locus_tag LOCUS_22730 97 1695 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061109.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence310 734 183 gene locus_tag LOCUS_22740 734 183 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_22740 1219 752 gene locus_tag LOCUS_22750 1219 752 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870151.1 protein_id gnl|my_center|LOCUS_22750 1595 1257 gene locus_tag LOCUS_22760 1595 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22760 >Feature sequence311 1847 9 gene locus_tag LOCUS_22770 1847 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence312 >Feature sequence313 >Feature sequence314 273 112 gene locus_tag LOCUS_22780 273 112 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877306.1 protein_id gnl|my_center|LOCUS_22780 602 276 gene locus_tag LOCUS_22790 602 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22790 948 544 gene locus_tag LOCUS_22800 948 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22800 1116 988 gene locus_tag LOCUS_22810 1116 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22810 1336 1094 gene locus_tag LOCUS_22820 1336 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22820 >Feature sequence315 <2145 400 gene locus_tag LOCUS_22830 <2145 400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010723107.1:inverse autotransporter adhesin YeeJ >Feature sequence316 1449 346 gene locus_tag LOCUS_22840 1449 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 <2144 1442 gene locus_tag LOCUS_22850 <2144 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875805.1:uroporphyrinogen-III synthase >Feature sequence317 1351 278 gene locus_tag LOCUS_22860 1351 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence318 <1 554 gene locus_tag LOCUS_22870 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875657.1:30S ribosomal protein S4e 551 1063 gene locus_tag LOCUS_22880 551 1063 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_22880 1072 1215 gene locus_tag LOCUS_22890 1072 1215 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295326.1 protein_id gnl|my_center|LOCUS_22890 1227 1619 gene locus_tag LOCUS_22900 1227 1619 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence319 28 255 gene locus_tag LOCUS_22910 28 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 161 394 gene locus_tag LOCUS_22920 161 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1227 814 gene locus_tag LOCUS_22930 1227 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 >Feature sequence320 418 540 gene locus_tag LOCUS_22940 418 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence321 >Feature sequence322 1842 493 gene locus_tag LOCUS_22950 1842 493 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence323 1546 1151 gene locus_tag LOCUS_22960 1546 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22960 >Feature sequence324 >Feature sequence325 1492 986 gene locus_tag LOCUS_22970 1492 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence326 >Feature sequence327 687 1322 gene locus_tag LOCUS_22980 687 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence328 1312 239 gene locus_tag LOCUS_22990 1312 239 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876855.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence329 726 226 gene locus_tag LOCUS_23000 726 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1343 807 gene locus_tag LOCUS_23010 1343 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1516 1379 gene locus_tag LOCUS_23020 1516 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1849 1517 gene locus_tag LOCUS_23030 1849 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence330 1342 401 gene locus_tag LOCUS_23040 1342 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence331 <2004 477 gene locus_tag LOCUS_23050 <2004 477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021764.1:PKD domain-containing protein note possible pseudo, frameshifted