>Feature sequence01 2400 364 gene locus_tag LOCUS_00010 gene prlC 2400 364 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070205.1 protein_id gnl|my_center|LOCUS_00010 3076 2432 gene locus_tag LOCUS_00020 3076 2432 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939589.1 protein_id gnl|my_center|LOCUS_00020 6098 3066 gene locus_tag LOCUS_00030 6098 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6628 6095 gene locus_tag LOCUS_00040 6628 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7460 6618 gene locus_tag LOCUS_00050 gene mshO 7460 6618 CDS product MSHA fimbrial biogenesis protein MshO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704374.1 protein_id gnl|my_center|LOCUS_00050 8155 7460 gene locus_tag LOCUS_00060 gene mshD 8155 7460 CDS product MSHA fimbrial minor subunit MshD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704373.1 protein_id gnl|my_center|LOCUS_00060 8741 8136 gene locus_tag LOCUS_00070 8741 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8961 8875 gene locus_tag LOCUS_t00010 8961 8875 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11008 9242 gene locus_tag LOCUS_00080 11008 9242 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_00080 11356 11270 gene locus_tag LOCUS_t00020 11356 11270 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11464 11378 gene locus_tag LOCUS_t00030 11464 11378 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11945 11478 gene locus_tag LOCUS_00090 11945 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13408 12074 gene locus_tag LOCUS_00100 gene glmM 13408 12074 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_00100 14413 13511 gene locus_tag LOCUS_00110 gene folP 14413 13511 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071428.1 protein_id gnl|my_center|LOCUS_00110 16469 14475 gene locus_tag LOCUS_00120 gene ftsH 16469 14475 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_00120 17223 16558 gene locus_tag LOCUS_00130 gene rlmE 17223 16558 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707081.1 protein_id gnl|my_center|LOCUS_00130 17399 17860 gene locus_tag LOCUS_00140 gene rnhA 17399 17860 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036192.1 protein_id gnl|my_center|LOCUS_00140 18967 17927 gene locus_tag LOCUS_00150 18967 17927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20086 19433 gene locus_tag LOCUS_00160 20086 19433 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764706.1 protein_id gnl|my_center|LOCUS_00160 23369 20325 gene locus_tag LOCUS_00170 23369 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 24174 23455 gene locus_tag LOCUS_00180 24174 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24363 25151 gene locus_tag LOCUS_00190 gene cysZ 24363 25151 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_00190 26108 25584 gene locus_tag LOCUS_00200 26108 25584 CDS product VC2046/SO_2500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705452.1 protein_id gnl|my_center|LOCUS_00200 27392 26274 gene locus_tag LOCUS_00210 gene asd 27392 26274 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694497.1 protein_id gnl|my_center|LOCUS_00210 29536 27512 gene locus_tag LOCUS_00220 29536 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29952 29548 gene locus_tag LOCUS_00230 29952 29548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30567 29968 gene locus_tag LOCUS_00240 gene lpcA 30567 29968 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457680.1 protein_id gnl|my_center|LOCUS_00240 30785 32380 gene locus_tag LOCUS_00250 30785 32380 CDS product DUF3369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362852.1 protein_id gnl|my_center|LOCUS_00250 33789 32449 gene locus_tag LOCUS_00260 33789 32449 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_00260 34244 34065 gene locus_tag LOCUS_00270 34244 34065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 34348 34578 gene locus_tag LOCUS_00280 34348 34578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00280 34889 36358 gene locus_tag LOCUS_00290 34889 36358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37233 36451 gene locus_tag LOCUS_00300 gene dnaQ 37233 36451 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210700.1 protein_id gnl|my_center|LOCUS_00300 37341 37643 gene locus_tag LOCUS_00310 gene yhbY 37341 37643 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071425.1 protein_id gnl|my_center|LOCUS_00310 38306 37749 gene locus_tag LOCUS_00320 gene greA 38306 37749 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 protein_id gnl|my_center|LOCUS_00320 39526 38384 gene locus_tag LOCUS_00330 gene dnaJ 39526 38384 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_00330 42010 40076 gene locus_tag LOCUS_00340 gene dnaK 42010 40076 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706781.1 protein_id gnl|my_center|LOCUS_00340 44333 42333 gene locus_tag LOCUS_00350 44333 42333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 45386 44424 gene locus_tag LOCUS_00360 45386 44424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45604 46476 gene locus_tag LOCUS_00370 gene nadK 45604 46476 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303013.1 protein_id gnl|my_center|LOCUS_00370 46492 48153 gene locus_tag LOCUS_00380 gene recN 46492 48153 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_00380 48204 48545 gene locus_tag LOCUS_00390 48204 48545 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705347.1 protein_id gnl|my_center|LOCUS_00390 50612 48915 gene locus_tag LOCUS_00400 50612 48915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50780 50944 gene locus_tag LOCUS_00410 50780 50944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51299 51892 gene locus_tag LOCUS_00420 51299 51892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52476 52009 gene locus_tag LOCUS_00430 52476 52009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52804 52511 gene locus_tag LOCUS_00440 52804 52511 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117834.1 protein_id gnl|my_center|LOCUS_00440 54067 52865 gene locus_tag LOCUS_00450 gene ackA 54067 52865 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072820.1 protein_id gnl|my_center|LOCUS_00450 54410 56500 gene locus_tag LOCUS_00460 gene ppk1 54410 56500 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706631.1 protein_id gnl|my_center|LOCUS_00460 58530 56671 gene locus_tag LOCUS_00470 58530 56671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 58843 59172 gene locus_tag LOCUS_00480 58843 59172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 63138 59299 gene locus_tag LOCUS_00490 63138 59299 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706838.1 protein_id gnl|my_center|LOCUS_00490 64409 63135 gene locus_tag LOCUS_00500 64409 63135 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706839.1 protein_id gnl|my_center|LOCUS_00500 64721 65116 gene locus_tag LOCUS_00510 64721 65116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 65291 66223 gene locus_tag LOCUS_00520 gene rdgC 65291 66223 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368016.1 protein_id gnl|my_center|LOCUS_00520 66312 67685 gene locus_tag LOCUS_00530 gene yegQ 66312 67685 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_00530 67685 67942 gene locus_tag LOCUS_00540 67685 67942 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_00540 68077 68994 gene locus_tag LOCUS_00550 68077 68994 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212693.1 protein_id gnl|my_center|LOCUS_00550 69191 70060 gene locus_tag LOCUS_00560 gene suhB 69191 70060 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 protein_id gnl|my_center|LOCUS_00560 70120 70296 gene locus_tag LOCUS_00570 70120 70296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 70760 70221 gene locus_tag LOCUS_00580 70760 70221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 71000 71131 gene locus_tag LOCUS_00590 71000 71131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 72498 71257 gene locus_tag LOCUS_00600 gene nifS 72498 71257 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_00600 73432 72500 gene locus_tag LOCUS_00610 gene nifU 73432 72500 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_00610 74006 73557 gene locus_tag LOCUS_00620 74006 73557 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_00620 74201 74455 gene locus_tag LOCUS_00630 74201 74455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 74540 75145 gene locus_tag LOCUS_00640 74540 75145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 75138 76475 gene locus_tag LOCUS_00650 75138 76475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 77121 76561 gene locus_tag LOCUS_00660 77121 76561 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 protein_id gnl|my_center|LOCUS_00660 77493 79946 gene locus_tag LOCUS_00670 gene plsB 77493 79946 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704200.1 protein_id gnl|my_center|LOCUS_00670 79998 81131 gene locus_tag LOCUS_00680 79998 81131 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_00680 81678 81259 gene locus_tag LOCUS_00690 81678 81259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 82459 81806 gene locus_tag LOCUS_00700 82459 81806 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_00700 82784 84142 gene locus_tag LOCUS_00710 82784 84142 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_00710 86755 84251 gene locus_tag LOCUS_00720 86755 84251 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_00720 87385 86765 gene locus_tag LOCUS_00730 87385 86765 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263204.1 protein_id gnl|my_center|LOCUS_00730 87744 87388 gene locus_tag LOCUS_00740 87744 87388 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837349.1 protein_id gnl|my_center|LOCUS_00740 88143 87925 gene locus_tag LOCUS_00750 88143 87925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 88783 88220 gene locus_tag LOCUS_00760 88783 88220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence02 691 392 gene locus_tag LOCUS_00770 691 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 1067 684 gene locus_tag LOCUS_00780 1067 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 1658 2059 gene locus_tag LOCUS_00790 1658 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 2258 2686 gene locus_tag LOCUS_00800 2258 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2679 3851 gene locus_tag LOCUS_00810 gene lapB 2679 3851 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481625.1 protein_id gnl|my_center|LOCUS_00810 3864 4577 gene locus_tag LOCUS_00820 gene pyrF 3864 4577 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481650.1 protein_id gnl|my_center|LOCUS_00820 5511 4717 gene locus_tag LOCUS_00830 5511 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 6737 5508 gene locus_tag LOCUS_00840 6737 5508 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706002.1 protein_id gnl|my_center|LOCUS_00840 8504 6936 gene locus_tag LOCUS_00850 8504 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 10018 8498 gene locus_tag LOCUS_00860 10018 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 10955 10011 gene locus_tag LOCUS_00870 10955 10011 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492076.1 protein_id gnl|my_center|LOCUS_00870 11401 10943 gene locus_tag LOCUS_00880 11401 10943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 12264 11398 gene locus_tag LOCUS_00890 12264 11398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 13217 12261 gene locus_tag LOCUS_00900 13217 12261 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462975.1 protein_id gnl|my_center|LOCUS_00900 13898 14338 gene locus_tag LOCUS_00910 gene sixA 13898 14338 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365538.1 protein_id gnl|my_center|LOCUS_00910 14539 15084 gene locus_tag LOCUS_00920 14539 15084 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_00920 15359 17086 gene locus_tag LOCUS_00930 gene nhaB 15359 17086 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211689.1 protein_id gnl|my_center|LOCUS_00930 17316 17573 gene locus_tag LOCUS_00940 17316 17573 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350921.1 protein_id gnl|my_center|LOCUS_00940 17776 18708 gene locus_tag LOCUS_00950 gene prmB 17776 18708 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209710.1 protein_id gnl|my_center|LOCUS_00950 18801 19895 gene locus_tag LOCUS_00960 gene aroC 18801 19895 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918437.1 protein_id gnl|my_center|LOCUS_00960 20074 20667 gene locus_tag LOCUS_00970 20074 20667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00970 20640 21107 gene locus_tag LOCUS_00980 20640 21107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00980 22386 21598 gene locus_tag LOCUS_00990 22386 21598 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705041.1 protein_id gnl|my_center|LOCUS_00990 22702 23001 gene locus_tag LOCUS_01000 gene rplY 22702 23001 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945378.1 protein_id gnl|my_center|LOCUS_01000 23499 23813 gene locus_tag LOCUS_01010 23499 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 23806 24123 gene locus_tag LOCUS_01020 23806 24123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 24358 25305 gene locus_tag LOCUS_01030 24358 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 25302 26462 gene locus_tag LOCUS_01040 gene setB 25302 26462 CDS product sugar efflux transporter SetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706120.1 protein_id gnl|my_center|LOCUS_01040 26466 27761 gene locus_tag LOCUS_01050 gene sohB 26466 27761 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394900.1 protein_id gnl|my_center|LOCUS_01050 27898 30687 gene locus_tag LOCUS_01060 gene topA 27898 30687 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072651.1 protein_id gnl|my_center|LOCUS_01060 30690 31475 gene locus_tag LOCUS_01070 gene mepA 30690 31475 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750429.1 protein_id gnl|my_center|LOCUS_01070 31613 33727 gene locus_tag LOCUS_01080 gene glgX 31613 33727 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_01080 34036 33950 gene locus_tag LOCUS_t00040 34036 33950 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34131 34058 gene locus_tag LOCUS_t00050 34131 34058 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 34209 34134 gene locus_tag LOCUS_t00060 34209 34134 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34453 37047 gene locus_tag LOCUS_01090 34453 37047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 37214 38176 gene locus_tag LOCUS_01100 37214 38176 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081179.1 protein_id gnl|my_center|LOCUS_01100 38481 41039 gene locus_tag LOCUS_01110 38481 41039 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706264.1 protein_id gnl|my_center|LOCUS_01110 41217 42332 gene locus_tag LOCUS_01120 41217 42332 CDS product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706497.1 protein_id gnl|my_center|LOCUS_01120 42334 43332 gene locus_tag LOCUS_01130 42334 43332 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706496.1 protein_id gnl|my_center|LOCUS_01130 43435 45432 gene locus_tag LOCUS_01140 43435 45432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 45481 46275 gene locus_tag LOCUS_01150 gene truA 45481 46275 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479529.1 protein_id gnl|my_center|LOCUS_01150 48496 46283 gene locus_tag LOCUS_01160 48496 46283 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267536.1 protein_id gnl|my_center|LOCUS_01160 49524 48493 gene locus_tag LOCUS_01170 49524 48493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 50078 49512 gene locus_tag LOCUS_01180 50078 49512 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963355.1 protein_id gnl|my_center|LOCUS_01180 50245 51111 gene locus_tag LOCUS_01190 gene accD 50245 51111 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706493.1 protein_id gnl|my_center|LOCUS_01190 51132 52454 gene locus_tag LOCUS_01200 gene folC 51132 52454 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072965.1 protein_id gnl|my_center|LOCUS_01200 52451 53326 gene locus_tag LOCUS_01210 52451 53326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 53373 54128 gene locus_tag LOCUS_01220 53373 54128 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706625.1 protein_id gnl|my_center|LOCUS_01220 54139 55683 gene locus_tag LOCUS_01230 54139 55683 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_01230 55676 56026 gene locus_tag LOCUS_01240 55676 56026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 56023 57249 gene locus_tag LOCUS_01250 56023 57249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 57306 59525 gene locus_tag LOCUS_01260 57306 59525 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819701.1 protein_id gnl|my_center|LOCUS_01260 60284 59565 gene locus_tag LOCUS_01270 60284 59565 CDS product DUF2057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097250.1 protein_id gnl|my_center|LOCUS_01270 60467 61516 gene locus_tag LOCUS_01280 60467 61516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 61598 62260 gene locus_tag LOCUS_01290 gene folE 61598 62260 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419880.1 protein_id gnl|my_center|LOCUS_01290 62296 62844 gene locus_tag LOCUS_01300 gene apt 62296 62844 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208606.1 protein_id gnl|my_center|LOCUS_01300 62844 65237 gene locus_tag LOCUS_01310 62844 65237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 65592 65915 gene locus_tag LOCUS_01320 65592 65915 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_01320 65923 66531 gene locus_tag LOCUS_01330 gene recR 65923 66531 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633741.1 protein_id gnl|my_center|LOCUS_01330 66904 69294 gene locus_tag LOCUS_01340 66904 69294 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819018.1 protein_id gnl|my_center|LOCUS_01340 69295 70773 gene locus_tag LOCUS_01350 69295 70773 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_01350 70770 71993 gene locus_tag LOCUS_01360 70770 71993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 >Feature sequence03 169 1914 gene locus_tag LOCUS_01370 169 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2091 1903 gene locus_tag LOCUS_01380 2091 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2291 2088 gene locus_tag LOCUS_01390 2291 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3361 2444 gene locus_tag LOCUS_01400 3361 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3639 4196 gene locus_tag LOCUS_01410 gene dsbB 3639 4196 CDS product disulfide bond formation protein DsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706278.1 protein_id gnl|my_center|LOCUS_01410 5004 4252 gene locus_tag LOCUS_01420 5004 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 5258 5920 gene locus_tag LOCUS_01430 5258 5920 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 protein_id gnl|my_center|LOCUS_01430 6483 5986 gene locus_tag LOCUS_01440 gene nrdG 6483 5986 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095356.1 protein_id gnl|my_center|LOCUS_01440 8770 6749 gene locus_tag LOCUS_01450 gene uvrB 8770 6749 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042501.1 protein_id gnl|my_center|LOCUS_01450 9033 9108 gene locus_tag LOCUS_t00070 9033 9108 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9133 9208 gene locus_tag LOCUS_t00080 9133 9208 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9368 11344 gene locus_tag LOCUS_01460 9368 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 12504 11509 gene locus_tag LOCUS_01470 gene aroA 12504 11509 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633771.1 protein_id gnl|my_center|LOCUS_01470 12542 12844 gene locus_tag LOCUS_01480 12542 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 13911 12862 gene locus_tag LOCUS_01490 gene serC 13911 12862 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705848.1 protein_id gnl|my_center|LOCUS_01490 16825 14000 gene locus_tag LOCUS_01500 gene gyrA 16825 14000 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706172.1 protein_id gnl|my_center|LOCUS_01500 18475 17108 gene locus_tag LOCUS_01510 18475 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 22533 18748 gene locus_tag LOCUS_01520 gene purL 22533 18748 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_01520 23205 23005 gene locus_tag LOCUS_01530 23205 23005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 25150 23264 gene locus_tag LOCUS_01540 25150 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 26671 25205 gene locus_tag LOCUS_01550 gene bamB 26671 25205 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815787.1 protein_id gnl|my_center|LOCUS_01550 27504 26878 gene locus_tag LOCUS_01560 27504 26878 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209815.1 protein_id gnl|my_center|LOCUS_01560 28885 27605 gene locus_tag LOCUS_01570 gene hisS 28885 27605 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_01570 30041 28932 gene locus_tag LOCUS_01580 gene ispG 30041 28932 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705645.1 protein_id gnl|my_center|LOCUS_01580 31349 30042 gene locus_tag LOCUS_01590 31349 30042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 32150 31470 gene locus_tag LOCUS_01600 32150 31470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 33453 32368 gene locus_tag LOCUS_01610 33453 32368 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098279.1 protein_id gnl|my_center|LOCUS_01610 34023 33589 gene locus_tag LOCUS_01620 gene ndk 34023 33589 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860625.1 protein_id gnl|my_center|LOCUS_01620 35434 34175 gene locus_tag LOCUS_01630 gene pepB 35434 34175 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705639.1 protein_id gnl|my_center|LOCUS_01630 35592 36803 gene locus_tag LOCUS_01640 35592 36803 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706443.1 protein_id gnl|my_center|LOCUS_01640 36873 37478 gene locus_tag LOCUS_01650 gene yfbR 36873 37478 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158196.1 protein_id gnl|my_center|LOCUS_01650 37544 38803 gene locus_tag LOCUS_01660 37544 38803 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029303566.1 protein_id gnl|my_center|LOCUS_01660 40900 38879 gene locus_tag LOCUS_01670 40900 38879 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080084.1 protein_id gnl|my_center|LOCUS_01670 44250 41173 gene locus_tag LOCUS_01680 44250 41173 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817986.1 protein_id gnl|my_center|LOCUS_01680 45191 44325 gene locus_tag LOCUS_01690 45191 44325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 46068 45193 gene locus_tag LOCUS_01700 46068 45193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 46423 46061 gene locus_tag LOCUS_01710 gene hinT 46423 46061 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 protein_id gnl|my_center|LOCUS_01710 46854 48926 gene locus_tag LOCUS_01720 46854 48926 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041204594.1 protein_id gnl|my_center|LOCUS_01720 48968 50311 gene locus_tag LOCUS_01730 48968 50311 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 protein_id gnl|my_center|LOCUS_01730 50754 52841 gene locus_tag LOCUS_01740 50754 52841 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041204594.1 protein_id gnl|my_center|LOCUS_01740 53834 53076 gene locus_tag LOCUS_01750 53834 53076 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705419.1 protein_id gnl|my_center|LOCUS_01750 55654 53885 gene locus_tag LOCUS_01760 gene aspS 55654 53885 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169176.1 protein_id gnl|my_center|LOCUS_01760 55927 55667 gene locus_tag LOCUS_01770 55927 55667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 56901 56065 gene locus_tag LOCUS_01780 56901 56065 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_01780 58796 56913 gene locus_tag LOCUS_01790 58796 56913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 59231 60808 gene locus_tag LOCUS_01800 59231 60808 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706723.1 protein_id gnl|my_center|LOCUS_01800 60801 61391 gene locus_tag LOCUS_01810 60801 61391 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706724.1 protein_id gnl|my_center|LOCUS_01810 61394 62407 gene locus_tag LOCUS_01820 gene trpD 61394 62407 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706725.1 protein_id gnl|my_center|LOCUS_01820 62409 63836 gene locus_tag LOCUS_01830 gene trpCF 62409 63836 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818276.1 protein_id gnl|my_center|LOCUS_01830 63891 65087 gene locus_tag LOCUS_01840 gene trpB 63891 65087 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706727.1 protein_id gnl|my_center|LOCUS_01840 65087 65908 gene locus_tag LOCUS_01850 gene trpA 65087 65908 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443029.1 protein_id gnl|my_center|LOCUS_01850 66090 66845 gene locus_tag LOCUS_01860 66090 66845 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409782.1 protein_id gnl|my_center|LOCUS_01860 66820 67533 gene locus_tag LOCUS_01870 gene rluA 66820 67533 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704807.1 protein_id gnl|my_center|LOCUS_01870 67536 68498 gene locus_tag LOCUS_01880 67536 68498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 70771 68537 gene locus_tag LOCUS_01890 70771 68537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 71123 70821 gene locus_tag LOCUS_01900 71123 70821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence04 876 277 gene locus_tag LOCUS_01910 876 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 1085 1258 gene locus_tag LOCUS_01920 1085 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 1595 2878 gene locus_tag LOCUS_01930 gene urtA 1595 2878 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314994.1 protein_id gnl|my_center|LOCUS_01930 3060 4592 gene locus_tag LOCUS_01940 gene urtB 3060 4592 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084266.1 protein_id gnl|my_center|LOCUS_01940 4596 5777 gene locus_tag LOCUS_01950 gene urtC 4596 5777 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244009.1 protein_id gnl|my_center|LOCUS_01950 5780 6610 gene locus_tag LOCUS_01960 gene urtD 5780 6610 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105136.1 protein_id gnl|my_center|LOCUS_01960 6607 7308 gene locus_tag LOCUS_01970 gene urtE 6607 7308 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_01970 7543 8280 gene locus_tag LOCUS_01980 7543 8280 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 protein_id gnl|my_center|LOCUS_01980 8379 8681 gene locus_tag LOCUS_01990 8379 8681 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862556.1 protein_id gnl|my_center|LOCUS_01990 8690 9004 gene locus_tag LOCUS_02000 8690 9004 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_02000 9090 10790 gene locus_tag LOCUS_02010 gene ureC 9090 10790 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_02010 10850 11401 gene locus_tag LOCUS_02020 10850 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 11459 12139 gene locus_tag LOCUS_02030 11459 12139 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098771.1 protein_id gnl|my_center|LOCUS_02030 12209 12820 gene locus_tag LOCUS_02040 gene ureG 12209 12820 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021389.1 protein_id gnl|my_center|LOCUS_02040 13020 13238 gene locus_tag LOCUS_02050 13020 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 13210 14850 gene locus_tag LOCUS_02060 13210 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 14958 16571 gene locus_tag LOCUS_02070 14958 16571 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_02070 16626 17225 gene locus_tag LOCUS_02080 16626 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 18097 17261 gene locus_tag LOCUS_02090 18097 17261 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705594.1 protein_id gnl|my_center|LOCUS_02090 19229 18024 gene locus_tag LOCUS_02100 19229 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 19915 19229 gene locus_tag LOCUS_02110 gene mtnN 19915 19229 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167232.1 protein_id gnl|my_center|LOCUS_02110 20312 24931 gene locus_tag LOCUS_02120 20312 24931 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_02120 24931 26415 gene locus_tag LOCUS_02130 24931 26415 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_02130 26608 26997 gene locus_tag LOCUS_02140 26608 26997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 27376 27161 gene locus_tag LOCUS_02150 27376 27161 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 protein_id gnl|my_center|LOCUS_02150 27675 29030 gene locus_tag LOCUS_02160 27675 29030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 29169 30482 gene locus_tag LOCUS_02170 gene glgC 29169 30482 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706313.1 protein_id gnl|my_center|LOCUS_02170 30812 31309 gene locus_tag LOCUS_02180 30812 31309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 31602 34064 gene locus_tag LOCUS_02190 gene thrA 31602 34064 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706816.1 protein_id gnl|my_center|LOCUS_02190 34064 35014 gene locus_tag LOCUS_02200 gene thrB 34064 35014 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479586.1 protein_id gnl|my_center|LOCUS_02200 35117 36403 gene locus_tag LOCUS_02210 gene thrC 35117 36403 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706814.1 protein_id gnl|my_center|LOCUS_02210 36432 37016 gene locus_tag LOCUS_02220 gene crr 36432 37016 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303134.1 protein_id gnl|my_center|LOCUS_02220 37013 37675 gene locus_tag LOCUS_02230 37013 37675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 37892 39520 gene locus_tag LOCUS_02240 37892 39520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 41230 40208 gene locus_tag LOCUS_02250 41230 40208 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022934.1 protein_id gnl|my_center|LOCUS_02250 42706 41624 gene locus_tag LOCUS_02260 42706 41624 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272497.1 protein_id gnl|my_center|LOCUS_02260 43538 42708 gene locus_tag LOCUS_02270 gene cysW 43538 42708 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_02270 44355 43522 gene locus_tag LOCUS_02280 gene cysT 44355 43522 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_02280 45475 44456 gene locus_tag LOCUS_02290 45475 44456 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_02290 46163 48526 gene locus_tag LOCUS_02300 46163 48526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 48541 50529 gene locus_tag LOCUS_02310 48541 50529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 50548 51537 gene locus_tag LOCUS_02320 gene hemB 50548 51537 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761803.1 protein_id gnl|my_center|LOCUS_02320 51537 52430 gene locus_tag LOCUS_02330 gene cysD 51537 52430 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_02330 52442 53689 gene locus_tag LOCUS_02340 52442 53689 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087711038.1 protein_id gnl|my_center|LOCUS_02340 53693 54421 gene locus_tag LOCUS_02350 53693 54421 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816178.1 protein_id gnl|my_center|LOCUS_02350 54425 54916 gene locus_tag LOCUS_02360 54425 54916 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927175.1 protein_id gnl|my_center|LOCUS_02360 54924 55817 gene locus_tag LOCUS_02370 54924 55817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 55887 57179 gene locus_tag LOCUS_02380 gene hemL 55887 57179 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_02380 57740 57243 gene locus_tag LOCUS_02390 57740 57243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 57893 58681 gene locus_tag LOCUS_02400 57893 58681 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836388.1 protein_id gnl|my_center|LOCUS_02400 58705 59493 gene locus_tag LOCUS_02410 gene xds 58705 59493 CDS product extracellular deoxyribonuclease Dns inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972596.1 protein_id gnl|my_center|LOCUS_02410 59512 59931 gene locus_tag LOCUS_02420 gene ruvX 59512 59931 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_02420 59950 60231 gene locus_tag LOCUS_02430 59950 60231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 60697 60215 gene locus_tag LOCUS_02440 60697 60215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 60812 60973 gene locus_tag LOCUS_02450 60812 60973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 61086 62522 gene locus_tag LOCUS_02460 61086 62522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence05 359 81 gene locus_tag LOCUS_02470 359 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 562 383 gene locus_tag LOCUS_02480 562 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2468 726 gene locus_tag LOCUS_02490 gene treZ 2468 726 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_02490 4540 2696 gene locus_tag LOCUS_02500 4540 2696 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529729.1 protein_id gnl|my_center|LOCUS_02500 4907 5893 gene locus_tag LOCUS_02510 4907 5893 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_02510 5893 6447 