>Feature sequence01 408 1214 gene locus_tag LOCUS_00010 408 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1224 2054 gene locus_tag LOCUS_00020 1224 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2065 2673 gene locus_tag LOCUS_00030 2065 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2798 3961 gene locus_tag LOCUS_00040 2798 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4032 4739 gene locus_tag LOCUS_00050 4032 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4884 5690 gene locus_tag LOCUS_00060 4884 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5739 6977 gene locus_tag LOCUS_00070 5739 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6993 8144 gene locus_tag LOCUS_00080 6993 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8169 9029 gene locus_tag LOCUS_00090 8169 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9155 10132 gene locus_tag LOCUS_00100 9155 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10275 10757 gene locus_tag LOCUS_00110 10275 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10852 11973 gene locus_tag LOCUS_00120 10852 11973 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087251.1 protein_id gnl|my_center|LOCUS_00120 11948 13135 gene locus_tag LOCUS_00130 11948 13135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393812.1 protein_id gnl|my_center|LOCUS_00130 13186 13746 gene locus_tag LOCUS_00140 13186 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13912 14718 gene locus_tag LOCUS_00150 13912 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14886 15473 gene locus_tag LOCUS_00160 14886 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15463 16194 gene locus_tag LOCUS_00170 15463 16194 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 protein_id gnl|my_center|LOCUS_00170 16541 17488 gene locus_tag LOCUS_00180 16541 17488 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 protein_id gnl|my_center|LOCUS_00180 17485 18339 gene locus_tag LOCUS_00190 gene panC 17485 18339 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_00190 18385 18780 gene locus_tag LOCUS_00200 18385 18780 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391689.1 protein_id gnl|my_center|LOCUS_00200 19125 18841 gene locus_tag LOCUS_00210 19125 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19325 19756 gene locus_tag LOCUS_00220 19325 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21062 19851 gene locus_tag LOCUS_00230 21062 19851 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_00230 21308 22186 gene locus_tag LOCUS_00240 21308 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22449 23867 gene locus_tag LOCUS_00250 gene pyk 22449 23867 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_00250 24006 24845 gene locus_tag LOCUS_00260 24006 24845 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288254.1 protein_id gnl|my_center|LOCUS_00260 24965 25318 gene locus_tag LOCUS_00270 24965 25318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25743 25973 gene locus_tag LOCUS_00280 25743 25973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26042 26788 gene locus_tag LOCUS_00290 26042 26788 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242610.1 protein_id gnl|my_center|LOCUS_00290 26858 29527 gene locus_tag LOCUS_00300 gene rnr 26858 29527 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_00300 29588 30061 gene locus_tag LOCUS_00310 gene smpB 29588 30061 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_00310 30140 31057 gene locus_tag LOCUS_00320 30140 31057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31050 31748 gene locus_tag LOCUS_00330 31050 31748 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651510.1 protein_id gnl|my_center|LOCUS_00330 31752 33473 gene locus_tag LOCUS_00340 31752 33473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33639 33929 gene locus_tag LOCUS_00350 33639 33929 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_00350 34096 34893 gene locus_tag LOCUS_00360 34096 34893 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_00360 34926 35591 gene locus_tag LOCUS_00370 34926 35591 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 protein_id gnl|my_center|LOCUS_00370 35578 36294 gene locus_tag LOCUS_00380 35578 36294 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_00380 36440 36988 gene locus_tag LOCUS_00390 gene raiA 36440 36988 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_00390 37169 37579 gene locus_tag LOCUS_00400 37169 37579 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380333.1 protein_id gnl|my_center|LOCUS_00400 37581 38411 gene locus_tag LOCUS_00410 37581 38411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 38444 39463 gene locus_tag LOCUS_00420 38444 39463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263789.1 protein_id gnl|my_center|LOCUS_00420 39510 41387 gene locus_tag LOCUS_00430 39510 41387 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086048.1 protein_id gnl|my_center|LOCUS_00430 41415 42266 gene locus_tag LOCUS_00440 41415 42266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_00440 42253 43284 gene locus_tag LOCUS_00450 42253 43284 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789856.1 protein_id gnl|my_center|LOCUS_00450 43323 43934 gene locus_tag LOCUS_00460 43323 43934 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_00460 44109 46745 gene locus_tag LOCUS_00470 gene secA 44109 46745 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966131.1 protein_id gnl|my_center|LOCUS_00470 46801 47907 gene locus_tag LOCUS_00480 gene prfB 46801 47907 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_00480 47993 48682 gene locus_tag LOCUS_00490 47993 48682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 48683 50746 gene locus_tag LOCUS_00500 48683 50746 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 protein_id gnl|my_center|LOCUS_00500 50756 51853 gene locus_tag LOCUS_00510 gene csaB 50756 51853 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_00510 51963 52649 gene locus_tag LOCUS_00520 gene ftsE 51963 52649 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_00520 52639 53526 gene locus_tag LOCUS_00530 gene ftsX 52639 53526 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_00530 53532 54653 gene locus_tag LOCUS_00540 53532 54653 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_00540 54668 55828 gene locus_tag LOCUS_00550 54668 55828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 55990 56406 gene locus_tag LOCUS_00560 gene ssb 55990 56406 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_00560 58287 56509 gene locus_tag LOCUS_00570 gene recQ 58287 56509 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272332.1 protein_id gnl|my_center|LOCUS_00570 58451 59992 gene locus_tag LOCUS_00580 58451 59992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 59998 61137 gene locus_tag LOCUS_00590 59998 61137 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852311.1 protein_id gnl|my_center|LOCUS_00590 61154 61882 gene locus_tag LOCUS_00600 61154 61882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_00600 61872 63089 gene locus_tag LOCUS_00610 61872 63089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_00610 64229 63165 gene locus_tag LOCUS_00620 64229 63165 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_00620 64580 66436 gene locus_tag LOCUS_00630 64580 66436 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_00630 66429 68015 gene locus_tag LOCUS_00640 66429 68015 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_00640 68085 69362 gene locus_tag LOCUS_00650 68085 69362 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_00650 69480 70124 gene locus_tag LOCUS_00660 69480 70124 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 protein_id gnl|my_center|LOCUS_00660 70105 70887 gene locus_tag LOCUS_00670 70105 70887 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_00670 71021 72364 gene locus_tag LOCUS_00680 71021 72364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 72641 73825 gene locus_tag LOCUS_00690 72641 73825 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272237.1 protein_id gnl|my_center|LOCUS_00690 73837 75189 gene locus_tag LOCUS_00700 73837 75189 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231218.1 protein_id gnl|my_center|LOCUS_00700 75204 75890 gene locus_tag LOCUS_00710 75204 75890 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_00710 76244 75978 gene locus_tag LOCUS_00720 gene rpsT 76244 75978 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_00720 76424 78220 gene locus_tag LOCUS_00730 gene lepA 76424 78220 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_00730 78231 79370 gene locus_tag LOCUS_00740 gene hemW 78231 79370 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_00740 79485 80522 gene locus_tag LOCUS_00750 gene hrcA 79485 80522 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954957.1 protein_id gnl|my_center|LOCUS_00750 80566 81192 gene locus_tag LOCUS_00760 gene grpE 80566 81192 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_00760 81301 83163 gene locus_tag LOCUS_00770 gene dnaK 81301 83163 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_00770 83242 84411 gene locus_tag LOCUS_00780 gene dnaJ 83242 84411 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816474.1 protein_id gnl|my_center|LOCUS_00780 84492 85127 gene locus_tag LOCUS_00790 84492 85127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 85413 85718 gene locus_tag LOCUS_00800 85413 85718 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994780.1 protein_id gnl|my_center|LOCUS_00800 85715 86044 gene locus_tag LOCUS_00810 85715 86044 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113282.1 protein_id gnl|my_center|LOCUS_00810 86198 87136 gene locus_tag LOCUS_00820 gene prmA 86198 87136 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_00820 87133 87882 gene locus_tag LOCUS_00830 87133 87882 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392124.1 protein_id gnl|my_center|LOCUS_00830 87901 89202 gene locus_tag LOCUS_00840 gene mtaB 87901 89202 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_00840 89291 89638 gene locus_tag LOCUS_00850 89291 89638 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_00850 89731 89913 gene locus_tag LOCUS_00860 gene rpsU 89731 89913 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816464.1 protein_id gnl|my_center|LOCUS_00860 89989 90435 gene locus_tag LOCUS_00870 89989 90435 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460866.1 protein_id gnl|my_center|LOCUS_00870 90633 92360 gene locus_tag LOCUS_00880 90633 92360 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272214.1 protein_id gnl|my_center|LOCUS_00880 92486 93121 gene locus_tag LOCUS_00890 92486 93121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 93201 94199 gene locus_tag LOCUS_00900 gene floA 93201 94199 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_00900 94212 94790 gene locus_tag LOCUS_00910 94212 94790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 94914 95894 gene locus_tag LOCUS_00920 94914 95894 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_00920 95966 96409 gene locus_tag LOCUS_00930 95966 96409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 96614 96823 gene locus_tag LOCUS_00940 96614 96823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 96842 97642 gene locus_tag LOCUS_00950 gene tatC 96842 97642 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 protein_id gnl|my_center|LOCUS_00950 97658 99118 gene locus_tag LOCUS_00960 97658 99118 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_00960 99192 100040 gene locus_tag LOCUS_00970 gene ubiA 99192 100040 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_00970 100090 100956 gene locus_tag LOCUS_00980 gene folD 100090 100956 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_00980 101027 102694 gene locus_tag LOCUS_00990 101027 102694 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_00990 102904 103530 gene locus_tag LOCUS_01000 102904 103530 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_01000 103523 104527 gene locus_tag LOCUS_01010 103523 104527 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_01010 104706 105449 gene locus_tag LOCUS_01020 104706 105449 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887613.1 protein_id gnl|my_center|LOCUS_01020 105522 106364 gene locus_tag LOCUS_01030 105522 106364 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_01030 106367 107776 gene locus_tag LOCUS_01040 gene gltA 106367 107776 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_01040 107773 108354 gene locus_tag LOCUS_01050 107773 108354 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101164.1 protein_id gnl|my_center|LOCUS_01050 108351 108836 gene locus_tag LOCUS_01060 108351 108836 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816335.1 protein_id gnl|my_center|LOCUS_01060 109090 110382 gene locus_tag LOCUS_01070 109090 110382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 110544 110619 gene locus_tag LOCUS_t00010 110544 110619 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 110621 110695 gene locus_tag LOCUS_t00020 110621 110695 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 110699 110774 gene locus_tag LOCUS_t00030 110699 110774 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 110933 111730 gene locus_tag LOCUS_01080 110933 111730 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_01080 111764 113440 gene locus_tag LOCUS_01090 111764 113440 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_01090 113477 113785 gene locus_tag LOCUS_01100 113477 113785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 113821 115104 gene locus_tag LOCUS_01110 113821 115104 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_01110 116588 115209 gene locus_tag LOCUS_01120 116588 115209 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_01120 116889 118367 gene locus_tag LOCUS_01130 gene putP 116889 118367 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_01130 118722 120032 gene locus_tag LOCUS_01140 118722 120032 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_01140 120032 120415 gene locus_tag LOCUS_01150 120032 120415 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_01150 120635 121498 gene locus_tag LOCUS_01160 120635 121498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 121503 121967 gene locus_tag LOCUS_01170 121503 121967 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450459.1 protein_id gnl|my_center|LOCUS_01170 122097 124112 gene locus_tag LOCUS_01180 122097 124112 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459970.1 protein_id gnl|my_center|LOCUS_01180 124252 124704 gene locus_tag LOCUS_01190 124252 124704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 124720 126375 gene locus_tag LOCUS_01200 gene argS 124720 126375 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_01200 126404 126736 gene locus_tag LOCUS_01210 126404 126736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 126830 128434 gene locus_tag LOCUS_01220 126830 128434 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_01220 128617 129249 gene locus_tag LOCUS_01230 128617 129249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393882.1 protein_id gnl|my_center|LOCUS_01230 129375 132710 gene locus_tag LOCUS_01240 gene mfd 129375 132710 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_01240 132710 133384 gene locus_tag LOCUS_01250 132710 133384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 133554 133829 gene locus_tag LOCUS_01260 133554 133829 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_01260 133939 134697 gene locus_tag LOCUS_01270 133939 134697 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_01270 134755 135876 gene locus_tag LOCUS_01280 134755 135876 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_01280 135995 136462 gene locus_tag LOCUS_01290 135995 136462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 136501 136812 gene locus_tag LOCUS_01300 136501 136812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 136897 137346 gene locus_tag LOCUS_01310 136897 137346 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391640.1 protein_id gnl|my_center|LOCUS_01310 137422 138402 gene locus_tag LOCUS_01320 137422 138402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 138531 139094 gene locus_tag LOCUS_01330 gene hpt 138531 139094 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_01330 139127 141178 gene locus_tag LOCUS_01340 gene ftsH 139127 141178 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_01340 141297 142289 gene locus_tag LOCUS_01350 141297 142289 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_01350 142305 143099 gene locus_tag LOCUS_01360 142305 143099 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_01360 143096 144070 gene locus_tag LOCUS_01370 gene dusB 143096 144070 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_01370 144130 145521 gene locus_tag LOCUS_01380 144130 145521 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_01380 145690 146847 gene locus_tag LOCUS_01390 145690 146847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 147657 146947 gene locus_tag LOCUS_01400 gene deoD 147657 146947 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231176.1 protein_id gnl|my_center|LOCUS_01400 147988 147794 gene locus_tag LOCUS_01410 147988 147794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 148598 149224 gene locus_tag LOCUS_01420 148598 149224 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_01420 149516 149878 gene locus_tag LOCUS_01430 gene folB 149516 149878 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861219.1 protein_id gnl|my_center|LOCUS_01430 150054 151166 gene locus_tag LOCUS_01440 gene dprA 150054 151166 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_01440 151171 153453 gene locus_tag LOCUS_01450 gene topA 151171 153453 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_01450 153460 154788 gene locus_tag LOCUS_01460 gene trmFO 153460 154788 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_01460 154812 155354 gene locus_tag LOCUS_01470 gene hslV 154812 155354 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_01470 155354 156757 gene locus_tag LOCUS_01480 gene hslU 155354 156757 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_01480 156781 157641 gene locus_tag LOCUS_01490 gene codY 156781 157641 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774472.1 protein_id gnl|my_center|LOCUS_01490 157857 158282 gene locus_tag LOCUS_01500 gene flgB 157857 158282 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_01500 158324 158773 gene locus_tag LOCUS_01510 gene flgC 158324 158773 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_01510 158798 159100 gene locus_tag LOCUS_01520 158798 159100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 159151 160740 gene locus_tag LOCUS_01530 gene fliF 159151 160740 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870079.1 protein_id gnl|my_center|LOCUS_01530 160741 161766 gene locus_tag LOCUS_01540 gene fliG 160741 161766 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_01540 161759 162550 gene locus_tag LOCUS_01550 gene yscL 161759 162550 CDS product SctL family type III secretion system stator protein YscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117643.1 protein_id gnl|my_center|LOCUS_01550 162547 163872 gene locus_tag LOCUS_01560 gene fliI 162547 163872 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_01560 163892 164353 gene locus_tag LOCUS_01570 163892 164353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 164350 164991 gene locus_tag LOCUS_01580 164350 164991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 165023 165652 gene locus_tag LOCUS_01590 165023 165652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 165789 167570 gene locus_tag LOCUS_01600 165789 167570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 167921 168418 gene locus_tag LOCUS_01610 167921 168418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 168431 168814 gene locus_tag LOCUS_01620 168431 168814 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_01620 168916 171252 gene locus_tag LOCUS_01630 168916 171252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 171395 171796 gene locus_tag LOCUS_01640 171395 171796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 171870 172382 gene locus_tag LOCUS_01650 171870 172382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 172418 173443 gene locus_tag LOCUS_01660 gene fliM 172418 173443 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_01660 173436 174731 gene locus_tag LOCUS_01670 gene fliY 173436 174731 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_01670 174869 175183 gene locus_tag LOCUS_01680 174869 175183 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_01680 175183 175710 gene locus_tag LOCUS_01690 175183 175710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 175747 176505 gene locus_tag LOCUS_01700 gene fliP 175747 176505 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_01700 176527 176796 gene locus_tag LOCUS_01710 gene fliQ 176527 176796 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_01710 176816 177601 gene locus_tag LOCUS_01720 gene fliR 176816 177601 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_01720 177552 178712 gene locus_tag LOCUS_01730 177552 178712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01730 178750 180840 gene locus_tag LOCUS_01740 gene flhA 178750 180840 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460749.1 protein_id gnl|my_center|LOCUS_01740 180884 182110 gene locus_tag LOCUS_01750 gene flhF 180884 182110 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_01750 182145 183041 gene locus_tag LOCUS_01760 182145 183041 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_01760 183060 183743 gene locus_tag LOCUS_01770 183060 183743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 183795 184958 gene locus_tag LOCUS_01780 183795 184958 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939356.1 protein_id gnl|my_center|LOCUS_01780 184977 187052 gene locus_tag LOCUS_01790 gene cheA 184977 187052 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081040.1 protein_id gnl|my_center|LOCUS_01790 187068 187535 gene locus_tag LOCUS_01800 187068 187535 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_01800 187634 188251 gene locus_tag LOCUS_01810 187634 188251 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943818.1 protein_id gnl|my_center|LOCUS_01810 188253 188738 gene locus_tag LOCUS_01820 188253 188738 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_01820 188754 189155 gene locus_tag LOCUS_01830 188754 189155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 189170 189913 gene locus_tag LOCUS_01840 gene whiG 189170 189913 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_01840 189989 191662 gene locus_tag LOCUS_01850 189989 191662 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080991.1 protein_id gnl|my_center|LOCUS_01850 191691 192023 gene locus_tag LOCUS_01860 191691 192023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 192067 192906 gene locus_tag LOCUS_01870 192067 192906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 193021 194052 gene locus_tag LOCUS_01880 193021 194052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 194166 195149 gene locus_tag LOCUS_01890 194166 195149 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_01890 195331 195930 gene locus_tag LOCUS_01900 195331 195930 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_01900 195947 196384 gene locus_tag LOCUS_01910 195947 196384 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_01910 197451 196561 gene locus_tag LOCUS_01920 197451 196561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 197611 198486 gene locus_tag LOCUS_01930 197611 198486 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_01930 198527 199849 gene locus_tag LOCUS_01940 198527 199849 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983287.1 protein_id gnl|my_center|LOCUS_01940 200069 201349 gene locus_tag LOCUS_01950 gene pfp 200069 201349 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_01950 201499 201574 gene locus_tag LOCUS_t00040 201499 201574 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 201606 201691 gene locus_tag LOCUS_t00050 201606 201691 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 201700 201775 gene locus_tag LOCUS_t00060 201700 201775 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 201786 201861 gene locus_tag LOCUS_t00070 201786 201861 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 201868 201944 gene locus_tag LOCUS_t00080 201868 201944 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 202117 202266 gene locus_tag LOCUS_01960 gene rpmG 202117 202266 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_01960 202300 202473 gene locus_tag LOCUS_01970 202300 202473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 202492 203043 gene locus_tag LOCUS_01980 gene nusG 202492 203043 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_01980 203081 203506 gene locus_tag LOCUS_01990 gene rplK 203081 203506 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 protein_id gnl|my_center|LOCUS_01990 203569 204252 gene locus_tag LOCUS_02000 gene rplA 203569 204252 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_02000 204453 204998 gene locus_tag LOCUS_02010 gene rplJ 204453 204998 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_02010 205071 205439 gene locus_tag LOCUS_02020 gene rplL 205071 205439 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_02020 205697 209419 gene locus_tag LOCUS_02030 gene rpoB 205697 209419 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147553.1 protein_id gnl|my_center|LOCUS_02030 209438 213448 gene locus_tag LOCUS_02040 gene rpoC 209438 213448 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546248.1 protein_id gnl|my_center|LOCUS_02040 213534 214388 gene locus_tag LOCUS_02050 213534 214388 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_02050 214620 215132 gene locus_tag LOCUS_02060 214620 215132 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815410.1 protein_id gnl|my_center|LOCUS_02060 215538 217214 gene locus_tag LOCUS_02070 215538 217214 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_02070 217308 218564 gene locus_tag LOCUS_02080 217308 218564 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_02080 218670 219119 gene locus_tag LOCUS_02090 gene dtd 218670 219119 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565699.1 protein_id gnl|my_center|LOCUS_02090 219266 220648 gene locus_tag LOCUS_02100 gene dcuC 219266 220648 CDS product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705380.1 protein_id gnl|my_center|LOCUS_02100 220841 221629 gene locus_tag LOCUS_02110 220841 221629 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_02110 221734 222387 gene locus_tag LOCUS_02120 221734 222387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 222384 223316 gene locus_tag LOCUS_02130 222384 223316 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_02130 223329 224057 gene locus_tag LOCUS_02140 223329 224057 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_02140 224216 224788 gene locus_tag LOCUS_02150 224216 224788 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141641.1 protein_id gnl|my_center|LOCUS_02150 224788 225039 gene locus_tag LOCUS_02160 224788 225039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 225184 225654 gene locus_tag LOCUS_02170 gene greA 225184 225654 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_02170 225689 227635 gene locus_tag LOCUS_02180 gene lysS 225689 227635 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_02180 228139 229836 gene locus_tag LOCUS_02190 228139 229836 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 protein_id gnl|my_center|LOCUS_02190 229852 230859 gene locus_tag LOCUS_02200 gene chvE 229852 230859 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287997.1 protein_id gnl|my_center|LOCUS_02200 231051 232388 gene locus_tag LOCUS_02210 231051 232388 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796113.1 protein_id gnl|my_center|LOCUS_02210 232514 232822 gene locus_tag LOCUS_02220 232514 232822 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809626.1 protein_id gnl|my_center|LOCUS_02220 232829 234181 gene locus_tag LOCUS_02230 232829 234181 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355834.1 protein_id gnl|my_center|LOCUS_02230 234320 234643 gene locus_tag LOCUS_02240 gene licA 234320 234643 CDS product PTS lichenan transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227313.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence02 204 449 gene locus_tag LOCUS_02250 204 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2811 532 gene locus_tag LOCUS_02260 2811 532 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_02260 3373 2831 gene locus_tag LOCUS_02270 3373 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 4121 3360 gene locus_tag LOCUS_02280 4121 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4669 4124 gene locus_tag LOCUS_02290 4669 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5284 4973 gene locus_tag LOCUS_02300 5284 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 6343 5393 gene locus_tag LOCUS_02310 6343 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 6525 6340 gene locus_tag LOCUS_02320 6525 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 6728 6546 gene locus_tag LOCUS_02330 6728 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 6901 7086 gene locus_tag LOCUS_02340 6901 7086 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_02340 8941 7235 gene locus_tag LOCUS_02350 8941 7235 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 protein_id gnl|my_center|LOCUS_02350 9664 9056 gene locus_tag LOCUS_02360 9664 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 11759 9792 gene locus_tag LOCUS_02370 11759 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 12061 11774 gene locus_tag LOCUS_02380 12061 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 12930 12145 gene locus_tag LOCUS_02390 12930 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 14232 13135 gene locus_tag LOCUS_02400 gene aroB 14232 13135 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_02400 14755 14225 gene locus_tag LOCUS_02410 14755 14225 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_02410 15921 14752 gene locus_tag LOCUS_02420 gene aroC 15921 14752 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_02420 16609 16043 gene locus_tag LOCUS_02430 16609 16043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 17788 16622 gene locus_tag LOCUS_02440 17788 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 18176 17763 gene locus_tag LOCUS_02450 18176 17763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 18711 18166 gene locus_tag LOCUS_02460 18711 18166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 19093 18686 gene locus_tag LOCUS_02470 19093 18686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 19626 19099 gene locus_tag LOCUS_02480 19626 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 20084 19623 gene locus_tag LOCUS_02490 20084 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 20497 20081 gene locus_tag LOCUS_02500 20497 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 21688 20708 gene locus_tag LOCUS_02510 21688 20708 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_02510 22083 21685 gene locus_tag LOCUS_02520 gene rbfA 22083 21685 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_02520 24735 22126 gene locus_tag LOCUS_02530 24735 22126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 25077 24754 gene locus_tag LOCUS_02540 25077 24754 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983488.1 protein_id gnl|my_center|LOCUS_02540 25369 25079 gene locus_tag LOCUS_02550 25369 25079 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965106.1 protein_id gnl|my_center|LOCUS_02550 26523 25369 gene locus_tag LOCUS_02560 gene nusA 26523 25369 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_02560 27141 26683 gene locus_tag LOCUS_02570 gene rimP 27141 26683 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359097.1 protein_id gnl|my_center|LOCUS_02570 28317 27358 gene locus_tag LOCUS_02580 28317 27358 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966817.1 protein_id gnl|my_center|LOCUS_02580 31410 28603 gene locus_tag LOCUS_02590 31410 28603 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_02590 32302 31397 gene locus_tag LOCUS_02600 32302 31397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 33682 32444 gene locus_tag LOCUS_02610 gene coaBC 33682 32444 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_02610 33886 33683 gene locus_tag LOCUS_02620 gene rpoZ 33886 33683 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388622.1 protein_id gnl|my_center|LOCUS_02620 34514 33897 gene locus_tag LOCUS_02630 gene gmk 34514 33897 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965025.1 protein_id gnl|my_center|LOCUS_02630 34801 34511 gene locus_tag LOCUS_02640 34801 34511 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_02640 35659 34817 gene locus_tag LOCUS_02650 gene dapF 35659 34817 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_02650 36043 35816 gene locus_tag LOCUS_02660 36043 35816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 37369 36431 gene locus_tag LOCUS_02670 37369 36431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 37677 39437 gene locus_tag LOCUS_02680 37677 39437 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_02680 41316 39511 gene locus_tag LOCUS_02690 41316 39511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 41925 41374 gene locus_tag LOCUS_02700 gene pyrR 41925 41374 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_02700 42875 41970 gene locus_tag LOCUS_02710 42875 41970 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_02710 43354 42902 gene locus_tag LOCUS_02720 gene lspA 43354 42902 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_02720 44090 43359 gene locus_tag LOCUS_02730 44090 43359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 44943 44149 gene locus_tag LOCUS_02740 44943 44149 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476135.1 protein_id gnl|my_center|LOCUS_02740 45756 44947 gene locus_tag LOCUS_02750 gene proC 45756 44947 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_02750 46328 45813 gene locus_tag LOCUS_02760 46328 45813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 47033 46341 gene locus_tag LOCUS_02770 47033 46341 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_02770 47882 47067 gene locus_tag LOCUS_02780 gene pgeF 47882 47067 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_02780 49635 47908 gene locus_tag LOCUS_02790 49635 47908 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_02790 50127 49651 gene locus_tag LOCUS_02800 gene nrdR 50127 49651 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_02800 52052 50124 gene locus_tag LOCUS_02810 52052 50124 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_02810 52897 52052 gene locus_tag LOCUS_02820 52897 52052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 53869 53015 gene locus_tag LOCUS_02830 53869 53015 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_02830 55332 53869 gene locus_tag LOCUS_02840 55332 53869 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_02840 55695 56138 gene locus_tag LOCUS_02850 55695 56138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 57390 56140 gene locus_tag LOCUS_02860 57390 56140 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_02860 58108 57527 gene locus_tag LOCUS_02870 gene pth 58108 57527 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_02870 59502 58576 gene locus_tag LOCUS_02880 gene secF 59502 58576 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_02880 60788 59502 gene locus_tag LOCUS_02890 gene secD 60788 59502 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583952.1 protein_id gnl|my_center|LOCUS_02890 61428 60850 gene locus_tag LOCUS_02900 61428 60850 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817342.1 protein_id gnl|my_center|LOCUS_02900 61758 61465 gene locus_tag LOCUS_02910 61758 61465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 63007 61874 gene locus_tag LOCUS_02920 gene tgt 63007 61874 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944694.1 protein_id gnl|my_center|LOCUS_02920 65260 63245 gene locus_tag LOCUS_02930 65260 63245 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_02930 67622 65655 gene locus_tag LOCUS_02940 67622 65655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 67862 68860 gene locus_tag LOCUS_02950 67862 68860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 70351 69284 gene locus_tag LOCUS_02960 gene leuB 70351 69284 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393735.1 protein_id gnl|my_center|LOCUS_02960 70931 70437 gene locus_tag LOCUS_02970 gene leuD 70931 70437 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_02970 72324 71050 gene locus_tag LOCUS_02980 gene leuC 72324 71050 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_02980 72621 74705 gene locus_tag LOCUS_02990 72621 74705 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086964.1 protein_id gnl|my_center|LOCUS_02990 75122 75047 gene locus_tag LOCUS_t00090 75122 75047 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 77002 75221 gene locus_tag LOCUS_03000 77002 75221 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 protein_id gnl|my_center|LOCUS_03000 77529 78233 gene locus_tag LOCUS_03010 77529 78233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 79308 78367 gene locus_tag LOCUS_03020 79308 78367 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_03020 80194 79394 gene locus_tag LOCUS_03030 80194 79394 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_03030 80899 80210 gene locus_tag LOCUS_03040 80899 80210 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_03040 81056 80981 gene locus_tag LOCUS_t00100 81056 80981 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 82223 81117 gene locus_tag LOCUS_03050 gene rpoD 82223 81117 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_03050 84124 82313 gene locus_tag LOCUS_03060 gene dnaG 84124 82313 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392160.1 protein_id gnl|my_center|LOCUS_03060 85376 84363 gene locus_tag LOCUS_03070 85376 84363 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816343.1 protein_id gnl|my_center|LOCUS_03070 85784 85395 gene locus_tag LOCUS_03080 85784 85395 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461063.1 protein_id gnl|my_center|LOCUS_03080 87541 85781 gene locus_tag LOCUS_03090 87541 85781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 88573 87575 gene locus_tag LOCUS_03100 88573 87575 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083922.1 protein_id gnl|my_center|LOCUS_03100 89446 88616 gene locus_tag LOCUS_03110 89446 88616 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963448.1 protein_id gnl|my_center|LOCUS_03110 89793 89443 gene locus_tag LOCUS_03120 89793 89443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 90139 89846 gene locus_tag LOCUS_03130 90139 89846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 90687 90136 gene locus_tag LOCUS_03140 90687 90136 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_03140 91037 90711 gene locus_tag LOCUS_03150 91037 90711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03150 92846 91038 gene locus_tag LOCUS_03160 92846 91038 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03160 93950 93018 gene locus_tag LOCUS_03170 93950 93018 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_03170 94256 95221 gene locus_tag LOCUS_03180 94256 95221 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_03180 95744 95280 gene locus_tag LOCUS_03190 gene tadA 95744 95280 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391574.1 protein_id gnl|my_center|LOCUS_03190 97234 96140 gene locus_tag LOCUS_03200 97234 96140 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_03200 99897 97420 gene locus_tag LOCUS_03210 gene leuS 99897 97420 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_03210 100809 100012 gene locus_tag LOCUS_03220 gene recO 100809 100012 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392138.1 protein_id gnl|my_center|LOCUS_03220 101546 100809 gene locus_tag LOCUS_03230 101546 100809 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807035.1 protein_id gnl|my_center|LOCUS_03230 102684 101785 gene locus_tag LOCUS_03240 gene era 102684 101785 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230051.1 protein_id gnl|my_center|LOCUS_03240 103164 102700 gene locus_tag LOCUS_03250 gene ybeY 103164 102700 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816440.1 protein_id gnl|my_center|LOCUS_03250 104477 103494 gene locus_tag LOCUS_03260 104477 103494 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_03260 105433 104522 gene locus_tag LOCUS_03270 105433 104522 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_03270 105883 105503 gene locus_tag LOCUS_03280 105883 105503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 109792 106010 gene locus_tag LOCUS_03290 109792 106010 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272602.1 protein_id gnl|my_center|LOCUS_03290 110362 109892 gene locus_tag LOCUS_03300 110362 109892 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_03300 110622 111101 gene locus_tag LOCUS_03310 110622 111101 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_03310 111101 112288 gene locus_tag LOCUS_03320 111101 112288 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_03320 113541 112402 gene locus_tag LOCUS_03330 113541 112402 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_03330 113742 114260 gene locus_tag LOCUS_03340 113742 114260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 114351 115448 gene locus_tag LOCUS_03350 114351 115448 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_03350 115441 118275 gene locus_tag LOCUS_03360 115441 118275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 118466 118771 gene locus_tag LOCUS_03370 gene trxA 118466 118771 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_03370 120144 118942 gene locus_tag LOCUS_03380 120144 118942 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890714.1 protein_id gnl|my_center|LOCUS_03380 120594 120217 gene locus_tag LOCUS_03390 120594 120217 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681167.1 protein_id gnl|my_center|LOCUS_03390 121979 120630 gene locus_tag LOCUS_03400 121979 120630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 122185 122805 gene locus_tag LOCUS_03410 122185 122805 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_03410 123437 122883 gene locus_tag LOCUS_03420 123437 122883 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905771.1 protein_id gnl|my_center|LOCUS_03420 123890 123468 gene locus_tag LOCUS_03430 123890 123468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 124233 123901 gene locus_tag LOCUS_03440 124233 123901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 124480 124223 gene locus_tag LOCUS_03450 124480 124223 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681231.1 protein_id gnl|my_center|LOCUS_03450 125018 124719 gene locus_tag LOCUS_03460 125018 124719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 126405 125011 gene locus_tag LOCUS_03470 gene rlmD 126405 125011 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_03470 127230 126565 gene locus_tag LOCUS_03480 127230 126565 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937441.1 protein_id gnl|my_center|LOCUS_03480 128763 127324 gene locus_tag LOCUS_03490 gene gatB 128763 127324 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 protein_id gnl|my_center|LOCUS_03490 130232 128763 gene locus_tag LOCUS_03500 gene gatA 130232 128763 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_03500 130537 130247 gene locus_tag LOCUS_03510 gene gatC 130537 130247 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_03510 133056 130618 gene locus_tag LOCUS_03520 gene priA 133056 130618 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_03520 134675 133143 gene locus_tag LOCUS_03530 134675 133143 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_03530 135051 134689 gene locus_tag LOCUS_03540 135051 134689 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_03540 135436 135107 gene locus_tag LOCUS_03550 135436 135107 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870093.1 protein_id gnl|my_center|LOCUS_03550 138007 135509 gene locus_tag LOCUS_03560 138007 135509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 138811 138026 gene locus_tag LOCUS_03570 138811 138026 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369352.1 protein_id gnl|my_center|LOCUS_03570 139762 138818 gene locus_tag LOCUS_03580 gene ylqF 139762 138818 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_03580 141283 139910 gene locus_tag LOCUS_03590 141283 139910 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_03590 141534 142439 gene locus_tag LOCUS_03600 141534 142439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 142470 143117 gene locus_tag LOCUS_03610 142470 143117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 143427 144935 gene locus_tag LOCUS_03620 143427 144935 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860226.1 protein_id gnl|my_center|LOCUS_03620 145805 145035 gene locus_tag LOCUS_03630 gene sigH 145805 145035 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_03630 146726 145965 gene locus_tag LOCUS_03640 gene rlmB 146726 145965 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_03640 146619 146930 gene locus_tag LOCUS_03650 146619 146930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 147600 146911 gene locus_tag LOCUS_03660 gene thyX 147600 146911 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_03660 148103 147609 gene locus_tag LOCUS_03670 148103 147609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 149527 148100 gene locus_tag LOCUS_03680 gene cysS 149527 148100 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459084.1 protein_id gnl|my_center|LOCUS_03680 150278 149529 gene locus_tag LOCUS_03690 gene cysE 150278 149529 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_03690 150807 150319 gene locus_tag LOCUS_03700 gene ispF 150807 150319 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_03700 151502 150819 gene locus_tag LOCUS_03710 gene ispD 151502 150819 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_03710 152781 151555 gene locus_tag LOCUS_03720 152781 151555 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_03720 153468 152974 gene locus_tag LOCUS_03730 153468 152974 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_03730 154516 153680 gene locus_tag LOCUS_03740 gene amrS 154516 153680 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_03740 155894 154509 gene locus_tag LOCUS_03750 gene amrA 155894 154509 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_03750 156042 157148 gene locus_tag LOCUS_03760 gene rsmH 156042 157148 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_03760 158285 157200 gene locus_tag LOCUS_03770 158285 157200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 159659 158691 gene locus_tag LOCUS_03780 gene mdh 159659 158691 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760830.1 protein_id gnl|my_center|LOCUS_03780 160122 159961 gene locus_tag LOCUS_03790 160122 159961 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_03790 161112 160222 gene locus_tag LOCUS_03800 161112 160222 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680625.1 protein_id gnl|my_center|LOCUS_03800 163001 161160 gene locus_tag LOCUS_03810 gene uvrC 163001 161160 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_03810 163184 164518 gene locus_tag LOCUS_03820 gene accC 163184 164518 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_03820 164884 164576 gene locus_tag LOCUS_03830 164884 164576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 165299 165012 gene locus_tag LOCUS_03840 165299 165012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 165180 165437 gene locus_tag LOCUS_03850 165180 165437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 165561 166472 gene locus_tag LOCUS_03860 165561 166472 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_03860 167418 166555 gene locus_tag LOCUS_03870 167418 166555 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986963.1 protein_id gnl|my_center|LOCUS_03870 169493 167589 gene locus_tag LOCUS_03880 169493 167589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 169759 170523 gene locus_tag LOCUS_03890 169759 170523 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719096.1 protein_id gnl|my_center|LOCUS_03890 172410 170656 gene locus_tag LOCUS_03900 172410 170656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 174189 172423 gene locus_tag LOCUS_03910 174189 172423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 175149 174211 gene locus_tag LOCUS_03920 175149 174211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 175517 175200 gene locus_tag LOCUS_03930 gene rhaM 175517 175200 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009913470.1 protein_id gnl|my_center|LOCUS_03930 176362 175544 gene locus_tag LOCUS_03940 gene rhaD 176362 175544 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 protein_id gnl|my_center|LOCUS_03940 177634 176396 gene locus_tag LOCUS_03950 gene rhaA 177634 176396 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_03950 179125 177698 gene locus_tag LOCUS_03960 gene rhaB 179125 177698 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243094.1 protein_id gnl|my_center|LOCUS_03960 181081 179363 gene locus_tag LOCUS_03970 181081 179363 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_03970 181770 181087 gene locus_tag LOCUS_03980 181770 181087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 182472 181918 gene locus_tag LOCUS_03990 182472 181918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 186006 182680 gene locus_tag LOCUS_04000 186006 182680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 186936 186148 gene locus_tag LOCUS_04010 186936 186148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 187960 187805 gene locus_tag LOCUS_04020 187960 187805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 189128 187923 gene locus_tag LOCUS_04030 189128 187923 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_04030 190729 189284 gene locus_tag LOCUS_04040 190729 189284 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020866.1 protein_id gnl|my_center|LOCUS_04040 190876 191520 gene locus_tag LOCUS_04050 190876 191520 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_04050 192491 191613 gene locus_tag LOCUS_04060 192491 191613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 193575 192682 gene locus_tag LOCUS_04070 193575 192682 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_04070 194943 194074 gene locus_tag LOCUS_04080 194943 194074 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855106.1 protein_id gnl|my_center|LOCUS_04080 195546 194947 gene locus_tag LOCUS_04090 195546 194947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04090 195889 195434 gene locus_tag LOCUS_04100 195889 195434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04100 197776 195908 gene locus_tag LOCUS_04110 gene sdhA 197776 195908 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_04110 198249 198040 gene locus_tag LOCUS_04120 198249 198040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 198661 198140 gene locus_tag LOCUS_04130 198661 198140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 200120 198783 gene locus_tag LOCUS_04140 200120 198783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 200957 200127 gene locus_tag LOCUS_04150 200957 200127 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812154.1 protein_id gnl|my_center|LOCUS_04150 203343 201133 gene locus_tag LOCUS_04160 203343 201133 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_04160 205327 203348 gene locus_tag LOCUS_04170 205327 203348 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_04170 206596 205349 gene locus_tag LOCUS_04180 206596 205349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 207205 207936 gene locus_tag LOCUS_04190 207205 207936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04190 208293 208191 gene locus_tag LOCUS_r00010 208293 208191 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence03 1839 1168 gene locus_tag LOCUS_04200 1839 1168 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391990.1 protein_id gnl|my_center|LOCUS_04200 2651 1839 gene locus_tag LOCUS_04210 2651 1839 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460849.1 protein_id gnl|my_center|LOCUS_04210 3552 2698 gene locus_tag LOCUS_04220 gene fdhE 3552 2698 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070512.1 protein_id gnl|my_center|LOCUS_04220 6623 3612 gene locus_tag LOCUS_04230 gene fdnG 6623 3612 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460850.1 protein_id gnl|my_center|LOCUS_04230 7641 6826 gene locus_tag LOCUS_04240 gene fdhD 7641 6826 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069995213.1 protein_id gnl|my_center|LOCUS_04240 9923 7863 gene locus_tag LOCUS_04250 gene glyS 9923 7863 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_04250 10801 9920 gene locus_tag LOCUS_04260 gene glyQ 10801 9920 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_04260 12982 11078 gene locus_tag LOCUS_04270 gene ftsH 12982 11078 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_04270 13820 12987 gene locus_tag LOCUS_04280 13820 12987 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 protein_id gnl|my_center|LOCUS_04280 14696 13866 gene locus_tag LOCUS_04290 14696 13866 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_04290 15576 14800 gene locus_tag LOCUS_04300 15576 14800 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_04300 16158 15601 gene locus_tag LOCUS_04310 16158 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392596.1 protein_id gnl|my_center|LOCUS_04310 17718 16243 gene locus_tag LOCUS_04320 gene rny 17718 16243 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_04320 18015 18305 gene locus_tag LOCUS_04330 18015 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 18863 18405 gene locus_tag LOCUS_04340 18863 18405 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198843.1 protein_id gnl|my_center|LOCUS_04340 19307 18966 gene locus_tag LOCUS_04350 19307 18966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 19866 19315 gene locus_tag LOCUS_04360 19866 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 20092 21180 gene locus_tag LOCUS_04370 20092 21180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 21458 22528 gene locus_tag LOCUS_04380 21458 22528 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290821.1 protein_id gnl|my_center|LOCUS_04380 22944 22714 gene locus_tag LOCUS_04390 22944 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 23646 23266 gene locus_tag LOCUS_04400 23646 23266 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979395.1 protein_id gnl|my_center|LOCUS_04400 25106 23799 gene locus_tag LOCUS_04410 gene thiC 25106 23799 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_04410 25652 25728 gene locus_tag LOCUS_t00110 25652 25728 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 26701 25865 gene locus_tag LOCUS_04420 26701 25865 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 protein_id gnl|my_center|LOCUS_04420 26919 28103 gene locus_tag LOCUS_04430 26919 28103 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_04430 29468 28191 gene locus_tag LOCUS_04440 gene purD 29468 28191 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 protein_id gnl|my_center|LOCUS_04440 30627 30034 gene locus_tag LOCUS_04450 30627 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 31330 30698 gene locus_tag LOCUS_04460 gene purN 31330 30698 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_04460 32375 31323 gene locus_tag LOCUS_04470 gene purM 32375 31323 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_04470 33815 32388 gene locus_tag LOCUS_04480 gene purF 33815 32388 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_04480 34327 33842 gene locus_tag LOCUS_04490 gene purE 34327 33842 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_04490 35315 34563 gene locus_tag LOCUS_04500 35315 34563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 36092 35439 gene locus_tag LOCUS_04510 36092 35439 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929263.1 protein_id gnl|my_center|LOCUS_04510 37049 36102 gene locus_tag LOCUS_04520 37049 36102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 38840 37170 gene locus_tag LOCUS_04530 38840 37170 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_04530 43145 38889 gene locus_tag LOCUS_04540 43145 38889 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812165.1 protein_id gnl|my_center|LOCUS_04540 44068 43277 gene locus_tag LOCUS_04550 gene truA 44068 43277 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459121.1 protein_id gnl|my_center|LOCUS_04550 44856 44065 gene locus_tag LOCUS_04560 44856 44065 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966381.1 protein_id gnl|my_center|LOCUS_04560 45731 44850 gene locus_tag LOCUS_04570 45731 44850 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_04570 46570 45734 gene locus_tag LOCUS_04580 46570 45734 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_04580 47069 46731 gene locus_tag LOCUS_04590 gene rplQ 47069 46731 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393907.1 protein_id gnl|my_center|LOCUS_04590 48053 47094 gene locus_tag LOCUS_04600 48053 47094 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_04600 48696 48103 gene locus_tag LOCUS_04610 gene rpsD 48696 48103 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_04610 49110 48718 gene locus_tag LOCUS_04620 gene rpsK 49110 48718 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_04620 49499 49128 gene locus_tag LOCUS_04630 gene rpsM 49499 49128 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_04630 50022 49804 gene locus_tag LOCUS_04640 gene infA 50022 49804 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_04640 50761 50117 gene locus_tag LOCUS_04650 50761 50117 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_04650 52034 50778 gene locus_tag LOCUS_04660 gene secY 52034 50778 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_04660 52476 52036 gene locus_tag LOCUS_04670 gene rplO 52476 52036 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766087.1 protein_id gnl|my_center|LOCUS_04670 52686 52501 gene locus_tag LOCUS_04680 gene rpmD 52686 52501 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 protein_id gnl|my_center|LOCUS_04680 53207 52701 gene locus_tag LOCUS_04690 gene rpsE 53207 52701 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_04690 53593 53234 gene locus_tag LOCUS_04700 gene rplR 53593 53234 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_04700 54175 53624 gene locus_tag LOCUS_04710 gene rplF 54175 53624 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_04710 54597 54199 gene locus_tag LOCUS_04720 gene rpsH 54597 54199 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_04720 54813 54628 gene locus_tag LOCUS_04730 54813 54628 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393924.1 protein_id gnl|my_center|LOCUS_04730 55367 54828 gene locus_tag LOCUS_04740 gene rplE 55367 54828 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_04740 55725 55393 gene locus_tag LOCUS_04750 gene rplX 55725 55393 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356212.1 protein_id gnl|my_center|LOCUS_04750 56112 55744 gene locus_tag LOCUS_04760 gene rplN 56112 55744 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_04760 56400 56143 gene locus_tag LOCUS_04770 gene rpsQ 56400 56143 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_04770 56633 56439 gene locus_tag LOCUS_04780 gene rpmC 56633 56439 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966404.1 protein_id gnl|my_center|LOCUS_04780 57064 56633 gene locus_tag LOCUS_04790 gene rplP 57064 56633 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_04790 57732 57064 gene locus_tag LOCUS_04800 gene rpsC 57732 57064 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_04800 58085 57750 gene locus_tag LOCUS_04810 gene rplV 58085 57750 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_04810 58387 58106 gene locus_tag LOCUS_04820 gene rpsS 58387 58106 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_04820 59264 58437 gene locus_tag LOCUS_04830 gene rplB 59264 58437 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_04830 59569 59288 gene locus_tag LOCUS_04840 gene rplW 59569 59288 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_04840 60192 59569 gene locus_tag LOCUS_04850 gene rplD 60192 59569 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_04850 60861 60217 gene locus_tag LOCUS_04860 gene rplC 60861 60217 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_04860 61191 60880 gene locus_tag LOCUS_04870 gene rpsJ 61191 60880 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_04870 62565 61369 gene locus_tag LOCUS_04880 gene tuf 62565 61369 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 protein_id gnl|my_center|LOCUS_04880 64662 62587 gene locus_tag LOCUS_04890 gene fusA 64662 62587 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_04890 65164 64694 gene locus_tag LOCUS_04900 gene rpsG 65164 64694 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_04900 65586 65203 gene locus_tag LOCUS_04910 gene rpsL 65586 65203 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_04910 65908 65663 gene locus_tag LOCUS_04920 65908 65663 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 protein_id gnl|my_center|LOCUS_04920 68166 66166 gene locus_tag LOCUS_04930 gene tkt 68166 66166 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_04930 68665 68303 gene locus_tag LOCUS_04940 gene aroH 68665 68303 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142699.1 protein_id gnl|my_center|LOCUS_04940 70308 68704 gene locus_tag LOCUS_04950 70308 68704 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051558.1 protein_id gnl|my_center|LOCUS_04950 71964 70339 gene locus_tag LOCUS_04960 71964 70339 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232344.1 protein_id gnl|my_center|LOCUS_04960 72819 72016 gene locus_tag LOCUS_04970 72819 72016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 74151 72868 gene locus_tag LOCUS_04980 74151 72868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 74306 75028 gene locus_tag LOCUS_04990 74306 75028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 75021 76292 gene locus_tag LOCUS_05000 75021 76292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 77303 76350 gene locus_tag LOCUS_05010 77303 76350 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810938.1 protein_id gnl|my_center|LOCUS_05010 79355 77691 gene locus_tag LOCUS_05020 79355 77691 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_05020 79674 79402 gene locus_tag LOCUS_05030 79674 79402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 81022 79715 gene locus_tag LOCUS_05040 81022 79715 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461052.1 protein_id gnl|my_center|LOCUS_05040 82257 81019 gene locus_tag LOCUS_05050 82257 81019 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461052.1 protein_id gnl|my_center|LOCUS_05050 83143 82268 gene locus_tag LOCUS_05060 gene galU 83143 82268 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_05060 85397 83298 gene locus_tag LOCUS_05070 85397 83298 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016976.1 protein_id gnl|my_center|LOCUS_05070 86068 85394 gene locus_tag LOCUS_05080 86068 85394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 86378 86073 gene locus_tag LOCUS_05090 86378 86073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 86680 86477 gene locus_tag LOCUS_05100 86680 86477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 86933 86849 gene locus_tag LOCUS_t00120 86933 86849 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 87462 87034 gene locus_tag LOCUS_05110 