gene locus_tag LOCUS_02520 5893 6447 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 protein_id gnl|my_center|LOCUS_02520 6444 7046 gene locus_tag LOCUS_02530 6444 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 7015 7563 gene locus_tag LOCUS_02540 gene lptA 7015 7563 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693464.1 protein_id gnl|my_center|LOCUS_02540 7565 8290 gene locus_tag LOCUS_02550 gene lptB 7565 8290 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 protein_id gnl|my_center|LOCUS_02550 8293 9882 gene locus_tag LOCUS_02560 8293 9882 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478844.1 protein_id gnl|my_center|LOCUS_02560 10165 10452 gene locus_tag LOCUS_02570 gene hpf 10165 10452 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_02570 11172 11669 gene locus_tag LOCUS_02580 gene ptsN 11172 11669 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213952.1 protein_id gnl|my_center|LOCUS_02580 11698 12564 gene locus_tag LOCUS_02590 gene rapZ 11698 12564 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707611.1 protein_id gnl|my_center|LOCUS_02590 14989 15837 gene locus_tag LOCUS_02600 14989 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 15861 16019 gene locus_tag LOCUS_02610 15861 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 16059 17072 gene locus_tag LOCUS_02620 16059 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 20233 17891 gene locus_tag LOCUS_02630 gene gyrB 20233 17891 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 protein_id gnl|my_center|LOCUS_02630 21479 20316 gene locus_tag LOCUS_02640 gene recF 21479 20316 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704049.1 protein_id gnl|my_center|LOCUS_02640 22981 21791 gene locus_tag LOCUS_02650 gene dnaN 22981 21791 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421522.1 protein_id gnl|my_center|LOCUS_02650 24611 23043 gene locus_tag LOCUS_02660 gene dnaA 24611 23043 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059095.1 protein_id gnl|my_center|LOCUS_02660 25217 25354 gene locus_tag LOCUS_02670 gene rpmH 25217 25354 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005539760.1 protein_id gnl|my_center|LOCUS_02670 25354 25719 gene locus_tag LOCUS_02680 gene rnpA 25354 25719 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 protein_id gnl|my_center|LOCUS_02680 25719 25943 gene locus_tag LOCUS_02690 25719 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 25946 27604 gene locus_tag LOCUS_02700 gene yidC 25946 27604 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220739.1 protein_id gnl|my_center|LOCUS_02700 28649 27669 gene locus_tag LOCUS_02710 28649 27669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 29719 28646 gene locus_tag LOCUS_02720 29719 28646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 30684 29899 gene locus_tag LOCUS_02730 30684 29899 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817266.1 protein_id gnl|my_center|LOCUS_02730 31610 30684 gene locus_tag LOCUS_02740 31610 30684 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174267.1 protein_id gnl|my_center|LOCUS_02740 33049 31613 gene locus_tag LOCUS_02750 33049 31613 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_02750 33519 34280 gene locus_tag LOCUS_02760 33519 34280 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_02760 34415 35764 gene locus_tag LOCUS_02770 gene mnmE 34415 35764 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 protein_id gnl|my_center|LOCUS_02770 35796 36458 gene locus_tag LOCUS_02780 35796 36458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 36696 36478 gene locus_tag LOCUS_02790 36696 36478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 37299 36805 gene locus_tag LOCUS_02800 37299 36805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02800 38360 37407 gene locus_tag LOCUS_02810 38360 37407 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027936894.1 protein_id gnl|my_center|LOCUS_02810 38558 39721 gene locus_tag LOCUS_02820 38558 39721 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_02820 39772 40374 gene locus_tag LOCUS_02830 39772 40374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 40371 40946 gene locus_tag LOCUS_02840 40371 40946 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642721.1 protein_id gnl|my_center|LOCUS_02840 40943 41749 gene locus_tag LOCUS_02850 40943 41749 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_02850 42668 41667 gene locus_tag LOCUS_02860 42668 41667 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_02860 42892 43242 gene locus_tag LOCUS_02870 gene tusC 42892 43242 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261074.1 protein_id gnl|my_center|LOCUS_02870 44489 44626 gene locus_tag LOCUS_02880 44489 44626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 45778 45101 gene locus_tag LOCUS_02890 45778 45101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 46435 45842 gene locus_tag LOCUS_02900 gene pqiC 46435 45842 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759123.1 protein_id gnl|my_center|LOCUS_02900 48112 46448 gene locus_tag LOCUS_02910 gene pqiB 48112 46448 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445550.1 protein_id gnl|my_center|LOCUS_02910 49385 48102 gene locus_tag LOCUS_02920 gene pqiA 49385 48102 CDS product membrane integrity-associated transporter subunit PqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333152.1 protein_id gnl|my_center|LOCUS_02920 51169 49382 gene locus_tag LOCUS_02930 51169 49382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 51184 51357 gene locus_tag LOCUS_02940 51184 51357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 51548 54220 gene locus_tag LOCUS_02950 51548 54220 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_02950 55566 54301 gene locus_tag LOCUS_02960 gene ydiK 55566 54301 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_02960 55670 56800 gene locus_tag LOCUS_02970 gene earP 55670 56800 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072321.1 protein_id gnl|my_center|LOCUS_02970 56957 57523 gene locus_tag LOCUS_02980 gene efp 56957 57523 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707002.1 protein_id gnl|my_center|LOCUS_02980 57724 58248 gene locus_tag LOCUS_02990 57724 58248 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_02990 59069 61000 gene locus_tag LOCUS_03000 gene mnmG 59069 61000 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707918.1 protein_id gnl|my_center|LOCUS_03000 60997 61626 gene locus_tag LOCUS_03010 gene rsmG 60997 61626 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 protein_id gnl|my_center|LOCUS_03010 61650 62459 gene locus_tag LOCUS_03020 61650 62459 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence06 <1 1072 gene locus_tag LOCUS_03030 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767836.1:ATP-binding protein 8512 1661 gene locus_tag LOCUS_03040 8512 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8711 8989 gene locus_tag LOCUS_03050 8711 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 9549 8881 gene locus_tag LOCUS_03060 9549 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 9878 11203 gene locus_tag LOCUS_03070 gene serS 9878 11203 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705744.1 protein_id gnl|my_center|LOCUS_03070 11305 11961 gene locus_tag LOCUS_03080 11305 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 11992 13512 gene locus_tag LOCUS_03090 gene purF 11992 13512 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705746.1 protein_id gnl|my_center|LOCUS_03090 13533 15893 gene locus_tag LOCUS_03100 13533 15893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 16012 16650 gene locus_tag LOCUS_03110 16012 16650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 16783 18477 gene locus_tag LOCUS_03120 16783 18477 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705772.1 protein_id gnl|my_center|LOCUS_03120 18739 19695 gene locus_tag LOCUS_03130 18739 19695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 19852 21546 gene locus_tag LOCUS_03140 gene fadD 19852 21546 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_03140 21546 22703 gene locus_tag LOCUS_03150 gene rnd 21546 22703 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496047.1 protein_id gnl|my_center|LOCUS_03150 23550 22645 gene locus_tag LOCUS_03160 23550 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 24482 23547 gene locus_tag LOCUS_03170 24482 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 25854 24673 gene locus_tag LOCUS_03180 gene purT 25854 24673 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705978.1 protein_id gnl|my_center|LOCUS_03180 26653 25997 gene locus_tag LOCUS_03190 26653 25997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 26971 27810 gene locus_tag LOCUS_03200 26971 27810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 27816 29906 gene locus_tag LOCUS_03210 gene prc 27816 29906 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 protein_id gnl|my_center|LOCUS_03210 29909 30009 gene locus_tag LOCUS_t00090 29909 30009 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 30077 32704 gene locus_tag LOCUS_03220 gene pepN 30077 32704 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816045.1 protein_id gnl|my_center|LOCUS_03220 32716 32958 gene locus_tag LOCUS_03230 32716 32958 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261890.1 protein_id gnl|my_center|LOCUS_03230 32948 33964 gene locus_tag LOCUS_03240 32948 33964 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_03240 34077 34634 gene locus_tag LOCUS_03250 34077 34634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 35663 34788 gene locus_tag LOCUS_03260 35663 34788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 36187 37533 gene locus_tag LOCUS_03270 36187 37533 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_03270 37971 37816 gene locus_tag LOCUS_03280 37971 37816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 39314 38280 gene locus_tag LOCUS_03290 gene gap 39314 38280 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_03290 39720 41978 gene locus_tag LOCUS_03300 gene relA 39720 41978 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704766.1 protein_id gnl|my_center|LOCUS_03300 43142 42081 gene locus_tag LOCUS_03310 gene flaA 43142 42081 CDS product flagellin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705588.1 protein_id gnl|my_center|LOCUS_03310 43323 44372 gene locus_tag LOCUS_03320 43323 44372 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_03320 44545 45045 gene locus_tag LOCUS_03330 44545 45045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 45692 45060 gene locus_tag LOCUS_03340 45692 45060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 46579 45770 gene locus_tag LOCUS_03350 46579 45770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 47643 46825 gene locus_tag LOCUS_03360 47643 46825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 47829 48623 gene locus_tag LOCUS_03370 47829 48623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 49630 48659 gene locus_tag LOCUS_03380 49630 48659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 50272 49814 gene locus_tag LOCUS_03390 50272 49814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 51359 50547 gene locus_tag LOCUS_03400 51359 50547 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_03400 51917 51420 gene locus_tag LOCUS_03410 51917 51420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 52300 51914 gene locus_tag LOCUS_03420 gene folB 52300 51914 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656206.1 protein_id gnl|my_center|LOCUS_03420 52514 56329 gene locus_tag LOCUS_03430 52514 56329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 56502 58148 gene locus_tag LOCUS_03440 gene pyrG 56502 58148 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209376.1 protein_id gnl|my_center|LOCUS_03440 58242 59543 gene locus_tag LOCUS_03450 gene eno 58242 59543 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455579.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence07 188 3 gene locus_tag LOCUS_03460 188 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 454 191 gene locus_tag LOCUS_03470 454 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 1371 772 gene locus_tag LOCUS_03480 gene leuD 1371 772 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704819.1 protein_id gnl|my_center|LOCUS_03480 2795 1368 gene locus_tag LOCUS_03490 gene leuC 2795 1368 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 protein_id gnl|my_center|LOCUS_03490 3883 2792 gene locus_tag LOCUS_03500 gene leuB 3883 2792 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132138.1 protein_id gnl|my_center|LOCUS_03500 5581 4013 gene locus_tag LOCUS_03510 gene leuA 5581 4013 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704822.1 protein_id gnl|my_center|LOCUS_03510 7169 5937 gene locus_tag LOCUS_03520 7169 5937 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_03520 8460 7246 gene locus_tag LOCUS_03530 8460 7246 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_03530 9105 8572 gene locus_tag LOCUS_03540 9105 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 9851 9102 gene locus_tag LOCUS_03550 9851 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 11187 9946 gene locus_tag LOCUS_03560 11187 9946 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_03560 12527 11319 gene locus_tag LOCUS_03570 12527 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 13668 12514 gene locus_tag LOCUS_03580 13668 12514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 14082 15023 gene locus_tag LOCUS_03590 14082 15023 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461645.1 protein_id gnl|my_center|LOCUS_03590 15352 15720 gene locus_tag LOCUS_03600 15352 15720 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_03600 17191 15983 gene locus_tag LOCUS_03610 17191 15983 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_03610 17445 18455 gene locus_tag LOCUS_03620 17445 18455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 19612 18548 gene locus_tag LOCUS_03630 19612 18548 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459940.1 protein_id gnl|my_center|LOCUS_03630 19785 20066 gene locus_tag LOCUS_03640 19785 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 25357 20198 gene locus_tag LOCUS_03650 25357 20198 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 protein_id gnl|my_center|LOCUS_03650 26206 25592 gene locus_tag LOCUS_03660 26206 25592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 26905 26318 gene locus_tag LOCUS_03670 26905 26318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 27581 27120 gene locus_tag LOCUS_03680 27581 27120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 28168 27662 gene locus_tag LOCUS_03690 28168 27662 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_03690 29860 28415 gene locus_tag LOCUS_03700 gene galP 29860 28415 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098659.1 protein_id gnl|my_center|LOCUS_03700 31055 30123 gene locus_tag LOCUS_03710 31055 30123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 31256 31418 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgtcatgatcgtcatcgtcat 32865 31942 gene locus_tag LOCUS_03720 gene miaA 32865 31942 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480058.1 protein_id gnl|my_center|LOCUS_03720 34895 32862 gene locus_tag LOCUS_03730 34895 32862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 35892 34963 gene locus_tag LOCUS_03740 gene ldtB 35892 34963 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056404.1 protein_id gnl|my_center|LOCUS_03740 36066 38654 gene locus_tag LOCUS_03750 gene leuS 36066 38654 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077392314.1 protein_id gnl|my_center|LOCUS_03750 38665 39162 gene locus_tag LOCUS_03760 38665 39162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 39162 40175 gene locus_tag LOCUS_03770 gene holA 39162 40175 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_03770 40172 40795 gene locus_tag LOCUS_03780 gene nadD 40172 40795 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_03780 42515 40809 gene locus_tag LOCUS_03790 42515 40809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 42732 42657 gene locus_tag LOCUS_t00100 42732 42657 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 43153 42872 gene locus_tag LOCUS_03800 43153 42872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 43773 43189 gene locus_tag LOCUS_03810 gene orn 43773 43189 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_03810 44225 44076 gene locus_tag LOCUS_03820 44225 44076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 44250 45011 gene locus_tag LOCUS_03830 44250 45011 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235899614.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03830 45105 45965 gene locus_tag LOCUS_03840 gene asd 45105 45965 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070925.1 protein_id gnl|my_center|LOCUS_03840 46195 48009 gene locus_tag LOCUS_03850 gene frdA 46195 48009 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706984.1 protein_id gnl|my_center|LOCUS_03850 48012 48749 gene locus_tag LOCUS_03860 48012 48749 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706985.1 protein_id gnl|my_center|LOCUS_03860 48752 49189 gene locus_tag LOCUS_03870 48752 49189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 49206 49574 gene locus_tag LOCUS_03880 gene frdD 49206 49574 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706986.1 protein_id gnl|my_center|LOCUS_03880 49918 50439 gene locus_tag LOCUS_03890 49918 50439 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_03890 50580 52250 gene locus_tag LOCUS_03900 gene ettA 50580 52250 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704886.1 protein_id gnl|my_center|LOCUS_03900 52330 52917 gene locus_tag LOCUS_03910 52330 52917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 53867 52932 gene locus_tag LOCUS_03920 gene dusA 53867 52932 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_03920 53866 54180 gene locus_tag LOCUS_03930 53866 54180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 54177 54527 gene locus_tag LOCUS_03940 54177 54527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 55741 54668 gene locus_tag LOCUS_03950 gene alr 55741 54668 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704949.1 protein_id gnl|my_center|LOCUS_03950 57300 55870 gene locus_tag LOCUS_03960 57300 55870 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774910.1 protein_id gnl|my_center|LOCUS_03960 57539 57631 gene locus_tag LOCUS_t00110 57539 57631 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57643 57719 gene locus_tag LOCUS_t00120 57643 57719 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 58159 57914 gene locus_tag LOCUS_03970 58159 57914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence08 1452 154 gene locus_tag LOCUS_03980 gene purA 1452 154 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139989280.1 protein_id gnl|my_center|LOCUS_03980 2395 1502 gene locus_tag LOCUS_03990 gene hflC 2395 1502 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704867.1 protein_id gnl|my_center|LOCUS_03990 3675 2398 gene locus_tag LOCUS_04000 3675 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 5078 3690 gene locus_tag LOCUS_04010 gene hflX 5078 3690 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704865.1 protein_id gnl|my_center|LOCUS_04010 5544 5251 gene locus_tag LOCUS_04020 gene hfq 5544 5251 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693756.1 protein_id gnl|my_center|LOCUS_04020 5841 7808 gene locus_tag LOCUS_04030 5841 7808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 protein_id gnl|my_center|LOCUS_04030 7966 8820 gene locus_tag LOCUS_04040 gene rlmJ 7966 8820 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707316.1 protein_id gnl|my_center|LOCUS_04040 14442 8920 gene locus_tag LOCUS_04050 14442 8920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 14924 14463 gene locus_tag LOCUS_04060 14924 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 15639 14938 gene locus_tag LOCUS_04070 15639 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 16643 15636 gene locus_tag LOCUS_04080 16643 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 17403 16648 gene locus_tag LOCUS_04090 17403 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 18023 17409 gene locus_tag LOCUS_04100 18023 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 19492 18356 gene locus_tag LOCUS_04110 gene flhB 19492 18356 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705284.1 protein_id gnl|my_center|LOCUS_04110 20271 19492 gene locus_tag LOCUS_04120 gene fliR 20271 19492 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705283.1 protein_id gnl|my_center|LOCUS_04120 20540 20271 gene locus_tag LOCUS_04130 gene fliQ 20540 20271 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705282.1 protein_id gnl|my_center|LOCUS_04130 21312 20542 gene locus_tag LOCUS_04140 gene fliP 21312 20542 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705281.1 protein_id gnl|my_center|LOCUS_04140 21874 21332 gene locus_tag LOCUS_04150 21874 21332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 22426 21878 gene locus_tag LOCUS_04160 22426 21878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 23559 22468 gene locus_tag LOCUS_04170 gene fliM 23559 22468 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705279.1 protein_id gnl|my_center|LOCUS_04170 24090 23569 gene locus_tag LOCUS_04180 24090 23569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 25909 24107 gene locus_tag LOCUS_04190 25909 24107 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625952.1 protein_id gnl|my_center|LOCUS_04190 26558 26088 gene locus_tag LOCUS_04200 gene fliJ 26558 26088 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073108.1 protein_id gnl|my_center|LOCUS_04200 27889 26555 gene locus_tag LOCUS_04210 gene fliI 27889 26555 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_04210 29151 27889 gene locus_tag LOCUS_04220 29151 27889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 30328 29201 gene locus_tag LOCUS_04230 gene fliG 30328 29201 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705273.1 protein_id gnl|my_center|LOCUS_04230 32178 30325 gene locus_tag LOCUS_04240 gene fliF 32178 30325 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705272.1 protein_id gnl|my_center|LOCUS_04240 32563 32219 gene locus_tag LOCUS_04250 gene fliE 32563 32219 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705271.1 protein_id gnl|my_center|LOCUS_04250 32888 32637 gene locus_tag LOCUS_04260 32888 32637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 34042 32900 gene locus_tag LOCUS_04270 34042 32900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 35357 34245 gene locus_tag LOCUS_04280 35357 34245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 35587 36273 gene locus_tag LOCUS_04290 35587 36273 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707099.1 protein_id gnl|my_center|LOCUS_04290 36386 36862 gene locus_tag LOCUS_04300 gene ribE 36386 36862 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351731.1 protein_id gnl|my_center|LOCUS_04300 36868 37785 gene locus_tag LOCUS_04310 36868 37785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 37782 38735 gene locus_tag LOCUS_04320 gene thiL 37782 38735 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_04320 39417 38755 gene locus_tag LOCUS_04330 39417 38755 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_04330 40091 39417 gene locus_tag LOCUS_04340 gene rpe 40091 39417 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215694.1 protein_id gnl|my_center|LOCUS_04340 42424 40517 gene locus_tag LOCUS_04350 42424 40517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 43503 42418 gene locus_tag LOCUS_04360 gene aroB 43503 42418 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070659.1 protein_id gnl|my_center|LOCUS_04360 44021 43503 gene locus_tag LOCUS_04370 gene aroK 44021 43503 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_04370 46305 44182 gene locus_tag LOCUS_04380 46305 44182 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070657.1 protein_id gnl|my_center|LOCUS_04380 46893 46321 gene locus_tag LOCUS_04390 46893 46321 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706967.1 protein_id gnl|my_center|LOCUS_04390 47549 46890 gene locus_tag LOCUS_04400 gene tapO 47549 46890 CDS product PilO family type IV pilus biogenesis protein TapO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706968.1 protein_id gnl|my_center|LOCUS_04400 49219 47549 gene locus_tag LOCUS_04410 49219 47549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 49735 52485 gene locus_tag LOCUS_04420 gene mrcA 49735 52485 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703659.1 protein_id gnl|my_center|LOCUS_04420 53065 52724 gene locus_tag LOCUS_04430 53065 52724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 53538 53080 gene locus_tag LOCUS_04440 gene fliS 53538 53080 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705592.1 protein_id gnl|my_center|LOCUS_04440 55027 53585 gene locus_tag LOCUS_04450 gene fliD 55027 53585 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146805.1 protein_id gnl|my_center|LOCUS_04450 55566 55036 gene locus_tag LOCUS_04460 55566 55036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 57523 55715 gene locus_tag LOCUS_04470 57523 55715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 >Feature sequence09 532 305 gene locus_tag LOCUS_04480 532 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04480 1227 544 gene locus_tag LOCUS_04490 1227 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1543 1776 gene locus_tag LOCUS_04500 1543 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1779 1997 gene locus_tag LOCUS_04510 1779 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2927 3205 gene locus_tag LOCUS_04520 2927 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3295 4551 gene locus_tag LOCUS_04530 gene lysA 3295 4551 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_04530 4569 5399 gene locus_tag LOCUS_04540 gene dapF 4569 5399 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983200.1 protein_id gnl|my_center|LOCUS_04540 5396 6163 gene locus_tag LOCUS_04550 5396 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6174 7112 gene locus_tag LOCUS_04560 gene xerC 6174 7112 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211473.1 protein_id gnl|my_center|LOCUS_04560 7109 7837 gene locus_tag LOCUS_04570 7109 7837 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073964.1 protein_id gnl|my_center|LOCUS_04570 7827 10133 gene locus_tag LOCUS_04580 gene uvrD 7827 10133 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480961.1 protein_id gnl|my_center|LOCUS_04580 10287 12416 gene locus_tag LOCUS_04590 10287 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 14189 12570 gene locus_tag LOCUS_04600 14189 12570 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_04600 15672 14383 gene locus_tag LOCUS_04610 15672 14383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_04610 16738 16022 gene locus_tag LOCUS_04620 16738 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 17293 16895 gene locus_tag LOCUS_04630 17293 16895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04630 17730 17443 gene locus_tag LOCUS_04640 17730 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 18010 17741 gene locus_tag LOCUS_04650 18010 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 19167 18844 gene locus_tag LOCUS_04660 19167 18844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 19481 19164 gene locus_tag LOCUS_04670 19481 19164 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811036.1 protein_id gnl|my_center|LOCUS_04670 19713 19594 gene locus_tag LOCUS_04680 19713 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 20147 22051 gene locus_tag LOCUS_04690 20147 22051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 22094 22399 gene locus_tag LOCUS_04700 22094 22399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 22430 23887 gene locus_tag LOCUS_04710 22430 23887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 24135 25904 gene locus_tag LOCUS_04720 24135 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 26079 27890 gene locus_tag LOCUS_04730 26079 27890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 27907 30147 gene locus_tag LOCUS_04740 27907 30147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 30275 32314 gene locus_tag LOCUS_04750 30275 32314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 33061 34200 gene locus_tag LOCUS_04760 33061 34200 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_04760 34974 37088 gene locus_tag LOCUS_04770 34974 37088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 37226 40729 gene locus_tag LOCUS_04780 37226 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 40814 41602 gene locus_tag LOCUS_04790 40814 41602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04790 42339 44684 gene locus_tag LOCUS_04800 42339 44684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 45186 46418 gene locus_tag LOCUS_04810 45186 46418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 46561 47334 gene locus_tag LOCUS_04820 46561 47334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 47437 47949 gene locus_tag LOCUS_04830 47437 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 49690 48896 gene locus_tag LOCUS_04840 49690 48896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 51047 49716 gene locus_tag LOCUS_04850 51047 49716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 52276 51056 gene locus_tag LOCUS_04860 52276 51056 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_04860 52511 53707 gene locus_tag LOCUS_04870 52511 53707 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_04870 53707 54435 gene locus_tag LOCUS_04880 53707 54435 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence10 930 412 gene locus_tag LOCUS_04890 930 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1400 948 gene locus_tag LOCUS_04900 1400 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 2032 1397 gene locus_tag LOCUS_04910 2032 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3300 2209 gene locus_tag LOCUS_04920 3300 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3630 3854 gene locus_tag LOCUS_04930 3630 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4412 4152 gene locus_tag LOCUS_04940 4412 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5725 4829 gene locus_tag LOCUS_04950 gene metF 5725 4829 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306036.1 protein_id gnl|my_center|LOCUS_04950 6068 5838 gene locus_tag LOCUS_04960 gene lpp 6068 5838 CDS product murein lipoprotein Lpp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082307.1 protein_id gnl|my_center|LOCUS_04960 12947 6450 gene locus_tag LOCUS_04970 12947 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 14015 13254 gene locus_tag LOCUS_04980 14015 13254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 14815 14012 gene locus_tag LOCUS_04990 14815 14012 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908213.1 protein_id gnl|my_center|LOCUS_04990 15651 14824 gene locus_tag LOCUS_05000 gene aroE 15651 14824 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_05000 16205 15651 gene locus_tag LOCUS_05010 16205 15651 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 protein_id gnl|my_center|LOCUS_05010 16717 16205 gene locus_tag LOCUS_05020 gene purE 16717 16205 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_05020 17412 16819 gene locus_tag LOCUS_05030 17412 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 17689 18105 gene locus_tag LOCUS_05040 17689 18105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 18602 19186 gene locus_tag LOCUS_05050 18602 19186 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071077.1 protein_id gnl|my_center|LOCUS_05050 19242 19898 gene locus_tag LOCUS_05060 gene rpiA 19242 19898 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482455.1 protein_id gnl|my_center|LOCUS_05060 21320 19977 gene locus_tag LOCUS_05070 21320 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704211.1 protein_id gnl|my_center|LOCUS_05070 21396 21566 gene locus_tag LOCUS_05080 21396 21566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 21630 22271 gene locus_tag LOCUS_05090 gene crp 21630 22271 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242749.1 protein_id gnl|my_center|LOCUS_05090 22428 23651 gene locus_tag LOCUS_05100 22428 23651 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706957.1 protein_id gnl|my_center|LOCUS_05100 25078 23810 gene locus_tag LOCUS_05110 25078 23810 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_05110 26457 25720 gene locus_tag LOCUS_05120 26457 25720 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144931.1 protein_id gnl|my_center|LOCUS_05120 26778 27797 gene locus_tag LOCUS_05130 26778 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 28189 28398 gene locus_tag LOCUS_05140 28189 28398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 29266 29126 gene locus_tag LOCUS_05150 29266 29126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 30100 29477 gene locus_tag LOCUS_05160 30100 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 30661 30218 gene locus_tag LOCUS_05170 30661 30218 CDS product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420303.1 protein_id gnl|my_center|LOCUS_05170 31172 30663 gene locus_tag LOCUS_05180 31172 30663 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075896.1 protein_id gnl|my_center|LOCUS_05180 32215 31229 gene locus_tag LOCUS_05190 32215 31229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 32991 32212 gene locus_tag LOCUS_05200 32991 32212 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_05200 34043 32988 gene locus_tag LOCUS_05210 34043 32988 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705293.1 protein_id gnl|my_center|LOCUS_05210 34794 34030 gene locus_tag LOCUS_05220 34794 34030 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073950.1 protein_id gnl|my_center|LOCUS_05220 36389 34791 gene locus_tag LOCUS_05230 36389 34791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 38492 36405 gene locus_tag LOCUS_05240 38492 36405 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705290.1 protein_id gnl|my_center|LOCUS_05240 38970 38587 gene locus_tag LOCUS_05250 gene cheY 38970 38587 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 protein_id gnl|my_center|LOCUS_05250 39843 39121 gene locus_tag LOCUS_05260 39843 39121 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073095.1 protein_id gnl|my_center|LOCUS_05260 40732 39851 gene locus_tag LOCUS_05270 40732 39851 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634619.1 protein_id gnl|my_center|LOCUS_05270 42363 40765 gene locus_tag LOCUS_05280 42363 40765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 44483 42360 gene locus_tag LOCUS_05290 gene flhA 44483 42360 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705285.1 protein_id gnl|my_center|LOCUS_05290 46374 44800 gene locus_tag LOCUS_05300 46374 44800 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_05300 48814 46820 gene locus_tag LOCUS_05310 48814 46820 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706924.1 protein_id gnl|my_center|LOCUS_05310 49794 48811 gene locus_tag LOCUS_05320 49794 48811 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201417868.1 protein_id gnl|my_center|LOCUS_05320 50699 49794 gene locus_tag LOCUS_05330 50699 49794 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_05330 50598 50807 gene locus_tag LOCUS_05340 50598 50807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 51233 52939 gene locus_tag LOCUS_05350 51233 52939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 52998 53477 gene locus_tag LOCUS_05360 gene smpB 52998 53477 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518569.