gene mutT 87462 87034 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_05110 90508 87452 gene locus_tag LOCUS_05120 90508 87452 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948376.1 protein_id gnl|my_center|LOCUS_05120 90621 91094 gene locus_tag LOCUS_05130 90621 91094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 91885 91127 gene locus_tag LOCUS_05140 91885 91127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 92016 92240 gene locus_tag LOCUS_05150 92016 92240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 92182 93024 gene locus_tag LOCUS_05160 92182 93024 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669815.1 protein_id gnl|my_center|LOCUS_05160 94592 93291 gene locus_tag LOCUS_05170 94592 93291 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_05170 95892 94738 gene locus_tag LOCUS_05180 95892 94738 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_05180 97335 95938 gene locus_tag LOCUS_05190 gene radA 97335 95938 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_05190 97822 97685 gene locus_tag LOCUS_05200 97822 97685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 100310 97809 gene locus_tag LOCUS_05210 100310 97809 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810223.1 protein_id gnl|my_center|LOCUS_05210 101393 100314 gene locus_tag LOCUS_05220 101393 100314 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050842.1 protein_id gnl|my_center|LOCUS_05220 101958 101380 gene locus_tag LOCUS_05230 101958 101380 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942740.1 protein_id gnl|my_center|LOCUS_05230 102456 102004 gene locus_tag LOCUS_05240 gene ctsR 102456 102004 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244565.1 protein_id gnl|my_center|LOCUS_05240 103034 102609 gene locus_tag LOCUS_05250 103034 102609 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_05250 103251 103096 gene locus_tag LOCUS_05260 103251 103096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 104853 103324 gene locus_tag LOCUS_05270 104853 103324 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_05270 106466 104949 gene locus_tag LOCUS_05280 106466 104949 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_05280 108374 106707 gene locus_tag LOCUS_05290 108374 106707 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_05290 114087 108448 gene locus_tag LOCUS_05300 114087 108448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 114569 114177 gene locus_tag LOCUS_05310 114569 114177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 115097 114870 gene locus_tag LOCUS_05320 115097 114870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 115432 115103 gene locus_tag LOCUS_05330 115432 115103 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_05330 116879 115527 gene locus_tag LOCUS_05340 116879 115527 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_05340 118013 116919 gene locus_tag LOCUS_05350 118013 116919 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_05350 118935 118291 gene locus_tag LOCUS_05360 118935 118291 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_05360 120547 118889 gene locus_tag LOCUS_05370 120547 118889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 121886 120540 gene locus_tag LOCUS_05380 121886 120540 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_05380 124570 121898 gene locus_tag LOCUS_05390 124570 121898 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_05390 125036 124716 gene locus_tag LOCUS_05400 125036 124716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 125893 125261 gene locus_tag LOCUS_05410 125893 125261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 126953 125871 gene locus_tag LOCUS_05420 126953 125871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 125916 125978 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 129918 127093 gene locus_tag LOCUS_05430 gene uvrA 129918 127093 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence04 759 118 gene locus_tag LOCUS_05440 759 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 863 1027 gene locus_tag LOCUS_05450 863 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1027 2379 gene locus_tag LOCUS_05460 1027 2379 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_05460 2486 3985 gene locus_tag LOCUS_05470 2486 3985 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_05470 3987 5459 gene locus_tag LOCUS_05480 3987 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5452 6441 gene locus_tag LOCUS_05490 5452 6441 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_05490 6438 7862 gene locus_tag LOCUS_05500 6438 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7967 8989 gene locus_tag LOCUS_05510 7967 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 8992 10464 gene locus_tag LOCUS_05520 8992 10464 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263118.1 protein_id gnl|my_center|LOCUS_05520 10479 11324 gene locus_tag LOCUS_05530 10479 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 11330 12457 gene locus_tag LOCUS_05540 11330 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 12463 13443 gene locus_tag LOCUS_05550 12463 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 13515 13709 gene locus_tag LOCUS_05560 13515 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 13749 14204 gene locus_tag LOCUS_05570 13749 14204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 14241 15629 gene locus_tag LOCUS_05580 14241 15629 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_05580 15629 16579 gene locus_tag LOCUS_05590 15629 16579 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_05590 16595 16957 gene locus_tag LOCUS_05600 16595 16957 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922600.1 protein_id gnl|my_center|LOCUS_05600 18441 16954 gene locus_tag LOCUS_05610 18441 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 19149 18568 gene locus_tag LOCUS_05620 19149 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 19293 20201 gene locus_tag LOCUS_05630 19293 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 20875 23304 gene locus_tag LOCUS_05640 gene gyrA 20875 23304 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_05640 23576 25018 gene locus_tag LOCUS_05650 23576 25018 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102219.1 protein_id gnl|my_center|LOCUS_05650 25037 26656 gene locus_tag LOCUS_05660 25037 26656 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102218.1 protein_id gnl|my_center|LOCUS_05660 26659 27387 gene locus_tag LOCUS_05670 26659 27387 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642916.1 protein_id gnl|my_center|LOCUS_05670 27432 28856 gene locus_tag LOCUS_05680 gene araA 27432 28856 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642915.1 protein_id gnl|my_center|LOCUS_05680 29989 28970 gene locus_tag LOCUS_05690 29989 28970 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532871.1 protein_id gnl|my_center|LOCUS_05690 31331 30099 gene locus_tag LOCUS_05700 gene maeB 31331 30099 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_05700 32788 31538 gene locus_tag LOCUS_05710 32788 31538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 32925 33383 gene locus_tag LOCUS_05720 32925 33383 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_05720 33756 34178 gene locus_tag LOCUS_05730 33756 34178 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_05730 36163 34265 gene locus_tag LOCUS_05740 36163 34265 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_05740 37163 36255 gene locus_tag LOCUS_05750 gene pfkB 37163 36255 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_05750 37921 37169 gene locus_tag LOCUS_05760 37921 37169 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323503.1 protein_id gnl|my_center|LOCUS_05760 38164 39045 gene locus_tag LOCUS_05770 38164 39045 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 protein_id gnl|my_center|LOCUS_05770 39259 40554 gene locus_tag LOCUS_05780 39259 40554 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786117.1 protein_id gnl|my_center|LOCUS_05780 40692 42353 gene locus_tag LOCUS_05790 40692 42353 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_05790 42569 43918 gene locus_tag LOCUS_05800 42569 43918 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_05800 44497 44078 gene locus_tag LOCUS_05810 44497 44078 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_05810 44695 44853 gene locus_tag LOCUS_05820 44695 44853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 45427 44927 gene locus_tag LOCUS_05830 45427 44927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 47387 45576 gene locus_tag LOCUS_05840 47387 45576 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861961.1 protein_id gnl|my_center|LOCUS_05840 48987 47482 gene locus_tag LOCUS_05850 48987 47482 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989833.1 protein_id gnl|my_center|LOCUS_05850 49699 49073 gene locus_tag LOCUS_05860 49699 49073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 51116 49785 gene locus_tag LOCUS_05870 51116 49785 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_05870 51416 52402 gene locus_tag LOCUS_05880 51416 52402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 52412 54421 gene locus_tag LOCUS_05890 52412 54421 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 protein_id gnl|my_center|LOCUS_05890 54393 54836 gene locus_tag LOCUS_05900 gene rplI 54393 54836 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_05900 54968 57004 gene locus_tag LOCUS_05910 gene lonC 54968 57004 CDS product Lon family ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391681.1 protein_id gnl|my_center|LOCUS_05910 56995 58326 gene locus_tag LOCUS_05920 gene dnaB 56995 58326 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_05920 58508 60367 gene locus_tag LOCUS_05930 58508 60367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 60485 61942 gene locus_tag LOCUS_05940 60485 61942 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 protein_id gnl|my_center|LOCUS_05940 62185 64149 gene locus_tag LOCUS_05950 62185 64149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 64227 64598 gene locus_tag LOCUS_05960 64227 64598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 65338 66132 gene locus_tag LOCUS_05970 65338 66132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 66511 66278 gene locus_tag LOCUS_05980 66511 66278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 67292 66846 gene locus_tag LOCUS_05990 67292 66846 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_05990 67504 68436 gene locus_tag LOCUS_06000 gene cysK 67504 68436 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_06000 68872 70224 gene locus_tag LOCUS_06010 gene trkA 68872 70224 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_06010 70226 71674 gene locus_tag LOCUS_06020 70226 71674 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812211.1 protein_id gnl|my_center|LOCUS_06020 71688 73142 gene locus_tag LOCUS_06030 71688 73142 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812212.1 protein_id gnl|my_center|LOCUS_06030 73329 74621 gene locus_tag LOCUS_06040 gene purB 73329 74621 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_06040 74682 75968 gene locus_tag LOCUS_06050 74682 75968 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_06050 76040 76849 gene locus_tag LOCUS_06060 76040 76849 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990045.1 protein_id gnl|my_center|LOCUS_06060 77008 79920 gene locus_tag LOCUS_06070 77008 79920 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861232.1 protein_id gnl|my_center|LOCUS_06070 80090 80836 gene locus_tag LOCUS_06080 gene sufC 80090 80836 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_06080 80847 82256 gene locus_tag LOCUS_06090 gene sufB 80847 82256 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_06090 82270 83115 gene locus_tag LOCUS_06100 82270 83115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 83115 84350 gene locus_tag LOCUS_06110 83115 84350 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_06110 84340 84777 gene locus_tag LOCUS_06120 84340 84777 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_06120 85142 85927 gene locus_tag LOCUS_06130 85142 85927 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963852.1 protein_id gnl|my_center|LOCUS_06130 86108 88237 gene locus_tag LOCUS_06140 86108 88237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 88316 89992 gene locus_tag LOCUS_06150 88316 89992 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674766.1 protein_id gnl|my_center|LOCUS_06150 89989 90768 gene locus_tag LOCUS_06160 gene yidA 89989 90768 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547047.1 protein_id gnl|my_center|LOCUS_06160 91079 92704 gene locus_tag LOCUS_06170 91079 92704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 93334 96810 gene locus_tag LOCUS_06180 93334 96810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 97687 99027 gene locus_tag LOCUS_06190 97687 99027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 99146 100804 gene locus_tag LOCUS_06200 99146 100804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 101260 102159 gene locus_tag LOCUS_06210 101260 102159 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033876.1 protein_id gnl|my_center|LOCUS_06210 102338 103423 gene locus_tag LOCUS_06220 102338 103423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 103522 104316 gene locus_tag LOCUS_06230 103522 104316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926884.1 protein_id gnl|my_center|LOCUS_06230 104678 104968 gene locus_tag LOCUS_06240 104678 104968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 105191 106087 gene locus_tag LOCUS_06250 105191 106087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 107111 106596 gene locus_tag LOCUS_06260 107111 106596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 107424 109475 gene locus_tag LOCUS_06270 107424 109475 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162265982.1 protein_id gnl|my_center|LOCUS_06270 109803 110852 gene locus_tag LOCUS_06280 109803 110852 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_06280 110833 111486 gene locus_tag LOCUS_06290 110833 111486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388547.1 protein_id gnl|my_center|LOCUS_06290 111574 112407 gene locus_tag LOCUS_06300 111574 112407 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 protein_id gnl|my_center|LOCUS_06300 114461 112548 gene locus_tag LOCUS_06310 114461 112548 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_06310 115028 114576 gene locus_tag LOCUS_06320 115028 114576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 115150 116250 gene locus_tag LOCUS_06330 115150 116250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 116447 116932 gene locus_tag LOCUS_06340 116447 116932 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964663.1 protein_id gnl|my_center|LOCUS_06340 117347 118417 gene locus_tag LOCUS_06350 117347 118417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_06350 118410 119243 gene locus_tag LOCUS_06360 118410 119243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_06360 119243 120046 gene locus_tag LOCUS_06370 119243 120046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_06370 120043 121134 gene locus_tag LOCUS_06380 120043 121134 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_06380 122134 121250 gene locus_tag LOCUS_06390 122134 121250 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802592.1 protein_id gnl|my_center|LOCUS_06390 122599 123000 gene locus_tag LOCUS_06400 122599 123000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 122948 123736 gene locus_tag LOCUS_06410 122948 123736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06410 123903 124109 gene locus_tag LOCUS_06420 123903 124109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 124106 125248 gene locus_tag LOCUS_06430 124106 125248 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041082676.1 protein_id gnl|my_center|LOCUS_06430 125248 126075 gene locus_tag LOCUS_06440 125248 126075 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_06440 126072 126599 gene locus_tag LOCUS_06450 126072 126599 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_06450 126951 126679 gene locus_tag LOCUS_06460 126951 126679 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027435.1 protein_id gnl|my_center|LOCUS_06460 127169 126948 gene locus_tag LOCUS_06470 127169 126948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 127598 127188 gene locus_tag LOCUS_06480 gene vapC 127598 127188 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_06480 127827 127591 gene locus_tag LOCUS_06490 127827 127591 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307811.1 protein_id gnl|my_center|LOCUS_06490 128101 129705 gene locus_tag LOCUS_06500 128101 129705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence05 488 159 gene locus_tag LOCUS_06510 488 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 670 2598 gene locus_tag LOCUS_06520 670 2598 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949159.1 protein_id gnl|my_center|LOCUS_06520 2613 3263 gene locus_tag LOCUS_06530 gene trmB 2613 3263 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_06530 3276 4472 gene locus_tag LOCUS_06540 gene ftsW 3276 4472 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_06540 5016 4555 gene locus_tag LOCUS_06550 5016 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5162 6550 gene locus_tag LOCUS_06560 5162 6550 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392489.1 protein_id gnl|my_center|LOCUS_06560 6547 8034 gene locus_tag LOCUS_06570 6547 8034 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_06570 8064 8741 gene locus_tag LOCUS_06580 8064 8741 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_06580 8764 9309 gene locus_tag LOCUS_06590 gene rnmV 8764 9309 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_06590 9306 10178 gene locus_tag LOCUS_06600 gene rsmA 9306 10178 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_06600 10368 11882 gene locus_tag LOCUS_06610 10368 11882 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996423.1 protein_id gnl|my_center|LOCUS_06610 12237 12046 gene locus_tag LOCUS_06620 12237 12046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 12475 12867 gene locus_tag LOCUS_06630 12475 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 12874 16113 gene locus_tag LOCUS_06640 12874 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 17180 16281 gene locus_tag LOCUS_06650 17180 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06650 17355 17197 gene locus_tag LOCUS_06660 17355 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 17778 17530 gene locus_tag LOCUS_06670 17778 17530 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_06670 18037 17771 gene locus_tag LOCUS_06680 18037 17771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 18634 18065 gene locus_tag LOCUS_06690 18634 18065 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_06690 19135 18719 gene locus_tag LOCUS_06700 19135 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 19169 19657 gene locus_tag LOCUS_06710 19169 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 19801 21876 gene locus_tag LOCUS_06720 19801 21876 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_06720 21922 23703 gene locus_tag LOCUS_06730 21922 23703 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_06730 23790 25988 gene locus_tag LOCUS_06740 23790 25988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 26859 26077 gene locus_tag LOCUS_06750 26859 26077 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_06750 27328 26930 gene locus_tag LOCUS_06760 27328 26930 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807906.1 protein_id gnl|my_center|LOCUS_06760 28459 27374 gene locus_tag LOCUS_06770 28459 27374 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948951.1 protein_id gnl|my_center|LOCUS_06770 29905 28472 gene locus_tag LOCUS_06780 29905 28472 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948950.1 protein_id gnl|my_center|LOCUS_06780 30795 29902 gene locus_tag LOCUS_06790 gene murQ 30795 29902 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 protein_id gnl|my_center|LOCUS_06790 32687 30927 gene locus_tag LOCUS_06800 32687 30927 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_06800 33940 32684 gene locus_tag LOCUS_06810 33940 32684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 34455 33955 gene locus_tag LOCUS_06820 gene nuoE 34455 33955 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_06820 34787 35026 gene locus_tag LOCUS_06830 34787 35026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 35276 36427 gene locus_tag LOCUS_06840 35276 36427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 37299 36508 gene locus_tag LOCUS_06850 37299 36508 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927632.1 protein_id gnl|my_center|LOCUS_06850 38437 37421 gene locus_tag LOCUS_06860 gene degA 38437 37421 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_06860 38840 39850 gene locus_tag LOCUS_06870 38840 39850 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972787.1 protein_id gnl|my_center|LOCUS_06870 39957 40538 gene locus_tag LOCUS_06880 39957 40538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 40538 41839 gene locus_tag LOCUS_06890 40538 41839 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_06890 41990 43000 gene locus_tag LOCUS_06900 41990 43000 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529042.1 protein_id gnl|my_center|LOCUS_06900 43234 44646 gene locus_tag LOCUS_06910 gene uxaC 43234 44646 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_06910 44659 46125 gene locus_tag LOCUS_06920 44659 46125 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174192.1 protein_id gnl|my_center|LOCUS_06920 46127 47626 gene locus_tag LOCUS_06930 46127 47626 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_06930 47733 48185 gene locus_tag LOCUS_06940 47733 48185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 48297 50081 gene locus_tag LOCUS_06950 48297 50081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 50216 51613 gene locus_tag LOCUS_06960 50216 51613 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_06960 51835 53193 gene locus_tag LOCUS_06970 51835 53193 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272513.1 protein_id gnl|my_center|LOCUS_06970 53440 65007 gene locus_tag LOCUS_06980 53440 65007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 65051 66796 gene locus_tag LOCUS_06990 gene hxuB 65051 66796 CDS product heme/hemopexin-binding protein HxuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694040.1 protein_id gnl|my_center|LOCUS_06990 67004 67078 gene locus_tag LOCUS_t00130 67004 67078 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 67083 67157 gene locus_tag LOCUS_t00140 67083 67157 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 67213 67289 gene locus_tag LOCUS_t00150 67213 67289 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67320 67397 gene locus_tag LOCUS_t00160 67320 67397 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 67404 67489 gene locus_tag LOCUS_t00170 67404 67489 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 67977 67582 gene locus_tag LOCUS_07000 67977 67582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 68391 69881 gene locus_tag LOCUS_07010 68391 69881 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261755.1 protein_id gnl|my_center|LOCUS_07010 69961 70038 gene locus_tag LOCUS_t00180 69961 70038 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 70212 70817 gene locus_tag LOCUS_07020 70212 70817 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812956.1 protein_id gnl|my_center|LOCUS_07020 70860 72047 gene locus_tag LOCUS_07030 gene nirJ1 70860 72047 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_07030 72048 73046 gene locus_tag LOCUS_07040 gene nirJ2 72048 73046 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460177.1 protein_id gnl|my_center|LOCUS_07040 73506 74309 gene locus_tag LOCUS_07050 73506 74309 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_07050 74327 75178 gene locus_tag LOCUS_07060 74327 75178 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_07060 75542 75772 gene locus_tag LOCUS_07070 75542 75772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 76543 75959 gene locus_tag LOCUS_07080 76543 75959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 76673 77872 gene locus_tag LOCUS_07090 gene hydF 76673 77872 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_07090 77918 78811 gene locus_tag LOCUS_07100 77918 78811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 78958 79890 gene locus_tag LOCUS_07110 gene metA 78958 79890 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796420.1 protein_id gnl|my_center|LOCUS_07110 79999 80607 gene locus_tag LOCUS_07120 79999 80607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 80614 81672 gene locus_tag LOCUS_07130 gene hydE 80614 81672 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_07130 81713 82867 gene locus_tag LOCUS_07140 gene nagA 81713 82867 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963512.1 protein_id gnl|my_center|LOCUS_07140 82860 83756 gene locus_tag LOCUS_07150 82860 83756 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433828.1 protein_id gnl|my_center|LOCUS_07150 84919 83813 gene locus_tag LOCUS_07160 84919 83813 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_07160 85886 85128 gene locus_tag LOCUS_07170 85886 85128 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974643.1 protein_id gnl|my_center|LOCUS_07170 86073 85999 gene locus_tag LOCUS_t00190 86073 85999 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 86153 86079 gene locus_tag LOCUS_t00200 86153 86079 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 86232 86158 gene locus_tag LOCUS_t00210 86232 86158 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 87741 86281 gene locus_tag LOCUS_07180 gene gltX 87741 86281 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_07180 88408 87782 gene locus_tag LOCUS_07190 gene dhaL 88408 87782 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707689.1 protein_id gnl|my_center|LOCUS_07190 88701 89615 gene locus_tag LOCUS_07200 88701 89615 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964063.1 protein_id gnl|my_center|LOCUS_07200 89947 90639 gene locus_tag LOCUS_07210 89947 90639 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_07210 90668 92074 gene locus_tag LOCUS_07220 90668 92074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 92110 92961 gene locus_tag LOCUS_07230 gene rfbD 92110 92961 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 protein_id gnl|my_center|LOCUS_07230 93217 94479 gene locus_tag LOCUS_07240 gene sstT 93217 94479 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_07240 94928 94584 gene locus_tag LOCUS_07250 94928 94584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 95115 95876 gene locus_tag LOCUS_07260 95115 95876 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545555.1 protein_id gnl|my_center|LOCUS_07260 95891 97246 gene locus_tag LOCUS_07270 95891 97246 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_07270 97405 99087 gene locus_tag LOCUS_07280 97405 99087 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_07280 99226 100695 gene locus_tag LOCUS_07290 99226 100695 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_07290 100777 101433 gene locus_tag LOCUS_07300 100777 101433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 101460 102791 gene locus_tag LOCUS_07310 101460 102791 CDS product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929011.1 protein_id gnl|my_center|LOCUS_07310 102794 103465 gene locus_tag LOCUS_07320 102794 103465 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_07320 103608 104249 gene locus_tag LOCUS_07330 103608 104249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 104218 105537 gene locus_tag LOCUS_07340 gene hemA 104218 105537 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_07340 105497 106438 gene locus_tag LOCUS_07350 gene hemC 105497 106438 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_07350 106459 107973 gene locus_tag LOCUS_07360 gene cobA 106459 107973 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_07360 108313 109299 gene locus_tag LOCUS_07370 gene hemB 108313 109299 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_07370 109359 110678 gene locus_tag LOCUS_07380 gene hemL 109359 110678 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_07380 110768 110911 gene locus_tag LOCUS_07390 gene scfA 110768 110911 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_07390 111138 112535 gene locus_tag LOCUS_07400 gene scfB 111138 112535 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_07400 112818 113834 gene locus_tag LOCUS_07410 gene gap 112818 113834 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_07410 113938 115131 gene locus_tag LOCUS_07420 113938 115131 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_07420 115242 115991 gene locus_tag LOCUS_07430 gene tpiA 115242 115991 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964030.1 protein_id gnl|my_center|LOCUS_07430 116034 117563 gene locus_tag LOCUS_07440 gene gpmI 116034 117563 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_07440 117684 118379 gene locus_tag LOCUS_07450 117684 118379 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_07450 118589 119590 gene locus_tag LOCUS_07460 118589 119590 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence06 686 330 gene locus_tag LOCUS_07470 686 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1151 741 gene locus_tag LOCUS_07480 1151 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1607 1290 gene locus_tag LOCUS_07490 1607 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2043 1783 gene locus_tag LOCUS_07500 2043 1783 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677040.1 protein_id gnl|my_center|LOCUS_07500 2303 2178 gene locus_tag LOCUS_07510 2303 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2848 2336 gene locus_tag LOCUS_07520 2848 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 3053 3649 gene locus_tag LOCUS_07530 3053 3649 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868997.1 protein_id gnl|my_center|LOCUS_07530 3686 4372 gene locus_tag LOCUS_07540 gene bioD 3686 4372 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_07540 4386 5750 gene locus_tag LOCUS_07550 gene bioA 4386 5750 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_07550 6946 5837 gene locus_tag LOCUS_07560 6946 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 7508 6975 gene locus_tag LOCUS_07570 7508 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 8323 7568 gene locus_tag LOCUS_07580 8323 7568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_07580 8582 9004 gene locus_tag LOCUS_07590 8582 9004 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_07590 10089 9073 gene locus_tag LOCUS_07600 10089 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 11728 10142 gene locus_tag LOCUS_07610 11728 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 12563 11784 gene locus_tag LOCUS_07620 12563 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 12984 12547 gene locus_tag LOCUS_07630 12984 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 14004 13030 gene locus_tag LOCUS_07640 14004 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 15209 14118 gene locus_tag LOCUS_07650 gene mnmA 15209 14118 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_07650 15972 15211 gene locus_tag LOCUS_07660 15972 15211 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_07660 16508 15987 gene locus_tag LOCUS_07670 gene lepB 16508 15987 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_07670 16948 16607 gene locus_tag LOCUS_07680 gene rplS 16948 16607 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_07680 17183 18499 gene locus_tag LOCUS_07690 17183 18499 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394037.1 protein_id gnl|my_center|LOCUS_07690 19468 18557 gene locus_tag LOCUS_07700 19468 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 19698 20534 gene locus_tag LOCUS_07710 19698 20534 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_07710 21482 20631 gene locus_tag LOCUS_07720 21482 20631 CDS product MTAP family purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393347.1 protein_id gnl|my_center|LOCUS_07720 22510 21485 gene locus_tag LOCUS_07730 gene mqnC 22510 21485 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_07730 23625 22507 gene locus_tag LOCUS_07740 gene mqnE 23625 22507 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_07740 24732 23638 gene locus_tag LOCUS_07750 gene mqnE 24732 23638 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_07750 25379 25041 gene locus_tag LOCUS_07760 25379 25041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 25639 25376 gene locus_tag LOCUS_07770 25639 25376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 25818 25603 gene locus_tag LOCUS_07780 25818 25603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 31557 25894 gene locus_tag LOCUS_07790 31557 25894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 32633 31440 gene locus_tag LOCUS_07800 32633 31440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 32855 32646 gene locus_tag LOCUS_07810 32855 32646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 32967 33455 gene locus_tag LOCUS_07820 32967 33455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 35517 34063 gene locus_tag LOCUS_07830 35517 34063 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130286390.1 protein_id gnl|my_center|LOCUS_07830 36216 35632 gene locus_tag LOCUS_07840 36216 35632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 38258 36432 gene locus_tag LOCUS_07850 gene typA 38258 36432 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_07850 38572 40107 gene locus_tag LOCUS_07860 38572 40107 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_07860 40104 42293 gene locus_tag LOCUS_07870 40104 42293 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 protein_id gnl|my_center|LOCUS_07870 42421 43374 gene locus_tag LOCUS_07880 gene ppx 42421 43374 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641094.1 protein_id gnl|my_center|LOCUS_07880 43509 43853 gene locus_tag LOCUS_07890 43509 43853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 44532 43942 gene locus_tag LOCUS_07900 gene pyrE 44532 43942 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_07900 45245 44529 gene locus_tag LOCUS_07910 gene pyrF 45245 44529 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_07910 46271 45354 gene locus_tag LOCUS_07920 46271 45354 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_07920 47044 46268 gene locus_tag LOCUS_07930 gene pyrK 47044 46268 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 protein_id gnl|my_center|LOCUS_07930 50264 47037 gene locus_tag LOCUS_07940 gene carB 50264 47037 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_07940 51341 50268 gene locus_tag LOCUS_07950 gene carA 51341 50268 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_07950 52701 51415 gene locus_tag LOCUS_07960 52701 51415 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_07960 53645 52698 gene locus_tag LOCUS_07970 53645 52698 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_07970 54817 53948 gene locus_tag LOCUS_07980 54817 53948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 54833 55102 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttctaagccgcctatgcggcggtcaac 55827 55249 gene locus_tag LOCUS_07990 55827 55249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 56857 55829 gene locus_tag LOCUS_08000 gene csy3 56857 55829 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957412.1 protein_id gnl|my_center|LOCUS_08000 57828 56872 gene locus_tag LOCUS_08010 57828 56872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 59003 57825 gene locus_tag LOCUS_08020 gene csy1 59003 57825 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_08020 62393 59070 gene locus_tag LOCUS_08030 gene cas3f 62393 59070 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_08030 62965 62390 gene locus_tag LOCUS_08040 62965 62390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 64750 63032 gene locus_tag LOCUS_08050 gene recN 64750 63032 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_08050 65343 64858 gene locus_tag LOCUS_08060 gene argR 65343 64858 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_08060 66226 65375 gene locus_tag LOCUS_08070 66226 65375 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_08070 67066 66257 gene locus_tag LOCUS_08080 67066 66257 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_08080 68958 67066 gene locus_tag LOCUS_08090 gene dxs 68958 67066 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_08090 69839 68958 gene locus_tag LOCUS_08100 69839 68958 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810943.1 protein_id gnl|my_center|LOCUS_08100 70080 69844 gene locus_tag LOCUS_08110 70080 69844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 71306 70083 gene locus_tag LOCUS_08120 gene xseA 71306 70083 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438130.1 protein_id gnl|my_center|LOCUS_08120 71769 71368 gene locus_tag LOCUS_08130 71769 71368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 72138 71878 gene locus_tag LOCUS_08140 72138 71878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 72728 72150 gene locus_tag LOCUS_08150 72728 72150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 73159 72746 gene locus_tag LOCUS_08160 73159 72746 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_08160 73977 73420 gene locus_tag LOCUS_08170 gene efp 73977 73420 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_08170 75175 74093 gene locus_tag LOCUS_08180 gene papA 75175 74093 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_08180 75650 75207 gene locus_tag LOCUS_08190 gene aroQ 75650 75207 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256299.1 protein_id gnl|my_center|LOCUS_08190 75953 75663 gene locus_tag LOCUS_08200 75953 75663 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404796.1 protein_id gnl|my_center|LOCUS_08200 77204 75960 gene locus_tag LOCUS_08210 77204 75960 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_08210 77863 77243 gene locus_tag LOCUS_08220 77863 77243 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964993.1 protein_id gnl|my_center|LOCUS_08220 79127 77880 gene locus_tag LOCUS_08230 gene mltG 79127 77880 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_08230 79532 79224 gene locus_tag LOCUS_08240 79532 79224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 80003 79587 gene locus_tag LOCUS_08250 gene ruvX 80003 79587 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_08250 80251 80000 gene locus_tag LOCUS_08260 80251 80000 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719797.1 protein_id gnl|my_center|LOCUS_08260 82240 80423 gene locus_tag LOCUS_08270 82240 80423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 82831 83121 gene locus_tag LOCUS_08280 gene mqsR 82831 83121 CDS product type II toxin-antitoxin system toxin MqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415584.1 protein_id gnl|my_center|LOCUS_08280 83140 83547 gene locus_tag LOCUS_08290 83140 83547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 84714 83680 gene locus_tag LOCUS_08300 84714 83680 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_08300 85586 84789 gene locus_tag LOCUS_08310 gene dapB 85586 84789 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_08310 85774 87843 gene locus_tag LOCUS_08320 gene recG 85774 87843 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_08320 87935 89029 gene locus_tag LOCUS_08330 gene mutY 87935 89029 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_08330 89646 89089 gene locus_tag LOCUS_08340 89646 89089 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816766.1 protein_id gnl|my_center|LOCUS_08340 90307 89705 gene locus_tag LOCUS_08350 gene coaE 90307 89705 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027337.1 protein_id gnl|my_center|LOCUS_08350 92721 90355 gene locus_tag LOCUS_08360 gene polA 92721 90355 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_08360 92969 92832 gene locus_tag LOCUS_08370 92969 92832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 92837 92846 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 94186 92975 gene locus_tag LOCUS_08380 94186 92975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 94785 94348 gene locus_tag LOCUS_08390 gene ndk 94785 94348 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723912.1 protein_id gnl|my_center|LOCUS_08390 95338 94802 gene locus_tag LOCUS_08400 95338 94802 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_08400 96673 95426 gene locus_tag LOCUS_08410 96673 95426 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707495.1 protein_id gnl|my_center|LOCUS_08410 97924 96698 gene locus_tag LOCUS_08420 97924 96698 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816160.1 protein_id gnl|my_center|LOCUS_08420 98190 98026 gene locus_tag LOCUS_08430 98190 98026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 98443 98219 gene locus_tag LOCUS_08440 98443 98219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 99221 98514 gene locus_tag LOCUS_08450 99221 98514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 99609 99229 gene locus_tag LOCUS_08460 99609 99229 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_08460 100910 100008 gene locus_tag LOCUS_08470 100910 100008 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_08470 101407 101042 gene locus_tag LOCUS_08480 101407 101042 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_08480 101745 101473 gene locus_tag LOCUS_08490 101745 101473 CDS product DUF6429 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008692742.1 protein_id gnl|my_center|LOCUS_08490 102478 101891 gene locus_tag LOCUS_08500 102478 101891 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922263.1 protein_id gnl|my_center|LOCUS_08500 102923 102540 gene locus_tag LOCUS_08510 102923 102540 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671440.1 protein_id gnl|my_center|LOCUS_08510 103153 102947 gene locus_tag LOCUS_08520 103153 102947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 103586 103179 gene locus_tag LOCUS_08530 103586 103179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 104023 103637 gene locus_tag LOCUS_08540 104023 103637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 104647 104063 gene locus_tag LOCUS_08550 104647 104063 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_08550 105135 104647 gene locus_tag LOCUS_08560 105135 104647 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066995.1 protein_id gnl|my_center|LOCUS_08560 105417 105569 gene locus_tag LOCUS_08570 105417 105569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 105902 106321 gene locus_tag LOCUS_08580 105902 106321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 106453 106842 gene locus_tag LOCUS_08590 gene tsaA 106453 106842 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458878.1 protein_id gnl|my_center|LOCUS_08590 107189 106920 gene locus_tag LOCUS_08600 107189 106920 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 protein_id gnl|my_center|LOCUS_08600 107391 107254 gene locus_tag LOCUS_08610 107391 107254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 108612 107620 gene locus_tag LOCUS_08620 108612 107620 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_08620 109156 108686 gene locus_tag LOCUS_08630 109156 108686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 109634 109146 gene locus_tag LOCUS_08640 109634 109146 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_08640 110171 109650 gene locus_tag LOCUS_08650 110171 109650 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_08650 110989 110195 gene locus_tag LOCUS_08660 110989 110195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 111607 111017 gene locus_tag LOCUS_08670 111607 111017 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922263.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence07 88 582 gene locus_tag LOCUS_08680 88 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08680 1485 1602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1735 1908 gene locus_tag LOCUS_08690 1735 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1998 3134 gene locus_tag LOCUS_08700 gene glf 1998 3134 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101279.1 protein_id gnl|my_center|LOCUS_08700 3131 3751 gene locus_tag LOCUS_08710 3131 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3773 5803 gene locus_tag LOCUS_08720 3773 5803 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040347516.1 protein_id gnl|my_center|LOCUS_08720 5990 6757 gene locus_tag LOCUS_08730 5990 6757 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963440.1 protein_id gnl|my_center|LOCUS_08730 6754 8772 gene locus_tag LOCUS_08740 6754 8772 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839094.1 protein_id gnl|my_center|LOCUS_08740 9170 10066 gene locus_tag LOCUS_08750 9170 10066 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_08750 10236 10610 gene locus_tag LOCUS_08760 10236 10610 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_08760 10710 12362 gene locus_tag LOCUS_08770 gene ilvD 10710 12362 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_08770 14130 12448 gene locus_tag LOCUS_08780 gene ilvB 14130 12448 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944692.1 protein_id gnl|my_center|LOCUS_08780 15218 14208 gene locus_tag LOCUS_08790 gene ilvC 15218 14208 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_08790 15567 16793 gene locus_tag LOCUS_08800 gene ilvA 15567 16793 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_08800 18730 16892 gene locus_tag LOCUS_08810 18730 16892 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 protein_id gnl|my_center|LOCUS_08810 19024 19473 gene locus_tag LOCUS_08820 19024 19473 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477506.1 protein_id gnl|my_center|LOCUS_08820 19670 21937 gene locus_tag LOCUS_08830 19670 21937 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_08830 22099 22863 gene locus_tag LOCUS_08840 22099 22863 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391974.1 protein_id gnl|my_center|LOCUS_08840 22887 24356 gene locus_tag LOCUS_08850 22887 24356 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_08850 24356 25018 gene locus_tag LOCUS_08860 24356 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 25005 28397 gene locus_tag LOCUS_08870 25005 28397 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08870 28720 28863 gene locus_tag LOCUS_08880 28720 28863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 29069 30709 gene locus_tag LOCUS_08890 gene hcp 29069 30709 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966698.1 protein_id gnl|my_center|LOCUS_08890 32112 30850 gene locus_tag LOCUS_08900 32112 30850 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307053.1 protein_id gnl|my_center|LOCUS_08900 33949 32255 gene locus_tag LOCUS_08910 33949 32255 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 protein_id gnl|my_center|LOCUS_08910 34242 34817 gene locus_tag LOCUS_08920 34242 34817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 34963 35649 gene locus_tag LOCUS_08930 34963 35649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 35653 36273 gene locus_tag LOCUS_08940 35653 36273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838378.1 protein_id gnl|my_center|LOCUS_08940 36254 36925 gene locus_tag LOCUS_08950 36254 36925 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956994.1 protein_id gnl|my_center|LOCUS_08950 36978 37652 gene locus_tag LOCUS_08960 36978 37652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 37649 38026 gene locus_tag LOCUS_08970 37649 38026 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_08970 38026 40125 gene locus_tag LOCUS_08980 38026 40125 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_08980 40336 40824 gene locus_tag LOCUS_08990 gene nrfH 40336 40824 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546298.1 protein_id gnl|my_center|LOCUS_08990 40817 42097 gene locus_tag LOCUS_09000 40817 42097 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810724.1 protein_id gnl|my_center|LOCUS_09000 42729 42247 gene locus_tag LOCUS_09010 gene moaC 42729 42247 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_09010 44212 42872 gene locus_tag LOCUS_09020 44212 42872 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459021.1 protein_id gnl|my_center|LOCUS_09020 44414 45103 gene locus_tag LOCUS_09030 44414 45103 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013859.1 protein_id gnl|my_center|LOCUS_09030 45201 45386 gene locus_tag LOCUS_09040 45201 45386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 45431 45874 gene locus_tag LOCUS_09050 45431 45874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 46116 49805 gene locus_tag LOCUS_09060 46116 49805 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_09060 49795 51213 gene locus_tag LOCUS_09070 gene narH 49795 51213 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244173.1 protein_id gnl|my_center|LOCUS_09070 51217 51762 gene locus_tag LOCUS_09080 gene narJ 51217 51762 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242466.1 protein_id gnl|my_center|LOCUS_09080 51759 52424 gene locus_tag LOCUS_09090 gene narI 51759 52424 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003331448.1 protein_id gnl|my_center|LOCUS_09090 52701 53801 gene locus_tag LOCUS_09100 gene mobAB 52701 53801 CDS product bifunctional molybdenum cofactor guanylyltransferase MobA/molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085010767.1 protein_id gnl|my_center|LOCUS_09100 53993 54370 gene locus_tag LOCUS_09110 53993 54370 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921517.1 protein_id gnl|my_center|LOCUS_09110 56499 54754 gene locus_tag LOCUS_09120 56499 54754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 56671 57261 gene locus_tag LOCUS_09130 56671 57261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 57707 57357 gene locus_tag LOCUS_09140 57707 57357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 57707 58228 gene locus_tag LOCUS_09150 57707 58228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 58248 59801 gene locus_tag LOCUS_09160 58248 59801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 59965 60402 gene locus_tag LOCUS_09170 59965 60402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 60415 61386 gene locus_tag LOCUS_09180 60415 61386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 62316 61501 gene locus_tag LOCUS_09190 62316 61501 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964193.1 protein_id gnl|my_center|LOCUS_09190 62582 62944 gene locus_tag LOCUS_09200 62582 62944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 63058 64287 gene locus_tag LOCUS_09210 63058 64287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 64303 65139 gene locus_tag LOCUS_09220 64303 65139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 66650 65298 gene locus_tag LOCUS_09230 66650 65298 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812351.1 protein_id gnl|my_center|LOCUS_09230 67116 67041 gene locus_tag LOCUS_t00220 67116 67041 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 68386 67208 gene locus_tag LOCUS_09240 68386 67208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_09240 68751 70550 gene locus_tag LOCUS_09250 68751 70550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 70740 73319 gene locus_tag LOCUS_09260 70740 73319 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_09260 73950 76763 gene locus_tag LOCUS_09270 73950 76763 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989569.1 protein_id gnl|my_center|LOCUS_09270 77097 77531 gene locus_tag LOCUS_09280 77097 77531 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721901.1 protein_id gnl|my_center|LOCUS_09280 77622 78104 gene locus_tag LOCUS_09290 77622 78104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09290 78185 78994 gene locus_tag LOCUS_09300 78185 78994 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721899.1 protein_id gnl|my_center|LOCUS_09300 79020 79844 gene locus_tag LOCUS_09310 79020 79844 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211067.1 protein_id gnl|my_center|LOCUS_09310 80072 80986 gene locus_tag LOCUS_09320 gene pfkA 80072 80986 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821167.1 protein_id gnl|my_center|LOCUS_09320 81140 82840 gene locus_tag LOCUS_09330 81140 82840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 82842 84518 gene locus_tag LOCUS_09340 82842 84518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 85802 84531 gene locus_tag LOCUS_09350 gene lysA 85802 84531 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 protein_id gnl|my_center|LOCUS_09350 86033 86416 gene locus_tag LOCUS_09360 86033 86416 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382894.1 protein_id gnl|my_center|LOCUS_09360 86484 88934 gene locus_tag LOCUS_09370 86484 88934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 88954 90099 gene locus_tag LOCUS_09380 88954 90099 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272331.1 protein_id gnl|my_center|LOCUS_09380 90129 91463 gene locus_tag LOCUS_09390 90129 91463 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_09390 91533 93455 gene locus_tag LOCUS_09400 91533 93455 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_09400 93525 94817 gene locus_tag LOCUS_09410 93525 94817 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_09410 94864 96219 gene locus_tag LOCUS_09420 gene rpoN 94864 96219 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_09420 96486 97748 gene locus_tag LOCUS_09430 96486 97748 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941161.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence08 1271 303 gene locus_tag LOCUS_09440 1271 303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053070.1 protein_id gnl|my_center|LOCUS_09440 1612 1376 gene locus_tag LOCUS_09450 1612 1376 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963456.1 protein_id gnl|my_center|LOCUS_09450 2208 1612 gene locus_tag LOCUS_09460 gene recR 2208 1612 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_09460 2543 2208 gene locus_tag LOCUS_09470 2543 2208 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_09470 4566 2641 gene locus_tag LOCUS_09480 4566 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4899 4808 gene locus_tag LOCUS_t00230 4899 4808 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5693 5019 gene locus_tag LOCUS_09490 5693 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 6063 5668 gene locus_tag LOCUS_09500 6063 5668 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_09500 7440 6238 gene locus_tag LOCUS_09510 7440 6238 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701408.1 protein_id gnl|my_center|LOCUS_09510 7906 7520 gene locus_tag LOCUS_09520 7906 7520 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358536.1 protein_id gnl|my_center|LOCUS_09520 9255 7933 gene locus_tag LOCUS_09530 9255 7933 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_09530 10479 9298 gene locus_tag LOCUS_09540 10479 9298 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_09540 11155 10502 gene locus_tag LOCUS_09550 gene deoC 11155 10502 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_09550 12022 11462 gene locus_tag LOCUS_09560 12022 11462 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142381.1 protein_id gnl|my_center|LOCUS_09560 12027 12227 gene locus_tag LOCUS_09570 12027 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 12181 12756 gene locus_tag LOCUS_09580 12181 12756 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775209.1 protein_id gnl|my_center|LOCUS_09580 12787 13848 gene locus_tag LOCUS_09590 12787 13848 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_09590 14061 14354 gene locus_tag LOCUS_09600 14061 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 14363 14866 gene locus_tag LOCUS_09610 gene nrdG 14363 14866 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_09610 15026 15466 gene locus_tag LOCUS_09620 15026 15466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09620 15493 15909 gene locus_tag LOCUS_09630 15493 15909 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_09630 16074 17603 gene locus_tag LOCUS_09640 16074 17603 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 protein_id gnl|my_center|LOCUS_09640 18128 17700 gene locus_tag LOCUS_09650 18128 17700 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_09650 19546 18134 gene locus_tag LOCUS_09660 gene atpD 19546 18134 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_09660 20425 19571 gene locus_tag LOCUS_09670 gene atpG 20425 19571 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_09670 21956 20445 gene locus_tag LOCUS_09680 gene atpA 21956 20445 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_09680 22529 21987 gene locus_tag LOCUS_09690 gene atpH 22529 21987 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 protein_id gnl|my_center|LOCUS_09690 23026 22523 gene locus_tag LOCUS_09700 23026 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 23317 23066 gene locus_tag LOCUS_09710 23317 23066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 24054 23371 gene locus_tag LOCUS_09720 gene atpB 24054 23371 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_09720 24521 24129 gene locus_tag LOCUS_09730 24521 24129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 25067 24831 gene locus_tag LOCUS_09740 25067 24831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 25287 26426 gene locus_tag LOCUS_09750 25287 26426 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817365.1 protein_id gnl|my_center|LOCUS_09750 26456 27628 gene locus_tag LOCUS_09760 26456 27628 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_09760 29010 27706 gene locus_tag LOCUS_09770 29010 27706 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388551.1 protein_id gnl|my_center|LOCUS_09770 30519 29023 gene locus_tag LOCUS_09780 30519 29023 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388531.1 protein_id gnl|my_center|LOCUS_09780 31309 30554 gene locus_tag LOCUS_09790 31309 30554 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837550.1 protein_id gnl|my_center|LOCUS_09790 32087 31275 gene locus_tag LOCUS_09800 32087 31275 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505205.1 protein_id gnl|my_center|LOCUS_09800 32787 32101 gene locus_tag LOCUS_09810 32787 32101 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988904.1 protein_id gnl|my_center|LOCUS_09810 33633 32794 gene locus_tag LOCUS_09820 33633 32794 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714633.1 protein_id gnl|my_center|LOCUS_09820 34509 33652 gene locus_tag LOCUS_09830 gene nifH 34509 33652 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963576.1 protein_id gnl|my_center|LOCUS_09830 34921 34553 gene locus_tag LOCUS_09840 34921 34553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 35805 34942 gene locus_tag LOCUS_09850 35805 34942 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943381.1 protein_id gnl|my_center|LOCUS_09850 36289 35939 gene locus_tag LOCUS_09860 36289 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 37625 36462 gene locus_tag LOCUS_09870 gene wecB 37625 36462 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 protein_id gnl|my_center|LOCUS_09870 38731 37676 gene locus_tag LOCUS_09880 38731 37676 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_09880 39321 38860 gene locus_tag LOCUS_09890 39321 38860 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_09890 39952 39503 gene locus_tag LOCUS_09900 gene ruvX 39952 39503 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_09900 41339 40059 gene locus_tag LOCUS_09910 41339 40059 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583194.1 protein_id gnl|my_center|LOCUS_09910 42478 41378 gene locus_tag LOCUS_09920 gene lptG 42478 41378 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_09920 43211 42492 gene locus_tag LOCUS_09930 gene lptB 43211 42492 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_09930 43947 43267 gene locus_tag LOCUS_09940 43947 43267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 44830 44120 gene locus_tag LOCUS_09950 44830 44120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 45735 44827 gene locus_tag LOCUS_09960 45735 44827 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_09960 46341 45778 gene locus_tag LOCUS_09970 46341 45778 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200146.1 protein_id gnl|my_center|LOCUS_09970 47328 46342 gene locus_tag LOCUS_09980 47328 46342 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_09980 48176 47352 gene locus_tag LOCUS_09990 gene kdsA 48176 47352 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_09990 48933 48205 gene locus_tag LOCUS_10000 gene kdsB 48933 48205 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_10000 51447 48937 gene locus_tag LOCUS_10010 51447 48937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 53191 51449 gene locus_tag LOCUS_10020 53191 51449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_10020 54345 53188 gene locus_tag LOCUS_10030 gene lpxB 54345 53188 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_10030 55283 54480 gene locus_tag LOCUS_10040 gene lpxI 55283 54480 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_10040 56122 55310 gene locus_tag LOCUS_10050 gene lpxA 56122 55310 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_10050 56752 56309 gene locus_tag LOCUS_10060 gene fabZ 56752 56309 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462206.1 protein_id gnl|my_center|LOCUS_10060 57606 56773 gene locus_tag LOCUS_10070 gene lpxC 57606 56773 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141863.1 protein_id gnl|my_center|LOCUS_10070 58548 57685 gene locus_tag LOCUS_10080 58548 57685 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_10080 59674 58643 gene locus_tag LOCUS_10090 gene lpxD 59674 58643 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_10090 60126 59689 gene locus_tag LOCUS_10100 60126 59689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 61308 60187 gene locus_tag LOCUS_10110 61308 60187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 61875 61411 gene locus_tag LOCUS_10120 61875 61411 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957688.1 protein_id gnl|my_center|LOCUS_10120 63292 62000 gene locus_tag LOCUS_10130 63292 62000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 65365 63293 gene locus_tag LOCUS_10140 65365 63293 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925192.1 protein_id gnl|my_center|LOCUS_10140 66091 65507 gene locus_tag LOCUS_10150 66091 65507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 66909 66265 gene locus_tag LOCUS_10160 66909 66265 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925428.1 protein_id gnl|my_center|LOCUS_10160 71385 66964 gene locus_tag LOCUS_10170 71385 66964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 73104 71476 gene locus_tag LOCUS_10180 gene tolC 73104 71476 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212186.1 protein_id gnl|my_center|LOCUS_10180 74506 73223 gene locus_tag LOCUS_10190 74506 73223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 75251 74496 gene locus_tag LOCUS_10200 75251 74496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_10200 76029 75259 gene locus_tag LOCUS_10210 76029 75259 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_10210 76252 77013 gene locus_tag LOCUS_10220 76252 77013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 78317 77100 gene locus_tag LOCUS_10230 78317 77100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 79421 78384 gene locus_tag LOCUS_10240 79421 78384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 80122 79460 gene locus_tag LOCUS_10250 80122 79460 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460781.1 protein_id gnl|my_center|LOCUS_10250 81182 80139 