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence11 883 137 gene locus_tag LOCUS_05370 gene pdxJ 883 137 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095364.1 protein_id gnl|my_center|LOCUS_05370 1560 880 gene locus_tag LOCUS_05380 gene recO 1560 880 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279493.1 protein_id gnl|my_center|LOCUS_05380 2470 1553 gene locus_tag LOCUS_05390 gene era 2470 1553 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262548.1 protein_id gnl|my_center|LOCUS_05390 3149 2454 gene locus_tag LOCUS_05400 gene rnc 3149 2454 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_05400 4062 3172 gene locus_tag LOCUS_05410 gene lepB 4062 3172 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071556.1 protein_id gnl|my_center|LOCUS_05410 5890 4091 gene locus_tag LOCUS_05420 gene lepA 5890 4091 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704747.1 protein_id gnl|my_center|LOCUS_05420 7700 6015 gene locus_tag LOCUS_05430 7700 6015 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482111.1 protein_id gnl|my_center|LOCUS_05430 8126 7752 gene locus_tag LOCUS_05440 gene rraB 8126 7752 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002952.1 protein_id gnl|my_center|LOCUS_05440 8643 8137 gene locus_tag LOCUS_05450 gene luxS 8643 8137 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693682.1 protein_id gnl|my_center|LOCUS_05450 9229 8654 gene locus_tag LOCUS_05460 9229 8654 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 protein_id gnl|my_center|LOCUS_05460 10520 9327 gene locus_tag LOCUS_05470 gene tuf 10520 9327 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667564.1 protein_id gnl|my_center|LOCUS_05470 12674 10575 gene locus_tag LOCUS_05480 gene fusA 12674 10575 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707695.1 protein_id gnl|my_center|LOCUS_05480 13223 12753 gene locus_tag LOCUS_05490 gene rpsG 13223 12753 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 protein_id gnl|my_center|LOCUS_05490 13687 13313 gene locus_tag LOCUS_05500 gene rpsL 13687 13313 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 protein_id gnl|my_center|LOCUS_05500 14501 13914 gene locus_tag LOCUS_05510 14501 13914 CDS product superinfection exclusion B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635988.1 protein_id gnl|my_center|LOCUS_05510 14675 15013 gene locus_tag LOCUS_05520 gene glnB 14675 15013 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211554.1 protein_id gnl|my_center|LOCUS_05520 15391 15014 gene locus_tag LOCUS_05530 15391 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 15755 15375 gene locus_tag LOCUS_05540 15755 15375 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_05540 20359 15926 gene locus_tag LOCUS_05550 gene rpoC 20359 15926 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707700.1 protein_id gnl|my_center|LOCUS_05550 24508 20414 gene locus_tag LOCUS_05560 gene rpoB 24508 20414 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635847.1 protein_id gnl|my_center|LOCUS_05560 25162 24803 gene locus_tag LOCUS_05570 gene rplL 25162 24803 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 protein_id gnl|my_center|LOCUS_05570 25775 25230 gene locus_tag LOCUS_05580 gene rplJ 25775 25230 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095001.1 protein_id gnl|my_center|LOCUS_05580 26684 25986 gene locus_tag LOCUS_05590 gene rplA 26684 25986 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070608.1 protein_id gnl|my_center|LOCUS_05590 27116 26688 gene locus_tag LOCUS_05600 gene rplK 27116 26688 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005318556.1 protein_id gnl|my_center|LOCUS_05600 28188 27301 gene locus_tag LOCUS_05610 gene rfbD 28188 27301 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 protein_id gnl|my_center|LOCUS_05610 28473 28709 gene locus_tag LOCUS_05620 gene rpmE 28473 28709 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862040.1 protein_id gnl|my_center|LOCUS_05620 29069 30319 gene locus_tag LOCUS_05630 29069 30319 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 protein_id gnl|my_center|LOCUS_05630 30705 30481 gene locus_tag LOCUS_05640 30705 30481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 31850 30735 gene locus_tag LOCUS_05650 31850 30735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 32484 31852 gene locus_tag LOCUS_05660 32484 31852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 32789 32484 gene locus_tag LOCUS_05670 32789 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 33997 32999 gene locus_tag LOCUS_05680 gene potI 33997 32999 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816016.1 protein_id gnl|my_center|LOCUS_05680 35034 33994 gene locus_tag LOCUS_05690 gene potH 35034 33994 CDS product putrescine ABC transporter permease PotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816015.1 protein_id gnl|my_center|LOCUS_05690 36177 35047 gene locus_tag LOCUS_05700 gene potG 36177 35047 CDS product putrescine ABC transporter ATP-binding subunit PotG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208760.1 protein_id gnl|my_center|LOCUS_05700 37603 36485 gene locus_tag LOCUS_05710 gene potF 37603 36485 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 protein_id gnl|my_center|LOCUS_05710 38607 37867 gene locus_tag LOCUS_05720 38607 37867 CDS product DUF3334 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742113.1 protein_id gnl|my_center|LOCUS_05720 41072 39258 gene locus_tag LOCUS_05730 41072 39258 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819242.1 protein_id gnl|my_center|LOCUS_05730 41533 41273 gene locus_tag LOCUS_05740 41533 41273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 42307 41651 gene locus_tag LOCUS_05750 42307 41651 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070698.1 protein_id gnl|my_center|LOCUS_05750 43515 42322 gene locus_tag LOCUS_05760 43515 42322 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409683.1 protein_id gnl|my_center|LOCUS_05760 44594 43530 gene locus_tag LOCUS_05770 44594 43530 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_05770 45762 44587 gene locus_tag LOCUS_05780 45762 44587 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074277.1 protein_id gnl|my_center|LOCUS_05780 46077 45787 gene locus_tag LOCUS_05790 46077 45787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 46881 46087 gene locus_tag LOCUS_05800 gene thyA 46881 46087 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369929.1 protein_id gnl|my_center|LOCUS_05800 49139 46878 gene locus_tag LOCUS_05810 gene ptsP 49139 46878 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704635.1 protein_id gnl|my_center|LOCUS_05810 49669 49133 gene locus_tag LOCUS_05820 gene rppH 49669 49133 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098553.1 protein_id gnl|my_center|LOCUS_05820 49770 50462 gene locus_tag LOCUS_05830 gene mutH 49770 50462 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481789.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence12 503 1663 gene locus_tag LOCUS_05840 503 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2451 2275 gene locus_tag LOCUS_05850 2451 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2450 3070 gene locus_tag LOCUS_05860 2450 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3123 6029 gene locus_tag LOCUS_05870 3123 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6213 9107 gene locus_tag LOCUS_05880 6213 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 9222 9800 gene locus_tag LOCUS_05890 9222 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 10764 9916 gene locus_tag LOCUS_05900 gene panC 10764 9916 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707282.1 protein_id gnl|my_center|LOCUS_05900 11684 10884 gene locus_tag LOCUS_05910 gene panB 11684 10884 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454450.1 protein_id gnl|my_center|LOCUS_05910 12188 11688 gene locus_tag LOCUS_05920 gene folK 12188 11688 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215147.1 protein_id gnl|my_center|LOCUS_05920 13651 12245 gene locus_tag LOCUS_05930 gene pcnB 13651 12245 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707279.1 protein_id gnl|my_center|LOCUS_05930 14271 13831 gene locus_tag LOCUS_05940 gene dksA 14271 13831 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304459.1 protein_id gnl|my_center|LOCUS_05940 15176 14469 gene locus_tag LOCUS_05950 gene queC 15176 14469 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_05950 15472 15284 gene locus_tag LOCUS_05960 15472 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 15386 17863 gene locus_tag LOCUS_05970 gene mrcB 15386 17863 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 protein_id gnl|my_center|LOCUS_05970 17878 19344 gene locus_tag LOCUS_05980 gene clcA 17878 19344 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 protein_id gnl|my_center|LOCUS_05980 20547 19372 gene locus_tag LOCUS_05990 20547 19372 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706905.1 protein_id gnl|my_center|LOCUS_05990 20632 21831 gene locus_tag LOCUS_06000 gene tyrS 20632 21831 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_06000 21930 22005 gene locus_tag LOCUS_t00130 21930 22005 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22686 23927 gene locus_tag LOCUS_06010 22686 23927 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 protein_id gnl|my_center|LOCUS_06010 23920 24618 gene locus_tag LOCUS_06020 gene lolD 23920 24618 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481886.1 protein_id gnl|my_center|LOCUS_06020 24618 25877 gene locus_tag LOCUS_06030 gene lolE 24618 25877 CDS product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705877.1 protein_id gnl|my_center|LOCUS_06030 26160 26807 gene locus_tag LOCUS_06040 26160 26807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 26932 27567 gene locus_tag LOCUS_06050 26932 27567 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704156.1 protein_id gnl|my_center|LOCUS_06050 28072 29112 gene locus_tag LOCUS_06060 28072 29112 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970313.1 protein_id gnl|my_center|LOCUS_06060 30406 29231 gene locus_tag LOCUS_06070 30406 29231 CDS product flagellar assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705016.1 protein_id gnl|my_center|LOCUS_06070 30595 31452 gene locus_tag LOCUS_06080 30595 31452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 31445 31918 gene locus_tag LOCUS_06090 31445 31918 CDS product LPP20 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705018.1 protein_id gnl|my_center|LOCUS_06090 32806 32003 gene locus_tag LOCUS_06100 gene metQ 32806 32003 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 protein_id gnl|my_center|LOCUS_06100 33543 32872 gene locus_tag LOCUS_06110 33543 32872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704854.1 protein_id gnl|my_center|LOCUS_06110 34564 33536 gene locus_tag LOCUS_06120 gene metN 34564 33536 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594003.1 protein_id gnl|my_center|LOCUS_06120 34868 36025 gene locus_tag LOCUS_06130 34868 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 36081 36428 gene locus_tag LOCUS_06140 36081 36428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 36350 36769 gene locus_tag LOCUS_06150 36350 36769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 36859 37845 gene locus_tag LOCUS_06160 36859 37845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 37992 38345 gene locus_tag LOCUS_06170 37992 38345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 38380 38832 gene locus_tag LOCUS_06180 38380 38832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 38962 39933 gene locus_tag LOCUS_06190 38962 39933 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_06190 39933 40808 gene locus_tag LOCUS_06200 39933 40808 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462295.1 protein_id gnl|my_center|LOCUS_06200 40898 41323 gene locus_tag LOCUS_06210 gene flgB 40898 41323 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706644.1 protein_id gnl|my_center|LOCUS_06210 41320 41748 gene locus_tag LOCUS_06220 gene flgC 41320 41748 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_06220 41770 42462 gene locus_tag LOCUS_06230 41770 42462 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706642.1 protein_id gnl|my_center|LOCUS_06230 42701 43771 gene locus_tag LOCUS_06240 42701 43771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 43983 45365 gene locus_tag LOCUS_06250 gene flgE 43983 45365 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706641.1 protein_id gnl|my_center|LOCUS_06250 45568 46314 gene locus_tag LOCUS_06260 gene flgF 45568 46314 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706640.1 protein_id gnl|my_center|LOCUS_06260 46386 47174 gene locus_tag LOCUS_06270 gene flgG 46386 47174 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706639.1 protein_id gnl|my_center|LOCUS_06270 47698 49083 gene locus_tag LOCUS_06280 47698 49083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence13 631 1974 gene locus_tag LOCUS_06290 631 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2179 3453 gene locus_tag LOCUS_06300 2179 3453 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 protein_id gnl|my_center|LOCUS_06300 4316 3528 gene locus_tag LOCUS_06310 4316 3528 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068143.1 protein_id gnl|my_center|LOCUS_06310 7726 4376 gene locus_tag LOCUS_06320 gene mfd 7726 4376 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705873.1 protein_id gnl|my_center|LOCUS_06320 8550 7843 gene locus_tag LOCUS_06330 8550 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8752 10131 gene locus_tag LOCUS_06340 8752 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10125 10286 gene locus_tag LOCUS_06350 10125 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 10584 10243 gene locus_tag LOCUS_06360 10584 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 11231 12178 gene locus_tag LOCUS_06370 11231 12178 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993737.1 protein_id gnl|my_center|LOCUS_06370 12565 13761 gene locus_tag LOCUS_06380 12565 13761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13940 15253 gene locus_tag LOCUS_06390 13940 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 16071 17240 gene locus_tag LOCUS_06400 16071 17240 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_06400 17605 17402 gene locus_tag LOCUS_06410 17605 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 17655 19397 gene locus_tag LOCUS_06420 17655 19397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 19799 20035 gene locus_tag LOCUS_06430 19799 20035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 20287 20772 gene locus_tag LOCUS_06440 20287 20772 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099321.1 protein_id gnl|my_center|LOCUS_06440 21095 21922 gene locus_tag LOCUS_06450 21095 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 23767 22112 gene locus_tag LOCUS_06460 gene thiI 23767 22112 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095844.1 protein_id gnl|my_center|LOCUS_06460 23992 24240 gene locus_tag LOCUS_06470 23992 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 24255 25208 gene locus_tag LOCUS_06480 gene ispA 24255 25208 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_06480 25211 27346 gene locus_tag LOCUS_06490 gene dxs 25211 27346 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 protein_id gnl|my_center|LOCUS_06490 27454 27939 gene locus_tag LOCUS_06500 27454 27939 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457116.1 protein_id gnl|my_center|LOCUS_06500 27977 29284 gene locus_tag LOCUS_06510 27977 29284 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243984.1 protein_id gnl|my_center|LOCUS_06510 29885 32131 gene locus_tag LOCUS_06520 gene pflB 29885 32131 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289265.1 protein_id gnl|my_center|LOCUS_06520 32216 32944 gene locus_tag LOCUS_06530 gene pflA 32216 32944 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_06530 33083 34195 gene locus_tag LOCUS_06540 33083 34195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 36264 34369 gene locus_tag LOCUS_06550 36264 34369 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025422746.1 protein_id gnl|my_center|LOCUS_06550 36781 38385 gene locus_tag LOCUS_06560 36781 38385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 38599 40221 gene locus_tag LOCUS_06570 38599 40221 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818860.1 protein_id gnl|my_center|LOCUS_06570 40211 40861 gene locus_tag LOCUS_06580 40211 40861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 40881 42023 gene locus_tag LOCUS_06590 40881 42023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 42907 43527 gene locus_tag LOCUS_06600 42907 43527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 43855 43667 gene locus_tag LOCUS_06610 43855 43667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 44769 43885 gene locus_tag LOCUS_06620 44769 43885 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116878287.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06620 45287 44835 gene locus_tag LOCUS_06630 45287 44835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence14 727 161 gene locus_tag LOCUS_06640 727 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1688 933 gene locus_tag LOCUS_06650 1688 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2770 1727 gene locus_tag LOCUS_06660 gene pseI 2770 1727 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707837.1 protein_id gnl|my_center|LOCUS_06660 3943 2858 gene locus_tag LOCUS_06670 gene pseG 3943 2858 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707836.1 protein_id gnl|my_center|LOCUS_06670 4739 4026 gene locus_tag LOCUS_06680 gene pseF 4739 4026 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_06680 6736 4739 gene locus_tag LOCUS_06690 6736 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6926 7675 gene locus_tag LOCUS_06700 6926 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 8404 7679 gene locus_tag LOCUS_06710 gene tsaA 8404 7679 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261411.1 protein_id gnl|my_center|LOCUS_06710 8858 8397 gene locus_tag LOCUS_06720 8858 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 9035 8960 gene locus_tag LOCUS_t00140 9035 8960 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9948 9085 gene locus_tag LOCUS_06730 9948 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 11433 10003 gene locus_tag LOCUS_06740 gene gltX 11433 10003 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668173.1 protein_id gnl|my_center|LOCUS_06740 13462 11663 gene locus_tag LOCUS_06750 13462 11663 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_06750 13748 15547 gene locus_tag LOCUS_06760 13748 15547 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_06760 16574 15669 gene locus_tag LOCUS_06770 16574 15669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 16917 16528 gene locus_tag LOCUS_06780 16917 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 17000 17428 gene locus_tag LOCUS_06790 17000 17428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 17640 21062 gene locus_tag LOCUS_06800 gene mscK 17640 21062 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177754.1 protein_id gnl|my_center|LOCUS_06800 21059 21946 gene locus_tag LOCUS_06810 gene glpG 21059 21946 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460378.1 protein_id gnl|my_center|LOCUS_06810 22239 21967 gene locus_tag LOCUS_06820 22239 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 23457 22378 gene locus_tag LOCUS_06830 gene fbaA 23457 22378 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704732.1 protein_id gnl|my_center|LOCUS_06830 24688 23513 gene locus_tag LOCUS_06840 24688 23513 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704731.1 protein_id gnl|my_center|LOCUS_06840 26842 25043 gene locus_tag LOCUS_06850 26842 25043 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_06850 27110 28027 gene locus_tag LOCUS_06860 gene rarD 27110 28027 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103301.1 protein_id gnl|my_center|LOCUS_06860 29255 28047 gene locus_tag LOCUS_06870 gene gltS 29255 28047 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_06870 32098 29384 gene locus_tag LOCUS_06880 32098 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 33008 32739 gene locus_tag LOCUS_06890 gene rpsO 33008 32739 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298162.1 protein_id gnl|my_center|LOCUS_06890 33728 33093 gene locus_tag LOCUS_06900 33728 33093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 34732 33716 gene locus_tag LOCUS_06910 34732 33716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 35580 34732 gene locus_tag LOCUS_06920 35580 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 36618 35656 gene locus_tag LOCUS_06930 gene truB 36618 35656 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071436.1 protein_id gnl|my_center|LOCUS_06930 37055 36615 gene locus_tag LOCUS_06940 gene rbfA 37055 36615 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707073.1 protein_id gnl|my_center|LOCUS_06940 39709 37145 gene locus_tag LOCUS_06950 gene infB 39709 37145 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131175.1 protein_id gnl|my_center|LOCUS_06950 41316 39736 gene locus_tag LOCUS_06960 gene nusA 41316 39736 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707075.1 protein_id gnl|my_center|LOCUS_06960 41947 41477 gene locus_tag LOCUS_06970 gene rimP 41947 41477 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351719.1 protein_id gnl|my_center|LOCUS_06970 42322 43053 gene locus_tag LOCUS_06980 gene mshB 42322 43053 CDS product MSHA fimbrial major subunit MshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704371.1 protein_id gnl|my_center|LOCUS_06980 44563 43136 gene locus_tag LOCUS_06990 44563 43136 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence15 1316 537 gene locus_tag LOCUS_07000 1316 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3345 1354 gene locus_tag LOCUS_07010 3345 1354 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_07010 4405 3401 gene locus_tag LOCUS_07020 4405 3401 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_07020 5412 4417 gene locus_tag LOCUS_07030 5412 4417 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770940.1 protein_id gnl|my_center|LOCUS_07030 6810 5623 gene locus_tag LOCUS_07040 6810 5623 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_07040 8382 6895 gene locus_tag LOCUS_07050 gene ilvC 8382 6895 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024919.1 protein_id gnl|my_center|LOCUS_07050 8538 9428 gene locus_tag LOCUS_07060 gene ilvY 8538 9428 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_07060 10727 9459 gene locus_tag LOCUS_07070 10727 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 11824 11108 gene locus_tag LOCUS_07080 11824 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 12585 11932 gene locus_tag LOCUS_07090 12585 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12854 13288 gene locus_tag LOCUS_07100 12854 13288 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 protein_id gnl|my_center|LOCUS_07100 13343 13678 gene locus_tag LOCUS_07110 gene speD 13343 13678 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392796.1 protein_id gnl|my_center|LOCUS_07110 13700 14806 gene locus_tag LOCUS_07120 13700 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14839 15267 gene locus_tag LOCUS_07130 14839 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 15311 16837 gene locus_tag LOCUS_07140 15311 16837 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192488.1 protein_id gnl|my_center|LOCUS_07140 17092 17574 gene locus_tag LOCUS_07150 gene secB 17092 17574 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208976.1 protein_id gnl|my_center|LOCUS_07150 17640 18641 gene locus_tag LOCUS_07160 gene gpsA 17640 18641 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_07160 18662 19552 gene locus_tag LOCUS_07170 18662 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 19598 19674 gene locus_tag LOCUS_t00150 19598 19674 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19701 21335 gene locus_tag LOCUS_07180 19701 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 23542 21476 gene locus_tag LOCUS_07190 gene glyS 23542 21476 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291797.1 protein_id gnl|my_center|LOCUS_07190 24471 23545 gene locus_tag LOCUS_07200 gene glyQ 24471 23545 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339464.1 protein_id gnl|my_center|LOCUS_07200 24622 25188 gene locus_tag LOCUS_07210 24622 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 25680 25198 gene locus_tag LOCUS_07220 gene ybaK 25680 25198 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707484.1 protein_id gnl|my_center|LOCUS_07220 26834 25677 gene locus_tag LOCUS_07230 gene argE 26834 25677 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704559.1 protein_id gnl|my_center|LOCUS_07230 26991 27995 gene locus_tag LOCUS_07240 gene argC 26991 27995 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704560.1 protein_id gnl|my_center|LOCUS_07240 27995 28789 gene locus_tag LOCUS_07250 gene argB 27995 28789 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704561.1 protein_id gnl|my_center|LOCUS_07250 28956 29876 gene locus_tag LOCUS_07260 28956 29876 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819287.1 protein_id gnl|my_center|LOCUS_07260 29901 31121 gene locus_tag LOCUS_07270 29901 31121 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704563.1 protein_id gnl|my_center|LOCUS_07270 31256 32638 gene locus_tag LOCUS_07280 gene argH 31256 32638 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693177.1 protein_id gnl|my_center|LOCUS_07280 32705 33625 gene locus_tag LOCUS_07290 32705 33625 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819265.1 protein_id gnl|my_center|LOCUS_07290 33684 34145 gene locus_tag LOCUS_07300 33684 34145 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704626.1 protein_id gnl|my_center|LOCUS_07300 34211 36106 gene locus_tag LOCUS_07310 34211 36106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 36103 37962 gene locus_tag LOCUS_07320 36103 37962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 38168 38647 gene locus_tag LOCUS_07330 gene tapA 38168 38647 CDS product type IVa pilus major pilin TapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 protein_id gnl|my_center|LOCUS_07330 38853 40574 gene locus_tag LOCUS_07340 gene tapB 38853 40574 CDS product PilB family type IVa pilus assembly ATPase TapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707569.1 protein_id gnl|my_center|LOCUS_07340 40587 41858 gene locus_tag LOCUS_07350 40587 41858 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_07350 41933 42817 gene locus_tag LOCUS_07360 41933 42817 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_07360 42820 43458 gene locus_tag LOCUS_07370 gene coaE 42820 43458 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707572.1 protein_id gnl|my_center|LOCUS_07370 43462 43680 gene locus_tag LOCUS_07380 gene yacG 43462 43680 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305661.1 protein_id gnl|my_center|LOCUS_07380 44560 43685 gene locus_tag LOCUS_07390 44560 43685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence16 608 177 gene locus_tag LOCUS_07400 608 177 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986313.1 protein_id gnl|my_center|LOCUS_07400 1044 790 gene locus_tag LOCUS_07410 1044 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1337 1041 gene locus_tag LOCUS_07420 1337 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1734 4379 gene locus_tag LOCUS_07430 1734 4379 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479527.1 protein_id gnl|my_center|LOCUS_07430 4388 6250 gene locus_tag LOCUS_07440 4388 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479497.1 protein_id gnl|my_center|LOCUS_07440 6247 6669 gene locus_tag LOCUS_07450 6247 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6922 7650 gene locus_tag LOCUS_07460 6922 7650 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_07460 9414 7651 gene locus_tag LOCUS_07470 9414 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 10840 9545 gene locus_tag LOCUS_07480 10840 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 11109 12944 gene locus_tag LOCUS_07490 11109 12944 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819691.1 protein_id gnl|my_center|LOCUS_07490 12941 16747 gene locus_tag LOCUS_07500 12941 16747 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705451.1 protein_id gnl|my_center|LOCUS_07500 16759 17754 gene locus_tag LOCUS_07510 16759 17754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 17877 19331 gene locus_tag LOCUS_07520 gene sbcB 17877 19331 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706025.1 protein_id gnl|my_center|LOCUS_07520 19417 20601 gene locus_tag LOCUS_07530 19417 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 20609 21115 gene locus_tag LOCUS_07540 20609 21115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 21112 22392 gene locus_tag LOCUS_07550 21112 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074554.1 protein_id gnl|my_center|LOCUS_07550 22495 22929 gene locus_tag LOCUS_07560 22495 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 22986 23750 gene locus_tag LOCUS_07570 22986 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 26847 24007 gene locus_tag LOCUS_07580 26847 24007 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818824.1 protein_id gnl|my_center|LOCUS_07580 27512 26997 gene locus_tag LOCUS_07590 27512 26997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 29207 27549 gene locus_tag LOCUS_07600 gene pepA 29207 27549 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_07600 29395 30645 gene locus_tag LOCUS_07610 gene lptF 29395 30645 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305138.1 protein_id gnl|my_center|LOCUS_07610 30638 31747 gene locus_tag LOCUS_07620 gene lptG 30638 31747 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707420.1 protein_id gnl|my_center|LOCUS_07620 32448 32026 gene locus_tag LOCUS_07630 32448 32026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07630 32660 32445 gene locus_tag LOCUS_07640 32660 32445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 32740 32826 gene locus_tag LOCUS_t00160 32740 32826 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33119 32940 gene locus_tag LOCUS_07650 33119 32940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 33043 33780 gene locus_tag