gene locus_tag LOCUS_10260 81182 80139 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 protein_id gnl|my_center|LOCUS_10260 81880 81179 gene locus_tag LOCUS_10270 81880 81179 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765262.1 protein_id gnl|my_center|LOCUS_10270 84313 82199 gene locus_tag LOCUS_10280 84313 82199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 84994 84365 gene locus_tag LOCUS_10290 84994 84365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 86243 84981 gene locus_tag LOCUS_10300 86243 84981 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_10300 87655 86270 gene locus_tag LOCUS_10310 87655 86270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 88256 87684 gene locus_tag LOCUS_10320 88256 87684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 88888 88625 gene locus_tag LOCUS_10330 88888 88625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 90208 88925 gene locus_tag LOCUS_10340 90208 88925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 91885 90296 gene locus_tag LOCUS_10350 91885 90296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 92453 91878 gene locus_tag LOCUS_10360 92453 91878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 92984 93211 gene locus_tag LOCUS_10370 92984 93211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 94544 93960 gene locus_tag LOCUS_10380 94544 93960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence09 975 541 gene locus_tag LOCUS_10390 975 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1436 2869 gene locus_tag LOCUS_10400 1436 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10400 2758 3189 gene locus_tag LOCUS_10410 2758 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10410 4026 3310 gene locus_tag LOCUS_10420 4026 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 4135 5673 gene locus_tag LOCUS_10430 4135 5673 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_10430 5690 5893 gene locus_tag LOCUS_10440 5690 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 7871 5985 gene locus_tag LOCUS_10450 7871 5985 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 protein_id gnl|my_center|LOCUS_10450 9362 8043 gene locus_tag LOCUS_10460 9362 8043 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_10460 12818 9507 gene locus_tag LOCUS_10470 12818 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 14183 12909 gene locus_tag LOCUS_10480 14183 12909 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460449.1 protein_id gnl|my_center|LOCUS_10480 15491 14250 gene locus_tag LOCUS_10490 15491 14250 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_10490 16316 15564 gene locus_tag LOCUS_10500 gene surE 16316 15564 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140447.1 protein_id gnl|my_center|LOCUS_10500 18405 16354 gene locus_tag LOCUS_10510 18405 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 18685 18610 gene locus_tag LOCUS_t00240 18685 18610 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18762 18687 gene locus_tag LOCUS_t00250 18762 18687 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19888 19013 gene locus_tag LOCUS_10520 19888 19013 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_10520 20481 20059 gene locus_tag LOCUS_10530 20481 20059 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 protein_id gnl|my_center|LOCUS_10530 20807 20571 gene locus_tag LOCUS_10540 20807 20571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 22493 20880 gene locus_tag LOCUS_10550 22493 20880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_10550 23578 22655 gene locus_tag LOCUS_10560 gene murB 23578 22655 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_10560 24106 23606 gene locus_tag LOCUS_10570 gene trmL 24106 23606 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_10570 24285 25904 gene locus_tag LOCUS_10580 24285 25904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 26671 26015 gene locus_tag LOCUS_10590 gene thiE 26671 26015 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_10590 27837 26668 gene locus_tag LOCUS_10600 gene thiH 27837 26668 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 protein_id gnl|my_center|LOCUS_10600 28642 27830 gene locus_tag LOCUS_10610 28642 27830 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393165.1 protein_id gnl|my_center|LOCUS_10610 28845 28642 gene locus_tag LOCUS_10620 28845 28642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 30630 29158 gene locus_tag LOCUS_10630 30630 29158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 32475 30919 gene locus_tag LOCUS_10640 32475 30919 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812879.1 protein_id gnl|my_center|LOCUS_10640 33452 32517 gene locus_tag LOCUS_10650 33452 32517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 34307 33543 gene locus_tag LOCUS_10660 34307 33543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 34517 35536 gene locus_tag LOCUS_10670 gene cbiM 34517 35536 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964089.1 protein_id gnl|my_center|LOCUS_10670 35573 36373 gene locus_tag LOCUS_10680 35573 36373 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964090.1 protein_id gnl|my_center|LOCUS_10680 36373 37086 gene locus_tag LOCUS_10690 36373 37086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964091.1 protein_id gnl|my_center|LOCUS_10690 40857 37330 gene locus_tag LOCUS_10700 gene nifJ 40857 37330 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_10700 42498 41311 gene locus_tag LOCUS_10710 42498 41311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 43600 42668 gene locus_tag LOCUS_10720 gene ftsY 43600 42668 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_10720 47275 43718 gene locus_tag LOCUS_10730 gene smc 47275 43718 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460497.1 protein_id gnl|my_center|LOCUS_10730 47537 49696 gene locus_tag LOCUS_10740 47537 49696 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435700.1 protein_id gnl|my_center|LOCUS_10740 50993 49806 gene locus_tag LOCUS_10750 50993 49806 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_10750 53034 51142 gene locus_tag LOCUS_10760 53034 51142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 53992 53048 gene locus_tag LOCUS_10770 53992 53048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 54635 54159 gene locus_tag LOCUS_10780 54635 54159 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393684.1 protein_id gnl|my_center|LOCUS_10780 55104 54646 gene locus_tag LOCUS_10790 55104 54646 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785477.1 protein_id gnl|my_center|LOCUS_10790 55835 55203 gene locus_tag LOCUS_10800 gene yihA 55835 55203 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_10800 58225 55913 gene locus_tag LOCUS_10810 gene lon 58225 55913 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460911.1 protein_id gnl|my_center|LOCUS_10810 59589 58333 gene locus_tag LOCUS_10820 gene clpX 59589 58333 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_10820 60230 59604 gene locus_tag LOCUS_10830 gene clpP 60230 59604 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_10830 61580 60288 gene locus_tag LOCUS_10840 gene tig 61580 60288 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_10840 62324 61725 gene locus_tag LOCUS_10850 62324 61725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 63440 62340 gene locus_tag LOCUS_10860 63440 62340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 63701 63480 gene locus_tag LOCUS_10870 63701 63480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 64690 63698 gene locus_tag LOCUS_10880 64690 63698 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_10880 65655 64840 gene locus_tag LOCUS_10890 65655 64840 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_10890 65888 65652 gene locus_tag LOCUS_10900 65888 65652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 66038 66508 gene locus_tag LOCUS_10910 66038 66508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 67789 66575 gene locus_tag LOCUS_10920 gene nhaA 67789 66575 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268892.1 protein_id gnl|my_center|LOCUS_10920 69177 67825 gene locus_tag LOCUS_10930 69177 67825 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_10930 70418 69249 gene locus_tag LOCUS_10940 70418 69249 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583956.1 protein_id gnl|my_center|LOCUS_10940 71209 70595 gene locus_tag LOCUS_10950 71209 70595 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_10950 72236 71211 gene locus_tag LOCUS_10960 gene ruvB 72236 71211 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_10960 72868 72266 gene locus_tag LOCUS_10970 gene ruvA 72868 72266 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271550.1 protein_id gnl|my_center|LOCUS_10970 73359 72871 gene locus_tag LOCUS_10980 gene ruvC 73359 72871 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_10980 74187 73453 gene locus_tag LOCUS_10990 74187 73453 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460362.1 protein_id gnl|my_center|LOCUS_10990 75479 74271 gene locus_tag LOCUS_11000 gene tyrS 75479 74271 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_11000 77665 75557 gene locus_tag LOCUS_11010 77665 75557 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583490.1 protein_id gnl|my_center|LOCUS_11010 80126 77751 gene locus_tag LOCUS_11020 80126 77751 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_11020 82718 80220 gene locus_tag LOCUS_11030 82718 80220 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458989.1 protein_id gnl|my_center|LOCUS_11030 83335 82718 gene locus_tag LOCUS_11040 gene scpB 83335 82718 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_11040 84122 83355 gene locus_tag LOCUS_11050 gene scpA 84122 83355 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199758.1 protein_id gnl|my_center|LOCUS_11050 84752 84129 gene locus_tag LOCUS_11060 84752 84129 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_11060 85409 84852 gene locus_tag LOCUS_11070 85409 84852 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_11070 86057 85740 gene locus_tag LOCUS_11080 86057 85740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence10 269 505 gene locus_tag LOCUS_11090 269 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1129 563 gene locus_tag LOCUS_11100 1129 563 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984482.1 protein_id gnl|my_center|LOCUS_11100 1467 2186 gene locus_tag LOCUS_11110 1467 2186 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_11110 2926 2354 gene locus_tag LOCUS_11120 2926 2354 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158950.1 protein_id gnl|my_center|LOCUS_11120 3040 3351 gene locus_tag LOCUS_11130 3040 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 3729 4163 gene locus_tag LOCUS_11140 3729 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4207 5010 gene locus_tag LOCUS_11150 4207 5010 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705454.1 protein_id gnl|my_center|LOCUS_11150 5047 5931 gene locus_tag LOCUS_11160 5047 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6051 6647 gene locus_tag LOCUS_11170 6051 6647 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_11170 6799 7359 gene locus_tag LOCUS_11180 6799 7359 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_11180 7508 7598 gene locus_tag LOCUS_t00260 7508 7598 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7871 9205 gene locus_tag LOCUS_11190 7871 9205 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792073.1 protein_id gnl|my_center|LOCUS_11190 9364 9675 gene locus_tag LOCUS_11200 gene rplU 9364 9675 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_11200 9681 10001 gene locus_tag LOCUS_11210 9681 10001 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633692.1 protein_id gnl|my_center|LOCUS_11210 10007 10300 gene locus_tag LOCUS_11220 gene rpmA 10007 10300 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 protein_id gnl|my_center|LOCUS_11220 10447 11727 gene locus_tag LOCUS_11230 gene obgE 10447 11727 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_11230 11731 12036 gene locus_tag LOCUS_11240 gene yhbY 11731 12036 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460893.1 protein_id gnl|my_center|LOCUS_11240 12048 13175 gene locus_tag LOCUS_11250 gene proB 12048 13175 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_11250 13201 14457 gene locus_tag LOCUS_11260 13201 14457 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_11260 14454 14615 gene locus_tag LOCUS_11270 14454 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 14633 15244 gene locus_tag LOCUS_11280 gene nadD 14633 15244 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_11280 15241 15828 gene locus_tag LOCUS_11290 gene yqeK 15241 15828 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_11290 15834 16892 gene locus_tag LOCUS_11300 15834 16892 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582789.1 protein_id gnl|my_center|LOCUS_11300 16895 17239 gene locus_tag LOCUS_11310 gene rsfS 16895 17239 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645187.1 protein_id gnl|my_center|LOCUS_11310 17245 18147 gene locus_tag LOCUS_11320 17245 18147 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214046.1 protein_id gnl|my_center|LOCUS_11320 18322 19320 gene locus_tag LOCUS_11330 gene cheV 18322 19320 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 protein_id gnl|my_center|LOCUS_11330 19530 20555 gene locus_tag LOCUS_11340 19530 20555 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626052.1 protein_id gnl|my_center|LOCUS_11340 20581 21936 gene locus_tag LOCUS_11350 gene rimO 20581 21936 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_11350 21933 22412 gene locus_tag LOCUS_11360 21933 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 22425 23900 gene locus_tag LOCUS_11370 22425 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 24103 24028 gene locus_tag LOCUS_t00270 24103 24028 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 25865 24159 gene locus_tag LOCUS_11380 25865 24159 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_11380 26007 26588 gene locus_tag LOCUS_11390 gene rsmD 26007 26588 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_11390 26589 27080 gene locus_tag LOCUS_11400 gene coaD 26589 27080 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887287.1 protein_id gnl|my_center|LOCUS_11400 27087 27776 gene locus_tag LOCUS_11410 27087 27776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 27846 28604 gene locus_tag LOCUS_11420 gene larB 27846 28604 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_11420 28639 29853 gene locus_tag LOCUS_11430 gene larC 28639 29853 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_11430 29951 30454 gene locus_tag LOCUS_11440 29951 30454 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_11440 30485 30664 gene locus_tag LOCUS_11450 gene rpmF 30485 30664 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813398.1 protein_id gnl|my_center|LOCUS_11450 30832 31401 gene locus_tag LOCUS_11460 gene fapR 30832 31401 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813404.1 protein_id gnl|my_center|LOCUS_11460 31404 32483 gene locus_tag LOCUS_11470 gene plsX 31404 32483 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_11470 32544 33491 gene locus_tag LOCUS_11480 gene fabK 32544 33491 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419125.1 protein_id gnl|my_center|LOCUS_11480 33510 34457 gene locus_tag LOCUS_11490 gene fabD 33510 34457 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_11490 34459 35202 gene locus_tag LOCUS_11500 gene fabG 34459 35202 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_11500 35252 35491 gene locus_tag LOCUS_11510 gene acpP 35252 35491 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_11510 35575 36522 gene locus_tag LOCUS_11520 35575 36522 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_11520 36552 37799 gene locus_tag LOCUS_11530 gene fabF 36552 37799 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_11530 37806 38519 gene locus_tag LOCUS_11540 gene rncS 37806 38519 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146873.1 protein_id gnl|my_center|LOCUS_11540 38667 39473 gene locus_tag LOCUS_11550 38667 39473 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_11550 39920 39480 gene locus_tag LOCUS_11560 39920 39480 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454702.1 protein_id gnl|my_center|LOCUS_11560 40114 41322 gene locus_tag LOCUS_11570 gene adeI 40114 41322 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AdeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116482.1 protein_id gnl|my_center|LOCUS_11570 41337 44531 gene locus_tag LOCUS_11580 41337 44531 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_11580 44676 45767 gene locus_tag LOCUS_11590 gene recA 44676 45767 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_11590 45748 46257 gene locus_tag LOCUS_11600 45748 46257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 46381 47952 gene locus_tag LOCUS_11610 gene guaA 46381 47952 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_11610 48008 48313 gene locus_tag LOCUS_11620 48008 48313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 48324 48830 gene locus_tag LOCUS_11630 48324 48830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 49023 49277 gene locus_tag LOCUS_11640 49023 49277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 49711 51189 gene locus_tag LOCUS_11650 49711 51189 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11650 51195 51602 gene locus_tag LOCUS_11660 51195 51602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 51743 52096 gene locus_tag LOCUS_11670 51743 52096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 52114 52956 gene locus_tag LOCUS_11680 52114 52956 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385762.1 protein_id gnl|my_center|LOCUS_11680 53227 54651 gene locus_tag LOCUS_11690 53227 54651 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363970.1 protein_id gnl|my_center|LOCUS_11690 54769 56334 gene locus_tag LOCUS_11700 54769 56334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 56405 56707 gene locus_tag LOCUS_11710 56405 56707 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741107.1 protein_id gnl|my_center|LOCUS_11710 56710 57033 gene locus_tag LOCUS_11720 56710 57033 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722139.1 protein_id gnl|my_center|LOCUS_11720 57030 58448 gene locus_tag LOCUS_11730 57030 58448 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262788.1 protein_id gnl|my_center|LOCUS_11730 58495 59277 gene locus_tag LOCUS_11740 58495 59277 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966092.1 protein_id gnl|my_center|LOCUS_11740 59308 61056 gene locus_tag LOCUS_11750 59308 61056 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_11750 61243 63627 gene locus_tag LOCUS_11760 gene feoB 61243 63627 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_11760 63731 64105 gene locus_tag LOCUS_11770 63731 64105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 64829 64122 gene locus_tag LOCUS_11780 64829 64122 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001993852.1 protein_id gnl|my_center|LOCUS_11780 66448 64826 gene locus_tag LOCUS_11790 66448 64826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 66668 67435 gene locus_tag LOCUS_11800 66668 67435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 67488 67724 gene locus_tag LOCUS_11810 67488 67724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 67824 68039 gene locus_tag LOCUS_11820 67824 68039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 68606 69334 gene locus_tag LOCUS_11830 68606 69334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 69399 70274 gene locus_tag LOCUS_11840 69399 70274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 70419 70793 gene locus_tag LOCUS_11850 70419 70793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 70805 71419 gene locus_tag LOCUS_11860 70805 71419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 71423 74812 gene locus_tag LOCUS_11870 71423 74812 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_11870 76366 75335 gene locus_tag LOCUS_11880 76366 75335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 76823 76554 gene locus_tag LOCUS_11890 76823 76554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 77078 76845 gene locus_tag LOCUS_11900 77078 76845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 77594 77265 gene locus_tag LOCUS_11910 77594 77265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 77868 78374 gene locus_tag LOCUS_11920 77868 78374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence11 2098 770 gene locus_tag LOCUS_11930 2098 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3150 2113 gene locus_tag LOCUS_11940 gene hypE 3150 2113 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_11940 4199 3150 gene locus_tag LOCUS_11950 gene hypD 4199 3150 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810717.1 protein_id gnl|my_center|LOCUS_11950 4424 4218 gene locus_tag LOCUS_11960 4424 4218 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393665.1 protein_id gnl|my_center|LOCUS_11960 6557 4674 gene locus_tag LOCUS_11970 gene hypF 6557 4674 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11970 6981 6754 gene locus_tag LOCUS_11980 6981 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11980 8311 7136 gene locus_tag LOCUS_11990 8311 7136 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_11990 9751 8372 gene locus_tag LOCUS_12000 9751 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 10620 9847 gene locus_tag LOCUS_12010 10620 9847 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461208.1 protein_id gnl|my_center|LOCUS_12010 10950 10702 gene locus_tag LOCUS_12020 10950 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 11079 11732 gene locus_tag LOCUS_12030 11079 11732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 12708 11806 gene locus_tag LOCUS_12040 12708 11806 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_12040 12898 16323 gene locus_tag LOCUS_12050 12898 16323 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_12050 16439 17698 gene locus_tag LOCUS_12060 16439 17698 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_12060 17773 18036 gene locus_tag LOCUS_12070 17773 18036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 18155 18538 gene locus_tag LOCUS_12080 18155 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12080 18535 19779 gene locus_tag LOCUS_12090 18535 19779 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_12090 19810 21120 gene locus_tag LOCUS_12100 gene aroA 19810 21120 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_12100 21183 21848 gene locus_tag LOCUS_12110 gene cmk 21183 21848 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_12110 21850 22455 gene locus_tag LOCUS_12120 21850 22455 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_12120 22587 23990 gene locus_tag LOCUS_12130 22587 23990 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392258.1 protein_id gnl|my_center|LOCUS_12130 24149 26611 gene locus_tag LOCUS_12140 24149 26611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 26639 31114 gene locus_tag LOCUS_12150 26639 31114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 31246 31597 gene locus_tag LOCUS_tm00010 31246 31597 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 31849 33351 gene locus_tag LOCUS_12160 31849 33351 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_12160 33652 33494 gene locus_tag LOCUS_12170 33652 33494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 33715 34389 gene locus_tag LOCUS_12180 33715 34389 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259363.1 protein_id gnl|my_center|LOCUS_12180 34390 35679 gene locus_tag LOCUS_12190 34390 35679 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_12190 35792 36202 gene locus_tag LOCUS_12200 35792 36202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 37428 36268 gene locus_tag LOCUS_12210 37428 36268 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_12210 37672 38991 gene locus_tag LOCUS_12220 37672 38991 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214669.1 protein_id gnl|my_center|LOCUS_12220 38988 42119 gene locus_tag LOCUS_12230 38988 42119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 42147 42223 gene locus_tag LOCUS_t00280 42147 42223 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 42308 44161 gene locus_tag LOCUS_12240 42308 44161 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748733.1 protein_id gnl|my_center|LOCUS_12240 44305 44577 gene locus_tag LOCUS_12250 44305 44577 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112985.1 protein_id gnl|my_center|LOCUS_12250 44614 45975 gene locus_tag LOCUS_12260 44614 45975 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963801.1 protein_id gnl|my_center|LOCUS_12260 45989 46651 gene locus_tag LOCUS_12270 gene nth 45989 46651 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_12270 46668 47120 gene locus_tag LOCUS_12280 46668 47120 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944375.1 protein_id gnl|my_center|LOCUS_12280 47580 48593 gene locus_tag LOCUS_12290 gene aroF 47580 48593 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393889.1 protein_id gnl|my_center|LOCUS_12290 48590 49483 gene locus_tag LOCUS_12300 48590 49483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 49623 49814 gene locus_tag LOCUS_12310 gene rpmB 49623 49814 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_12310 50019 50933 gene locus_tag LOCUS_12320 50019 50933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 50933 51778 gene locus_tag LOCUS_12330 50933 51778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 51775 52671 gene locus_tag LOCUS_12340 51775 52671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 52664 53698 gene locus_tag LOCUS_12350 52664 53698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 53703 55151 gene locus_tag LOCUS_12360 gene pelF 53703 55151 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_12360 55127 55765 gene locus_tag LOCUS_12370 55127 55765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 55795 56265 gene locus_tag LOCUS_12380 55795 56265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 56262 58577 gene locus_tag LOCUS_12390 56262 58577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 58596 59636 gene locus_tag LOCUS_12400 58596 59636 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779459.1 protein_id gnl|my_center|LOCUS_12400 59706 60281 gene locus_tag LOCUS_12410 gene folE 59706 60281 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938082.1 protein_id gnl|my_center|LOCUS_12410 60371 61237 gene locus_tag LOCUS_12420 gene folP 60371 61237 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492526.1 protein_id gnl|my_center|LOCUS_12420 61238 61618 gene locus_tag LOCUS_12430 gene folB 61238 61618 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_12430 61618 62637 gene locus_tag LOCUS_12440 61618 62637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 62658 63371 gene locus_tag LOCUS_12450 62658 63371 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_12450 63717 64022 gene locus_tag LOCUS_12460 63717 64022 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_12460 64046 65230 gene locus_tag LOCUS_12470 gene hisZ 64046 65230 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_12470 65227 65742 gene locus_tag LOCUS_12480 65227 65742 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963337.1 protein_id gnl|my_center|LOCUS_12480 65870 66535 gene locus_tag LOCUS_12490 gene hisG 65870 66535 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817216.1 protein_id gnl|my_center|LOCUS_12490 66557 67900 gene locus_tag LOCUS_12500 gene hisD 66557 67900 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_12500 67914 68987 gene locus_tag LOCUS_12510 gene hisC 67914 68987 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_12510 68987 69595 gene locus_tag LOCUS_12520 gene hisB 68987 69595 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_12520 69609 70220 gene locus_tag LOCUS_12530 gene hisH 69609 70220 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_12530 70224 70952 gene locus_tag LOCUS_12540 gene hisA 70224 70952 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256251.1 protein_id gnl|my_center|LOCUS_12540 70954 71712 gene locus_tag LOCUS_12550 gene hisF 70954 71712 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_12550 71712 72425 gene locus_tag LOCUS_12560 gene hisIE 71712 72425 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_12560 72438 72911 gene locus_tag LOCUS_12570 72438 72911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 73929 73003 gene locus_tag LOCUS_12580 gene ribF 73929 73003 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925165.1 protein_id gnl|my_center|LOCUS_12580 74100 75203 gene locus_tag LOCUS_12590 gene queA 74100 75203 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_12590 75284 75445 gene locus_tag LOCUS_12600 75284 75445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 77076 77273 gene locus_tag LOCUS_12610 77076 77273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 77828 77406 gene locus_tag LOCUS_12620 77828 77406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 77862 78059 gene locus_tag LOCUS_12630 77862 78059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence12 491 1108 gene locus_tag LOCUS_12640 gene thiT 491 1108 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_12640 2191 1121 gene locus_tag LOCUS_12650 2191 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4427 2346 gene locus_tag LOCUS_12660 4427 2346 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948168.1 protein_id gnl|my_center|LOCUS_12660 7170 4594 gene locus_tag LOCUS_12670 gene clpB 7170 4594 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_12670 7317 8516 gene locus_tag LOCUS_12680 7317 8516 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362074.1 protein_id gnl|my_center|LOCUS_12680 9802 8603 gene locus_tag LOCUS_12690 9802 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963531.1 protein_id gnl|my_center|LOCUS_12690 11431 10007 gene locus_tag LOCUS_12700 11431 10007 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_12700 12058 11468 gene locus_tag LOCUS_12710 12058 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 13227 12211 gene locus_tag LOCUS_12720 gene trpD 13227 12211 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_12720 13841 13272 gene locus_tag LOCUS_12730 13841 13272 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_12730 15321 13822 gene locus_tag LOCUS_12740 gene trpE 15321 13822 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_12740 15704 15447 gene locus_tag LOCUS_12750 15704 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 16637 15840 gene locus_tag LOCUS_12760 gene trpA 16637 15840 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391175.1 protein_id gnl|my_center|LOCUS_12760 17824 16637 gene locus_tag LOCUS_12770 gene trpB 17824 16637 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_12770 18642 17872 gene locus_tag LOCUS_12780 gene trpC 18642 17872 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_12780 19286 18639 gene locus_tag LOCUS_12790 19286 18639 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865141.1 protein_id gnl|my_center|LOCUS_12790 20475 19750 gene locus_tag LOCUS_12800 20475 19750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 20747 20953 gene locus_tag LOCUS_12810 20747 20953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 21471 21079 gene locus_tag LOCUS_12820 gene rpsI 21471 21079 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_12820 21936 21496 gene locus_tag LOCUS_12830 gene rplM 21936 21496 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250038.1 protein_id gnl|my_center|LOCUS_12830 23124 22219 gene locus_tag LOCUS_12840 23124 22219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 23406 23200 gene locus_tag LOCUS_12850 23406 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 24040 23465 gene locus_tag LOCUS_12860 24040 23465 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_12860 24641 24174 gene locus_tag LOCUS_12870 24641 24174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 25033 24656 gene locus_tag LOCUS_12880 25033 24656 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_12880 25293 25030 gene locus_tag LOCUS_12890 25293 25030 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 protein_id gnl|my_center|LOCUS_12890 26044 25418 gene locus_tag LOCUS_12900 gene cobC 26044 25418 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_12900 27111 26035 gene locus_tag LOCUS_12910 gene cobD 27111 26035 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_12910 27914 27144 gene locus_tag LOCUS_12920 gene cobS 27914 27144 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_12920 28907 27927 gene locus_tag LOCUS_12930 gene cbiB 28907 27927 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392613.1 protein_id gnl|my_center|LOCUS_12930 29524 28904 gene locus_tag LOCUS_12940 gene cobU 29524 28904 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 protein_id gnl|my_center|LOCUS_12940 30191 29586 gene locus_tag LOCUS_12950 30191 29586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 31322 30333 gene locus_tag LOCUS_12960 31322 30333 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869831.1 protein_id gnl|my_center|LOCUS_12960 32207 31410 gene locus_tag LOCUS_12970 gene folE2 32207 31410 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_12970 32890 32207 gene locus_tag LOCUS_12980 gene queC 32890 32207 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_12980 33589 32924 gene locus_tag LOCUS_12990 gene rpe 33589 32924 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_12990 34485 33586 gene locus_tag LOCUS_13000 gene rsgA 34485 33586 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_13000 36226 34469 gene locus_tag LOCUS_13010 gene pknB 36226 34469 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_13010 37661 36261 gene locus_tag LOCUS_13020 37661 36261 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_13020 38931 37654 gene locus_tag LOCUS_13030 38931 37654 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392427.1 protein_id gnl|my_center|LOCUS_13030 39632 38928 gene locus_tag LOCUS_13040 39632 38928 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_13040 40090 39638 gene locus_tag LOCUS_13050 40090 39638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 40816 40091 gene locus_tag LOCUS_13060 40816 40091 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392424.1 protein_id gnl|my_center|LOCUS_13060 41929 40883 gene locus_tag LOCUS_13070 gene rlmN 41929 40883 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_13070 43305 41953 gene locus_tag LOCUS_13080 gene rsmB 43305 41953 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_13080 44171 43302 gene locus_tag LOCUS_13090 44171 43302 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392418.1 protein_id gnl|my_center|LOCUS_13090 45134 44184 gene locus_tag LOCUS_13100 gene fmt 45134 44184 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_13100 45598 45131 gene locus_tag LOCUS_13110 gene def 45598 45131 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460527.1 protein_id gnl|my_center|LOCUS_13110 46861 45608 gene locus_tag LOCUS_13120 gene pepT 46861 45608 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_13120 48171 47047 gene locus_tag LOCUS_13130 48171 47047 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_13130 49776 48457 gene locus_tag LOCUS_13140 49776 48457 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864507.1 protein_id gnl|my_center|LOCUS_13140 52956 49930 gene locus_tag LOCUS_13150 52956 49930 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_13150 54041 52953 gene locus_tag LOCUS_13160 54041 52953 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_13160 54745 54119 gene locus_tag LOCUS_13170 54745 54119 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111908.1 protein_id gnl|my_center|LOCUS_13170 54930 55676 gene locus_tag LOCUS_13180 54930 55676 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513090.1 protein_id gnl|my_center|LOCUS_13180 56933 55755 gene locus_tag LOCUS_13190 56933 55755 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434490.1 protein_id gnl|my_center|LOCUS_13190 57331 58416 gene locus_tag LOCUS_13200 57331 58416 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476545.1 protein_id gnl|my_center|LOCUS_13200 58438 59343 gene locus_tag LOCUS_13210 58438 59343 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_13210 59372 59551 gene locus_tag LOCUS_13220 59372 59551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 60779 59577 gene locus_tag LOCUS_13230 60779 59577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 61024 60887 gene locus_tag LOCUS_13240 61024 60887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 63009 61633 gene locus_tag LOCUS_13250 63009 61633 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_13250 63411 63160 gene locus_tag LOCUS_13260 63411 63160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 63848 63480 gene locus_tag LOCUS_13270 63848 63480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 64587 64066 gene locus_tag LOCUS_13280 64587 64066 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_13280 65120 64608 gene locus_tag LOCUS_13290 65120 64608 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_13290 66185 65283 gene locus_tag LOCUS_13300 66185 65283 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 protein_id gnl|my_center|LOCUS_13300 66921 66265 gene locus_tag LOCUS_13310 66921 66265 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_13310 67696 66947 gene locus_tag LOCUS_13320 gene fabG 67696 66947 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_13320 68261 67875 gene locus_tag LOCUS_13330 68261 67875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 68480 68749 gene locus_tag LOCUS_13340 68480 68749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 70196 69312 gene locus_tag LOCUS_13350 70196 69312 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_13350 70439 70317 gene locus_tag LOCUS_13360 70439 70317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 70773 70594 gene locus_tag LOCUS_13370 70773 70594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 70905 71438 gene locus_tag LOCUS_13380 70905 71438 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_13380 72089 71766 gene locus_tag LOCUS_13390 gene azlD 72089 71766 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_13390 72873 72091 gene locus_tag LOCUS_13400 72873 72091 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410658.1 protein_id gnl|my_center|LOCUS_13400 73370 72969 gene locus_tag LOCUS_13410 73370 72969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 73568 73945 gene locus_tag LOCUS_13420 73568 73945 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459154.1 protein_id gnl|my_center|LOCUS_13420 74044 74283 gene locus_tag LOCUS_13430 74044 74283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 75299 74229 gene locus_tag LOCUS_13440 75299 74229 CDS product ISL3-like element IS1001 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038907.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence13 524 72 gene locus_tag LOCUS_13450 524 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1225 521 gene locus_tag LOCUS_13460 1225 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1475 1257 gene locus_tag LOCUS_13470 1475 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2784 1873 gene locus_tag LOCUS_13480 2784 1873 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_13480 3019 4317 gene locus_tag LOCUS_13490 3019 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5025 4333 gene locus_tag LOCUS_13500 5025 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 5286 6227 gene locus_tag LOCUS_13510 5286 6227 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_13510 7426 6302 gene locus_tag LOCUS_13520 7426 6302 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705310.1 protein_id gnl|my_center|LOCUS_13520 7779 8690 gene locus_tag LOCUS_13530 7779 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 9273 8980 gene locus_tag LOCUS_13540 9273 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 9472 9284 gene locus_tag LOCUS_13550 9472 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 9736 9873 gene locus_tag LOCUS_13560 9736 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 9889 11472 gene locus_tag LOCUS_13570 9889 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13570 12751 11495 gene locus_tag LOCUS_13580 12751 11495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_13580 13098 14201 gene locus_tag LOCUS_13590 13098 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 14216 14428 gene locus_tag LOCUS_13600 14216 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 16512 14512 gene locus_tag LOCUS_13610 16512 14512 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941543.1 protein_id gnl|my_center|LOCUS_13610 17232 16531 gene locus_tag LOCUS_13620 17232 16531 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812253.1 protein_id gnl|my_center|LOCUS_13620 18377 17253 gene locus_tag LOCUS_13630 18377 17253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812266.1 protein_id gnl|my_center|LOCUS_13630 19498 18377 gene locus_tag LOCUS_13640 19498 18377 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812264.1 protein_id gnl|my_center|LOCUS_13640 21303 19495 gene locus_tag LOCUS_13650 21303 19495 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_13650 22057 21365 gene locus_tag LOCUS_13660 22057 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 21941 22258 gene locus_tag LOCUS_13670 21941 22258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 22550 23734 gene locus_tag LOCUS_13680 22550 23734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403811.1 protein_id gnl|my_center|LOCUS_13680 24285 23986 gene locus_tag LOCUS_13690 24285 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 24557 24291 gene locus_tag LOCUS_13700 24557 24291 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_13700 24612 25079 gene locus_tag LOCUS_13710 24612 25079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 25349 27088 gene locus_tag LOCUS_13720 25349 27088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 27484 27173 gene locus_tag LOCUS_13730 27484 27173 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679825.1 protein_id gnl|my_center|LOCUS_13730 27749 27462 gene locus_tag LOCUS_13740 27749 27462 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_13740 29723 28080 gene locus_tag LOCUS_13750 29723 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 30634 29723 gene locus_tag LOCUS_13760 gene cysD 30634 29723 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 protein_id gnl|my_center|LOCUS_13760 31005 30694 gene locus_tag LOCUS_13770 31005 30694 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_13770 32708 31002 gene locus_tag LOCUS_13780 32708 31002 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_13780 33790 32720 gene locus_tag LOCUS_13790 33790 32720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 34604 33780 gene locus_tag LOCUS_13800 gene cysW 34604 33780 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_13800 35431 34607 gene locus_tag LOCUS_13810 gene cysT 35431 34607 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 protein_id gnl|my_center|LOCUS_13810 36499 35471 gene locus_tag LOCUS_13820 36499 35471 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266412.1 protein_id gnl|my_center|LOCUS_13820 37856 36633 gene locus_tag LOCUS_13830 37856 36633 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_13830 38101 37853 gene locus_tag LOCUS_13840 38101 37853 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_13840 38958 38098 gene locus_tag LOCUS_13850 38958 38098 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_13850 39445 39026 gene locus_tag LOCUS_13860 39445 39026 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_13860 40305 39487 gene locus_tag LOCUS_13870 gene moeB 40305 39487 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_13870 40511 40302 gene locus_tag LOCUS_13880 gene thiS 40511 40302 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_13880 42136 40706 gene locus_tag LOCUS_13890 gene pelB 42136 40706 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_13890 42310 43269 gene locus_tag LOCUS_13900 42310 43269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 44034 43225 gene locus_tag LOCUS_13910 44034 43225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 44662 44045 gene locus_tag LOCUS_13920 44662 44045 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272290.1 protein_id gnl|my_center|LOCUS_13920 47017 44678 gene locus_tag LOCUS_13930 47017 44678 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945118.1 protein_id gnl|my_center|LOCUS_13930 47467 47670 gene locus_tag LOCUS_13940 47467 47670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 47663 48070 gene locus_tag LOCUS_13950 47663 48070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 48348 49379 gene locus_tag LOCUS_13960 48348 49379 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235899614.1 protein_id gnl|my_center|LOCUS_13960 50972 49557 gene locus_tag LOCUS_13970 50972 49557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 51949 50969 gene locus_tag LOCUS_13980 51949 50969 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921952.1 protein_id gnl|my_center|LOCUS_13980 54273 52024 gene locus_tag LOCUS_13990 54273 52024 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019639497.1 protein_id gnl|my_center|LOCUS_13990 57479 54285 gene locus_tag LOCUS_14000 57479 54285 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_14000 58945 57533 gene locus_tag LOCUS_14010 58945 57533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 59600 58998 gene locus_tag LOCUS_14020 59600 58998 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_14020 61828 59873 gene locus_tag LOCUS_14030 gene htpG 61828 59873 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_14030 62564 61989 gene locus_tag LOCUS_14040 62564 61989 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891255.1 protein_id gnl|my_center|LOCUS_14040 63064 62693 gene locus_tag LOCUS_14050 63064 62693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 63425 63078 gene locus_tag LOCUS_14060 63425 63078 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_14060 64493 63639 gene locus_tag LOCUS_14070 gene pstA 64493 63639 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965014.1 protein_id gnl|my_center|LOCUS_14070 65368 64493 gene locus_tag LOCUS_14080 gene pstC 65368 64493 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391660.1 protein_id gnl|my_center|LOCUS_14080 66256 65384 gene locus_tag LOCUS_14090 66256 65384 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_14090 66510 67955 gene locus_tag LOCUS_14100 66510 67955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 68724 68038 gene locus_tag LOCUS_14110 gene phoU 68724 68038 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582863.1 protein_id gnl|my_center|LOCUS_14110 69524 68775 gene locus_tag LOCUS_14120 gene pstB 69524 68775 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_14120 70323 69640 gene locus_tag LOCUS_14130 70323 69640 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_14130 70511 70978 gene locus_tag LOCUS_14140 70511 70978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence14 208 2823 gene locus_tag LOCUS_14150 gene mutS 208 2823 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541545.1 protein_id gnl|my_center|LOCUS_14150 2820 4781 gene locus_tag LOCUS_14160 gene mutL 2820 4781 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 protein_id gnl|my_center|LOCUS_14160 4796 5596 gene locus_tag LOCUS_14170 4796 5596 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_14170 5805 6086 gene locus_tag LOCUS_14180 5805 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6322 7986 gene locus_tag LOCUS_14190 6322 7986 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_14190 8111 8713 gene locus_tag LOCUS_14200 8111 8713 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 protein_id gnl|my_center|LOCUS_14200 8763 9335 gene locus_tag LOCUS_14210 8763 9335 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_14210 9575 9294 gene locus_tag LOCUS_14220 9575 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 9456 13016 gene locus_tag LOCUS_14230 gene brxC 9456 13016 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 protein_id gnl|my_center|LOCUS_14230 13061 16588 gene locus_tag LOCUS_14240 gene pglX 13061 16588 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 protein_id gnl|my_center|LOCUS_14240 16254 16350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16647 16928 gene locus_tag LOCUS_14250 16647 16928 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_14250 17365 17637 gene locus_tag LOCUS_14260 17365 17637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14260 17812 18783 gene locus_tag LOCUS_14270 17812 18783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 18882 21506 gene locus_tag LOCUS_14280 gene pglZ 18882 21506 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459232.1 protein_id gnl|my_center|LOCUS_14280 21564 22424 gene locus_tag LOCUS_14290 gene nudC 21564 22424 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_14290 23093 22542 gene locus_tag LOCUS_14300 23093 22542 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986538.1 protein_id gnl|my_center|LOCUS_14300 23511 24665 gene locus_tag LOCUS_14310 23511 24665 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_14310 24665 24856 gene locus_tag LOCUS_14320 24665 24856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 25020 25346 gene locus_tag LOCUS_14330 25020 25346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 26750 25452 gene locus_tag LOCUS_14340 26750 25452 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_14340 28973 27027 gene locus_tag LOCUS_14350 28973 27027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 29381 31360 gene locus_tag LOCUS_14360 29381 31360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 31743 32777 gene locus_tag LOCUS_14370 gene pheS 31743 32777 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_14370 32800 35235 gene locus_tag LOCUS_14380 gene pheT 32800 35235 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_14380 35251 35523 gene locus_tag LOCUS_14390 gene zapA 35251 35523 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808223.1 protein_id gnl|my_center|LOCUS_14390 35621 37129 gene locus_tag LOCUS_14400 35621 37129 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023851.1 protein_id gnl|my_center|LOCUS_14400 37126 37824 gene locus_tag LOCUS_14410 37126 37824 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459873.1 protein_id gnl|my_center|LOCUS_14410 39839 37917 gene locus_tag LOCUS_14420 39839 37917 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_14420 41779 39956 gene locus_tag LOCUS_14430 41779 39956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 43581 41776 gene locus_tag LOCUS_14440 43581 41776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_14440 43643 43870 gene locus_tag LOCUS_14450 43643 43870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 44041 44523 gene locus_tag LOCUS_14460 44041 44523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 44667 45212 gene locus_tag LOCUS_14470 44667 45212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 45209 46666 gene locus_tag LOCUS_14480 45209 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 47506 46718 gene locus_tag LOCUS_14490 47506 46718 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_14490 48819 47539 gene locus_tag LOCUS_14500 gene glyA 48819 47539 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870131.1 protein_id gnl|my_center|LOCUS_14500 49061 51973 gene locus_tag LOCUS_14510 49061 51973 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_14510 52107 52994 gene locus_tag LOCUS_14520 gene dapA 52107 52994 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_14520 53077 53742 gene locus_tag LOCUS_14530 gene sdaAB 53077 53742 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671219.1 protein_id gnl|my_center|LOCUS_14530 53753 54628 gene locus_tag LOCUS_14540 gene sdaAA 53753 54628 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 protein_id gnl|my_center|LOCUS_14540 54760 55326 gene locus_tag LOCUS_14550 54760 55326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 56220 55387 gene locus_tag LOCUS_14560 56220 55387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 56365 57399 gene locus_tag LOCUS_14570 gene argC 56365 57399 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_14570 57446 58657 gene locus_tag LOCUS_14580 gene argJ 57446 58657 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_14580 58673 59557 gene locus_tag LOCUS_14590 gene argB 58673 59557 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_14590 59585 60781 gene locus_tag LOCUS_14600 59585 60781 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_14600 61404 62336 gene locus_tag LOCUS_14610 gene argF 61404 62336 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808622.1 protein_id gnl|my_center|LOCUS_14610 62435 63652 gene locus_tag LOCUS_14620 62435 63652 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_14620 63649 65076 gene locus_tag LOCUS_14630 gene argH 63649 65076 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_14630 65258 65527 gene locus_tag LOCUS_14640 65258 65527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 65520 65789 gene locus_tag LOCUS_14650 65520 65789 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613391.1 protein_id gnl|my_center|LOCUS_14650 67586 65907 gene locus_tag LOCUS_14660 67586 65907 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641784.1 protein_id gnl|my_center|LOCUS_14660 69308 67776 gene locus_tag LOCUS_14670 69308 67776 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_14670 69447 70388 gene locus_tag LOCUS_14680 gene cynR 69447 70388 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527752.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence15 608 177 gene locus_tag LOCUS_14690 608 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1138 605 gene locus_tag LOCUS_14700 1138 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1902 1174 gene locus_tag LOCUS_14710 1902 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2399 1899 gene locus_tag LOCUS_14720 2399 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2566 2396 gene locus_tag LOCUS_14730 2566 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2865 2563 gene locus_tag LOCUS_14740 2865 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3952 2906 gene locus_tag LOCUS_14750 3952 2906 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_14750 4767 4009 gene locus_tag LOCUS_14760 4767 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 5119 4649 gene locus_tag LOCUS_14770 5119 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 5640 5341 gene locus_tag LOCUS_14780 5640 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 6066 5689 gene locus_tag LOCUS_14790 6066 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14790 6987 6343 gene locus_tag LOCUS_14800 6987 6343 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562571.1 protein_id gnl|my_center|LOCUS_14800 7825 7037 gene locus_tag LOCUS_14810 7825 7037 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965895.1 protein_id gnl|my_center|LOCUS_14810 8683 7841 gene locus_tag LOCUS_14820 gene kduI 8683 7841 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098576.1 protein_id gnl|my_center|LOCUS_14820 9654 8707 gene locus_tag LOCUS_14830 9654 8707 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963717.1 protein_id gnl|my_center|LOCUS_14830 10788 9778 gene locus_tag LOCUS_14840 10788 9778 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963715.1 protein_id gnl|my_center|LOCUS_14840 11298 12308 gene locus_tag LOCUS_14850 gene trpS 11298 12308 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_14850 13165 12395 gene locus_tag LOCUS_14860 13165 12395 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986889.1 protein_id gnl|my_center|LOCUS_14860 13363 15252 gene locus_tag LOCUS_14870 13363 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 16621 15341 gene locus_tag LOCUS_14880 gene serS 16621 15341 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722107.1 protein_id gnl|my_center|LOCUS_14880 17601 16768 gene locus_tag LOCUS_14890 17601 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 17984 17670 gene locus_tag LOCUS_14900 17984 17670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 21796 18515 gene locus_tag LOCUS_14910 21796 18515 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_14910 21938 22993 gene locus_tag LOCUS_14920 gene waaC 21938 22993 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_14920 24359 23100 gene locus_tag LOCUS_14930 24359 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 24484 27015 gene locus_tag LOCUS_14940 24484 27015 CDS product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214035.1 protein_id gnl|my_center|LOCUS_14940 27163 27342 gene locus_tag LOCUS_14950 gene rpmF 27163 27342 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813398.1 protein_id gnl|my_center|LOCUS_14950 27517 29349 gene locus_tag LOCUS_14960 27517 29349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 29494 29766 gene locus_tag LOCUS_14970 29494 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 30410 29751 gene locus_tag LOCUS_14980 30410 29751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 30953 30865 gene locus_tag LOCUS_t00290 30953 30865 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31637 31017 gene locus_tag LOCUS_14990 31637 31017 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_14990 32283 31654 gene locus_tag LOCUS_15000 32283 31654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 32898 32458 gene locus_tag LOCUS_15010 32898 32458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 33438 33926 gene locus_tag LOCUS_15020 33438 33926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 35977 34019 gene locus_tag LOCUS_15030 35977 34019 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_15030 36506 36006 gene locus_tag LOCUS_15040 36506 36006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 37583 36597 gene locus_tag LOCUS_15050 37583 36597 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_15050 39045 38071 gene locus_tag LOCUS_15060 39045 38071 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 protein_id gnl|my_center|LOCUS_15060 40371 39796 gene locus_tag LOCUS_15070 40371 39796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 40676 40464 gene locus_tag LOCUS_15080 40676 40464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 41826 40921 gene locus_tag LOCUS_15090 41826 40921 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 protein_id gnl|my_center|LOCUS_15090 42542 42018 gene locus_tag LOCUS_15100 42542 42018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 43413 42769 gene locus_tag LOCUS_15110 43413 42769 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_15110 44135 43419 gene locus_tag LOCUS_15120 44135 43419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_15120 44902 44135 gene locus_tag LOCUS_15130 44902 44135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_15130 45849 44902 gene locus_tag LOCUS_15140 45849 44902 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_15140 46747 45860 gene locus_tag LOCUS_15150 46747 45860 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_15150 48002 46827 gene locus_tag LOCUS_15160 48002 46827 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_15160 49600 48170 gene locus_tag LOCUS_15170 49600 48170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 49828 49752 gene locus_tag LOCUS_t00300 49828 49752 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51637 49952 gene locus_tag LOCUS_15180 51637 49952 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_15180 53006 51909 gene locus_tag LOCUS_15190 53006 51909 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021442.1 protein_id gnl|my_center|LOCUS_15190 54365 53100 gene locus_tag LOCUS_15200 gene murA 54365 53100 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_15200 56568 54457 gene locus_tag LOCUS_15210 56568 54457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 58123 56672 gene locus_tag LOCUS_15220 58123 56672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 58736 58227 gene locus_tag LOCUS_15230 58736 58227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 59873 58761 gene locus_tag LOCUS_15240 59873 58761 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_15240 60494 59892 gene locus_tag LOCUS_15250 60494 59892 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930326.1 protein_id gnl|my_center|LOCUS_15250 61263 60517 gene locus_tag LOCUS_15260 61263 60517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 62070 61276 gene locus_tag LOCUS_15270 gene flgG 62070 61276 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869894.1 protein_id gnl|my_center|LOCUS_15270 62976 62173 gene locus_tag LOCUS_15280 gene flgF 62976 62173 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_15280 64059 63037 gene locus_tag LOCUS_15290 64059 63037 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence16 250 2118 gene locus_tag LOCUS_15300 250 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4601 2397 gene locus_tag LOCUS_15310 4601 2397 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_15310 4760 5218 gene locus_tag LOCUS_15320 4760 5218 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048199.1 protein_id gnl|my_center|LOCUS_15320 5334 6116 gene locus_tag LOCUS_15330 5334 6116 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_15330 6183 7301 gene locus_tag LOCUS_15340 6183 7301 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_15340 7305 7784 gene locus_tag LOCUS_15350 gene rlmH 7305 7784 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773554.1 protein_id gnl|my_center|LOCUS_15350 7934 9886 gene locus_tag LOCUS_15360 7934 9886 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_15360 9917 10789 gene locus_tag LOCUS_15370 gene rfbA 9917 10789 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_15370 10821 11384 gene locus_tag LOCUS_15380 gene rfbC 10821 11384 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_15380 11482 12525 gene locus_tag LOCUS_15390 gene rfbB 11482 12525 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_15390 12691 14169 gene locus_tag LOCUS_15400 gene lacG 12691 14169 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966246.1 protein_id gnl|my_center|LOCUS_15400 14209 15063 gene locus_tag LOCUS_15410 14209 15063 CDS product tagatose bisphosphate family class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358381.1 protein_id gnl|my_center|LOCUS_15410 15087 16013 gene locus_tag LOCUS_15420 15087 16013 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966234.1 protein_id gnl|my_center|LOCUS_15420 16267 16845 gene locus_tag LOCUS_15430 16267 16845 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_15430 17016 17726 gene locus_tag LOCUS_15440 17016 17726 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_15440 18712 17900 gene locus_tag LOCUS_15450 18712 17900 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047704.1 protein_id gnl|my_center|LOCUS_15450 18974 19396 gene locus_tag LOCUS_15460 gene lacA 18974 19396 CDS product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027026.1 protein_id gnl|my_center|LOCUS_15460 19423 19938 gene locus_tag LOCUS_15470 gene lacB 19423 19938 CDS product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966236.1 protein_id gnl|my_center|LOCUS_15470 19990 20301 gene locus_tag LOCUS_15480 19990 20301 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966248.1 protein_id gnl|my_center|LOCUS_15480 20312 21733 gene locus_tag LOCUS_15490 gene lacG 20312 21733 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966246.1 protein_id gnl|my_center|LOCUS_15490 21971 23188 gene locus_tag LOCUS_15500 21971 23188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 23415 25196 gene locus_tag LOCUS_15510 23415 25196 CDS product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966247.1 protein_id gnl|my_center|LOCUS_15510 25337 27040 gene locus_tag LOCUS_15520 25337 27040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 27189 27055 gene locus_tag LOCUS_15530 27189 27055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 28376 28729 gene locus_tag LOCUS_15540 28376 28729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 28729 29016 gene locus_tag LOCUS_15550 28729 29016 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391907.1 protein_id gnl|my_center|LOCUS_15550 29999 31837 gene locus_tag LOCUS_15560 29999 31837 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583222.1 protein_id gnl|my_center|LOCUS_15560 32551 34398 gene locus_tag LOCUS_15570 32551 34398 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012311219.1 protein_id gnl|my_center|LOCUS_15570 36777 34486 gene locus_tag LOCUS_15580 gene metE 36777 34486 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836499.1 protein_id gnl|my_center|LOCUS_15580 37004 38869 gene locus_tag LOCUS_15590 37004 38869 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012311219.1 protein_id gnl|my_center|LOCUS_15590 38884 40740 gene locus_tag LOCUS_15600 38884 40740 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583222.1 protein_id gnl|my_center|LOCUS_15600 41088 42254 gene locus_tag LOCUS_15610 41088 42254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 42290 43306 gene locus_tag LOCUS_15620 42290 43306 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890699.1 protein_id gnl|my_center|LOCUS_15620 43358 45076 gene locus_tag LOCUS_15630 43358 45076 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272214.1 protein_id gnl|my_center|LOCUS_15630 45241 45738 gene locus_tag LOCUS_15640 45241 45738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 45970 47142 gene locus_tag LOCUS_15650 45970 47142 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_15650 47262 48251 gene locus_tag LOCUS_15660 gene galE 47262 48251 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 protein_id gnl|my_center|LOCUS_15660 48300 49814 gene locus_tag LOCUS_15670 gene galT 48300 49814 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_15670 49821 50864 gene locus_tag LOCUS_15680 49821 50864 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966245.1 protein_id gnl|my_center|LOCUS_15680 50927 51000 gene locus_tag LOCUS_t00310 50927 51000 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51155 52762 gene locus_tag LOCUS_15690 51155 52762 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195435952.1 protein_id gnl|my_center|LOCUS_15690 54224 52872 gene locus_tag LOCUS_15700 54224 52872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 54432 55562 gene locus_tag LOCUS_15710 54432 55562 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_15710 55824 57020 gene locus_tag LOCUS_15720 gene sucC 55824 57020 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_15720 57034 57936 gene locus_tag LOCUS_15730 gene sucD 57034 57936 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_15730 58961 58005 gene locus_tag LOCUS_15740 58961 58005 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966817.