LOCUS_07660 gene glnH 33043 33780 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097464.1 protein_id gnl|my_center|LOCUS_07660 33835 34497 gene locus_tag LOCUS_07670 33835 34497 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081260.1 protein_id gnl|my_center|LOCUS_07670 34494 35261 gene locus_tag LOCUS_07680 34494 35261 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101161.1 protein_id gnl|my_center|LOCUS_07680 38268 35332 gene locus_tag LOCUS_07690 gene barA 38268 35332 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704764.1 protein_id gnl|my_center|LOCUS_07690 38616 41756 gene locus_tag LOCUS_07700 38616 41756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 41931 42857 gene locus_tag LOCUS_07710 41931 42857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence17 950 132 gene locus_tag LOCUS_07720 gene ttcA 950 132 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816357.1 protein_id gnl|my_center|LOCUS_07720 1920 1009 gene locus_tag LOCUS_07730 gene uspE 1920 1009 CDS product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_07730 2817 2092 gene locus_tag LOCUS_07740 gene anr 2817 2092 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_07740 5500 3017 gene locus_tag LOCUS_07750 5500 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5773 5946 gene locus_tag LOCUS_07760 5773 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 6682 6020 gene locus_tag LOCUS_07770 6682 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 7352 6774 gene locus_tag LOCUS_07780 7352 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07780 7639 7349 gene locus_tag LOCUS_07790 7639 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 7532 8509 gene locus_tag LOCUS_07800 gene rluC 7532 8509 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 protein_id gnl|my_center|LOCUS_07800 8629 9306 gene locus_tag LOCUS_07810 8629 9306 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_07810 9317 9859 gene locus_tag LOCUS_07820 gene yceD 9317 9859 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461584.1 protein_id gnl|my_center|LOCUS_07820 9878 10078 gene locus_tag LOCUS_07830 gene rpmF 9878 10078 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544470.1 protein_id gnl|my_center|LOCUS_07830 10122 11105 gene locus_tag LOCUS_07840 gene plsX 10122 11105 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063411321.1 protein_id gnl|my_center|LOCUS_07840 11120 12076 gene locus_tag LOCUS_07850 11120 12076 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490641.1 protein_id gnl|my_center|LOCUS_07850 12237 13172 gene locus_tag LOCUS_07860 gene fabD 12237 13172 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 protein_id gnl|my_center|LOCUS_07860 13175 13903 gene locus_tag LOCUS_07870 gene fabG 13175 13903 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008535.1 protein_id gnl|my_center|LOCUS_07870 14113 14352 gene locus_tag LOCUS_07880 gene acpP 14113 14352 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300909.1 protein_id gnl|my_center|LOCUS_07880 14452 15702 gene locus_tag LOCUS_07890 gene fabF 14452 15702 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706107.1 protein_id gnl|my_center|LOCUS_07890 15788 16873 gene locus_tag LOCUS_07900 gene mltG 15788 16873 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350715.1 protein_id gnl|my_center|LOCUS_07900 16938 17579 gene locus_tag LOCUS_07910 gene tmk 16938 17579 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490472.1 protein_id gnl|my_center|LOCUS_07910 17564 18571 gene locus_tag LOCUS_07920 17564 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 18580 19374 gene locus_tag LOCUS_07930 18580 19374 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480245.1 protein_id gnl|my_center|LOCUS_07930 19458 20639 gene locus_tag LOCUS_07940 gene rluB 19458 20639 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706718.1 protein_id gnl|my_center|LOCUS_07940 21046 22422 gene locus_tag LOCUS_07950 21046 22422 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107846.1 protein_id gnl|my_center|LOCUS_07950 22563 23453 gene locus_tag LOCUS_07960 22563 23453 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693963.1 protein_id gnl|my_center|LOCUS_07960 23443 24069 gene locus_tag LOCUS_07970 23443 24069 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816405.1 protein_id gnl|my_center|LOCUS_07970 24991 24083 gene locus_tag LOCUS_07980 gene galU 24991 24083 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818749.1 protein_id gnl|my_center|LOCUS_07980 25318 25001 gene locus_tag LOCUS_07990 25318 25001 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707245.1 protein_id gnl|my_center|LOCUS_07990 25965 25318 gene locus_tag LOCUS_08000 25965 25318 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210640.1 protein_id gnl|my_center|LOCUS_08000 26137 27144 gene locus_tag LOCUS_08010 gene rluD 26137 27144 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079108.1 protein_id gnl|my_center|LOCUS_08010 27137 27895 gene locus_tag LOCUS_08020 gene pgeF 27137 27895 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_08020 28051 30621 gene locus_tag LOCUS_08030 gene clpB 28051 30621 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112130572.1 protein_id gnl|my_center|LOCUS_08030 30854 31621 gene locus_tag LOCUS_08040 30854 31621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 31942 31574 gene locus_tag LOCUS_08050 31942 31574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 31968 32585 gene locus_tag LOCUS_08060 31968 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 32548 34746 gene locus_tag LOCUS_08070 32548 34746 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707152.1 protein_id gnl|my_center|LOCUS_08070 35471 34776 gene locus_tag LOCUS_08080 35471 34776 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_08080 35786 35541 gene locus_tag LOCUS_08090 35786 35541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 36218 37957 gene locus_tag LOCUS_08100 36218 37957 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704827.1 protein_id gnl|my_center|LOCUS_08100 37954 38451 gene locus_tag LOCUS_08110 gene ilvN 37954 38451 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704829.1 protein_id gnl|my_center|LOCUS_08110 38657 39745 gene locus_tag LOCUS_08120 gene prfA 38657 39745 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032803489.1 protein_id gnl|my_center|LOCUS_08120 39755 40597 gene locus_tag LOCUS_08130 gene prmC 39755 40597 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706934.1 protein_id gnl|my_center|LOCUS_08130 40618 41481 gene locus_tag LOCUS_08140 gene kdsA 40618 41481 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811067.1 protein_id gnl|my_center|LOCUS_08140 41659 42666 gene locus_tag LOCUS_08150 41659 42666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence18 509 1378 gene locus_tag LOCUS_08160 509 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1679 1497 gene locus_tag LOCUS_08170 1679 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1816 2568 gene locus_tag LOCUS_08180 1816 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08180 2646 3707 gene locus_tag LOCUS_08190 2646 3707 CDS product MalM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819528.1 protein_id gnl|my_center|LOCUS_08190 4678 4028 gene locus_tag LOCUS_08200 4678 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 5638 4775 gene locus_tag LOCUS_08210 gene folD 5638 4775 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729153.1 protein_id gnl|my_center|LOCUS_08210 6765 5944 gene locus_tag LOCUS_08220 gene dapD 6765 5944 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632504.1 protein_id gnl|my_center|LOCUS_08220 7352 7960 gene locus_tag LOCUS_08230 7352 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 10752 8125 gene locus_tag LOCUS_08240 gene glnD 10752 8125 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705092.1 protein_id gnl|my_center|LOCUS_08240 11597 10839 gene locus_tag LOCUS_08250 gene map 11597 10839 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705093.1 protein_id gnl|my_center|LOCUS_08250 11977 12741 gene locus_tag LOCUS_08260 gene rpsB 11977 12741 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303470.1 protein_id gnl|my_center|LOCUS_08260 12844 13749 gene locus_tag LOCUS_08270 gene tsf 12844 13749 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705094.1 protein_id gnl|my_center|LOCUS_08270 14046 14783 gene locus_tag LOCUS_08280 gene pyrH 14046 14783 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210548.1 protein_id gnl|my_center|LOCUS_08280 14816 15400 gene locus_tag LOCUS_08290 gene frr 14816 15400 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632773.1 protein_id gnl|my_center|LOCUS_08290 15448 16272 gene locus_tag LOCUS_08300 gene uppS 15448 16272 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_08300 16336 17193 gene locus_tag LOCUS_08310 16336 17193 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480977.1 protein_id gnl|my_center|LOCUS_08310 17285 18493 gene locus_tag LOCUS_08320 gene ispC 17285 18493 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262430.1 protein_id gnl|my_center|LOCUS_08320 18503 19891 gene locus_tag LOCUS_08330 gene rseP 18503 19891 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456697.1 protein_id gnl|my_center|LOCUS_08330 19894 22308 gene locus_tag LOCUS_08340 gene bamA 19894 22308 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705100.1 protein_id gnl|my_center|LOCUS_08340 22370 22879 gene locus_tag LOCUS_08350 22370 22879 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022478.1 protein_id gnl|my_center|LOCUS_08350 22883 23908 gene locus_tag LOCUS_08360 gene lpxD 22883 23908 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705102.1 protein_id gnl|my_center|LOCUS_08360 24064 24525 gene locus_tag LOCUS_08370 gene fabZ 24064 24525 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634777.1 protein_id gnl|my_center|LOCUS_08370 24535 25323 gene locus_tag LOCUS_08380 gene lpxA 24535 25323 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705103.1 protein_id gnl|my_center|LOCUS_08380 25480 26661 gene locus_tag LOCUS_08390 gene lpxB 25480 26661 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705104.1 protein_id gnl|my_center|LOCUS_08390 26715 27674 gene locus_tag LOCUS_08400 26715 27674 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104756978.1 protein_id gnl|my_center|LOCUS_08400 27677 28288 gene locus_tag LOCUS_08410 gene rnhB 27677 28288 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927570.1 protein_id gnl|my_center|LOCUS_08410 28289 32002 gene locus_tag LOCUS_08420 gene dnaE 28289 32002 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705106.1 protein_id gnl|my_center|LOCUS_08420 32015 32995 gene locus_tag LOCUS_08430 gene accA 32015 32995 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212147.1 protein_id gnl|my_center|LOCUS_08430 33005 34384 gene locus_tag LOCUS_08440 gene tilS 33005 34384 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705125.1 protein_id gnl|my_center|LOCUS_08440 35998 34583 gene locus_tag LOCUS_08450 gene pykF 35998 34583 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633307.1 protein_id gnl|my_center|LOCUS_08450 37310 36330 gene locus_tag LOCUS_08460 37310 36330 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_08460 38898 37315 gene locus_tag LOCUS_08470 38898 37315 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705413.1 protein_id gnl|my_center|LOCUS_08470 39834 38989 gene locus_tag LOCUS_08480 39834 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 40992 40015 gene locus_tag LOCUS_08490 gene cmoB 40992 40015 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216623.1 protein_id gnl|my_center|LOCUS_08490 41744 40992 gene locus_tag LOCUS_08500 gene cmoA 41744 40992 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072410.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence19 1991 354 gene locus_tag LOCUS_08510 1991 354 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_08510 2677 1982 gene locus_tag LOCUS_08520 2677 1982 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_08520 3096 5645 gene locus_tag LOCUS_08530 3096 5645 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013856.1 protein_id gnl|my_center|LOCUS_08530 5747 5586 gene locus_tag LOCUS_08540 5747 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 12592 5744 gene locus_tag LOCUS_08550 12592 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 12735 12893 gene locus_tag LOCUS_08560 12735 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 13049 14299 gene locus_tag LOCUS_08570 13049 14299 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_08570 21283 14420 gene locus_tag LOCUS_08580 21283 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 21514 22632 gene locus_tag LOCUS_08590 gene spuD 21514 22632 CDS product putrescine-binding protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084299.1 protein_id gnl|my_center|LOCUS_08590 23201 23791 gene locus_tag LOCUS_08600 23201 23791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 24362 23850 gene locus_tag LOCUS_08610 24362 23850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 24949 24413 gene locus_tag LOCUS_08620 24949 24413 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266210.1 protein_id gnl|my_center|LOCUS_08620 26964 25222 gene locus_tag LOCUS_08630 26964 25222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 29183 27609 gene locus_tag LOCUS_08640 29183 27609 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_08640 30494 29508 gene locus_tag LOCUS_08650 30494 29508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 31645 30536 gene locus_tag LOCUS_08660 31645 30536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 33247 31694 gene locus_tag LOCUS_08670 33247 31694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 33476 34021 gene locus_tag LOCUS_08680 33476 34021 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704283.1 protein_id gnl|my_center|LOCUS_08680 34117 35193 gene locus_tag LOCUS_08690 gene glnL 34117 35193 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704282.1 protein_id gnl|my_center|LOCUS_08690 35345 36667 gene locus_tag LOCUS_08700 gene glnG 35345 36667 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635441.1 protein_id gnl|my_center|LOCUS_08700 37360 36656 gene locus_tag LOCUS_08710 37360 36656 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_08710 38049 37513 gene locus_tag LOCUS_08720 38049 37513 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647970.1 protein_id gnl|my_center|LOCUS_08720 39375 38602 gene locus_tag LOCUS_08730 39375 38602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 <40706 39372 gene locus_tag LOCUS_08740 <40706 39372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence20 129 2591 gene locus_tag LOCUS_08750 129 2591 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_08750 2753 3199 gene locus_tag LOCUS_08760 2753 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08760 3222 3491 gene locus_tag LOCUS_08770 3222 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08770 3577 3945 gene locus_tag LOCUS_08780 3577 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3956 5230 gene locus_tag LOCUS_08790 3956 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5251 5988 gene locus_tag LOCUS_08800 5251 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6032 8287 gene locus_tag LOCUS_08810 6032 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8377 10524 gene locus_tag LOCUS_08820 8377 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10521 11387 gene locus_tag LOCUS_08830 10521 11387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 11480 13087 gene locus_tag LOCUS_08840 11480 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 13107 14063 gene locus_tag LOCUS_08850 13107 14063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 14173 16233 gene locus_tag LOCUS_08860 14173 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 16714 17790 gene locus_tag LOCUS_08870 16714 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 17955 18944 gene locus_tag LOCUS_08880 17955 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 20260 19010 gene locus_tag LOCUS_08890 20260 19010 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_08890 21281 20616 gene locus_tag LOCUS_08900 gene yihA 21281 20616 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704276.1 protein_id gnl|my_center|LOCUS_08900 21611 22651 gene locus_tag LOCUS_08910 21611 22651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 23268 22717 gene locus_tag LOCUS_08920 23268 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 24685 23285 gene locus_tag LOCUS_08930 24685 23285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 25228 24731 gene locus_tag LOCUS_08940 gene yciA 25228 24731 CDS product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169322.1 protein_id gnl|my_center|LOCUS_08940 25723 27324 gene locus_tag LOCUS_08950 25723 27324 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769461.1 protein_id gnl|my_center|LOCUS_08950 27756 28538 gene locus_tag LOCUS_08960 27756 28538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 28858 29940 gene locus_tag LOCUS_08970 gene ompA 28858 29940 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014883252.1 protein_id gnl|my_center|LOCUS_08970 30437 31513 gene locus_tag LOCUS_08980 30437 31513 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818883.1 protein_id gnl|my_center|LOCUS_08980 31576 32454 gene locus_tag LOCUS_08990 31576 32454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 32451 33347 gene locus_tag LOCUS_09000 32451 33347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 33457 35583 gene locus_tag LOCUS_09010 gene spoT 33457 35583 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704079.1 protein_id gnl|my_center|LOCUS_09010 35616 36575 gene locus_tag LOCUS_09020 gene pldB 35616 36575 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211487.1 protein_id gnl|my_center|LOCUS_09020 36993 36586 gene locus_tag LOCUS_09030 36993 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 37446 37024 gene locus_tag LOCUS_09040 37446 37024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 38099 37692 gene locus_tag LOCUS_09050 38099 37692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 38571 38074 gene locus_tag LOCUS_09060 38571 38074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 39330 38902 gene locus_tag LOCUS_09070 39330 38902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 39782 39312 gene locus_tag LOCUS_09080 39782 39312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 40146 39772 gene locus_tag LOCUS_09090 40146 39772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence21 1180 95 gene locus_tag LOCUS_09100 1180 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2167 1421 gene locus_tag LOCUS_09110 2167 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3554 2184 gene locus_tag LOCUS_09120 3554 2184 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815059.1 protein_id gnl|my_center|LOCUS_09120 4279 3554 gene locus_tag LOCUS_09130 4279 3554 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_09130 5493 4291 gene locus_tag LOCUS_09140 5493 4291 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216358298.1 protein_id gnl|my_center|LOCUS_09140 6415 5480 gene locus_tag LOCUS_09150 6415 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7069 6503 gene locus_tag LOCUS_09160 7069 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418342.1 protein_id gnl|my_center|LOCUS_09160 8289 7066 gene locus_tag LOCUS_09170 8289 7066 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032901333.1 protein_id gnl|my_center|LOCUS_09170 8788 8513 gene locus_tag LOCUS_09180 8788 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 9473 8937 gene locus_tag LOCUS_09190 9473 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 9832 9470 gene locus_tag LOCUS_09200 9832 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 10520 9825 gene locus_tag LOCUS_09210 10520 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 11002 10520 gene locus_tag LOCUS_09220 11002 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 11966 10983 gene locus_tag LOCUS_09230 11966 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 12866 12084 gene locus_tag LOCUS_09240 12866 12084 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703715.1 protein_id gnl|my_center|LOCUS_09240 15504 13336 gene locus_tag LOCUS_09250 15504 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 16114 15494 gene locus_tag LOCUS_09260 16114 15494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 17301 16312 gene locus_tag LOCUS_09270 17301 16312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 19865 18252 gene locus_tag LOCUS_09280 19865 18252 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_09280 22019 20406 gene locus_tag LOCUS_09290 22019 20406 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_09290 22397 24250 gene locus_tag LOCUS_09300 22397 24250 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704972.1 protein_id gnl|my_center|LOCUS_09300 24297 24551 gene locus_tag LOCUS_09310 24297 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 24947 25111 gene locus_tag LOCUS_09320 24947 25111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 25108 25788 gene locus_tag LOCUS_09330 25108 25788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 26514 25852 gene locus_tag LOCUS_09340 gene rsmD 26514 25852 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189766.1 protein_id gnl|my_center|LOCUS_09340 26720 28417 gene locus_tag LOCUS_09350 26720 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 28886 29254 gene locus_tag LOCUS_09360 28886 29254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 31611 29743 gene locus_tag LOCUS_09370 gene typA 31611 29743 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_09370 32058 33473 gene locus_tag LOCUS_09380 gene glnA 32058 33473 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 protein_id gnl|my_center|LOCUS_09380 33699 34526 gene locus_tag LOCUS_09390 33699 34526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 35038 34601 gene locus_tag LOCUS_09400 35038 34601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 36718 35303 gene locus_tag LOCUS_09410 36718 35303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 36952 38169 gene locus_tag LOCUS_09420 gene coaBC 36952 38169 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_09420 38228 38683 gene locus_tag LOCUS_09430 gene dut 38228 38683 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 protein_id gnl|my_center|LOCUS_09430 38828 39697 gene locus_tag LOCUS_09440 38828 39697 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence22 1232 201 gene locus_tag LOCUS_09450 gene purM 1232 201 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016423.1 protein_id gnl|my_center|LOCUS_09450 1906 1409 gene locus_tag LOCUS_09460 gene pyrI 1906 1409 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707750.1 protein_id gnl|my_center|LOCUS_09460 2830 1907 gene locus_tag LOCUS_09470 gene pyrB 2830 1907 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352301.1 protein_id gnl|my_center|LOCUS_09470 3448 3372 gene locus_tag LOCUS_t00170 3448 3372 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4316 3567 gene locus_tag LOCUS_09480 4316 3567 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707393.1 protein_id gnl|my_center|LOCUS_09480 4371 6404 gene locus_tag LOCUS_09490 4371 6404 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260991.1 protein_id gnl|my_center|LOCUS_09490 7141 6488 gene locus_tag LOCUS_09500 7141 6488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7334 7101 gene locus_tag LOCUS_09510 7334 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 8815 7337 gene locus_tag LOCUS_09520 gene glgA 8815 7337 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707514.1 protein_id gnl|my_center|LOCUS_09520 10032 8815 gene locus_tag LOCUS_09530 gene glgC 10032 8815 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707513.1 protein_id gnl|my_center|LOCUS_09530 10251 11141 gene locus_tag LOCUS_09540 gene dapA 10251 11141 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707511.1 protein_id gnl|my_center|LOCUS_09540 11220 12008 gene locus_tag LOCUS_09550 gene trmB 11220 12008 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_09550 12008 12604 gene locus_tag LOCUS_09560 12008 12604 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_09560 12888 12589 gene locus_tag LOCUS_09570 gene hfq 12888 12589 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707507.1 protein_id gnl|my_center|LOCUS_09570 13783 12947 gene locus_tag LOCUS_09580 13783 12947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 14348 14902 gene locus_tag LOCUS_09590 14348 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 15052 15846 gene locus_tag LOCUS_09600 15052 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 16124 16049 gene locus_tag LOCUS_t00180 16124 16049 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16207 16132 gene locus_tag LOCUS_t00190 16207 16132 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 16366 17316 gene locus_tag LOCUS_09610 16366 17316 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704184.1 protein_id gnl|my_center|LOCUS_09610 17306 19552 gene locus_tag LOCUS_09620 gene priA 17306 19552 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707854.1 protein_id gnl|my_center|LOCUS_09620 19586 20323 gene locus_tag LOCUS_09630 gene cobB 19586 20323 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194688031.1 protein_id gnl|my_center|LOCUS_09630 20458 20533 gene locus_tag LOCUS_t00200 20458 20533 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20715 21443 gene locus_tag LOCUS_09640 20715 21443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 21652 25002 gene locus_tag LOCUS_09650 21652 25002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 25059 28478 gene locus_tag LOCUS_09660 25059 28478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 28874 30208 gene locus_tag LOCUS_09670 28874 30208 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300205.1 protein_id gnl|my_center|LOCUS_09670 30315 30932 gene locus_tag LOCUS_09680 30315 30932 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477286.1 protein_id gnl|my_center|LOCUS_09680 31085 33514 gene locus_tag LOCUS_09690 gene rnr 31085 33514 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704662.1 protein_id gnl|my_center|LOCUS_09690 33521 34324 gene locus_tag LOCUS_09700 gene rlmB 33521 34324 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_09700 34435 34827 gene locus_tag LOCUS_09710 gene rpsF 34435 34827 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308887.1 protein_id gnl|my_center|LOCUS_09710 34845 35075 gene locus_tag LOCUS_09720 gene rpsR 34845 35075 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308890.1 protein_id gnl|my_center|LOCUS_09720 35117 35569 gene locus_tag LOCUS_09730 gene rplI 35117 35569 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704669.1 protein_id gnl|my_center|LOCUS_09730 36428 37990 gene locus_tag LOCUS_09740 36428 37990 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_09740 38836 38144 gene locus_tag LOCUS_09750 38836 38144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence23 347 1879 gene locus_tag LOCUS_09760 gene gpmM 347 1879 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 protein_id gnl|my_center|LOCUS_09760 1943 3184 gene locus_tag LOCUS_09770 1943 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3185 3550 gene locus_tag LOCUS_09780 3185 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4160 3576 gene locus_tag LOCUS_09790 gene nfuA 4160 3576 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704302.1 protein_id gnl|my_center|LOCUS_09790 4353 5969 gene locus_tag LOCUS_09800 gene pckA 4353 5969 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_09800 6060 6818 gene locus_tag LOCUS_09810 6060 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7858 6815 gene locus_tag LOCUS_09820 7858 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 8127 7867 gene locus_tag LOCUS_09830 8127 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 8345 11179 gene locus_tag LOCUS_09840 gene uvrA 8345 11179 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174389.1 protein_id gnl|my_center|LOCUS_09840 11293 11700 gene locus_tag LOCUS_09850 11293 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 13318 11786 gene locus_tag LOCUS_09860 13318 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 17274 13588 gene locus_tag LOCUS_09870 gene metH 17274 13588 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514261.1 protein_id gnl|my_center|LOCUS_09870 18350 17430 gene locus_tag LOCUS_09880 gene metA 18350 17430 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704462.1 protein_id gnl|my_center|LOCUS_09880 19277 18483 gene locus_tag LOCUS_09890 19277 18483 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881131.1 protein_id gnl|my_center|LOCUS_09890 20326 19280 gene locus_tag LOCUS_09900 20326 19280 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 protein_id gnl|my_center|LOCUS_09900 21444 20326 gene locus_tag LOCUS_09910 21444 20326 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704460.1 protein_id gnl|my_center|LOCUS_09910 21739 22269 gene locus_tag LOCUS_09920 21739 22269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 22266 22784 gene locus_tag LOCUS_09930 22266 22784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 25356 23578 gene locus_tag LOCUS_09940 25356 23578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 25877 25365 gene locus_tag LOCUS_09950 25877 25365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 26617 25874 gene locus_tag LOCUS_09960 26617 25874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 28347 26653 gene locus_tag LOCUS_09970 28347 26653 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267835.1 protein_id gnl|my_center|LOCUS_09970 29914 28406 gene locus_tag LOCUS_09980 29914 28406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 30696 29914 gene locus_tag LOCUS_09990 30696 29914 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267837.1 protein_id gnl|my_center|LOCUS_09990 32690 30696 gene locus_tag LOCUS_10000 32690 30696 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267838.1 protein_id gnl|my_center|LOCUS_10000 34026 32746 gene locus_tag LOCUS_10010 34026 32746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 36844 34040 gene locus_tag LOCUS_10020 36844 34040 CDS product putative virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267840.1 protein_id gnl|my_center|LOCUS_10020 <37401 36871 gene locus_tag LOCUS_10030 <37401 36871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816324.1:virulence factor SrfB >Feature sequence24 1614 283 gene locus_tag LOCUS_10040 gene secY 1614 283 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672567.1 protein_id gnl|my_center|LOCUS_10040 2099 1629 gene locus_tag LOCUS_10050 gene rplO 2099 1629 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 protein_id gnl|my_center|LOCUS_10050 2287 2102 gene locus_tag LOCUS_10060 gene rpmD 2287 2102 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213339.1 protein_id gnl|my_center|LOCUS_10060 2800 2291 gene locus_tag LOCUS_10070 gene rpsE 2800 2291 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625871.1 protein_id gnl|my_center|LOCUS_10070 3166 2816 gene locus_tag LOCUS_10080 gene rplR 3166 2816 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006817270.1 protein_id gnl|my_center|LOCUS_10080 3710 3177 gene locus_tag LOCUS_10090 gene rplF 3710 3177 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213334.1 protein_id gnl|my_center|LOCUS_10090 4115 3723 gene locus_tag LOCUS_10100 gene rpsH 4115 3723 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704316.1 protein_id gnl|my_center|LOCUS_10100 4435 4130 gene locus_tag LOCUS_10110 gene rpsN 4435 4130 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213330.1 protein_id gnl|my_center|LOCUS_10110 4984 4445 gene locus_tag LOCUS_10120 gene rplE 4984 4445 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331162.1 protein_id gnl|my_center|LOCUS_10120 5320 4997 gene locus_tag LOCUS_10130 gene rplX 5320 4997 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307977.1 protein_id gnl|my_center|LOCUS_10130 5699 5331 gene locus_tag LOCUS_10140 gene rplN 5699 5331 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555479.1 protein_id gnl|my_center|LOCUS_10140 6262 6008 gene locus_tag LOCUS_10150 gene rpsQ 6262 6008 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307966.1 protein_id gnl|my_center|LOCUS_10150 6459 6262 gene locus_tag LOCUS_10160 6459 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6872 6459 gene locus_tag LOCUS_10170 gene rplP 6872 6459 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307963.1 protein_id gnl|my_center|LOCUS_10170 7608 6886 gene locus_tag LOCUS_10180 gene rpsC 7608 6886 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383161.1 protein_id gnl|my_center|LOCUS_10180 7954 7619 gene locus_tag LOCUS_10190 gene rplV 7954 7619 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704314.1 protein_id gnl|my_center|LOCUS_10190 8286 7972 gene locus_tag LOCUS_10200 gene rpsS 8286 7972 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138114.1 