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence17 525 4109 gene locus_tag LOCUS_15750 gene addB 525 4109 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058551.1 protein_id gnl|my_center|LOCUS_15750 4109 7831 gene locus_tag LOCUS_15760 gene addA 4109 7831 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_15760 7961 8587 gene locus_tag LOCUS_15770 7961 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 8781 10034 gene locus_tag LOCUS_15780 8781 10034 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_15780 10333 12453 gene locus_tag LOCUS_15790 10333 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12518 13120 gene locus_tag LOCUS_15800 12518 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 13223 13753 gene locus_tag LOCUS_15810 13223 13753 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_15810 17377 13901 gene locus_tag LOCUS_15820 17377 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 17348 17614 gene locus_tag LOCUS_15830 17348 17614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 18687 17680 gene locus_tag LOCUS_15840 gene cydB 18687 17680 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393586.1 protein_id gnl|my_center|LOCUS_15840 20060 18687 gene locus_tag LOCUS_15850 20060 18687 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393585.1 protein_id gnl|my_center|LOCUS_15850 20620 20210 gene locus_tag LOCUS_15860 20620 20210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 21861 20719 gene locus_tag LOCUS_15870 21861 20719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 22205 23212 gene locus_tag LOCUS_15880 22205 23212 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888504.1 protein_id gnl|my_center|LOCUS_15880 23209 24081 gene locus_tag LOCUS_15890 gene ispE 23209 24081 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_15890 24194 24919 gene locus_tag LOCUS_15900 24194 24919 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_15900 24939 26303 gene locus_tag LOCUS_15910 gene glmU 24939 26303 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_15910 26448 27395 gene locus_tag LOCUS_15920 26448 27395 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_15920 27636 28484 gene locus_tag LOCUS_15930 27636 28484 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 protein_id gnl|my_center|LOCUS_15930 28705 30933 gene locus_tag LOCUS_15940 28705 30933 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_15940 31077 31541 gene locus_tag LOCUS_15950 31077 31541 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_15950 31531 33042 gene locus_tag LOCUS_15960 31531 33042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 33066 34331 gene locus_tag LOCUS_15970 gene hisS 33066 34331 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_15970 34331 36139 gene locus_tag LOCUS_15980 gene aspS 34331 36139 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460332.1 protein_id gnl|my_center|LOCUS_15980 36330 36908 gene locus_tag LOCUS_15990 36330 36908 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811907.1 protein_id gnl|my_center|LOCUS_15990 36990 37556 gene locus_tag LOCUS_16000 36990 37556 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_16000 37724 38461 gene locus_tag LOCUS_16010 37724 38461 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_16010 38611 39243 gene locus_tag LOCUS_16020 38611 39243 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_16020 39243 39950 gene locus_tag LOCUS_16030 gene pssA 39243 39950 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_16030 39957 41219 gene locus_tag LOCUS_16040 39957 41219 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_16040 41293 41670 gene locus_tag LOCUS_16050 gene queD 41293 41670 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_16050 41783 42517 gene locus_tag LOCUS_16060 41783 42517 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_16060 43186 42587 gene locus_tag LOCUS_16070 43186 42587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986295.1 protein_id gnl|my_center|LOCUS_16070 43496 43296 gene locus_tag LOCUS_16080 43496 43296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 44164 43544 gene locus_tag LOCUS_16090 gene udk 44164 43544 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181374.1 protein_id gnl|my_center|LOCUS_16090 44583 44176 gene locus_tag LOCUS_16100 44583 44176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 45083 44724 gene locus_tag LOCUS_16110 45083 44724 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_16110 46990 45095 gene locus_tag LOCUS_16120 46990 45095 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_16120 47250 48737 gene locus_tag LOCUS_16130 gene thrC 47250 48737 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_16130 48936 50543 gene locus_tag LOCUS_16140 gene pckA 48936 50543 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_16140 51734 50649 gene locus_tag LOCUS_16150 51734 50649 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_16150 51926 52816 gene locus_tag LOCUS_16160 51926 52816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 53282 53515 gene locus_tag LOCUS_16170 53282 53515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence18 1088 705 gene locus_tag LOCUS_16180 1088 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2548 1316 gene locus_tag LOCUS_16190 2548 1316 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_16190 3601 2696 gene locus_tag LOCUS_16200 3601 2696 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940939.1 protein_id gnl|my_center|LOCUS_16200 3936 4718 gene locus_tag LOCUS_16210 gene motA 3936 4718 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458996.1 protein_id gnl|my_center|LOCUS_16210 4722 5657 gene locus_tag LOCUS_16220 4722 5657 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809827.1 protein_id gnl|my_center|LOCUS_16220 5806 6183 gene locus_tag LOCUS_16230 5806 6183 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_16230 6180 7739 gene locus_tag LOCUS_16240 6180 7739 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_16240 7913 8938 gene locus_tag LOCUS_16250 7913 8938 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_16250 9146 9352 gene locus_tag LOCUS_16260 9146 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 9376 9855 gene locus_tag LOCUS_16270 9376 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 9852 10805 gene locus_tag LOCUS_16280 9852 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 10859 12493 gene locus_tag LOCUS_16290 10859 12493 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943055.1 protein_id gnl|my_center|LOCUS_16290 12621 13970 gene locus_tag LOCUS_16300 gene glmM 12621 13970 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_16300 13971 14750 gene locus_tag LOCUS_16310 13971 14750 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680703.1 protein_id gnl|my_center|LOCUS_16310 15020 15244 gene locus_tag LOCUS_16320 15020 15244 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_16320 15358 17259 gene locus_tag LOCUS_16330 gene feoB 15358 17259 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_16330 17352 17510 gene locus_tag LOCUS_16340 17352 17510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 17771 18019 gene locus_tag LOCUS_16350 17771 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 18157 19020 gene locus_tag LOCUS_16360 18157 19020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 19008 19712 gene locus_tag LOCUS_16370 19008 19712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 19712 20644 gene locus_tag LOCUS_16380 19712 20644 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986628.1 protein_id gnl|my_center|LOCUS_16380 21552 20668 gene locus_tag LOCUS_16390 21552 20668 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_16390 22386 21610 gene locus_tag LOCUS_16400 22386 21610 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_16400 23560 22499 gene locus_tag LOCUS_16410 23560 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 23772 24686 gene locus_tag LOCUS_16420 gene nadA 23772 24686 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_16420 24691 26340 gene locus_tag LOCUS_16430 gene nadB 24691 26340 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_16430 26294 27136 gene locus_tag LOCUS_16440 gene nadC 26294 27136 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942603.1 protein_id gnl|my_center|LOCUS_16440 28466 27225 gene locus_tag LOCUS_16450 28466 27225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 28651 30348 gene locus_tag LOCUS_16460 28651 30348 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462181.1 protein_id gnl|my_center|LOCUS_16460 31477 30479 gene locus_tag LOCUS_16470 gene fba 31477 30479 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948010.1 protein_id gnl|my_center|LOCUS_16470 32707 31790 gene locus_tag LOCUS_16480 32707 31790 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_16480 33028 34260 gene locus_tag LOCUS_16490 33028 34260 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583724.1 protein_id gnl|my_center|LOCUS_16490 34427 35752 gene locus_tag LOCUS_16500 34427 35752 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_16500 35948 36574 gene locus_tag LOCUS_16510 35948 36574 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_16510 36585 37565 gene locus_tag LOCUS_16520 36585 37565 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_16520 37659 39278 gene locus_tag LOCUS_16530 37659 39278 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_16530 40806 39397 gene locus_tag LOCUS_16540 40806 39397 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861309.1 protein_id gnl|my_center|LOCUS_16540 41209 42642 gene locus_tag LOCUS_16550 41209 42642 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 protein_id gnl|my_center|LOCUS_16550 42811 43599 gene locus_tag LOCUS_16560 42811 43599 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359187.1 protein_id gnl|my_center|LOCUS_16560 43790 44767 gene locus_tag LOCUS_16570 43790 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 44865 46037 gene locus_tag LOCUS_16580 44865 46037 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072763.1 protein_id gnl|my_center|LOCUS_16580 46034 49099 gene locus_tag LOCUS_16590 46034 49099 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247622.1 protein_id gnl|my_center|LOCUS_16590 50014 49616 gene locus_tag LOCUS_16600 50014 49616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence19 3300 2932 gene locus_tag LOCUS_16610 3300 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 5043 3457 gene locus_tag LOCUS_16620 5043 3457 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000607108.1 protein_id gnl|my_center|LOCUS_16620 5818 6762 gene locus_tag LOCUS_16630 5818 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 6865 7950 gene locus_tag LOCUS_16640 6865 7950 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_16640 8132 8056 gene locus_tag LOCUS_t00320 8132 8056 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8254 8178 gene locus_tag LOCUS_t00330 8254 8178 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8490 10001 gene locus_tag LOCUS_16650 8490 10001 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_16650 10667 10104 gene locus_tag LOCUS_16660 10667 10104 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703288.1 protein_id gnl|my_center|LOCUS_16660 11627 10749 gene locus_tag LOCUS_16670 11627 10749 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943414.1 protein_id gnl|my_center|LOCUS_16670 11798 11965 gene locus_tag LOCUS_16680 11798 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 12265 13332 gene locus_tag LOCUS_16690 12265 13332 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700204.1 protein_id gnl|my_center|LOCUS_16690 15792 13450 gene locus_tag LOCUS_16700 15792 13450 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546258.1 protein_id gnl|my_center|LOCUS_16700 17445 15814 gene locus_tag LOCUS_16710 17445 15814 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545407.1 protein_id gnl|my_center|LOCUS_16710 18539 17433 gene locus_tag LOCUS_16720 18539 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_16720 20047 18980 gene locus_tag LOCUS_16730 20047 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 20589 20077 gene locus_tag LOCUS_16740 20589 20077 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398925.1 protein_id gnl|my_center|LOCUS_16740 21659 20688 gene locus_tag LOCUS_16750 gene spo0J 21659 20688 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_16750 22410 21646 gene locus_tag LOCUS_16760 gene soj 22410 21646 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_16760 22644 23321 gene locus_tag LOCUS_16770 22644 23321 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_16770 23345 25717 gene locus_tag LOCUS_16780 23345 25717 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_16780 26080 25919 gene locus_tag LOCUS_16790 26080 25919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 26347 26090 gene locus_tag LOCUS_16800 26347 26090 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_16800 26607 26344 gene locus_tag LOCUS_16810 26607 26344 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_16810 27706 26792 gene locus_tag LOCUS_16820 gene pfkA 27706 26792 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_16820 28370 27939 gene locus_tag LOCUS_16830 28370 27939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 28698 28360 gene locus_tag LOCUS_16840 28698 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 28937 29956 gene locus_tag LOCUS_16850 gene bioB 28937 29956 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_16850 30235 31413 gene locus_tag LOCUS_16860 30235 31413 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_16860 32683 31649 gene locus_tag LOCUS_16870 32683 31649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 33110 32856 gene locus_tag LOCUS_16880 33110 32856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 34312 33584 gene locus_tag LOCUS_16890 gene rsmG 34312 33584 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_16890 36250 34343 gene locus_tag LOCUS_16900 gene mnmG 36250 34343 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_16900 37678 36296 gene locus_tag LOCUS_16910 gene mnmE 37678 36296 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295261.1 protein_id gnl|my_center|LOCUS_16910 38590 37748 gene locus_tag LOCUS_16920 38590 37748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 39273 38590 gene locus_tag LOCUS_16930 39273 38590 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393998.1 protein_id gnl|my_center|LOCUS_16930 39528 39319 gene locus_tag LOCUS_16940 gene yidD 39528 39319 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256304.1 protein_id gnl|my_center|LOCUS_16940 39893 39528 gene locus_tag LOCUS_16950 gene rnpA 39893 39528 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 protein_id gnl|my_center|LOCUS_16950 40130 39996 gene locus_tag LOCUS_16960 40130 39996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 40400 40218 gene locus_tag LOCUS_16970 40400 40218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 40537 41973 gene locus_tag LOCUS_16980 gene dnaA 40537 41973 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_16980 42244 43356 gene locus_tag LOCUS_16990 gene dnaN 42244 43356 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_16990 43388 43609 gene locus_tag LOCUS_17000 gene rlbA 43388 43609 CDS product ribosome maturation protein RlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226810.1 protein_id gnl|my_center|LOCUS_17000 43611 44711 gene locus_tag LOCUS_17010 gene recF 43611 44711 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641631.1 protein_id gnl|my_center|LOCUS_17010 44732 44989 gene locus_tag LOCUS_17020 44732 44989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 45021 47078 gene locus_tag LOCUS_17030 gene gyrB 45021 47078 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_17030 47217 47921 gene locus_tag LOCUS_17040 47217 47921 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362617.1 protein_id gnl|my_center|LOCUS_17040 47992 48855 gene locus_tag LOCUS_17050 gene htpX 47992 48855 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence20 650 291 gene locus_tag LOCUS_17060 650 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1059 640 gene locus_tag LOCUS_17070 gene fliS 1059 640 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272503.1 protein_id gnl|my_center|LOCUS_17070 2837 1110 gene locus_tag LOCUS_17080 2837 1110 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 protein_id gnl|my_center|LOCUS_17080 3355 2861 gene locus_tag LOCUS_17090 3355 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 3665 3435 gene locus_tag LOCUS_17100 gene csrA 3665 3435 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460793.1 protein_id gnl|my_center|LOCUS_17100 4117 3668 gene locus_tag LOCUS_17110 gene fliW 4117 3668 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273801.1 protein_id gnl|my_center|LOCUS_17110 4740 4162 gene locus_tag LOCUS_17120 4740 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 6139 4787 gene locus_tag LOCUS_17130 6139 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 7893 6169 gene locus_tag LOCUS_17140 gene flgK 7893 6169 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545686.1 protein_id gnl|my_center|LOCUS_17140 8388 7918 gene locus_tag LOCUS_17150 8388 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 8920 8435 gene locus_tag LOCUS_17160 8920 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 9240 8959 gene locus_tag LOCUS_17170 9240 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 9858 9421 gene locus_tag LOCUS_17180 9858 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 10700 10050 gene locus_tag LOCUS_17190 10700 10050 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_17190 11560 10727 gene locus_tag LOCUS_17200 gene yqeB 11560 10727 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_17200 12790 12125 gene locus_tag LOCUS_17210 12790 12125 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_17210 13672 12848 gene locus_tag LOCUS_17220 13672 12848 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_17220 14169 13669 gene locus_tag LOCUS_17230 gene queF 14169 13669 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 protein_id gnl|my_center|LOCUS_17230 15881 14166 gene locus_tag LOCUS_17240 gene pdcB 15881 14166 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_17240 16922 16170 gene locus_tag LOCUS_17250 gene sdhB 16922 16170 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_17250 18841 16940 gene locus_tag LOCUS_17260 gene sdhA 18841 16940 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808703.1 protein_id gnl|my_center|LOCUS_17260 19496 18870 gene locus_tag LOCUS_17270 gene sdhC 19496 18870 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 protein_id gnl|my_center|LOCUS_17270 20160 19594 gene locus_tag LOCUS_17280 20160 19594 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_17280 21025 20183 gene locus_tag LOCUS_17290 21025 20183 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_17290 21832 21344 gene locus_tag LOCUS_17300 21832 21344 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_17300 22419 21829 gene locus_tag LOCUS_17310 22419 21829 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_17310 23174 22428 gene locus_tag LOCUS_17320 gene rph 23174 22428 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392056.1 protein_id gnl|my_center|LOCUS_17320 23920 23249 gene locus_tag LOCUS_17330 23920 23249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392507.1 protein_id gnl|my_center|LOCUS_17330 24525 23935 gene locus_tag LOCUS_17340 24525 23935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 24968 24522 gene locus_tag LOCUS_17350 24968 24522 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_17350 26265 25099 gene locus_tag LOCUS_17360 26265 25099 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222697.1 protein_id gnl|my_center|LOCUS_17360 27074 26295 gene locus_tag LOCUS_17370 gene murI 27074 26295 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229860.1 protein_id gnl|my_center|LOCUS_17370 27386 27476 gene locus_tag LOCUS_t00340 27386 27476 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30389 27540 gene locus_tag LOCUS_17380 30389 27540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 31147 30455 gene locus_tag LOCUS_17390 31147 30455 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_17390 32387 31407 gene locus_tag LOCUS_17400 gene ansA 32387 31407 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_17400 33814 32483 gene locus_tag LOCUS_17410 gene brnQ 33814 32483 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229322.1 protein_id gnl|my_center|LOCUS_17410 34080 34511 gene locus_tag LOCUS_17420 34080 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 35383 34577 gene locus_tag LOCUS_17430 35383 34577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 36455 35646 gene locus_tag LOCUS_17440 36455 35646 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_17440 37999 36455 gene locus_tag LOCUS_17450 gene metG 37999 36455 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_17450 38992 38111 gene locus_tag LOCUS_17460 gene rsmI 38992 38111 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_17460 39745 39005 gene locus_tag LOCUS_17470 39745 39005 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_17470 40878 39742 gene locus_tag LOCUS_17480 40878 39742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 41906 40908 gene locus_tag LOCUS_17490 gene holB 41906 40908 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_17490 42367 41909 gene locus_tag LOCUS_17500 42367 41909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 42989 42654 gene locus_tag LOCUS_17510 42989 42654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 43246 43632 gene locus_tag LOCUS_17520 43246 43632 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392789.1 protein_id gnl|my_center|LOCUS_17520 45023 43716 gene locus_tag LOCUS_17530 45023 43716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 45180 45094 gene locus_tag LOCUS_t00350 45180 45094 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45311 45224 gene locus_tag LOCUS_t00360 45311 45224 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45438 45351 gene locus_tag LOCUS_t00370 45438 45351 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45558 45470 gene locus_tag LOCUS_t00380 45558 45470 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45652 45579 gene locus_tag LOCUS_t00390 45652 45579 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 45740 45665 gene locus_tag LOCUS_t00400 45740 45665 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 45830 45755 gene locus_tag LOCUS_t00410 45830 45755 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 46025 45949 gene locus_tag LOCUS_t00420 46025 45949 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 46115 46040 gene locus_tag LOCUS_t00430 46115 46040 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 46195 46120 gene locus_tag LOCUS_t00440 46195 46120 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 46281 46206 gene locus_tag LOCUS_t00450 46281 46206 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 46360 46284 gene locus_tag LOCUS_t00460 46360 46284 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 46459 46384 gene locus_tag LOCUS_t00470 46459 46384 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 1648 539 gene locus_tag LOCUS_17540 1648 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2215 2078 gene locus_tag LOCUS_17550 2215 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2690 2830 gene locus_tag LOCUS_17560 2690 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 2811 3089 gene locus_tag LOCUS_17570 2811 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3709 3284 gene locus_tag LOCUS_17580 3709 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277639.1 protein_id gnl|my_center|LOCUS_17580 4613 3759 gene locus_tag LOCUS_17590 4613 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 5108 6826 gene locus_tag LOCUS_17600 5108 6826 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272214.1 protein_id gnl|my_center|LOCUS_17600 6924 7637 gene locus_tag LOCUS_17610 6924 7637 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721870.1 protein_id gnl|my_center|LOCUS_17610 7651 8997 gene locus_tag LOCUS_17620 7651 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 9668 9132 gene locus_tag LOCUS_17630 9668 9132 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_17630 9920 10384 gene locus_tag LOCUS_17640 9920 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 10389 10922 gene locus_tag LOCUS_17650 10389 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 10927 11679 gene locus_tag LOCUS_17660 10927 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 11932 12663 gene locus_tag LOCUS_17670 11932 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 13027 13581 gene locus_tag LOCUS_17680 13027 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 13600 14790 gene locus_tag LOCUS_17690 gene nagZ 13600 14790 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_17690 14836 16107 gene locus_tag LOCUS_17700 14836 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 16138 16842 gene locus_tag LOCUS_17710 16138 16842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 17049 17564 gene locus_tag LOCUS_17720 17049 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 17554 18639 gene locus_tag LOCUS_17730 17554 18639 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193758.1 protein_id gnl|my_center|LOCUS_17730 18639 21692 gene locus_tag LOCUS_17740 gene mexK 18639 21692 CDS product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_17740 21778 22500 gene locus_tag LOCUS_17750 21778 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 22686 24716 gene locus_tag LOCUS_17760 22686 24716 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669465.1 protein_id gnl|my_center|LOCUS_17760 25745 24804 gene locus_tag LOCUS_17770 25745 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 26911 25769 gene locus_tag LOCUS_17780 26911 25769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 27167 28873 gene locus_tag LOCUS_17790 27167 28873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 29108 29374 gene locus_tag LOCUS_17800 29108 29374 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_17800 29542 31254 gene locus_tag LOCUS_17810 gene ptsP 29542 31254 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475729.1 protein_id gnl|my_center|LOCUS_17810 31638 33026 gene locus_tag LOCUS_17820 gene aspA 31638 33026 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 protein_id gnl|my_center|LOCUS_17820 34356 33112 gene locus_tag LOCUS_17830 34356 33112 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861472.1 protein_id gnl|my_center|LOCUS_17830 34523 35197 gene locus_tag LOCUS_17840 34523 35197 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814489.1 protein_id gnl|my_center|LOCUS_17840 35323 36354 gene locus_tag LOCUS_17850 35323 36354 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167747.1 protein_id gnl|my_center|LOCUS_17850 36470 36886 gene locus_tag LOCUS_17860 36470 36886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 37315 36953 gene locus_tag LOCUS_17870 37315 36953 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430855.1 protein_id gnl|my_center|LOCUS_17870 37525 37600 gene locus_tag LOCUS_t00480 37525 37600 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37667 38422 gene locus_tag LOCUS_17880 37667 38422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 39038 40570 gene locus_tag LOCUS_17890 39038 40570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 40696 42471 gene locus_tag LOCUS_17900 40696 42471 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815325.1 protein_id gnl|my_center|LOCUS_17900 42489 43613 gene locus_tag LOCUS_17910 42489 43613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 43626 45260 gene locus_tag LOCUS_17920 43626 45260 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815325.