protein_id gnl|my_center|LOCUS_10200 9041 8307 gene locus_tag LOCUS_10210 gene rplB 9041 8307 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307957.1 protein_id gnl|my_center|LOCUS_10210 9438 9139 gene locus_tag LOCUS_10220 gene rplW 9438 9139 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159841.1 protein_id gnl|my_center|LOCUS_10220 10043 9435 gene locus_tag LOCUS_10230 gene rplD 10043 9435 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005340616.1 protein_id gnl|my_center|LOCUS_10230 10699 10058 gene locus_tag LOCUS_10240 gene rplC 10699 10058 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632753.1 protein_id gnl|my_center|LOCUS_10240 11028 10717 gene locus_tag LOCUS_10250 gene rpsJ 11028 10717 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181005.1 protein_id gnl|my_center|LOCUS_10250 13263 11299 gene locus_tag LOCUS_10260 13263 11299 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105914.1 protein_id gnl|my_center|LOCUS_10260 14101 13337 gene locus_tag LOCUS_10270 14101 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 14585 14091 gene locus_tag LOCUS_10280 14585 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 15808 14582 gene locus_tag LOCUS_10290 15808 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 16791 15805 gene locus_tag LOCUS_10300 gene exeK 16791 15805 CDS product GspK family T2SS minor pseudopilin variant ExeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704546.1 protein_id gnl|my_center|LOCUS_10300 17416 16811 gene locus_tag LOCUS_10310 gene gspJ 17416 16811 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082782.1 protein_id gnl|my_center|LOCUS_10310 17771 17403 gene locus_tag LOCUS_10320 gene exeI 17771 17403 CDS product GspI family T2SS minor pseudopilin variant ExeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704544.1 protein_id gnl|my_center|LOCUS_10320 18354 17755 gene locus_tag LOCUS_10330 18354 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 18830 18393 gene locus_tag LOCUS_10340 gene gspG 18830 18393 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202874.1 protein_id gnl|my_center|LOCUS_10340 20065 18842 gene locus_tag LOCUS_10350 gene exeF 20065 18842 CDS product GspF family T2SS innner membrane protein variant ExeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704542.1 protein_id gnl|my_center|LOCUS_10350 22492 20069 gene locus_tag LOCUS_10360 22492 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 24410 22473 gene locus_tag LOCUS_10370 gene exeD 24410 22473 CDS product GspD family T2SS secretin variant ExeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704540.1 protein_id gnl|my_center|LOCUS_10370 25490 24621 gene locus_tag LOCUS_10380 gene hslO 25490 24621 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001775502.1 protein_id gnl|my_center|LOCUS_10380 25944 25471 gene locus_tag LOCUS_10390 gene hslR 25944 25471 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660485.1 protein_id gnl|my_center|LOCUS_10390 26954 25947 gene locus_tag LOCUS_10400 gene glpX 26954 25947 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815289.1 protein_id gnl|my_center|LOCUS_10400 28203 27148 gene locus_tag LOCUS_10410 28203 27148 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704267.1 protein_id gnl|my_center|LOCUS_10410 28379 28897 gene locus_tag LOCUS_10420 gene def 28379 28897 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704266.1 protein_id gnl|my_center|LOCUS_10420 28961 29905 gene locus_tag LOCUS_10430 gene fmt 28961 29905 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285161.1 protein_id gnl|my_center|LOCUS_10430 29902 31197 gene locus_tag LOCUS_10440 gene rsmB 29902 31197 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560556.1 protein_id gnl|my_center|LOCUS_10440 31201 32574 gene locus_tag LOCUS_10450 gene trkA 31201 32574 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704263.1 protein_id gnl|my_center|LOCUS_10450 32582 34018 gene locus_tag LOCUS_10460 32582 34018 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704262.1 protein_id gnl|my_center|LOCUS_10460 35493 34042 gene locus_tag LOCUS_10470 gene tldD 35493 34042 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819195.1 protein_id gnl|my_center|LOCUS_10470 35755 36387 gene locus_tag LOCUS_10480 35755 36387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence25 220 1185 gene locus_tag LOCUS_10490 220 1185 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707915.1 protein_id gnl|my_center|LOCUS_10490 1274 2434 gene locus_tag LOCUS_10500 1274 2434 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_10500 3566 2496 gene locus_tag LOCUS_10510 3566 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4593 3550 gene locus_tag LOCUS_10520 4593 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 4860 5252 gene locus_tag LOCUS_10530 4860 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5254 6225 gene locus_tag LOCUS_10540 gene atpB 5254 6225 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135618.1 protein_id gnl|my_center|LOCUS_10540 6261 6509 gene locus_tag LOCUS_10550 gene atpE 6261 6509 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873965.1 protein_id gnl|my_center|LOCUS_10550 6528 6998 gene locus_tag LOCUS_10560 gene atpF 6528 6998 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707912.1 protein_id gnl|my_center|LOCUS_10560 7010 7579 gene locus_tag LOCUS_10570 gene atpH 7010 7579 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 protein_id gnl|my_center|LOCUS_10570 7594 9132 gene locus_tag LOCUS_10580 gene atpA 7594 9132 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005688698.1 protein_id gnl|my_center|LOCUS_10580 9151 10032 gene locus_tag LOCUS_10590 gene atpG 9151 10032 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369007.1 protein_id gnl|my_center|LOCUS_10590 10053 11477 gene locus_tag LOCUS_10600 gene atpD 10053 11477 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074330.1 protein_id gnl|my_center|LOCUS_10600 11512 11991 gene locus_tag LOCUS_10610 11512 11991 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307217.1 protein_id gnl|my_center|LOCUS_10610 13853 12663 gene locus_tag LOCUS_10620 13853 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 14445 15797 gene locus_tag LOCUS_10630 gene glmU 14445 15797 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884331.1 protein_id gnl|my_center|LOCUS_10630 15982 17811 gene locus_tag LOCUS_10640 gene glmS 15982 17811 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707902.1 protein_id gnl|my_center|LOCUS_10640 17884 18618 gene locus_tag LOCUS_10650 17884 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 18608 20716 gene locus_tag LOCUS_10660 gene rep 18608 20716 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 protein_id gnl|my_center|LOCUS_10660 20851 22014 gene locus_tag LOCUS_10670 20851 22014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 22725 22042 gene locus_tag LOCUS_10680 22725 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 24273 22849 gene locus_tag LOCUS_10690 24273 22849 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706710.1 protein_id gnl|my_center|LOCUS_10690 27574 24266 gene locus_tag LOCUS_10700 gene mdtF 27574 24266 CDS product multidrug efflux pump RND permease MdtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024892.1 protein_id gnl|my_center|LOCUS_10700 28851 27592 gene locus_tag LOCUS_10710 28851 27592 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 protein_id gnl|my_center|LOCUS_10710 29117 29794 gene locus_tag LOCUS_10720 29117 29794 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706713.1 protein_id gnl|my_center|LOCUS_10720 30753 29926 gene locus_tag LOCUS_10730 30753 29926 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_10730 30968 31744 gene locus_tag LOCUS_10740 30968 31744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 31797 32492 gene locus_tag LOCUS_10750 31797 32492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 32538 32798 gene locus_tag LOCUS_10760 32538 32798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 34052 32829 gene locus_tag LOCUS_10770 34052 32829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_10770 34806 34483 gene locus_tag LOCUS_10780 gene trxA 34806 34483 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence26 904 278 gene locus_tag LOCUS_10790 904 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1628 942 gene locus_tag LOCUS_10800 1628 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1843 1613 gene locus_tag LOCUS_10810 1843 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3321 2071 gene locus_tag LOCUS_10820 3321 2071 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865516.1 protein_id gnl|my_center|LOCUS_10820 5349 3475 gene locus_tag LOCUS_10830 5349 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 7446 5629 gene locus_tag LOCUS_10840 7446 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 10222 7661 gene locus_tag LOCUS_10850 10222 7661 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704443.1 protein_id gnl|my_center|LOCUS_10850 11052 13994 gene locus_tag LOCUS_10860 11052 13994 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203068.1 protein_id gnl|my_center|LOCUS_10860 15801 14530 gene locus_tag LOCUS_10870 15801 14530 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659589.1 protein_id gnl|my_center|LOCUS_10870 17519 16908 gene locus_tag LOCUS_10880 17519 16908 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_10880 18904 17621 gene locus_tag LOCUS_10890 18904 17621 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_10890 19366 20127 gene locus_tag LOCUS_10900 19366 20127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 20638 20141 gene locus_tag LOCUS_10910 20638 20141 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_10910 21263 20640 gene locus_tag LOCUS_10920 21263 20640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 22594 21428 gene locus_tag LOCUS_10930 22594 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 24114 22597 gene locus_tag LOCUS_10940 gene hemX 24114 22597 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211463.1 protein_id gnl|my_center|LOCUS_10940 25936 24392 gene locus_tag LOCUS_10950 gene ilvA 25936 24392 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707857.1 protein_id gnl|my_center|LOCUS_10950 27796 25982 gene locus_tag LOCUS_10960 gene ilvD 27796 25982 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127366.1 protein_id gnl|my_center|LOCUS_10960 28976 28026 gene locus_tag LOCUS_10970 28976 28026 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_10970 29479 30402 gene locus_tag LOCUS_10980 29479 30402 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819016.1 protein_id gnl|my_center|LOCUS_10980 30558 30923 gene locus_tag LOCUS_10990 30558 30923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 30829 32049 gene locus_tag LOCUS_11000 30829 32049 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_11000 32046 32309 gene locus_tag LOCUS_11010 32046 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 32818 32486 gene locus_tag LOCUS_11020 32818 32486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 33221 32820 gene locus_tag LOCUS_11030 33221 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 33586 33221 gene locus_tag LOCUS_11040 33586 33221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 33834 33700 gene locus_tag LOCUS_11050 33834 33700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 33796 34095 gene locus_tag LOCUS_11060 33796 34095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 34164 34397 gene locus_tag LOCUS_11070 34164 34397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence27 176 1954 gene locus_tag LOCUS_11080 gene msbA 176 1954 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 protein_id gnl|my_center|LOCUS_11080 3577 2000 gene locus_tag LOCUS_11090 3577 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4489 3581 gene locus_tag LOCUS_11100 4489 3581 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707454.1 protein_id gnl|my_center|LOCUS_11100 6741 4489 gene locus_tag LOCUS_11110 gene parC 6741 4489 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707468.1 protein_id gnl|my_center|LOCUS_11110 6958 7539 gene locus_tag LOCUS_11120 6958 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8365 7541 gene locus_tag LOCUS_11130 8365 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11130 9261 8386 gene locus_tag LOCUS_11140 9261 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 9427 9221 gene locus_tag LOCUS_11150 9427 9221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 10737 9424 gene locus_tag LOCUS_11160 10737 9424 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_11160 11113 12513 gene locus_tag LOCUS_11170 11113 12513 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948261.1 protein_id gnl|my_center|LOCUS_11170 13220 14482 gene locus_tag LOCUS_11180 13220 14482 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457515.1 protein_id gnl|my_center|LOCUS_11180 14748 15203 gene locus_tag LOCUS_11190 14748 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 15179 16171 gene locus_tag LOCUS_11200 15179 16171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11200 17881 16553 gene locus_tag LOCUS_11210 17881 16553 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477167.1 protein_id gnl|my_center|LOCUS_11210 19532 18225 gene locus_tag LOCUS_11220 19532 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 19739 19888 gene locus_tag LOCUS_11230 19739 19888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 20150 21166 gene locus_tag LOCUS_11240 20150 21166 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339091.1 protein_id gnl|my_center|LOCUS_11240 21171 23933 gene locus_tag LOCUS_11250 gene rbbA 21171 23933 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140331.1 protein_id gnl|my_center|LOCUS_11250 23936 25054 gene locus_tag LOCUS_11260 23936 25054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339089.1 protein_id gnl|my_center|LOCUS_11260 25059 26516 gene locus_tag LOCUS_11270 25059 26516 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901032.1 protein_id gnl|my_center|LOCUS_11270 28404 26614 gene locus_tag LOCUS_11280 28404 26614 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11280 29628 28681 gene locus_tag LOCUS_11290 29628 28681 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298464.1 protein_id gnl|my_center|LOCUS_11290 30532 29666 gene locus_tag LOCUS_11300 gene ispE 30532 29666 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_11300 31260 30529 gene locus_tag LOCUS_11310 31260 30529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 32527 31421 gene locus_tag LOCUS_11320 32527 31421 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_11320 32780 32508 gene locus_tag LOCUS_11330 32780 32508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 33327 33049 gene locus_tag LOCUS_11340 33327 33049 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165613498.1 protein_id gnl|my_center|LOCUS_11340 33595 33314 gene locus_tag LOCUS_11350 33595 33314 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence28 216 590 gene locus_tag LOCUS_11360 216 590 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704632.1 protein_id gnl|my_center|LOCUS_11360 1175 804 gene locus_tag LOCUS_11370 gene rplS 1175 804 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116654.1 protein_id gnl|my_center|LOCUS_11370 1966 1202 gene locus_tag LOCUS_11380 gene trmD 1966 1202 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071568.1 protein_id gnl|my_center|LOCUS_11380 2497 1970 gene locus_tag LOCUS_11390 gene rimM 2497 1970 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209459.1 protein_id gnl|my_center|LOCUS_11390 2805 2515 gene locus_tag LOCUS_11400 gene rpsP 2805 2515 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071566.1 protein_id gnl|my_center|LOCUS_11400 4353 2998 gene locus_tag LOCUS_11410 gene ffh 4353 2998 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_11410 4513 5793 gene locus_tag LOCUS_11420 4513 5793 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_11420 5983 6921 gene locus_tag LOCUS_11430 gene mdh 5983 6921 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454639.1 protein_id gnl|my_center|LOCUS_11430 7081 7698 gene locus_tag LOCUS_11440 gene pgsA 7081 7698 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 protein_id gnl|my_center|LOCUS_11440 7810 8553 gene locus_tag LOCUS_11450 7810 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 8733 8948 gene locus_tag LOCUS_11460 8733 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 9147 8932 gene locus_tag LOCUS_11470 9147 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 9693 9196 gene locus_tag LOCUS_11480 gene rraA 9693 9196 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456236.1 protein_id gnl|my_center|LOCUS_11480 10427 9702 gene locus_tag LOCUS_11490 gene cysE 10427 9702 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_11490 11704 10484 gene locus_tag LOCUS_11500 11704 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 13449 11707 gene locus_tag LOCUS_11510 gene argS 13449 11707 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707774.1 protein_id gnl|my_center|LOCUS_11510 15765 13594 gene locus_tag LOCUS_11520 15765 13594 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705133.1 protein_id gnl|my_center|LOCUS_11520 16033 16686 gene locus_tag LOCUS_11530 16033 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 17227 16706 gene locus_tag LOCUS_11540 17227 16706 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261221.1 protein_id gnl|my_center|LOCUS_11540 17756 17220 gene locus_tag LOCUS_11550 17756 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 18297 17905 gene locus_tag LOCUS_11560 gene rpsI 18297 17905 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 protein_id gnl|my_center|LOCUS_11560 18737 18309 gene locus_tag LOCUS_11570 gene rplM 18737 18309 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847599.1 protein_id gnl|my_center|LOCUS_11570 20395 18926 gene locus_tag LOCUS_11580 gene rng 20395 18926 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704378.1 protein_id gnl|my_center|LOCUS_11580 21013 20438 gene locus_tag LOCUS_11590 21013 20438 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_11590 21501 21010 gene locus_tag LOCUS_11600 21501 21010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 22487 21498 gene locus_tag LOCUS_11610 gene mreC 22487 21498 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 protein_id gnl|my_center|LOCUS_11610 23569 22520 gene locus_tag LOCUS_11620 gene mreB 23569 22520 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228205.1 protein_id gnl|my_center|LOCUS_11620 23841 25214 gene locus_tag LOCUS_11630 gene amt 23841 25214 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_11630 25385 26287 gene locus_tag LOCUS_11640 25385 26287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 27712 26360 gene locus_tag LOCUS_11650 gene pmbA 27712 26360 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707624.1 protein_id gnl|my_center|LOCUS_11650 27906 28535 gene locus_tag LOCUS_11660 27906 28535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 28582 28908 gene locus_tag LOCUS_11670 gene pspE 28582 28908 CDS product thiosulfate sulfurtransferase PspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473115.1 protein_id gnl|my_center|LOCUS_11670 28913 29461 gene locus_tag LOCUS_11680 28913 29461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 30725 29475 gene locus_tag LOCUS_11690 30725 29475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 30937 31266 gene locus_tag LOCUS_11700 30937 31266 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807902.1 protein_id gnl|my_center|LOCUS_11700 31651 31328 gene locus_tag LOCUS_11710 31651 31328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 33167 31644 gene locus_tag LOCUS_11720 33167 31644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence29 199 822 gene locus_tag LOCUS_11730 199 822 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_11730 2009 930 gene locus_tag LOCUS_11740 2009 930 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764738.1 protein_id gnl|my_center|LOCUS_11740 2880 4667 gene locus_tag LOCUS_11750 2880 4667 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11750 5698 4724 gene locus_tag LOCUS_11760 5698 4724 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269387.1 protein_id gnl|my_center|LOCUS_11760 6291 5695 gene locus_tag LOCUS_11770 6291 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 11196 6730 gene locus_tag LOCUS_11780 11196 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 12187 11903 gene locus_tag LOCUS_11790 12187 11903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 13907 12198 gene locus_tag LOCUS_11800 13907 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 15153 14050 gene locus_tag LOCUS_11810 15153 14050 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_11810 17038 15260 gene locus_tag LOCUS_11820 17038 15260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_11820 17727 17035 gene locus_tag LOCUS_11830 17727 17035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_11830 19660 18161 gene locus_tag LOCUS_11840 gene ygjG 19660 18161 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098827.1 protein_id gnl|my_center|LOCUS_11840 21615 20338 gene locus_tag LOCUS_11850 21615 20338 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846674.1 protein_id gnl|my_center|LOCUS_11850 22178 21846 gene locus_tag LOCUS_11860 22178 21846 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107123.1 protein_id gnl|my_center|LOCUS_11860 22438 23037 gene locus_tag LOCUS_11870 22438 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 23271 24254 gene locus_tag LOCUS_11880 23271 24254 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_11880 24431 26626 gene locus_tag LOCUS_11890 24431 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 29269 26699 gene locus_tag LOCUS_11900 29269 26699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 30783 29611 gene locus_tag LOCUS_11910 30783 29611 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766719.1 protein_id gnl|my_center|LOCUS_11910 31068 32519 gene locus_tag LOCUS_11920 31068 32519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence30 1241 159 gene locus_tag LOCUS_11930 1241 159 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706590.1 protein_id gnl|my_center|LOCUS_11930 2801 1671 gene locus_tag LOCUS_11940 gene ompS1 2801 1671 CDS product porin OmpS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080666.1 protein_id gnl|my_center|LOCUS_11940 4471 3356 gene locus_tag LOCUS_11950 4471 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 6099 4978 gene locus_tag LOCUS_11960 gene ompS2 6099 4978 CDS product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824321.1 protein_id gnl|my_center|LOCUS_11960 8067 6967 gene locus_tag LOCUS_11970 gene ompS2 8067 6967 CDS product porin OmpS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824321.1 protein_id gnl|my_center|LOCUS_11970 8113 8325 gene locus_tag LOCUS_11980 8113 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 10480 8291 gene locus_tag LOCUS_11990 gene feoB 10480 8291 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861233.1 protein_id gnl|my_center|LOCUS_11990 12393 10768 gene locus_tag LOCUS_12000 gene dacB 12393 10768 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706441.1 protein_id gnl|my_center|LOCUS_12000 12697 13893 gene locus_tag LOCUS_12010 12697 13893 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261553.1 protein_id gnl|my_center|LOCUS_12010 14097 15761 gene locus_tag LOCUS_12020 14097 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 17010 15820 gene locus_tag LOCUS_12030 17010 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 17511 17101 gene locus_tag LOCUS_12040 17511 17101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 18055 17627 gene locus_tag LOCUS_12050 18055 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 18722 18207 gene locus_tag LOCUS_12060 18722 18207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 19137 19676 gene locus_tag LOCUS_12070 19137 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 21425 19743 gene locus_tag LOCUS_12080 gene asnB 21425 19743 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_12080 21577 22650 gene locus_tag LOCUS_12090 gene lpxM 21577 22650 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705968.1 protein_id gnl|my_center|LOCUS_12090 22749 23936 gene locus_tag LOCUS_12100 22749 23936 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 protein_id gnl|my_center|LOCUS_12100 24077 25132 gene locus_tag LOCUS_12110 gene aroG 24077 25132 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263273.1 protein_id gnl|my_center|LOCUS_12110 25184 26416 gene locus_tag LOCUS_12120 gene serA 25184 26416 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262564.1 protein_id gnl|my_center|LOCUS_12120 26763 26687 gene locus_tag LOCUS_t00210 26763 26687 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27257 27045 gene locus_tag LOCUS_12130 27257 27045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 27533 27378 gene locus_tag LOCUS_12140 27533 27378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 27790 27623 gene locus_tag LOCUS_12150 27790 27623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 27813 28784 gene locus_tag LOCUS_12160 27813 28784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 29341 29526 gene locus_tag LOCUS_12170 29341 29526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 29604 31223 gene locus_tag LOCUS_12180 29604 31223 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_12180 31337 32170 gene locus_tag LOCUS_12190 gene purU 31337 32170 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020112.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence31 165 392 gene locus_tag LOCUS_12200 165 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 828 2813 gene locus_tag LOCUS_12210 gene htpG 828 2813 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706320.1 protein_id gnl|my_center|LOCUS_12210 3621 2941 gene locus_tag LOCUS_12220 3621 2941 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172351.1 protein_id gnl|my_center|LOCUS_12220 4859 3720 gene locus_tag LOCUS_12230 gene dapE 4859 3720 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277830.1 protein_id gnl|my_center|LOCUS_12230 5501 4971 gene locus_tag LOCUS_12240 5501 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 5841 5548 gene locus_tag LOCUS_12250 5841 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 6461 5865 gene locus_tag LOCUS_12260 6461 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 7420 8598 gene locus_tag LOCUS_12270 7420 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 8723 9535 gene locus_tag LOCUS_12280 8723 9535 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_12280 9596 10219 gene locus_tag LOCUS_12290 9596 10219 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298548.1 protein_id gnl|my_center|LOCUS_12290 10298 11107 gene locus_tag LOCUS_12300 gene dapB 10298 11107 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417649.1 protein_id gnl|my_center|LOCUS_12300 12302 11196 gene locus_tag LOCUS_12310 gene potF 12302 11196 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208762.1 protein_id gnl|my_center|LOCUS_12310 12606 13742 gene locus_tag LOCUS_12320 gene carA 12606 13742 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_12320 13747 16989 gene locus_tag LOCUS_12330 gene carB 13747 16989 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706535.1 protein_id gnl|my_center|LOCUS_12330 17155 17967 gene locus_tag LOCUS_12340 17155 17967 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_12340 18209 18285 gene locus_tag LOCUS_t00220 18209 18285 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18954 18415 gene locus_tag LOCUS_12350 gene smrA 18954 18415 CDS product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704977.1 protein_id gnl|my_center|LOCUS_12350 19091 20068 gene locus_tag LOCUS_12360 19091 20068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 20227 22419 gene locus_tag LOCUS_12370 gene rlmKL 20227 22419 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819954.1 protein_id gnl|my_center|LOCUS_12370 22410 24329 gene locus_tag LOCUS_12380 22410 24329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704904.1 protein_id gnl|my_center|LOCUS_12380 24326 26056 gene locus_tag LOCUS_12390 24326 26056 CDS product DUF3466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706134.1 protein_id gnl|my_center|LOCUS_12390 27697 26363 gene locus_tag LOCUS_12400 27697 26363 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455487.1 protein_id gnl|my_center|LOCUS_12400 29216 27879 gene locus_tag LOCUS_12410 29216 27879 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975735.1 protein_id gnl|my_center|LOCUS_12410 29650 30810 gene locus_tag LOCUS_12420 gene sucC 29650 30810 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072032.1 protein_id gnl|my_center|LOCUS_12420 30825 31697 gene locus_tag LOCUS_12430 gene sucD 30825 31697 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455492.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence32 268 89 gene locus_tag LOCUS_12440 268 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3164 414 gene locus_tag LOCUS_12450 gene secA 3164 414 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_12450 4284 3280 gene locus_tag LOCUS_12460 4284 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 5833 4460 gene locus_tag LOCUS_12470 gene srmB 5833 4460 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707392.1 protein_id gnl|my_center|LOCUS_12470 6130 8535 gene locus_tag LOCUS_12480 6130 8535 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158196641.1 protein_id gnl|my_center|LOCUS_12480 8777 9052 gene locus_tag LOCUS_12490 gene hupA 8777 9052 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166072.1 protein_id gnl|my_center|LOCUS_12490 9233 11689 gene locus_tag LOCUS_12500 9233 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 11692 12291 gene locus_tag LOCUS_12510 11692 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 13387 12428 gene locus_tag LOCUS_12520 13387 12428 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_12520 14388 13390 gene locus_tag LOCUS_12530 gene serB 14388 13390 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707408.1 protein_id gnl|my_center|LOCUS_12530 15256 14456 gene locus_tag LOCUS_12540 15256 14456 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_12540 16024 15257 gene locus_tag LOCUS_12550 16024 15257 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261271.1 protein_id gnl|my_center|LOCUS_12550 17597 16014 gene locus_tag LOCUS_12560 gene prfC 17597 16014 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704687.1 protein_id gnl|my_center|LOCUS_12560 18357 17692 gene locus_tag LOCUS_12570 gene queE 18357 17692 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_12570 18698 18357 gene locus_tag LOCUS_12580 gene queD 18698 18357 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_12580 18770 19060 gene locus_tag LOCUS_12590 18770 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 19267 19614 gene locus_tag LOCUS_12600 19267 19614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 19617 19904 gene locus_tag LOCUS_12610 19617 19904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 20075 20494 gene locus_tag LOCUS_12620 20075 20494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 22476 20575 gene locus_tag LOCUS_12630 gene parE 22476 20575 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305312.1 protein_id gnl|my_center|LOCUS_12630 23375 22776 gene locus_tag LOCUS_12640 gene yqiA 23375 22776 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077091.1 protein_id gnl|my_center|LOCUS_12640 24199 23375 gene locus_tag LOCUS_12650 gene cpdA 24199 23375 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707475.1 protein_id gnl|my_center|LOCUS_12650 25078 24455 gene locus_tag LOCUS_12660 gene nudF 25078 24455 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_12660 25410 26672 gene locus_tag LOCUS_12670 25410 26672 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_12670 26925 27803 gene locus_tag LOCUS_12680 gene panE 26925 27803 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095846.1 protein_id gnl|my_center|LOCUS_12680 27877 28434 gene locus_tag LOCUS_12690 gene yajL 27877 28434 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208657.1 protein_id gnl|my_center|LOCUS_12690 28603 29064 gene locus_tag LOCUS_12700 28603 29064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 30024 29248 gene locus_tag LOCUS_12710 30024 29248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence33 <1 757 gene locus_tag LOCUS_12720 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263053.1:diguanylate cyclase 1224 1925 gene locus_tag LOCUS_12730 1224 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 1931 3049 gene locus_tag LOCUS_12740 1931 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3110 4282 gene locus_tag LOCUS_12750 gene ugd 3110 4282 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706040.1 protein_id gnl|my_center|LOCUS_12750 5614 5979 gene locus_tag LOCUS_12760 5614 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7173 6115 gene locus_tag LOCUS_12770 gene rfbB 7173 6115 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_12770 7731 7183 gene locus_tag LOCUS_12780 gene rfbC 7731 7183 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 protein_id gnl|my_center|LOCUS_12780 8689 7823 gene locus_tag LOCUS_12790 gene rfbA 8689 7823 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097851.1 protein_id gnl|my_center|LOCUS_12790 9165 10280 gene locus_tag LOCUS_12800 9165 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 10174 11154 gene locus_tag LOCUS_12810 10174 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 11945 11271 gene locus_tag LOCUS_12820 gene nth 11945 11271 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680501.1 protein_id gnl|my_center|LOCUS_12820 12612 11932 gene locus_tag LOCUS_12830 12612 11932 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944880.1 protein_id gnl|my_center|LOCUS_12830 13235 12609 gene locus_tag LOCUS_12840 gene rsxG 13235 12609 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706453.1 protein_id gnl|my_center|LOCUS_12840 14863 13232 gene locus_tag LOCUS_12850 14863 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 17385 14860 gene locus_tag LOCUS_12860 17385 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 17939 17394 gene locus_tag LOCUS_12870 gene rsxB 17939 17394 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650033.1 protein_id gnl|my_center|LOCUS_12870 18517 17939 gene locus_tag LOCUS_12880 gene rsxA 18517 17939 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_12880 19353 18598 gene locus_tag LOCUS_12890 19353 18598 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208568.1 protein_id gnl|my_center|LOCUS_12890 19940 19437 gene locus_tag LOCUS_12900 19940 19437 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071912.1 protein_id gnl|my_center|LOCUS_12900 20238 21497 gene locus_tag LOCUS_12910 20238 21497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 21663 23063 gene locus_tag LOCUS_12920 gene cysS 21663 23063 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 protein_id gnl|my_center|LOCUS_12920 23298 25976 gene locus_tag LOCUS_12930 23298 25976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 26138 27901 gene locus_tag LOCUS_12940 26138 27901 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994691.1 protein_id gnl|my_center|LOCUS_12940 28394 27975 gene locus_tag LOCUS_12950 28394 27975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 28511 29842 gene locus_tag LOCUS_12960 28511 29842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 29963 30922 gene locus_tag LOCUS_12970 29963 30922 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125980453.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence34 469 176 gene locus_tag LOCUS_12980 469 176 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652847.1 protein_id gnl|my_center|LOCUS_12980 2867 480 gene locus_tag LOCUS_12990 gene pheT 2867 480 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480596.1 protein_id gnl|my_center|LOCUS_12990 3870 2890 gene locus_tag LOCUS_13000 gene pheS 3870 2890 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706167.1 protein_id gnl|my_center|LOCUS_13000 7062 4066 gene locus_tag LOCUS_13010 7062 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7530 7171 gene locus_tag LOCUS_13020 gene rplT 7530 7171 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300683.1 protein_id gnl|my_center|LOCUS_13020 7743 7549 gene locus_tag LOCUS_13030 gene rpmI 7743 7549 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 protein_id gnl|my_center|LOCUS_13030 8363 7815 gene locus_tag LOCUS_13040 gene infC 8363 7815 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894072.1 protein_id gnl|my_center|LOCUS_13040 10296 8374 gene locus_tag LOCUS_13050 gene thrS 10296 8374 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816225.1 protein_id gnl|my_center|LOCUS_13050 11874 10543 gene locus_tag LOCUS_13060 11874 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 13379 12000 gene locus_tag LOCUS_13070 13379 12000 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_13070 13949 13562 gene locus_tag LOCUS_tm00010 13949 13562 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 15334 14072 gene locus_tag LOCUS_13080 gene sstT 15334 14072 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216063.1 protein_id gnl|my_center|LOCUS_13080 15578 15964 gene locus_tag LOCUS_13090 15578 15964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17956 16376 gene locus_tag LOCUS_13100 gene guaA 17956 16376 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703162.1 protein_id gnl|my_center|LOCUS_13100 19438 17969 gene locus_tag LOCUS_13110 gene guaB 19438 17969 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705859.1 protein_id gnl|my_center|LOCUS_13110 19559 21244 gene locus_tag LOCUS_13120 gene xseA 19559 21244 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 protein_id gnl|my_center|LOCUS_13120 21439 23298 gene locus_tag LOCUS_13130 gene sppA 21439 23298 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211674.1 protein_id gnl|my_center|LOCUS_13130 23368 23895 gene locus_tag LOCUS_13140 gene fldA 23368 23895 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648709.1 protein_id gnl|my_center|LOCUS_13140 25710 24034 gene locus_tag LOCUS_13150 gene glnS 25710 24034 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705426.1 protein_id gnl|my_center|LOCUS_13150 26118 25789 gene locus_tag LOCUS_13160 gene azlD 26118 25789 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_13160 26909 26115 gene locus_tag LOCUS_13170 gene azlC 26909 26115 CDS product azaleucine resistance protein AzlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969035.1 protein_id gnl|my_center|LOCUS_13170 27039 28211 gene locus_tag LOCUS_13180 gene nagA 27039 28211 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 protein_id gnl|my_center|LOCUS_13180 28288 28686 gene locus_tag LOCUS_13190 28288 28686 CDS product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350309.1 protein_id gnl|my_center|LOCUS_13190 29713 28793 gene locus_tag LOCUS_13200 29713 28793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence35 229 4647 gene locus_tag LOCUS_13210 229 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 4902 5285 gene locus_tag LOCUS_13220 4902 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5319 5879 gene locus_tag LOCUS_13230 5319 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6019 7326 gene locus_tag LOCUS_13240 6019 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 7424 7993 gene locus_tag LOCUS_13250 gene ampD 7424 7993 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923715.1 protein_id gnl|my_center|LOCUS_13250 8927 7998 gene locus_tag LOCUS_13260 8927 7998 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_13260 9581 9009 gene locus_tag LOCUS_13270 gene sodB 9581 9009 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366881.1 protein_id gnl|my_center|LOCUS_13270 10558 9674 gene locus_tag LOCUS_13280 gene gltR 10558 9674 CDS product glutamate biosynthesis transcriptional regulator GltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246132.1 protein_id gnl|my_center|LOCUS_13280 10707 11549 gene locus_tag LOCUS_13290 10707 11549 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089316.1 protein_id gnl|my_center|LOCUS_13290 12124 11585 gene locus_tag LOCUS_13300 12124 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 17071 12170 gene locus_tag LOCUS_13310 17071 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 17252 17395 gene locus_tag LOCUS_13320 17252 17395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 19394 17424 gene locus_tag LOCUS_13330 19394 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 22347 19438 gene locus_tag LOCUS_13340 22347 19438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 23050 23943 gene locus_tag LOCUS_13350 23050 23943 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_13350 24301 24098 gene locus_tag LOCUS_13360 24301 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 24442 26946 gene locus_tag LOCUS_13370 24442 26946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 27520 27110 gene locus_tag LOCUS_13380 27520 27110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 28227 27811 gene locus_tag LOCUS_13390 28227 27811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 28549 28247 gene locus_tag LOCUS_13400 28549 28247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence36 660 247 gene locus_tag LOCUS_13410 660 247 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 protein_id gnl|my_center|LOCUS_13410 1913 714 gene locus_tag LOCUS_13420 1913 714 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_13420 2153 2677 gene locus_tag LOCUS_13430 2153 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2886 3671 gene locus_tag LOCUS_13440 gene tcdA 2886 3671 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173260.1 protein_id gnl|my_center|LOCUS_13440 3668 4057 gene locus_tag LOCUS_13450 3668 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 4057 4551 gene locus_tag LOCUS_13460 4057 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 4548 7301 gene locus_tag LOCUS_13470 gene polA 4548 7301 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250007.1 protein_id gnl|my_center|LOCUS_13470 7495 8268 gene locus_tag LOCUS_13480 7495 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 8439 9602 gene locus_tag LOCUS_13490 8439 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 9599 10309 gene locus_tag LOCUS_13500 9599 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 10306 10953 gene locus_tag LOCUS_13510 gene mshJ 10306 10953 CDS product MSHA fimbrial biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704364.1 protein_id gnl|my_center|LOCUS_13510 10943 11401 gene locus_tag LOCUS_13520 10943 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 11414 13099 gene locus_tag LOCUS_13530 gene mshL 11414 13099 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704365.1 protein_id gnl|my_center|LOCUS_13530 13151 14104 gene locus_tag LOCUS_13540 gene mshM 13151 14104 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_13540 14101 15255 gene locus_tag LOCUS_13550 14101 15255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 15255 16964 gene locus_tag LOCUS_13560 gene mshE 15255 16964 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_13560 16966 18198 gene locus_tag LOCUS_13570 gene mshG 16966 18198 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_13570 18195 18740 gene locus_tag LOCUS_13580 18195 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 20974 19529 gene locus_tag LOCUS_13590 20974 19529 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_13590 22292 21150 gene locus_tag LOCUS_13600 22292 21150 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_13600 22693 22956 gene locus_tag LOCUS_13610 22693 22956 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584499.1 protein_id gnl|my_center|LOCUS_13610 22916 23173 gene locus_tag LOCUS_13620 22916 23173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 23312 23482 gene locus_tag LOCUS_13630 23312 23482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 23555 23683 gene locus_tag LOCUS_13640 23555 23683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 23766 23954 gene locus_tag LOCUS_13650 23766 23954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 23951 24106 gene locus_tag LOCUS_13660 23951 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 24201 25118 gene locus_tag LOCUS_13670 24201 25118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 26419 25490 gene locus_tag LOCUS_13680 26419 25490 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003822229.1 protein_id gnl|my_center|LOCUS_13680 26897 26424 gene locus_tag LOCUS_13690 26897 26424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 27146 27301 gene locus_tag LOCUS_13700 27146 27301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13700 27330 27635 gene locus_tag LOCUS_13710 27330 27635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13710 >Feature sequence37 360 436 gene locus_tag LOCUS_t00230 360 436 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 438 513 gene locus_tag LOCUS_t00240 438 513 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 548 623 gene locus_tag LOCUS_t00250 548 623 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 636 711 gene locus_tag LOCUS_t00260 636 711 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2489 1398 gene locus_tag LOCUS_13720 gene ychF 2489 1398 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705079.1 protein_id gnl|my_center|LOCUS_13720 3186 2587 gene locus_tag LOCUS_13730 gene pth 3186 2587 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071415.1 protein_id gnl|my_center|LOCUS_13730 3571 3188 gene locus_tag LOCUS_13740 gene panD 3571 3188 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856284.1 protein_id gnl|my_center|LOCUS_13740 4189 3752 gene locus_tag LOCUS_13750 4189 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4470 4931 gene locus_tag LOCUS_13760 gene mraZ 4470 4931 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305730.1 protein_id gnl|my_center|LOCUS_13760 5022 6026 gene locus_tag LOCUS_13770 gene rsmH 5022 6026 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707587.1 protein_id gnl|my_center|LOCUS_13770 6023 6361 gene locus_tag LOCUS_13780 gene ftsL 6023 6361 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210441.1 protein_id gnl|my_center|LOCUS_13780 6339 8351 gene locus_tag LOCUS_13790 6339 8351 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707586.1 protein_id gnl|my_center|LOCUS_13790 8348 9910 gene locus_tag LOCUS_13800 gene murE 8348 9910 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775100.1 protein_id gnl|my_center|LOCUS_13800 9996 11363 gene locus_tag LOCUS_13810 gene murF 9996 11363 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707584.1 protein_id gnl|my_center|LOCUS_13810 11364 12446 gene locus_tag LOCUS_13820 gene mraY 11364 12446 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707583.1 protein_id gnl|my_center|LOCUS_13820 12459 13829 gene locus_tag LOCUS_13830 gene murD 12459 13829 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707582.1 protein_id gnl|my_center|LOCUS_13830 13826 16042 gene locus_tag LOCUS_13840 13826 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 16056 17201 gene locus_tag LOCUS_13850 gene murG 16056 17201 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073900.1 protein_id gnl|my_center|LOCUS_13850 17239 18681 gene locus_tag LOCUS_13860 gene murC 17239 18681 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635950.1 protein_id gnl|my_center|LOCUS_13860 18761 19798 gene locus_tag LOCUS_13870 18761 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 19779 21050 gene locus_tag LOCUS_13880 gene ftsA 19779 21050 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305690.1 protein_id gnl|my_center|LOCUS_13880 21242 22537 gene locus_tag LOCUS_13890 gene ftsZ 21242 22537 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497096.1 protein_id gnl|my_center|LOCUS_13890 22658 23320 gene locus_tag LOCUS_13900 gene ung 22658 23320 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262720.1 protein_id gnl|my_center|LOCUS_13900 23349 24962 gene locus_tag LOCUS_13910 23349 24962 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_13910 25763 26707 gene locus_tag LOCUS_13920 gene lpxC 25763 26707 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707578.1 protein_id gnl|my_center|LOCUS_13920 26773 28284 gene locus_tag LOCUS_13930 gene putP 26773 28284 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211164.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence38 2644 1007 gene locus_tag LOCUS_13940 gene groL 2644 1007 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729136.1 protein_id gnl|my_center|LOCUS_13940 2958 2665 gene locus_tag LOCUS_13950 2958 2665 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309514.1 protein_id gnl|my_center|LOCUS_13950 3225 5012 gene locus_tag LOCUS_13960 3225 5012 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704735.1 protein_id gnl|my_center|LOCUS_13960 6962 5553 gene locus_tag LOCUS_13970 6962 5553 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_13970 7754 7044 gene locus_tag LOCUS_13980 7754 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 9409 7751 gene locus_tag LOCUS_13990 9409 7751 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818210.1 protein_id gnl|my_center|LOCUS_13990 10721 9558 gene locus_tag LOCUS_14000 gene pseC 10721 9558 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707809.1 protein_id gnl|my_center|LOCUS_14000 11784 10771 gene locus_tag LOCUS_14010 gene pseB 11784 10771 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 protein_id gnl|my_center|LOCUS_14010 14913 11824 gene locus_tag LOCUS_14020 14913 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 16099 15119 gene locus_tag LOCUS_14030 gene flaB 16099 15119 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705589.1 protein_id gnl|my_center|LOCUS_14030 16612 16340 gene locus_tag LOCUS_14040 16612 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 17087 16872 gene locus_tag LOCUS_14050 17087 16872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 18445 17348 gene locus_tag LOCUS_14060 18445 17348 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420373.1 protein_id gnl|my_center|LOCUS_14060 19108 18602 gene locus_tag LOCUS_14070 19108 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 20469 19249 gene locus_tag LOCUS_14080 20469 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 22489 20480 gene locus_tag LOCUS_14090 22489 20480 CDS product flagellar basal body rod C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706635.1 protein_id gnl|my_center|LOCUS_14090 23729 22641 gene locus_tag LOCUS_14100 gene flgJ 23729 22641 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944830.1 protein_id gnl|my_center|LOCUS_14100 24866 23757 gene locus_tag LOCUS_14110 24866 23757 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706637.1 protein_id gnl|my_center|LOCUS_14110 25575 24883 gene locus_tag LOCUS_14120 gene flgH 25575 24883 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706638.1 protein_id gnl|my_center|LOCUS_14120 26728 25697 gene locus_tag LOCUS_14130 26728 25697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 27166 26933 gene locus_tag LOCUS_14140 27166 26933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence39 2656 176 gene locus_tag LOCUS_14150 gene feoB 2656 176 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 protein_id gnl|my_center|LOCUS_14150 3035 3886 gene locus_tag LOCUS_14160 3035 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4848 4126 gene locus_tag LOCUS_14170 4848 4126 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478504.1 protein_id gnl|my_center|LOCUS_14170 4756 5007 gene locus_tag LOCUS_14180 4756 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6245 5076 gene locus_tag LOCUS_14190 6245 5076 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_14190 7918 6785 gene locus_tag LOCUS_14200 gene tapU 7918 6785 CDS product type IVa pilus ATPase TapU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707390.1 protein_id gnl|my_center|LOCUS_14200 8896 7937 gene locus_tag LOCUS_14210 gene tapT 8896 7937 CDS product type IVa pilus ATPase TapT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707389.1 protein_id gnl|my_center|LOCUS_14210 9024 9734 gene locus_tag LOCUS_14220 gene yggS 9024 9734 CDS product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 protein_id gnl|my_center|LOCUS_14220 9802 10623 gene locus_tag LOCUS_14230 gene proC 9802 10623 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707387.1 protein_id gnl|my_center|LOCUS_14230 11444 10722 gene locus_tag LOCUS_14240 11444 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 12603 11689 gene locus_tag LOCUS_14250 12603 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 13659 12823 gene locus_tag LOCUS_14260 13659 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 13944 15734 gene locus_tag LOCUS_14270 13944 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 15742 16449 gene locus_tag LOCUS_14280 15742 16449 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866314.1 protein_id gnl|my_center|LOCUS_14280 16683 18320 gene locus_tag LOCUS_14290 gene nadB 16683 18320 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704743.1 protein_id gnl|my_center|LOCUS_14290 18468 20876 gene locus_tag LOCUS_14300 18468 20876 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704526.1 protein_id gnl|my_center|LOCUS_14300 21434 21078 gene locus_tag LOCUS_14310 21434 21078 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944750.1 protein_id gnl|my_center|LOCUS_14310 22234 21431 gene locus_tag LOCUS_14320 22234 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 23056 22241 gene locus_tag LOCUS_14330 23056 22241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 23832 23059 gene locus_tag LOCUS_14340 23832 23059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 24880 23843 gene locus_tag LOCUS_14350 24880 23843 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840860.1 protein_id gnl|my_center|LOCUS_14350 26010 24880 gene locus_tag LOCUS_14360 26010 24880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence40 177 368 gene locus_tag LOCUS_14370 177 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 539 868 gene locus_tag LOCUS_14380 539 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 798 1733 gene locus_tag LOCUS_14390 798 1733 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265914.1 protein_id gnl|my_center|LOCUS_14390 2320 1892 gene locus_tag LOCUS_14400 2320 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2381 2563 gene locus_tag LOCUS_14410 2381 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2574 3473 gene locus_tag LOCUS_14420 2574 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3698 7531 gene locus_tag LOCUS_14430 3698 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 8356 7619 gene locus_tag LOCUS_14440 8356 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 9050 8379 gene locus_tag LOCUS_14450 9050 8379 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 protein_id gnl|my_center|LOCUS_14450 9258 10643 gene locus_tag LOCUS_14460 9258 10643 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705975.1 protein_id gnl|my_center|LOCUS_14460 11312 10659 gene locus_tag LOCUS_14470 11312 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 11649 11317 gene locus_tag LOCUS_14480 11649 11317 CDS product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051681.1 protein_id gnl|my_center|LOCUS_14480 11819 12598 gene locus_tag LOCUS_14490 11819 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 12591 13421 gene locus_tag LOCUS_14500 12591 13421 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695943.1 protein_id gnl|my_center|LOCUS_14500 15167 13515 gene locus_tag LOCUS_14510 gene pgi 15167 13515 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704176.1 protein_id gnl|my_center|LOCUS_14510 17181 15559 gene locus_tag LOCUS_14520 17181 15559 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_14520 18509 17319 gene locus_tag LOCUS_14530 18509 17319 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_14530 19582 19061 gene locus_tag LOCUS_14540 19582 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 19775 19575 gene locus_tag LOCUS_14550 19775 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 20208 19717 gene locus_tag LOCUS_14560 20208 19717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 20584 20417 gene locus_tag LOCUS_14570 20584 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 20764 22143 gene locus_tag LOCUS_14580 20764 22143 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_14580 22999 22163 gene locus_tag LOCUS_14590 22999 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 23091 23624 gene locus_tag LOCUS_14600 23091 23624 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107759.1 protein_id gnl|my_center|LOCUS_14600 23642 24298 gene locus_tag LOCUS_14610 23642 24298 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211145.1 protein_id gnl|my_center|LOCUS_14610 25607 24324 gene locus_tag LOCUS_14620 25607 24324 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389377.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence41 71 1573 gene locus_tag LOCUS_14630 71 1573 CDS product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 protein_id gnl|my_center|LOCUS_14630 1869 2543 gene locus_tag LOCUS_14640 1869 2543 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_14640 2561 3736 gene locus_tag LOCUS_14650 2561 3736 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247498.1 protein_id gnl|my_center|LOCUS_14650 5023 3854 gene locus_tag LOCUS_14660 5023 3854 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_14660 6549 5221 gene locus_tag LOCUS_14670 gene cca 6549 5221 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708500.1 protein_id gnl|my_center|LOCUS_14670 7295 6660 gene locus_tag LOCUS_14680 7295 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 7508 7756 gene locus_tag LOCUS_14690 7508 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 8712 7771 gene locus_tag LOCUS_14700 8712 7771 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_14700 9243 8713 gene locus_tag LOCUS_14710 9243 8713 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_14710 9878 9240 gene locus_tag LOCUS_14720 gene pdxH 9878 9240 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705310.1 protein_id gnl|my_center|LOCUS_14720 10522 9881 gene locus_tag LOCUS_14730 10522 9881 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351085.1 protein_id gnl|my_center|LOCUS_14730 11109 10525 gene locus_tag LOCUS_14740 11109 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 12937 11300 gene locus_tag LOCUS_14750 12937 11300 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_14750 14340 13312 gene locus_tag LOCUS_14760 14340 13312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 14484 14696 gene locus_tag LOCUS_14770 14484 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 15179 14913 gene locus_tag LOCUS_14780 15179 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 15729 15490 gene locus_tag LOCUS_14790 15729 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 15913 17277 gene locus_tag LOCUS_14800 gene ppnN 15913 17277 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 protein_id gnl|my_center|LOCUS_14800 17862 17410 gene locus_tag LOCUS_14810 17862 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 18232 19281 gene locus_tag LOCUS_14820 18232 19281 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 protein_id gnl|my_center|LOCUS_14820 19386 20042 gene locus_tag LOCUS_14830 19386 20042 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_14830 22801 20063 gene locus_tag LOCUS_14840 22801 20063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 24877 23006 gene locus_tag LOCUS_14850 24877 23006 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707132.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence42 815 264 gene locus_tag LOCUS_14860 815 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 992 2059 gene locus_tag LOCUS_14870 992 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 2300 2890 gene locus_tag LOCUS_14880 2300 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 9986 3075 gene locus_tag LOCUS_14890 9986 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 10486 10298 gene locus_tag LOCUS_14900 10486 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 10430 11155 gene locus_tag LOCUS_14910 10430 11155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173843.1 protein_id gnl|my_center|LOCUS_14910 11152 12018 gene locus_tag LOCUS_14920 11152 12018 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391450.1 protein_id gnl|my_center|LOCUS_14920 11982 12881 gene locus_tag LOCUS_14930 11982 12881 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966160.1 protein_id gnl|my_center|LOCUS_14930 12895 13890 gene locus_tag LOCUS_14940 12895 13890 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_14940 14149 14074 gene locus_tag LOCUS_t00270 14149 14074 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15730 14246 gene locus_tag LOCUS_14950 gene hslU 15730 14246 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404390.1 protein_id gnl|my_center|LOCUS_14950 16335 15790 gene locus_tag LOCUS_14960 gene hslV 16335 15790 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306539.1 protein_id gnl|my_center|LOCUS_14960 17311 16394 gene locus_tag LOCUS_14970 17311 16394 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 protein_id gnl|my_center|LOCUS_14970 17710 18399 gene locus_tag LOCUS_14980 gene lexA 17710 18399 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_14980 19166 18513 gene locus_tag LOCUS_14990 gene pyrE 19166 18513 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_14990 19416 20285 gene locus_tag LOCUS_15000 19416 20285 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 protein_id gnl|my_center|LOCUS_15000 20441 21079 gene locus_tag LOCUS_15010 gene gmk 20441 21079 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348898.1 protein_id gnl|my_center|LOCUS_15010 21565 21191 gene locus_tag LOCUS_15020 21565 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 21704 22867 gene locus_tag LOCUS_15030 21704 22867 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 protein_id gnl|my_center|LOCUS_15030 24357 22840 gene locus_tag LOCUS_15040 gene gppA 24357 22840 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704128.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence43 323 1510 gene locus_tag LOCUS_15050 323 1510 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 protein_id gnl|my_center|LOCUS_15050 1657 2325 gene locus_tag LOCUS_15060 1657 2325 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206768.1 protein_id gnl|my_center|LOCUS_15060 2325 2747 gene locus_tag LOCUS_15070 2325 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2762 3709 gene locus_tag LOCUS_15080 2762 3709 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024407.1 protein_id gnl|my_center|LOCUS_15080 3687 4475 gene locus_tag LOCUS_15090 3687 4475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933420.1 protein_id gnl|my_center|LOCUS_15090 4888 4508 gene locus_tag LOCUS_15100 4888 4508 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_15100 5969 5031 gene locus_tag LOCUS_15110 5969 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 6932 6027 gene locus_tag LOCUS_15120 6932 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 7959 7081 gene locus_tag LOCUS_15130 7959 7081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 8965 7994 gene locus_tag LOCUS_15140 8965 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 9906 9091 gene locus_tag LOCUS_15150 9906 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 11187 10234 gene locus_tag LOCUS_15160 11187 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 11508 11846 gene locus_tag LOCUS_15170 11508 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 12252 13454 gene locus_tag LOCUS_15180 12252 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 13458 14552 gene locus_tag LOCUS_15190 13458 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 14683 15591 gene locus_tag LOCUS_15200 14683 15591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 15584 16507 gene locus_tag LOCUS_15210 15584 16507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 16744 16574 gene locus_tag LOCUS_15220 16744 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 16674 17627 gene locus_tag LOCUS_15230 16674 17627 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_15230 17648 18883 gene locus_tag LOCUS_15240 17648 18883 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 protein_id gnl|my_center|LOCUS_15240 18880 19299 gene locus_tag LOCUS_15250 18880 19299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 19765 19316 gene locus_tag LOCUS_15260 19765 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 20056 21678 gene locus_tag LOCUS_15270 20056 21678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107911.1 protein_id gnl|my_center|LOCUS_15270 21796 22896 gene locus_tag LOCUS_15280 21796 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence44 1296 100 gene locus_tag LOCUS_15290 1296 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1699 1307 gene locus_tag LOCUS_15300 1699 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5276 1905 gene locus_tag LOCUS_15310 5276 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 9862 5399 gene locus_tag LOCUS_15320 9862 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 10640 9852 gene locus_tag LOCUS_15330 10640 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12037 10664 gene locus_tag LOCUS_15340 gene tssK 12037 10664 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118739.1 protein_id gnl|my_center|LOCUS_15340 12605 12048 gene locus_tag LOCUS_15350 12605 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 12938 12648 gene locus_tag LOCUS_15360 12938 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 15581 12939 gene locus_tag LOCUS_15370 gene tssH 15581 12939 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_15370 16608 15574 gene locus_tag LOCUS_15380 gene tssG 16608 15574 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086369.1 protein_id gnl|my_center|LOCUS_15380 18398 16587 gene locus_tag LOCUS_15390 gene tssF 18398 16587 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925948.1 protein_id gnl|my_center|LOCUS_15390 18892 18395 gene locus_tag LOCUS_15400 18892 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 19453 18926 gene locus_tag LOCUS_15410 19453 18926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 20977 19484 gene locus_tag LOCUS_15420 gene tssC 20977 19484 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_15420 21513 20980 gene locus_tag LOCUS_15430 gene tssB 21513 20980 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_15430 22588 21524 gene locus_tag LOCUS_15440 gene tssA 22588 21524 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence45 967 437 gene locus_tag LOCUS_15450 967 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1691 1176 gene locus_tag LOCUS_15460 1691 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1863 2015 gene locus_tag LOCUS_15470 1863 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2002 3006 gene locus_tag LOCUS_15480 2002 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15480 2985 3290 gene locus_tag LOCUS_15490 2985 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3715 3401 gene locus_tag LOCUS_15500 3715 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 7568 3726 gene locus_tag LOCUS_15510 7568 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7948 9798 gene locus_tag LOCUS_15520 7948 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 10318 11472 gene locus_tag LOCUS_15530 10318 11472 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 protein_id gnl|my_center|LOCUS_15530 11665 12474 gene locus_tag LOCUS_15540 11665 12474 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301472.1 protein_id gnl|my_center|LOCUS_15540 12530 13678 gene locus_tag LOCUS_15550 gene tyrA 12530 13678 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 protein_id gnl|my_center|LOCUS_15550 14315 13788 gene locus_tag LOCUS_15560 14315 13788 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368552.1 protein_id gnl|my_center|LOCUS_15560 15431 14322 gene locus_tag LOCUS_15570 gene pheA 15431 14322 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815647.1 protein_id gnl|my_center|LOCUS_15570 15583 16230 gene locus_tag LOCUS_15580 15583 16230 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870965.1 protein_id gnl|my_center|LOCUS_15580 18758 17187 gene locus_tag LOCUS_15590 18758 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 19348 21471 gene locus_tag LOCUS_15600 19348 21471 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705455.1 protein_id gnl|my_center|LOCUS_15600 21645 22649 gene locus_tag LOCUS_15610 21645 22649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence46 160 300 gene locus_tag LOCUS_15620 160 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 479 1102 gene locus_tag LOCUS_15630 479 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1099 1569 gene locus_tag LOCUS_15640 1099 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1622 1816 gene locus_tag LOCUS_15650 1622 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 2660 3931 gene locus_tag LOCUS_15660 2660 3931 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_15660 4139 4462 gene locus_tag LOCUS_15670 4139 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 5346 4843 gene locus_tag LOCUS_15680 5346 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 8071 5816 gene locus_tag LOCUS_15690 8071 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 11315 8052 gene locus_tag LOCUS_15700 11315 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 11730 11320 gene locus_tag LOCUS_15710 11730 11320 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_15710 13241 11817 gene locus_tag LOCUS_15720 13241 11817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 14492 13440 gene locus_tag LOCUS_15730 14492 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 15277 14582 gene locus_tag LOCUS_15740 15277 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 17739 15484 gene locus_tag LOCUS_15750 17739 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 18004 18174 gene locus_tag LOCUS_15760 18004 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 19975 18401 gene locus_tag LOCUS_15770 19975 18401 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_15770 21887 20127 gene locus_tag LOCUS_15780 21887 20127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 22269 22490 gene locus_tag LOCUS_15790 22269 22490 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence47 1063 404 gene locus_tag LOCUS_15800 1063 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1295 1056 gene locus_tag LOCUS_15810 1295 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1750 2400 gene locus_tag LOCUS_15820 1750 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2382 2735 gene locus_tag LOCUS_15830 2382 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3466 3756 gene locus_tag LOCUS_15840 3466 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3876 4403 gene locus_tag LOCUS_15850 3876 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 4529 4813 gene locus_tag LOCUS_15860 4529 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4869 5417 gene locus_tag LOCUS_15870 4869 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 5654 6160 gene locus_tag LOCUS_15880 5654 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6195 6350 gene locus_tag LOCUS_15890 6195 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 6425 7006 gene locus_tag LOCUS_15900 6425 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 7103 7693 gene locus_tag LOCUS_15910 7103 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 7981 8976 gene locus_tag LOCUS_15920 7981 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 9171 9710 gene locus_tag LOCUS_15930 9171 9710 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_15930 10248 10478 gene locus_tag LOCUS_15940 10248 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 11178 10453 gene locus_tag LOCUS_15950 11178 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 11674 11297 gene locus_tag LOCUS_15960 gene mutT 11674 11297 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_15960 14833 11687 gene locus_tag LOCUS_15970 14833 11687 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 protein_id gnl|my_center|LOCUS_15970 15498 17333 gene locus_tag LOCUS_15980 15498 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 18226 17396 gene locus_tag LOCUS_15990 18226 17396 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061002828.1 protein_id gnl|my_center|LOCUS_15990 19374 18223 gene locus_tag LOCUS_16000 gene metK 19374 18223 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071209.1 protein_id gnl|my_center|LOCUS_16000 20473 19892 gene locus_tag LOCUS_16010 20473 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 21330 20749 gene locus_tag LOCUS_16020 21330 20749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence48 3765 265 gene locus_tag LOCUS_16030 3765 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 4304 3867 gene locus_tag LOCUS_16040 4304 3867 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173892.1 protein_id gnl|my_center|LOCUS_16040 4680 4453 gene locus_tag LOCUS_16050 gene rpsU 4680 4453 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309452.1 protein_id gnl|my_center|LOCUS_16050 4896 7181 gene locus_tag LOCUS_16060 4896 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 7269 8297 gene locus_tag LOCUS_16070 gene tsaD 7269 8297 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 protein_id gnl|my_center|LOCUS_16070 8290 9726 gene locus_tag LOCUS_16080 8290 9726 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819824.1 protein_id gnl|my_center|LOCUS_16080 9769 10926 gene locus_tag LOCUS_16090 9769 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 11008 11460 gene locus_tag LOCUS_16100 11008 11460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 11763 13106 gene locus_tag LOCUS_16110 11763 13106 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705061.1 protein_id gnl|my_center|LOCUS_16110 13113 14360 gene locus_tag LOCUS_16120 13113 14360 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705062.1 protein_id gnl|my_center|LOCUS_16120 14350 15147 gene locus_tag LOCUS_16130 14350 15147 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705063.1 protein_id gnl|my_center|LOCUS_16130 15147 15803 gene locus_tag LOCUS_16140 15147 15803 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303545.1 protein_id gnl|my_center|LOCUS_16140 15807 16403 gene locus_tag LOCUS_16150 gene nqrE 15807 16403 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401432.1 protein_id gnl|my_center|LOCUS_16150 16416 17639 gene locus_tag LOCUS_16160 gene nqrF 16416 17639 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225565.1 protein_id gnl|my_center|LOCUS_16160 17965 21537 gene locus_tag LOCUS_16170 17965 21537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 21540 21785 gene locus_tag LOCUS_16180 21540 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence49 148 238 gene locus_tag LOCUS_r00010 148 238 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 76 percent of the 5S ribosomal RNA 456 1535 gene locus_tag LOCUS_16190 456 1535 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_16190 3092 1671 gene locus_tag LOCUS_16200 gene phoA 3092 1671 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351506.1 protein_id gnl|my_center|LOCUS_16200 4606 3266 gene locus_tag LOCUS_16210 gene gdhA 4606 3266 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964055.1 protein_id gnl|my_center|LOCUS_16210 6025 5027 gene locus_tag LOCUS_16220 6025 5027 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706238.1 protein_id gnl|my_center|LOCUS_16220 8301 6118 gene locus_tag LOCUS_16230 gene recG 8301 6118 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 protein_id gnl|my_center|LOCUS_16230 9670 8303 gene locus_tag LOCUS_16240 gene pssA 9670 8303 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275564.1 protein_id gnl|my_center|LOCUS_16240 11620 9809 gene locus_tag LOCUS_16250 11620 9809 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704534.1 protein_id gnl|my_center|LOCUS_16250 13548 11638 gene locus_tag LOCUS_16260 13548 11638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 14488 13538 gene locus_tag LOCUS_16270 gene ribF 14488 13538 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704642.1 protein_id gnl|my_center|LOCUS_16270 16095 14488 gene locus_tag LOCUS_16280 gene murJ 16095 14488 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 protein_id gnl|my_center|LOCUS_16280 16304 16585 gene locus_tag LOCUS_16290 gene rpsT 16304 16585 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518655.1 protein_id gnl|my_center|LOCUS_16290 17013 18953 gene locus_tag LOCUS_16300 17013 18953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence50 966 2156 gene locus_tag LOCUS_16310 gene malE 966 2156 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_16310 2362 3324 gene locus_tag LOCUS_16320 gene rfaD 2362 3324 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707885.1 protein_id gnl|my_center|LOCUS_16320 5508 3376 gene locus_tag LOCUS_16330 5508 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 6591 5524 gene locus_tag LOCUS_16340 gene traU 6591 5524 CDS product conjugal transfer pilus assembly protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830838.1 protein_id gnl|my_center|LOCUS_16340 7480 6575 gene locus_tag LOCUS_16350 7480 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 8046 7558 gene locus_tag LOCUS_16360 8046 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 8681 9805 gene locus_tag LOCUS_16370 8681 9805 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_16370 9814 11442 gene locus_tag LOCUS_16380 9814 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 12333 11479 gene locus_tag LOCUS_16390 12333 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 12555 13451 gene locus_tag LOCUS_16400 12555 13451 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_16400 15973 13508 gene locus_tag LOCUS_16410 15973 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 19938 15970 gene locus_tag LOCUS_16420 19938 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 20313 20738 gene locus_tag LOCUS_16430 20313 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 20827 21180 gene locus_tag LOCUS_16440 20827 21180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 21212 21637 gene locus_tag LOCUS_16450 21212 21637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence51 475 92 gene locus_tag LOCUS_16460 475 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1248 478 gene locus_tag LOCUS_16470 gene pstB 1248 478 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_16470 2048 1245 gene locus_tag LOCUS_16480 gene pstA 2048 1245 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_16480 3003 2131 gene locus_tag LOCUS_16490 gene pstC 3003 2131 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073954.1 protein_id gnl|my_center|LOCUS_16490 3893 3081 gene locus_tag LOCUS_16500 3893 3081 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_16500 4871 4155 gene locus_tag LOCUS_16510 gene tsaB 4871 4155 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220966.1 protein_id gnl|my_center|LOCUS_16510 7192 4964 gene locus_tag LOCUS_16520 7192 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 7227 9197 gene locus_tag LOCUS_16530 7227 9197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 9708 9484 gene locus_tag LOCUS_16540 9708 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10016 9735 gene locus_tag LOCUS_16550 10016 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 10279 10043 gene locus_tag LOCUS_16560 10279 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 12213 10618 gene locus_tag LOCUS_16570 gene purH 12213 10618 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057885.1 protein_id gnl|my_center|LOCUS_16570 13074 12352 gene locus_tag LOCUS_16580 13074 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 14273 13260 gene locus_tag LOCUS_16590 14273 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 15089 14319 gene locus_tag LOCUS_16600 15089 14319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 15720 15094 gene locus_tag LOCUS_16610 15720 15094 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_16610 16377 15748 gene locus_tag LOCUS_16620 16377 15748 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704775.1 protein_id gnl|my_center|LOCUS_16620 16858 16370 gene locus_tag LOCUS_16630 gene ispF 16858 16370 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 protein_id gnl|my_center|LOCUS_16630 17608 16910 gene locus_tag LOCUS_16640 gene ispD 17608 16910 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704771.1 protein_id gnl|my_center|LOCUS_16640 17879 17598 gene locus_tag LOCUS_16650 gene ftsB 17879 17598 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209390.1 protein_id gnl|my_center|LOCUS_16650 18640 18098 gene locus_tag LOCUS_16660 18640 18098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 18904 18662 gene locus_tag LOCUS_16670 18904 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 19465 18923 gene locus_tag LOCUS_16680 19465 18923 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_16680 <20317 19606 gene locus_tag LOCUS_16690 <20317 19606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705588.1:flagellin A >Feature sequence52 323 129 gene locus_tag LOCUS_16700 323 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 647 390 gene locus_tag LOCUS_16710 647 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 817 1716 gene locus_tag LOCUS_16720 817 1716 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_16720 2174 3493 gene locus_tag LOCUS_16730 2174 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3583 4416 gene locus_tag LOCUS_16740 gene amrS 3583 4416 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964730.1 protein_id gnl|my_center|LOCUS_16740 4426 5838 gene locus_tag LOCUS_16750 gene amrA 4426 5838 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964729.1 protein_id gnl|my_center|LOCUS_16750 8290 5939 gene locus_tag LOCUS_16760 8290 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 8734 8441 gene locus_tag LOCUS_16770 8734 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 9785 9003 gene locus_tag LOCUS_16780 9785 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031057.1 protein_id gnl|my_center|LOCUS_16780 10041 10394 gene locus_tag LOCUS_16790 10041 10394 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_16790 10728 11000 gene locus_tag LOCUS_16800 10728 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 10997 11398 gene locus_tag LOCUS_16810 10997 11398 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_16810 13132 11765 gene locus_tag LOCUS_16820 gene purB 13132 11765 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423489.1 protein_id gnl|my_center|LOCUS_16820 13795 13175 gene locus_tag LOCUS_16830 gene hflD 13795 13175 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295971.1 protein_id gnl|my_center|LOCUS_16830 15005 13788 gene locus_tag LOCUS_16840 gene mnmA 15005 13788 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005022119.1 protein_id gnl|my_center|LOCUS_16840 18845 15141 gene locus_tag LOCUS_16850 18845 15141 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680859.1 protein_id gnl|my_center|LOCUS_16850 19598 19254 gene locus_tag LOCUS_16860 19598 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence53 267 1532 gene locus_tag LOCUS_16870 gene pepT 267 1532 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_16870 1602 2411 gene locus_tag LOCUS_16880 1602 2411 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940517.1 protein_id gnl|my_center|LOCUS_16880 3995 2595 gene locus_tag LOCUS_16890 gene asnS 3995 2595 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705384.1 protein_id gnl|my_center|LOCUS_16890 5673 4090 gene locus_tag LOCUS_16900 5673 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 5843 6793 gene locus_tag LOCUS_16910 gene corA 5843 6793 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705843.1 protein_id gnl|my_center|LOCUS_16910 6922 8298 gene locus_tag LOCUS_16920 6922 8298 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868907.1 protein_id gnl|my_center|LOCUS_16920 8302 10674 gene locus_tag LOCUS_16930 8302 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 10685 11926 gene locus_tag LOCUS_16940 10685 11926 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874223.1 protein_id gnl|my_center|LOCUS_16940 12009 13223 gene locus_tag LOCUS_16950 gene fabB 12009 13223 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705793.1 protein_id gnl|my_center|LOCUS_16950 13298 14047 gene locus_tag LOCUS_16960 gene rsuA 13298 14047 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706653.1 protein_id gnl|my_center|LOCUS_16960 14917 14021 gene locus_tag LOCUS_16970 14917 14021 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533894.1 protein_id gnl|my_center|LOCUS_16970 15276 14923 gene locus_tag LOCUS_16980 15276 14923 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_16980 15359 15730 gene locus_tag LOCUS_16990 15359 15730 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_16990 15873 17225 gene locus_tag LOCUS_17000 gene lysC 15873 17225 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706390.1 protein_id gnl|my_center|LOCUS_17000 18684 17419 gene locus_tag LOCUS_17010 gene argA 18684 17419 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706389.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence54 1206 22 gene locus_tag LOCUS_17020 gene malE 1206 22 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_17020 2507 1677 gene locus_tag LOCUS_17030 2507 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17030 2859 2545 gene locus_tag LOCUS_17040 2859 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17040 3331 5172 gene locus_tag LOCUS_17050 3331 5172 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705555.1 protein_id gnl|my_center|LOCUS_17050 5223 6065 gene locus_tag LOCUS_17060 5223 6065 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705224.1 protein_id gnl|my_center|LOCUS_17060 6097 7578 gene locus_tag LOCUS_17070 6097 7578 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350322.1 protein_id gnl|my_center|LOCUS_17070 8300 7605 gene locus_tag LOCUS_17080 gene hda 8300 7605 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205596950.1 protein_id gnl|my_center|LOCUS_17080 12863 8559 gene locus_tag LOCUS_17090 12863 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 13563 12979 gene locus_tag LOCUS_17100 13563 12979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 13917 16004 gene locus_tag LOCUS_17110 gene pta 13917 16004 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 protein_id gnl|my_center|LOCUS_17110 16098 17333 gene locus_tag LOCUS_17120 16098 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 18780 17380 gene locus_tag LOCUS_17130 18780 17380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence55 301 2085 gene locus_tag LOCUS_17140 301 2085 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_17140 2370 2654 gene locus_tag LOCUS_17150 2370 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2719 2937 gene locus_tag LOCUS_17160 2719 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 5372 3099 gene locus_tag LOCUS_17170 gene metE 5372 3099 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108255.1 protein_id gnl|my_center|LOCUS_17170 5991 5542 gene locus_tag LOCUS_17180 5991 5542 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226425.1 protein_id gnl|my_center|LOCUS_17180 6278 6057 gene locus_tag LOCUS_17190 6278 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 6296 7546 gene locus_tag LOCUS_17200 gene icd 6296 7546 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705065.1 protein_id gnl|my_center|LOCUS_17200 8951 8052 gene locus_tag LOCUS_17210 gene prmA 8951 8052 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675412.1 protein_id gnl|my_center|LOCUS_17210 9490 9029 gene locus_tag LOCUS_17220 9490 9029 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_17220 10019 9510 gene locus_tag LOCUS_17230 10019 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11564 10140 gene locus_tag LOCUS_17240 gene rarA 11564 10140 CDS product replication-associated recombination protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067785.1 protein_id gnl|my_center|LOCUS_17240 12184 11561 gene locus_tag LOCUS_17250 gene lolA 12184 11561 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261566.1 protein_id gnl|my_center|LOCUS_17250 15763 12242 gene locus_tag LOCUS_17260 15763 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 15919 16878 gene locus_tag LOCUS_17270 gene trxB 15919 16878 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114229.1 protein_id gnl|my_center|LOCUS_17270 17594 16962 gene locus_tag LOCUS_17280 17594 16962 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052627.1 protein_id gnl|my_center|LOCUS_17280 18105 17704 gene locus_tag LOCUS_17290 18105 17704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence56 526 1710 gene locus_tag LOCUS_17300 gene malE 526 1710 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705558.1 protein_id gnl|my_center|LOCUS_17300 1815 3494 gene locus_tag LOCUS_17310 gene malF 1815 3494 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705559.1 protein_id gnl|my_center|LOCUS_17310 3510 4751 gene locus_tag LOCUS_17320 3510 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4837 5973 gene locus_tag LOCUS_17330 gene ugpC 4837 5973 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705560.1 protein_id gnl|my_center|LOCUS_17330 6125 6778 gene locus_tag LOCUS_17340 6125 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17340 6788 7741 gene locus_tag LOCUS_17350 6788 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 8223 8651 gene locus_tag LOCUS_17360 8223 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 9590 10699 gene locus_tag LOCUS_17370 gene queA 9590 10699 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482995.1 protein_id gnl|my_center|LOCUS_17370 10701 11816 gene locus_tag LOCUS_17380 gene tgt 10701 11816 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768200.1 protein_id gnl|my_center|LOCUS_17380 11878 12300 gene locus_tag LOCUS_17390 11878 12300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 12329 14188 gene locus_tag LOCUS_17400 gene secD 12329 14188 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_17400 14207 15166 gene locus_tag LOCUS_17410 gene secF 14207 15166 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705626.1 protein_id gnl|my_center|LOCUS_17410 15375 16280 gene locus_tag LOCUS_17420 gene nlpI 15375 16280 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802076.1 protein_id gnl|my_center|LOCUS_17420 16333 17496 gene locus_tag LOCUS_17430 16333 17496 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868979.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence57 680 1633 gene locus_tag LOCUS_17440 680 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1715 2374 gene locus_tag LOCUS_17450 1715 2374 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_17450 2718 2987 gene locus_tag LOCUS_17460 2718 2987 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_17460 3050 3331 gene locus_tag LOCUS_17470 3050 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3422 3706 gene locus_tag LOCUS_17480 3422 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3760 4038 gene locus_tag LOCUS_17490 3760 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5046 4153 gene locus_tag LOCUS_17500 5046 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5425 6654 gene locus_tag LOCUS_17510 5425 6654 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_17510 7082 8050 gene locus_tag LOCUS_17520 7082 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 7933 8163 gene locus_tag LOCUS_17530 7933 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 9802 8222 gene locus_tag LOCUS_17540 9802 8222 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_17540 10213 11004 gene locus_tag LOCUS_17550 gene mlaF 10213 11004 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210121.1 protein_id gnl|my_center|LOCUS_17550 11004 11783 gene locus_tag LOCUS_17560 gene mlaE 11004 11783 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 protein_id gnl|my_center|LOCUS_17560 11791 12381 gene locus_tag LOCUS_17570 gene mlaD 11791 12381 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187994.1 protein_id gnl|my_center|LOCUS_17570 12387 13025 gene locus_tag LOCUS_17580 gene mlaC 12387 13025 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707621.1 protein_id gnl|my_center|LOCUS_17580 13022 13288 gene locus_tag LOCUS_17590 13022 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 13351 14607 gene locus_tag LOCUS_17600 gene murA 13351 14607 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707623.1 protein_id gnl|my_center|LOCUS_17600 14615 15649 gene locus_tag LOCUS_17610 gene murB 14615 15649 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593527.1 protein_id gnl|my_center|LOCUS_17610 15706 16680 gene locus_tag LOCUS_17620 gene birA 15706 16680 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_17620 16712 17491 gene locus_tag LOCUS_17630 16712 17491 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence58 2077 260 gene locus_tag LOCUS_17640 2077 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3153 2173 gene locus_tag LOCUS_17650 gene ispB 3153 2173 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479642.1 protein_id gnl|my_center|LOCUS_17650 3402 3710 gene locus_tag LOCUS_17660 gene rplU 3402 3710 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_17660 3732 4004 gene locus_tag LOCUS_17670 gene rpmA 3732 4004 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339028.1 protein_id gnl|my_center|LOCUS_17670 4071 5237 gene locus_tag LOCUS_17680 gene cgtA 4071 5237 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704870.1 protein_id gnl|my_center|LOCUS_17680 5234 6028 gene locus_tag LOCUS_17690 5234 6028 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_17690 6028 6495 gene locus_tag LOCUS_17700 6028 6495 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707143.1 protein_id gnl|my_center|LOCUS_17700 6588 7112 gene locus_tag LOCUS_17710 6588 7112 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769725.1 protein_id gnl|my_center|LOCUS_17710 7997 7167 gene locus_tag LOCUS_17720 gene apaH 7997 7167 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480531.1 protein_id gnl|my_center|LOCUS_17720 8812 7982 gene locus_tag LOCUS_17730 gene rsmA 8812 7982 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459622.1 protein_id gnl|my_center|LOCUS_17730 9810 8809 gene locus_tag LOCUS_17740 gene pdxA 9810 8809 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 protein_id gnl|my_center|LOCUS_17740 11114 9807 gene locus_tag LOCUS_17750 gene surA 11114 9807 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704881.1 protein_id gnl|my_center|LOCUS_17750 13461 11134 gene locus_tag LOCUS_17760 gene lptD 13461 11134 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704882.1 protein_id gnl|my_center|LOCUS_17760 13403 13687 gene locus_tag LOCUS_17770 13403 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 13796 14752 gene locus_tag LOCUS_17780 13796 14752 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704883.1 protein_id gnl|my_center|LOCUS_17780 14752 15462 gene locus_tag LOCUS_17790 14752 15462 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_17790 15532 16551 gene locus_tag LOCUS_17800 15532 16551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence59 267 410 gene locus_tag LOCUS_17810 267 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1727 465 gene locus_tag LOCUS_17820 1727 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2365 1724 gene locus_tag LOCUS_17830 2365 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422308.1 protein_id gnl|my_center|LOCUS_17830 6289 2366 gene locus_tag LOCUS_17840 6289 2366 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073731.1 protein_id gnl|my_center|LOCUS_17840 6644 6799 gene locus_tag LOCUS_17850 6644 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 6856 7065 gene locus_tag LOCUS_17860 6856 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7229 7471 gene locus_tag LOCUS_17870 7229 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 7600 7872 gene locus_tag LOCUS_17880 7600 7872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 7922 8104 gene locus_tag LOCUS_17890 7922 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 9929 8130 gene locus_tag LOCUS_17900 9929 8130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10262 10753 gene locus_tag LOCUS_17910 10262 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 11218 12552 gene locus_tag LOCUS_17920 11218 12552 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_17920 12650 12952 gene locus_tag LOCUS_17930 12650 12952 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_17930 13907 13104 gene locus_tag LOCUS_17940 13907 13104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 14285 14043 gene locus_tag LOCUS_17950 14285 14043 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679671.1 protein_id gnl|my_center|LOCUS_17950 14811 14362 gene locus_tag LOCUS_17960 14811 14362 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 protein_id gnl|my_center|LOCUS_17960 15035 15820 gene locus_tag LOCUS_17970 15035 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 15828 16304 gene locus_tag LOCUS_17980 15828 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17980 >Feature sequence60 263 123 gene locus_tag LOCUS_17990 263 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 496 4752 gene locus_tag LOCUS_18000 496 4752 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812165.1 protein_id gnl|my_center|LOCUS_18000 6176 4788 gene locus_tag LOCUS_18010 6176 4788 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_18010 6478 6741 gene locus_tag LOCUS_18020 6478 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 8755 6845 gene locus_tag LOCUS_18030 8755 6845 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18030 9004 8780 gene locus_tag LOCUS_18040 9004 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 9243 9620 gene locus_tag LOCUS_18050 9243 9620 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393689.1 protein_id gnl|my_center|LOCUS_18050 9798 10481 gene locus_tag LOCUS_18060 9798 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 10608 11651 gene locus_tag LOCUS_18070 10608 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 11648 13084 gene locus_tag LOCUS_18080 11648 13084 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175404606.1 protein_id gnl|my_center|LOCUS_18080 13081 15408 gene locus_tag LOCUS_18090 13081 15408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 15543 15938 gene locus_tag LOCUS_18100 15543 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence61 633 400 gene locus_tag LOCUS_18110 633 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 902 621 gene locus_tag LOCUS_18120 902 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 1328 1110 gene locus_tag LOCUS_18130 1328 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1493 1849 gene locus_tag LOCUS_18140 1493 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2184 2618 gene locus_tag LOCUS_18150 2184 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2608 3711 gene locus_tag LOCUS_18160 2608 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 3742 4254 gene locus_tag LOCUS_18170 3742 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 4506 5456 gene locus_tag LOCUS_18180 4506 5456 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_18180 6223 5453 gene locus_tag LOCUS_18190 6223 5453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_18190 7009 6233 gene locus_tag LOCUS_18200 7009 6233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_18200 7991 6993 gene locus_tag LOCUS_18210 7991 6993 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393471.1 protein_id gnl|my_center|LOCUS_18210 9907 7982 gene locus_tag LOCUS_18220 gene cooS 9907 7982 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768251.1 protein_id gnl|my_center|LOCUS_18220 9923 10090 gene locus_tag LOCUS_18230 9923 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 10516 10833 gene locus_tag LOCUS_18240 10516 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18240 10960 11841 gene locus_tag LOCUS_18250 10960 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18250 13248 12184 gene locus_tag LOCUS_18260 13248 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 13132 13344 gene locus_tag LOCUS_18270 13132 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 13580 13431 gene locus_tag LOCUS_18280 13580 13431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 14115 13582 gene locus_tag LOCUS_18290 14115 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 15408 14161 gene locus_tag LOCUS_18300 15408 14161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence62 348 1112 gene locus_tag LOCUS_18310 gene moeB 348 1112 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_18310 1587 1126 gene locus_tag LOCUS_18320 1587 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2769 1597 gene locus_tag LOCUS_18330 2769 1597 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301690.1 protein_id gnl|my_center|LOCUS_18330 3110 2766 gene locus_tag LOCUS_18340 3110 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 3777 3097 gene locus_tag LOCUS_18350 3777 3097 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707163.1 protein_id gnl|my_center|LOCUS_18350 4766 3825 gene locus_tag LOCUS_18360 gene ispH 4766 3825 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166426.1 protein_id gnl|my_center|LOCUS_18360 5350 4763 gene locus_tag LOCUS_18370 gene lspA 5350 4763 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266581.1 protein_id gnl|my_center|LOCUS_18370 8229 5404 gene locus_tag LOCUS_18380 gene ileS 8229 5404 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488695.1 protein_id gnl|my_center|LOCUS_18380 9940 8687 gene locus_tag LOCUS_18390 9940 8687 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_18390 13311 10642 gene locus_tag LOCUS_18400 13311 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 13836 15389 gene locus_tag LOCUS_18410 13836 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 15408 15611 gene locus_tag LOCUS_18420 15408 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence63 447 671 gene locus_tag LOCUS_18430 447 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 740 1027 gene locus_tag LOCUS_18440 740 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2914 1139 gene locus_tag LOCUS_18450 2914 1139 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_18450 4099 3023 gene locus_tag LOCUS_18460 4099 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 4074 4292 gene locus_tag LOCUS_18470 4074 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 4540 6000 gene locus_tag LOCUS_18480 gene modF 4540 6000 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704776.1 protein_id gnl|my_center|LOCUS_18480 6986 6153 gene locus_tag LOCUS_18490 6986 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 7405 7103 gene locus_tag LOCUS_18500 7405 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 8538 7438 gene locus_tag LOCUS_18510 8538 7438 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707032.1 protein_id gnl|my_center|LOCUS_18510 8525 8809 gene locus_tag LOCUS_18520 8525 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 9793 8921 gene locus_tag LOCUS_18530 9793 8921 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 protein_id gnl|my_center|LOCUS_18530 10807 9794 gene locus_tag LOCUS_18540 gene mltB 10807 9794 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 protein_id gnl|my_center|LOCUS_18540 11904 10804 gene locus_tag LOCUS_18550 gene rodA 11904 10804 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818663.1 protein_id gnl|my_center|LOCUS_18550 14006 12039 gene locus_tag LOCUS_18560 gene mrdA 14006 12039 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707027.1 protein_id gnl|my_center|LOCUS_18560 14480 14010 gene locus_tag LOCUS_18570 gene rlmH 14480 14010 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 protein_id gnl|my_center|LOCUS_18570 15114 15419 gene locus_tag LOCUS_18580 15114 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence64 330 1367 gene locus_tag LOCUS_18590 gene asnA 330 1367 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_18590 2267 1461 gene locus_tag LOCUS_18600 2267 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3277 2348 gene locus_tag LOCUS_18610 3277 2348 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_18610 4541 3444 gene locus_tag LOCUS_18620 gene queG 4541 3444 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964745.1 protein_id gnl|my_center|LOCUS_18620 4555 6039 gene locus_tag LOCUS_18630 gene nnr 4555 6039 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418520.1 protein_id gnl|my_center|LOCUS_18630 6092 6550 gene locus_tag LOCUS_18640 gene tsaE 6092 6550 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 protein_id gnl|my_center|LOCUS_18640 6670 8244 gene locus_tag LOCUS_18650 6670 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 8285 8635 gene locus_tag LOCUS_18660 8285 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 10338 8755 gene locus_tag LOCUS_18670 gene lnt 10338 8755 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 protein_id gnl|my_center|LOCUS_18670 10931 10347 gene locus_tag LOCUS_18680 10931 10347 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707437.1 protein_id gnl|my_center|LOCUS_18680 12729 10954 gene locus_tag LOCUS_18690 12729 10954 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_18690 13552 12731 gene locus_tag LOCUS_18700 gene yidA 13552 12731 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065596971.1 protein_id gnl|my_center|LOCUS_18700 14853 13552 gene locus_tag LOCUS_18710 gene purD 14853 13552 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866800.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence65 627 334 gene locus_tag LOCUS_18720 627 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1848 823 gene locus_tag LOCUS_18730 1848 823 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_18730 2444 1851 gene locus_tag LOCUS_18740 2444 1851 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203248.1 protein_id gnl|my_center|LOCUS_18740 2679 2398 gene locus_tag LOCUS_18750 2679 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2936 4261 gene locus_tag LOCUS_18760 gene miaB 2936 4261 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 protein_id gnl|my_center|LOCUS_18760 4389 5474 gene locus_tag LOCUS_18770 4389 5474 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490838.1 protein_id gnl|my_center|LOCUS_18770 5471 5938 gene locus_tag LOCUS_18780 gene ybeY 5471 5938 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158419.1 protein_id gnl|my_center|LOCUS_18780 6027 7031 gene locus_tag LOCUS_18790 gene corC 6027 7031 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418183.1 protein_id gnl|my_center|LOCUS_18790 8313 7201 gene locus_tag LOCUS_18800 8313 7201 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_18800 9855 8797 gene locus_tag LOCUS_18810 9855 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 11713 9935 gene locus_tag LOCUS_18820 gene msbA 11713 9935 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_18820 12008 12682 gene locus_tag LOCUS_18830 12008 12682 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647270.1 protein_id gnl|my_center|LOCUS_18830 12685 13947 gene locus_tag LOCUS_18840 12685 13947 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707483.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence66 621 2093 gene locus_tag LOCUS_18850 621 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2395 2709 gene locus_tag LOCUS_18860 2395 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 3205 2750 gene locus_tag LOCUS_18870 3205 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 4119 5192 gene locus_tag LOCUS_18880 4119 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 5264 5539 gene locus_tag LOCUS_18890 5264 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 6047 7285 gene locus_tag LOCUS_18900 6047 7285 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_18900 7405 8628 gene locus_tag LOCUS_18910 7405 8628 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707147.1 protein_id gnl|my_center|LOCUS_18910 8730 10637 gene locus_tag LOCUS_18920 8730 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 10634 11338 gene locus_tag LOCUS_18930 gene ftsE 10634 11338 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369317.1 protein_id gnl|my_center|LOCUS_18930 11335 12294 gene locus_tag LOCUS_18940 gene ftsX 11335 12294 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704350.1 protein_id gnl|my_center|LOCUS_18940 12303 13220 gene locus_tag LOCUS_18950 gene rpoH 12303 13220 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490420.1 protein_id gnl|my_center|LOCUS_18950 13493 14143 gene locus_tag LOCUS_18960 13493 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence67 215 859 gene locus_tag LOCUS_18970 gene adk 215 859 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 protein_id gnl|my_center|LOCUS_18970 1742 921 gene locus_tag LOCUS_18980 1742 921 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705748.1 protein_id gnl|my_center|LOCUS_18980 2756 1767 gene locus_tag LOCUS_18990 2756 1767 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705749.1 protein_id gnl|my_center|LOCUS_18990 3648 2743 gene locus_tag LOCUS_19000 gene sapC 3648 2743 CDS product peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210971.1 protein_id gnl|my_center|LOCUS_19000 4598 3645 gene locus_tag LOCUS_19010 4598 3645 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705751.1 protein_id gnl|my_center|LOCUS_19010 6042 4591 gene locus_tag LOCUS_19020 gene sapA 6042 4591 CDS product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819989.1 protein_id gnl|my_center|LOCUS_19020 6041 6241 gene locus_tag LOCUS_19030 6041 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6425 6988 gene locus_tag LOCUS_19040 6425 6988 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_19040 7089 8135 gene locus_tag LOCUS_19050 7089 8135 CDS product TerY-C metal binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253656.1 protein_id gnl|my_center|LOCUS_19050 8226 9656 gene locus_tag LOCUS_19060 8226 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 9735 12878 gene locus_tag LOCUS_19070 9735 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 12978 14054 gene locus_tag LOCUS_19080 gene bioB 12978 14054 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence68 1417 296 gene locus_tag LOCUS_19090 gene proB 1417 296 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285281.1 protein_id gnl|my_center|LOCUS_19090 2643 1423 gene locus_tag LOCUS_19100 gene frsA 2643 1423 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707188.1 protein_id gnl|my_center|LOCUS_19100 2787 3776 gene locus_tag LOCUS_19110 2787 3776 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 protein_id gnl|my_center|LOCUS_19110 4017 5501 gene locus_tag LOCUS_19120 4017 5501 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_19120 5292 5307 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5498 5656 gene locus_tag LOCUS_19130 5498 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 5840 6091 gene locus_tag LOCUS_19140 5840 6091 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_19140 6259 6444 gene locus_tag LOCUS_19150 6259 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 6646 7962 gene locus_tag LOCUS_19160 6646 7962 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_19160 8319 8101 gene locus_tag LOCUS_19170 8319 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 8775 8320 gene locus_tag LOCUS_19180 8775 8320 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803082.1 protein_id gnl|my_center|LOCUS_19180 9033 8806 gene locus_tag LOCUS_19190 9033 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 11359 9371 gene locus_tag LOCUS_19200 gene tkt 11359 9371 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706909.1 protein_id gnl|my_center|LOCUS_19200 12657 11563 gene locus_tag LOCUS_19210 12657 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence69 1132 527 gene locus_tag LOCUS_19220 1132 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1308 1595 gene locus_tag LOCUS_19230 1308 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 1817 2071 gene locus_tag LOCUS_19240 1817 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3231 2452 gene locus_tag LOCUS_19250 3231 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4421 5725 gene locus_tag LOCUS_19260 4421 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 7006 5852 gene locus_tag LOCUS_19270 gene recA 7006 5852 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707431.1 protein_id gnl|my_center|LOCUS_19270 7722 7231 gene locus_tag LOCUS_19280 gene pncC 7722 7231 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098439.1 protein_id gnl|my_center|LOCUS_19280 7789 10377 gene locus_tag LOCUS_19290 gene mutS 7789 10377 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707433.1 protein_id gnl|my_center|LOCUS_19290 10577 11926 gene locus_tag LOCUS_19300 10577 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence70 430 2415 gene locus_tag LOCUS_19310 gene rpoD 430 2415 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001519776.1 protein_id gnl|my_center|LOCUS_19310 2916 4934 gene locus_tag LOCUS_19320 gene rpoD 2916 4934 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704782.1 protein_id gnl|my_center|LOCUS_19320 5150 5226 gene locus_tag LOCUS_t00280 5150 5226 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5391 6662 gene locus_tag LOCUS_19330 gene lde 5391 6662 CDS product multidrug efflux MFS transporter Lde inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990057.1 protein_id gnl|my_center|LOCUS_19330 6881 7426 gene locus_tag LOCUS_19340 6881 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 7836 8270 gene locus_tag LOCUS_19350 7836 8270 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_19350 9386 8454 gene locus_tag LOCUS_19360 gene cysK 9386 8454 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_19360 9918 10367 gene locus_tag LOCUS_19370 9918 10367 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141918.1 protein_id gnl|my_center|LOCUS_19370 10555 11838 gene locus_tag LOCUS_19380 10555 11838 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence71 585 298 gene locus_tag LOCUS_19390 585 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1170 733 gene locus_tag LOCUS_19400 1170 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 1188 1457 gene locus_tag LOCUS_19410 1188 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1830 1561 gene locus_tag LOCUS_19420 1830 1561 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920707.1 protein_id gnl|my_center|LOCUS_19420 2316 3692 gene locus_tag LOCUS_19430 2316 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4237 3746 gene locus_tag LOCUS_19440 4237 3746 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_19440 5298 4234 gene locus_tag LOCUS_19450 gene trpS 5298 4234 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_19450 5410 5631 gene locus_tag LOCUS_19460 5410 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 5874 6347 gene locus_tag LOCUS_19470 5874 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 6832 7044 gene locus_tag LOCUS_19480 6832 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 7150 8058 gene locus_tag LOCUS_19490 7150 8058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 8135 10558 gene locus_tag LOCUS_19500 8135 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 10739 11509 gene locus_tag LOCUS_19510 10739 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence72 413 904 gene locus_tag LOCUS_19520 413 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1164 1316 gene locus_tag LOCUS_19530 1164 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2230 1334 gene locus_tag LOCUS_19540 2230 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2873 2223 gene locus_tag LOCUS_19550 2873 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 4750 2870 gene locus_tag LOCUS_19560 gene traD 4750 2870 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817091.1 protein_id gnl|my_center|LOCUS_19560 6083 4737 gene locus_tag LOCUS_19570 6083 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 6208 7005 gene locus_tag LOCUS_19580 6208 7005 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_19580 8881 7067 gene locus_tag LOCUS_19590 8881 7067 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215255.1 protein_id gnl|my_center|LOCUS_19590 9993 9106 gene locus_tag LOCUS_19600 gene htpX 9993 9106 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 protein_id gnl|my_center|LOCUS_19600 10516 10142 gene locus_tag LOCUS_19610 10516 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 10991 10539 gene locus_tag LOCUS_19620 10991 10539 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070537.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence73 738 1223 gene locus_tag LOCUS_19630 738 1223 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_19630 1735 1283 gene locus_tag LOCUS_19640 gene umuD 1735 1283 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946963.1 protein_id gnl|my_center|LOCUS_19640 2436 1747 gene locus_tag LOCUS_19650 2436 1747 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948676.1 protein_id gnl|my_center|LOCUS_19650 3118 2555 gene locus_tag LOCUS_19660 3118 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5064 3124 gene locus_tag LOCUS_19670 5064 3124 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818899.1 protein_id gnl|my_center|LOCUS_19670 5487 5272 gene locus_tag LOCUS_19680 5487 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 5803 6387 gene locus_tag LOCUS_19690 gene rpoE 5803 6387 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_19690 6398 7057 gene locus_tag LOCUS_19700 6398 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 7078 8079 gene locus_tag LOCUS_19710 7078 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 8086 8535 gene locus_tag LOCUS_19720 8086 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 8528 9898 gene locus_tag LOCUS_19730 gene radA 8528 9898 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456064.1 protein_id gnl|my_center|LOCUS_19730 10382 9975 gene locus_tag LOCUS_19740 10382 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 11027 10449 gene locus_tag LOCUS_19750 gene rsd 11027 10449 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175676.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence74 1355 1543 gene locus_tag LOCUS_19760 1355 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2104 1859 gene locus_tag LOCUS_19770 2104 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1985 2788 gene locus_tag LOCUS_19780 1985 2788 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389102.1 protein_id gnl|my_center|LOCUS_19780 2936 5827 gene locus_tag LOCUS_19790 2936 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 6539 7870 gene locus_tag LOCUS_19800 6539 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 7858 9327 gene locus_tag LOCUS_19810 7858 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 10369 9482 gene locus_tag LOCUS_19820 10369 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 10638 10369 gene locus_tag LOCUS_19830 10638 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 <11198 10631 gene locus_tag LOCUS_19840 <11198 10631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256554.1:site-specific DNA-methyltransferase >Feature sequence75 1379 945 gene locus_tag LOCUS_19850 1379 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1723 2766 gene locus_tag LOCUS_19860 1723 2766 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704081.1 protein_id gnl|my_center|LOCUS_19860 2750 3043 gene locus_tag LOCUS_19870 gene tusA 2750 3043 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307416.1 protein_id gnl|my_center|LOCUS_19870 3053 3559 gene locus_tag LOCUS_19880 gene coaD 3053 3559 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260992.1 protein_id gnl|my_center|LOCUS_19880 4374 3562 gene locus_tag LOCUS_19890 gene mutM 4374 3562 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704183.1 protein_id gnl|my_center|LOCUS_19890 4691 4524 gene locus_tag LOCUS_19900 gene rpmG 4691 4524 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307500.1 protein_id gnl|my_center|LOCUS_19900 4938 4702 gene locus_tag LOCUS_19910 gene rpmB 4938 4702 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005542826.1 protein_id gnl|my_center|LOCUS_19910 5145 6074 gene locus_tag LOCUS_19920 5145 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 6357 6136 gene locus_tag LOCUS_19930 6357 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 7321 6497 gene locus_tag LOCUS_19940 7321 6497 CDS product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014660168.1 protein_id gnl|my_center|LOCUS_19940 7564 8496 gene locus_tag LOCUS_19950 7564 8496 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_19950 9195 8581 gene locus_tag LOCUS_19960 9195 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 10105 9269 gene locus_tag LOCUS_19970 10105 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19970 >Feature sequence76 101 178 gene locus_tag LOCUS_t00290 101 178 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 687 1337 gene locus_tag LOCUS_19980 687 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1516 1250 gene locus_tag LOCUS_19990 1516 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2134 1595 gene locus_tag LOCUS_20000 gene ppa 2134 1595 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707292.1 protein_id gnl|my_center|LOCUS_20000 2411 6253 gene locus_tag LOCUS_20010 gene pulA 2411 6253 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819303.1 protein_id gnl|my_center|LOCUS_20010 6397 7767 gene locus_tag LOCUS_20020 gene mpl 6397 7767 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547405.1 protein_id gnl|my_center|LOCUS_20020 7770 8747 gene locus_tag LOCUS_20030 7770 8747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262613.1 protein_id gnl|my_center|LOCUS_20030 8744 9517 gene locus_tag LOCUS_20040 8744 9517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284384.1 protein_id gnl|my_center|LOCUS_20040 9567 10202 gene locus_tag LOCUS_20050 9567 10202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence77 2668 170 gene locus_tag LOCUS_20060 2668 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5747 2859 gene locus_tag LOCUS_20070 5747 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 6219 5980 gene locus_tag LOCUS_20080 6219 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 6530 6844 gene locus_tag LOCUS_20090 6530 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 6940 9504 gene locus_tag LOCUS_20100 gene acnB 6940 9504 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888954.1 protein_id gnl|my_center|LOCUS_20100 >Feature sequence78 373 882 gene locus_tag LOCUS_20110 gene nrdR 373 882 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482986.1 protein_id gnl|my_center|LOCUS_20110 960 2069 gene locus_tag LOCUS_20120 gene ribD 960 2069 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167588.1 protein_id gnl|my_center|LOCUS_20120 2195 5041 gene locus_tag LOCUS_20130 gene glnE 2195 5041 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819368.1 protein_id gnl|my_center|LOCUS_20130 5268 6818 gene locus_tag LOCUS_20140 5268 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 7929 6973 gene locus_tag LOCUS_20150 gene lpxL 7929 6973 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707479.1 protein_id gnl|my_center|LOCUS_20150 8060 8572 gene locus_tag LOCUS_20160 8060 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20160 8481 9539 gene locus_tag LOCUS_20170 8481 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20170 >Feature sequence79 146 484 gene locus_tag LOCUS_20180 146 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 888 1880 gene locus_tag LOCUS_20190 888 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2048 3031 gene locus_tag LOCUS_20200 2048 3031 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704622.1 protein_id gnl|my_center|LOCUS_20200 3035 3490 gene locus_tag LOCUS_20210 3035 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 4078 4752 gene locus_tag LOCUS_20220 4078 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5667 4738 gene locus_tag LOCUS_20230 5667 4738 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234873.1 protein_id gnl|my_center|LOCUS_20230 6391 5669 gene locus_tag LOCUS_20240 6391 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 8019 6478 gene locus_tag LOCUS_20250 gene lysS 8019 6478 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707134.1 protein_id gnl|my_center|LOCUS_20250 8962 8120 gene locus_tag LOCUS_20260 gene prfB 8962 8120 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989230.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20260 >Feature sequence80 370 738 gene locus_tag LOCUS_20270 370 738 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_20270 1903 1106 gene locus_tag LOCUS_20280 1903 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2723 2139 gene locus_tag LOCUS_20290 2723 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3420 2854 gene locus_tag LOCUS_20300 3420 2854 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266210.1 protein_id gnl|my_center|LOCUS_20300 4091 3516 gene locus_tag LOCUS_20310 4091 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 4488 4279 gene locus_tag LOCUS_20320 4488 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 6250 4907 gene locus_tag LOCUS_20330 6250 4907 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_20330 7762 6551 gene locus_tag LOCUS_20340 7762 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence81 477 941 gene locus_tag LOCUS_20350 477 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2063 1059 gene locus_tag LOCUS_20360 gene xerD 2063 1059 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 protein_id gnl|my_center|LOCUS_20360 3692 2340 gene locus_tag LOCUS_20370 gene accC 3692 2340 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707113.1 protein_id gnl|my_center|LOCUS_20370 4186 3704 gene locus_tag LOCUS_20380 gene accB 4186 3704 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354621.1 protein_id gnl|my_center|LOCUS_20380 4787 4326 gene locus_tag LOCUS_20390 gene aroQ 4787 4326 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707111.1 protein_id gnl|my_center|LOCUS_20390 5079 6332 gene locus_tag LOCUS_20400 5079 6332 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707102.1 protein_id gnl|my_center|LOCUS_20400 6718 7677 gene locus_tag LOCUS_20410 6718 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence82 2278 149 gene locus_tag LOCUS_20420 gene nrdD 2278 149 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368566.1 protein_id gnl|my_center|LOCUS_20420 3194 3111 gene locus_tag LOCUS_t00300 3194 3111 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3313 3238 gene locus_tag LOCUS_t00310 3313 3238 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3415 3339 gene locus_tag LOCUS_t00320 3415 3339 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3749 6439 gene locus_tag LOCUS_20430 3749 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 6537 7082 gene locus_tag LOCUS_20440 6537 7082 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_20440 7455 7379 gene locus_tag LOCUS_t00330 7455 7379 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7557 7481 gene locus_tag LOCUS_t00340 7557 7481 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence83 1116 187 gene locus_tag LOCUS_20450 gene galE 1116 187 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996163.1 protein_id gnl|my_center|LOCUS_20450 1069 1287 gene locus_tag LOCUS_20460 1069 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1415 2605 gene locus_tag LOCUS_20470 1415 2605 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_20470 2659 3486 gene locus_tag LOCUS_20480 2659 3486 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_20480 4751 3546 gene locus_tag LOCUS_20490 4751 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 5635 4781 gene locus_tag LOCUS_20500 gene rsmI 5635 4781 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707588.1 protein_id gnl|my_center|LOCUS_20500 6252 5635 gene locus_tag LOCUS_20510 6252 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 6843 6286 gene locus_tag LOCUS_20520 gene ribB 6843 6286 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705223.1 protein_id gnl|my_center|LOCUS_20520 7118 7318 gene locus_tag LOCUS_20530 7118 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 7550 7753 gene locus_tag LOCUS_20540 7550 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence84 2806 170 gene locus_tag LOCUS_20550 gene alaS 2806 170 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707429.1 protein_id gnl|my_center|LOCUS_20550 3928 3101 gene locus_tag LOCUS_20560 3928 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 4432 4725 gene locus_tag LOCUS_20570 gene fis 4432 4725 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651583.1 protein_id gnl|my_center|LOCUS_20570 5597 4812 gene locus_tag LOCUS_20580 5597 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 6686 5622 gene locus_tag LOCUS_20590 6686 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence85 453 226 gene locus_tag LOCUS_20600 453 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 588 959 gene locus_tag LOCUS_20610 588 959 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_20610 1020 1424 gene locus_tag LOCUS_20620 gene mutT 1020 1424 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_20620 3153 1540 gene locus_tag LOCUS_20630 3153 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3466 3834 gene locus_tag LOCUS_20640 3466 3834 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_20640 3882 6542 gene locus_tag LOCUS_20650 3882 6542 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_20650 6553 6786 gene locus_tag LOCUS_20660 6553 6786 CDS product copper ion binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132585.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence86 1178 330 gene locus_tag LOCUS_20670 1178 330 CDS product viperin family antiviral radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957056.1 protein_id gnl|my_center|LOCUS_20670 1890 1519 gene locus_tag LOCUS_20680 1890 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2348 1971 gene locus_tag LOCUS_20690 2348 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2820 2446 gene locus_tag LOCUS_20700 2820 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence87 1201 314 gene locus_tag LOCUS_20710 1201 314 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272197.1 protein_id gnl|my_center|LOCUS_20710 1365 2240 gene locus_tag LOCUS_20720 1365 2240 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243271.1 protein_id gnl|my_center|LOCUS_20720 2321 2920 gene locus_tag LOCUS_20730 2321 2920 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174735.1 protein_id gnl|my_center|LOCUS_20730 2913 4079 gene locus_tag LOCUS_20740 gene hemW 2913 4079 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704790.1 protein_id gnl|my_center|LOCUS_20740 4292 4633 gene locus_tag LOCUS_20750 4292 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 5259 4963 gene locus_tag LOCUS_20760 5259 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6115 5273 gene locus_tag LOCUS_20770 gene nadC 6115 5273 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479699.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence88 1726 149 gene locus_tag LOCUS_20780 gene pntB 1726 149 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707742.1 protein_id gnl|my_center|LOCUS_20780 3291 1738 gene locus_tag LOCUS_20790 gene pntA 3291 1738 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence89 188 760 gene locus_tag LOCUS_20800 188 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1301 3238 gene locus_tag LOCUS_20810 1301 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810