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence22 674 2239 gene locus_tag LOCUS_17930 674 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2393 2671 gene locus_tag LOCUS_17940 gene rpsO 2393 2671 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_17940 2842 4926 gene locus_tag LOCUS_17950 gene pnp 2842 4926 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_17950 5972 5007 gene locus_tag LOCUS_17960 5972 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6152 7111 gene locus_tag LOCUS_17970 6152 7111 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_17970 7256 7624 gene locus_tag LOCUS_17980 7256 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 8473 7706 gene locus_tag LOCUS_17990 8473 7706 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593336.1 protein_id gnl|my_center|LOCUS_17990 9517 8564 gene locus_tag LOCUS_18000 9517 8564 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_18000 9724 10428 gene locus_tag LOCUS_18010 9724 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 10425 11429 gene locus_tag LOCUS_18020 10425 11429 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 protein_id gnl|my_center|LOCUS_18020 11448 12692 gene locus_tag LOCUS_18030 11448 12692 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_18030 12969 13994 gene locus_tag LOCUS_18040 12969 13994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 15001 14129 gene locus_tag LOCUS_18050 gene hslO 15001 14129 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_18050 15557 14994 gene locus_tag LOCUS_18060 gene yfcE 15557 14994 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392436.1 protein_id gnl|my_center|LOCUS_18060 16046 15582 gene locus_tag LOCUS_18070 gene ribH 16046 15582 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_18070 17363 16155 gene locus_tag LOCUS_18080 17363 16155 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_18080 18063 17413 gene locus_tag LOCUS_18090 gene ribE 18063 17413 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493840.1 protein_id gnl|my_center|LOCUS_18090 19170 18073 gene locus_tag LOCUS_18100 gene ribD 19170 18073 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_18100 19689 19474 gene locus_tag LOCUS_18110 19689 19474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 21199 19856 gene locus_tag LOCUS_18120 gene accC 21199 19856 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_18120 21706 21239 gene locus_tag LOCUS_18130 gene accB 21706 21239 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732266.1 protein_id gnl|my_center|LOCUS_18130 22734 21712 gene locus_tag LOCUS_18140 gene pxpC 22734 21712 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 protein_id gnl|my_center|LOCUS_18140 23486 22731 gene locus_tag LOCUS_18150 gene pxpB 23486 22731 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_18150 24355 23534 gene locus_tag LOCUS_18160 24355 23534 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_18160 25691 24432 gene locus_tag LOCUS_18170 25691 24432 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_18170 26520 25756 gene locus_tag LOCUS_18180 gene pxpA 26520 25756 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_18180 27827 26688 gene locus_tag LOCUS_18190 27827 26688 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096494.1 protein_id gnl|my_center|LOCUS_18190 28336 27968 gene locus_tag LOCUS_18200 28336 27968 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682305.1 protein_id gnl|my_center|LOCUS_18200 28584 28333 gene locus_tag LOCUS_18210 28584 28333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 29340 28726 gene locus_tag LOCUS_18220 29340 28726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 30052 29372 gene locus_tag LOCUS_18230 30052 29372 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460083.1 protein_id gnl|my_center|LOCUS_18230 30601 31911 gene locus_tag LOCUS_18240 30601 31911 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438175.1 protein_id gnl|my_center|LOCUS_18240 32781 31993 gene locus_tag LOCUS_18250 gene pflA 32781 31993 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_18250 35013 32782 gene locus_tag LOCUS_18260 gene pflB 35013 32782 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195472.1 protein_id gnl|my_center|LOCUS_18260 35422 36123 gene locus_tag LOCUS_18270 35422 36123 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811515.1 protein_id gnl|my_center|LOCUS_18270 37083 36205 gene locus_tag LOCUS_18280 37083 36205 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356507.1 protein_id gnl|my_center|LOCUS_18280 38759 37080 gene locus_tag LOCUS_18290 gene spoVB 38759 37080 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_18290 39454 38885 gene locus_tag LOCUS_18300 39454 38885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 40171 39560 gene locus_tag LOCUS_18310 gene ttdB 40171 39560 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 protein_id gnl|my_center|LOCUS_18310 41070 40171 gene locus_tag LOCUS_18320 gene ttdA 41070 40171 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_18320 41241 42173 gene locus_tag LOCUS_18330 41241 42173 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_18330 42544 42218 gene locus_tag LOCUS_18340 42544 42218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence23 <1 719 gene locus_tag LOCUS_18350 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109307.1:restriction endonuclease subunit S 754 1305 gene locus_tag LOCUS_18360 754 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1277 1459 gene locus_tag LOCUS_18370 1277 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 1684 2202 gene locus_tag LOCUS_18380 1684 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 2202 2534 gene locus_tag LOCUS_18390 2202 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18390 2488 3015 gene locus_tag LOCUS_18400 2488 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18400 3106 3798 gene locus_tag LOCUS_18410 3106 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4087 4647 gene locus_tag LOCUS_18420 4087 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4728 5060 gene locus_tag LOCUS_18430 4728 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 5299 6453 gene locus_tag LOCUS_18440 5299 6453 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_18440 6472 7587 gene locus_tag LOCUS_18450 gene glgD 6472 7587 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_18450 7699 10191 gene locus_tag LOCUS_18460 7699 10191 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_18460 10245 12197 gene locus_tag LOCUS_18470 gene glgB 10245 12197 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_18470 12194 13636 gene locus_tag LOCUS_18480 gene glgA 12194 13636 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860977.1 protein_id gnl|my_center|LOCUS_18480 13780 17253 gene locus_tag LOCUS_18490 13780 17253 CDS product bifunctional glycogen debranching protein GlgX/4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460009.1 protein_id gnl|my_center|LOCUS_18490 17375 18064 gene locus_tag LOCUS_18500 17375 18064 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963960.1 protein_id gnl|my_center|LOCUS_18500 18067 18741 gene locus_tag LOCUS_18510 18067 18741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 18757 20412 gene locus_tag LOCUS_18520 18757 20412 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_18520 20606 21589 gene locus_tag LOCUS_18530 20606 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 22779 21682 gene locus_tag LOCUS_18540 gene serC 22779 21682 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_18540 23343 24884 gene locus_tag LOCUS_18550 gene serA 23343 24884 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_18550 25093 25449 gene locus_tag LOCUS_18560 25093 25449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 25674 26258 gene locus_tag LOCUS_18570 25674 26258 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583465.1 protein_id gnl|my_center|LOCUS_18570 26507 26710 gene locus_tag LOCUS_18580 26507 26710 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669524.1 protein_id gnl|my_center|LOCUS_18580 26707 27117 gene locus_tag LOCUS_18590 26707 27117 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669522.1 protein_id gnl|my_center|LOCUS_18590 27363 29879 gene locus_tag LOCUS_18600 27363 29879 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_18600 29896 32565 gene locus_tag LOCUS_18610 29896 32565 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948931.1 protein_id gnl|my_center|LOCUS_18610 33270 32722 gene locus_tag LOCUS_18620 33270 32722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 33670 33951 gene locus_tag LOCUS_18630 33670 33951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 34156 34806 gene locus_tag LOCUS_18640 34156 34806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 34779 35450 gene locus_tag LOCUS_18650 34779 35450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18650 36061 35771 gene locus_tag LOCUS_18660 36061 35771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 36231 37610 gene locus_tag LOCUS_18670 36231 37610 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272192.1 protein_id gnl|my_center|LOCUS_18670 37836 37663 gene locus_tag LOCUS_18680 37836 37663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 37956 38135 gene locus_tag LOCUS_18690 37956 38135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 38128 38394 gene locus_tag LOCUS_18700 38128 38394 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189463936.1 protein_id gnl|my_center|LOCUS_18700 38408 38713 gene locus_tag LOCUS_18710 38408 38713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 39054 38869 gene locus_tag LOCUS_18720 39054 38869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence24 255 980 gene locus_tag LOCUS_18730 gene rpsB 255 980 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_18730 1081 1953 gene locus_tag LOCUS_18740 gene tsf 1081 1953 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_18740 2101 2829 gene locus_tag LOCUS_18750 gene pyrH 2101 2829 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_18750 2826 3383 gene locus_tag LOCUS_18760 gene frr 2826 3383 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_18760 3383 3610 gene locus_tag LOCUS_18770 3383 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3600 3770 gene locus_tag LOCUS_18780 3600 3770 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_18780 3895 4692 gene locus_tag LOCUS_18790 3895 4692 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_18790 4723 5553 gene locus_tag LOCUS_18800 4723 5553 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_18800 5569 6723 gene locus_tag LOCUS_18810 gene dxr 5569 6723 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986796.1 protein_id gnl|my_center|LOCUS_18810 6755 7795 gene locus_tag LOCUS_18820 gene rseP 6755 7795 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_18820 7801 8871 gene locus_tag LOCUS_18830 gene ispG 7801 8871 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_18830 8871 10586 gene locus_tag LOCUS_18840 8871 10586 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_18840 10747 11679 gene locus_tag LOCUS_18850 10747 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 11695 13401 gene locus_tag LOCUS_18860 11695 13401 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948958.1 protein_id gnl|my_center|LOCUS_18860 13763 13425 gene locus_tag LOCUS_18870 13763 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 14636 16021 gene locus_tag LOCUS_18880 14636 16021 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 protein_id gnl|my_center|LOCUS_18880 16072 17346 gene locus_tag LOCUS_18890 16072 17346 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067958.1 protein_id gnl|my_center|LOCUS_18890 17381 18733 gene locus_tag LOCUS_18900 17381 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 18766 20250 gene locus_tag LOCUS_18910 18766 20250 CDS product DUF4975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841481.1 protein_id gnl|my_center|LOCUS_18910 20279 21583 gene locus_tag LOCUS_18920 20279 21583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 21946 22920 gene locus_tag LOCUS_18930 21946 22920 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068530.1 protein_id gnl|my_center|LOCUS_18930 23225 23016 gene locus_tag LOCUS_18940 23225 23016 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_18940 23402 24217 gene locus_tag LOCUS_18950 23402 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 24220 25056 gene locus_tag LOCUS_18960 24220 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 25270 25707 gene locus_tag LOCUS_18970 gene mraZ 25270 25707 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_18970 25720 26694 gene locus_tag LOCUS_18980 gene rsmH 25720 26694 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_18980 26694 27059 gene locus_tag LOCUS_18990 26694 27059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 27227 28732 gene locus_tag LOCUS_19000 27227 28732 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_19000 28732 30111 gene locus_tag LOCUS_19010 28732 30111 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_19010 30158 31123 gene locus_tag LOCUS_19020 gene mraY 30158 31123 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_19020 31140 32510 gene locus_tag LOCUS_19030 gene murD 31140 32510 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_19030 32523 33638 gene locus_tag LOCUS_19040 gene murG 32523 33638 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_19040 33691 35091 gene locus_tag LOCUS_19050 gene murC 33691 35091 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_19050 35119 36060 gene locus_tag LOCUS_19060 35119 36060 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_19060 36057 36848 gene locus_tag LOCUS_19070 36057 36848 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392366.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence25 1341 109 gene locus_tag LOCUS_19080 1341 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2075 1428 gene locus_tag LOCUS_19090 2075 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3254 2088 gene locus_tag LOCUS_19100 3254 2088 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_19100 4956 3508 gene locus_tag LOCUS_19110 gene miaB 4956 3508 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811605.1 protein_id gnl|my_center|LOCUS_19110 5883 4978 gene locus_tag LOCUS_19120 5883 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 6014 5940 gene locus_tag LOCUS_t00490 6014 5940 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6096 6022 gene locus_tag LOCUS_t00500 6096 6022 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6173 6099 gene locus_tag LOCUS_t00510 6173 6099 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6279 6205 gene locus_tag LOCUS_t00520 6279 6205 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6360 6284 gene locus_tag LOCUS_t00530 6360 6284 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6641 6471 gene locus_tag LOCUS_19130 6641 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 7091 6645 gene locus_tag LOCUS_19140 7091 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 7465 7088 gene locus_tag LOCUS_19150 7465 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 7844 7455 gene locus_tag LOCUS_19160 7844 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 8218 7844 gene locus_tag LOCUS_19170 8218 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 8661 8290 gene locus_tag LOCUS_19180 8661 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 8956 8702 gene locus_tag LOCUS_19190 8956 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 10326 8953 gene locus_tag LOCUS_19200 10326 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 11308 10340 gene locus_tag LOCUS_19210 11308 10340 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047642.1 protein_id gnl|my_center|LOCUS_19210 11949 11326 gene locus_tag LOCUS_19220 11949 11326 CDS product phage scaffolding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003769956.1 protein_id gnl|my_center|LOCUS_19220 12197 12021 gene locus_tag LOCUS_19230 12197 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 13596 12190 gene locus_tag LOCUS_19240 13596 12190 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861027.1 protein_id gnl|my_center|LOCUS_19240 14854 13610 gene locus_tag LOCUS_19250 14854 13610 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047636.1 protein_id gnl|my_center|LOCUS_19250 15052 14873 gene locus_tag LOCUS_19260 15052 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 15096 15314 gene locus_tag LOCUS_19270 15096 15314 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097013212.1 protein_id gnl|my_center|LOCUS_19270 15872 15363 gene locus_tag LOCUS_19280 15872 15363 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047635.1 protein_id gnl|my_center|LOCUS_19280 16154 16079 gene locus_tag LOCUS_t00540 16154 16079 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16883 16368 gene locus_tag LOCUS_19290 16883 16368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 17116 16940 gene locus_tag LOCUS_19300 17116 16940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 17336 17121 gene locus_tag LOCUS_19310 17336 17121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 17532 17323 gene locus_tag LOCUS_19320 17532 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 18003 17587 gene locus_tag LOCUS_19330 18003 17587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 18451 18089 gene locus_tag LOCUS_19340 18451 18089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 18795 18448 gene locus_tag LOCUS_19350 18795 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 19460 18792 gene locus_tag LOCUS_19360 19460 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 20196 19405 gene locus_tag LOCUS_19370 20196 19405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 21083 20214 gene locus_tag LOCUS_19380 21083 20214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 22060 21113 gene locus_tag LOCUS_19390 22060 21113 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_19390 22506 22318 gene locus_tag LOCUS_19400 22506 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395994.1 protein_id gnl|my_center|LOCUS_19400 22846 22460 gene locus_tag LOCUS_19410 22846 22460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 23049 22882 gene locus_tag LOCUS_19420 23049 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 23256 23053 gene locus_tag LOCUS_19430 23256 23053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 24065 23268 gene locus_tag LOCUS_19440 24065 23268 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_19440 24304 24086 gene locus_tag LOCUS_19450 24304 24086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 24490 24888 gene locus_tag LOCUS_19460 24490 24888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 24998 26146 gene locus_tag LOCUS_19470 24998 26146 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461088.1 protein_id gnl|my_center|LOCUS_19470 26136 28364 gene locus_tag LOCUS_19480 26136 28364 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461087.1 protein_id gnl|my_center|LOCUS_19480 28434 29294 gene locus_tag LOCUS_19490 gene dinD 28434 29294 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_19490 29425 30474 gene locus_tag LOCUS_19500 29425 30474 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_19500 30890 30534 gene locus_tag LOCUS_19510 30890 30534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 31094 31816 gene locus_tag LOCUS_19520 31094 31816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 31908 33080 gene locus_tag LOCUS_19530 31908 33080 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_19530 33547 33215 gene locus_tag LOCUS_19540 33547 33215 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_19540 33848 33534 gene locus_tag LOCUS_19550 33848 33534 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680062.1 protein_id gnl|my_center|LOCUS_19550 34717 33950 gene locus_tag LOCUS_19560 34717 33950 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225953.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence26 417 76 gene locus_tag LOCUS_19570 417 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1015 635 gene locus_tag LOCUS_19580 1015 635 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_19580 1608 1123 gene locus_tag LOCUS_19590 1608 1123 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_19590 2794 1613 gene locus_tag LOCUS_19600 2794 1613 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_19600 3547 3065 gene locus_tag LOCUS_19610 3547 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3748 3554 gene locus_tag LOCUS_19620 3748 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 5261 4290 gene locus_tag LOCUS_19630 gene thrB 5261 4290 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_19630 6561 5263 gene locus_tag LOCUS_19640 6561 5263 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_19640 7037 6582 gene locus_tag LOCUS_19650 7037 6582 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_19650 7878 7270 gene locus_tag LOCUS_19660 gene plsY 7878 7270 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_19660 9209 7878 gene locus_tag LOCUS_19670 gene der 9209 7878 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_19670 10641 9247 gene locus_tag LOCUS_19680 10641 9247 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_19680 11835 10747 gene locus_tag LOCUS_19690 11835 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 12647 11817 gene locus_tag LOCUS_19700 gene ispH 12647 11817 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_19700 15691 12836 gene locus_tag LOCUS_19710 15691 12836 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460038.1 protein_id gnl|my_center|LOCUS_19710 17311 16079 gene locus_tag LOCUS_19720 17311 16079 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_19720 18370 17342 gene locus_tag LOCUS_19730 18370 17342 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_19730 19391 18501 gene locus_tag LOCUS_19740 gene truB 19391 18501 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_19740 21431 19404 gene locus_tag LOCUS_19750 gene ligA 21431 19404 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_19750 23908 21458 gene locus_tag LOCUS_19760 gene pcrA 23908 21458 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_19760 25641 23992 gene locus_tag LOCUS_19770 25641 23992 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_19770 25917 26003 gene locus_tag LOCUS_t00550 25917 26003 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26337 26101 gene locus_tag LOCUS_19780 26337 26101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 26429 26262 gene locus_tag LOCUS_19790 26429 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 26569 26868 gene locus_tag LOCUS_19800 26569 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 28155 27034 gene locus_tag LOCUS_19810 28155 27034 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_19810 29644 28250 gene locus_tag LOCUS_19820 29644 28250 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_19820 29781 30656 gene locus_tag LOCUS_19830 gene pdxS 29781 30656 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_19830 30658 31257 gene locus_tag LOCUS_19840 gene pdxT 30658 31257 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 protein_id gnl|my_center|LOCUS_19840 32486 31338 gene locus_tag LOCUS_19850 32486 31338 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_19850 32690 34018 gene locus_tag LOCUS_19860 32690 34018 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence27 <1 2256 gene locus_tag LOCUS_19870 <1 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_138224727.1:urea carboxylase 2273 3634 gene locus_tag LOCUS_19880 2273 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3631 3996 gene locus_tag LOCUS_19890 3631 3996 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_19890 4060 4428 gene locus_tag LOCUS_19900 4060 4428 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_19900 5711 4500 gene locus_tag LOCUS_19910 5711 4500 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_19910 5953 5878 gene locus_tag LOCUS_t00560 5953 5878 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6298 7389 gene locus_tag LOCUS_19920 6298 7389 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880392.1 protein_id gnl|my_center|LOCUS_19920 7390 9330 gene locus_tag LOCUS_19930 7390 9330 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880393.1 protein_id gnl|my_center|LOCUS_19930 9364 10065 gene locus_tag LOCUS_19940 gene cybH 9364 10065 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880394.1 protein_id gnl|my_center|LOCUS_19940 10155 10397 gene locus_tag LOCUS_19950 10155 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 10514 10855 gene locus_tag LOCUS_19960 gene hypA 10514 10855 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_19960 10855 11514 gene locus_tag LOCUS_19970 gene hypB 10855 11514 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_19970 11525 12124 gene locus_tag LOCUS_19980 11525 12124 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_19980 12153 12410 gene locus_tag LOCUS_19990 12153 12410 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964126.1 protein_id gnl|my_center|LOCUS_19990 12400 13506 gene locus_tag LOCUS_20000 gene hypD 12400 13506 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_20000 13496 14503 gene locus_tag LOCUS_20010 gene hypE 13496 14503 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_20010 14710 15018 gene locus_tag LOCUS_20020 14710 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 15272 16198 gene locus_tag LOCUS_20030 15272 16198 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_20030 16271 17191 gene locus_tag LOCUS_20040 16271 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 17498 17334 gene locus_tag LOCUS_20050 17498 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 17700 19244 gene locus_tag LOCUS_20060 17700 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 19256 20239 gene locus_tag LOCUS_20070 19256 20239 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142635.1 protein_id gnl|my_center|LOCUS_20070 20336 20803 gene locus_tag LOCUS_20080 20336 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20080 20803 21831 gene locus_tag LOCUS_20090 20803 21831 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260995.1 protein_id gnl|my_center|LOCUS_20090 21941 23953 gene locus_tag LOCUS_20100 21941 23953 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040347516.1 protein_id gnl|my_center|LOCUS_20100 23955 24710 gene locus_tag LOCUS_20110 23955 24710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 24713 25891 gene locus_tag LOCUS_20120 24713 25891 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938354.1 protein_id gnl|my_center|LOCUS_20120 25905 26894 gene locus_tag LOCUS_20130 25905 26894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 26974 27945 gene locus_tag LOCUS_20140 gene rfaD 26974 27945 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815275.1 protein_id gnl|my_center|LOCUS_20140 27935 28435 gene locus_tag LOCUS_20150 27935 28435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 29292 28498 gene locus_tag LOCUS_20160 29292 28498 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_20160 29321 29518 gene locus_tag LOCUS_20170 29321 29518 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_20170 29786 31096 gene locus_tag LOCUS_20180 29786 31096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 31410 31745 gene locus_tag LOCUS_20190 31410 31745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 31780 32619 gene locus_tag LOCUS_20200 31780 32619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence28 305 1969 gene locus_tag LOCUS_20210 305 1969 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_20210 1996 3660 gene locus_tag LOCUS_20220 1996 3660 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_20220 3712 4479 gene locus_tag LOCUS_20230 3712 4479 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 protein_id gnl|my_center|LOCUS_20230 4490 5569 gene locus_tag LOCUS_20240 4490 5569 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_20240 5592 6491 gene locus_tag LOCUS_20250 gene virK 5592 6491 CDS product virulence factor VirK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602664.1 protein_id gnl|my_center|LOCUS_20250 6546 7754 gene locus_tag LOCUS_20260 6546 7754 CDS product polysialyltransferase family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302730.1 protein_id gnl|my_center|LOCUS_20260 7792 9000 gene locus_tag LOCUS_20270 7792 9000 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_20270 9017 10204 gene locus_tag LOCUS_20280 9017 10204 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942618.1 protein_id gnl|my_center|LOCUS_20280 10394 11395 gene locus_tag LOCUS_20290 gene neuC 10394 11395 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459665.1 protein_id gnl|my_center|LOCUS_20290 11397 12446 gene locus_tag LOCUS_20300 11397 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 12459 13529 gene locus_tag LOCUS_20310 12459 13529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 13576 14586 gene locus_tag LOCUS_20320 gene neuB 13576 14586 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_20320 14577 15638 gene locus_tag LOCUS_20330 14577 15638 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_20330 15692 16258 gene locus_tag LOCUS_20340 15692 16258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 16275 16943 gene locus_tag LOCUS_20350 16275 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 16988 17683 gene locus_tag LOCUS_20360 16988 17683 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403384.1 protein_id gnl|my_center|LOCUS_20360 17769 18467 gene locus_tag LOCUS_20370 17769 18467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 18746 19531 gene locus_tag LOCUS_20380 18746 19531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 19533 19970 gene locus_tag LOCUS_20390 19533 19970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 20120 20389 gene locus_tag LOCUS_20400 20120 20389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 20373 20651 gene locus_tag LOCUS_20410 20373 20651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 20727 21731 gene locus_tag LOCUS_20420 20727 21731 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_20420 21731 22423 gene locus_tag LOCUS_20430 gene hddC 21731 22423 CDS product D-glycero-D-manno-heptose 1-phosphate guanosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857908.1 protein_id gnl|my_center|LOCUS_20430 22455 23012 gene locus_tag LOCUS_20440 22455 23012 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_20440 23040 23183 gene locus_tag LOCUS_20450 23040 23183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 23525 23337 gene locus_tag LOCUS_20460 23525 23337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 24294 23491 gene locus_tag LOCUS_20470 24294 23491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 24648 24373 gene locus_tag LOCUS_20480 24648 24373 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_20480 24923 24645 gene locus_tag LOCUS_20490 24923 24645 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_20490 25053 25172 gene locus_tag LOCUS_20500 25053 25172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 25274 25441 gene locus_tag LOCUS_20510 25274 25441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence29 265 1935 gene locus_tag LOCUS_20520 265 1935 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_20520 3130 2093 gene locus_tag LOCUS_20530 3130 2093 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130718.1 protein_id gnl|my_center|LOCUS_20530 3206 3772 gene locus_tag LOCUS_20540 3206 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 4516 3776 gene locus_tag LOCUS_20550 gene budA 4516 3776 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723157.1 protein_id gnl|my_center|LOCUS_20550 5644 4793 gene locus_tag LOCUS_20560 5644 4793 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_20560 6475 5777 gene locus_tag LOCUS_20570 6475 5777 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113056.1 protein_id gnl|my_center|LOCUS_20570 6386 6616 gene locus_tag LOCUS_20580 6386 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 7015 6887 gene locus_tag LOCUS_20590 7015 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 7220 8539 gene locus_tag LOCUS_20600 7220 8539 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 protein_id gnl|my_center|LOCUS_20600 9555 8638 gene locus_tag LOCUS_20610 9555 8638 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 protein_id gnl|my_center|LOCUS_20610 10060 11373 gene locus_tag LOCUS_20620 10060 11373 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905157.1 protein_id gnl|my_center|LOCUS_20620 11792 12520 gene locus_tag LOCUS_20630 11792 12520 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208820.1 protein_id gnl|my_center|LOCUS_20630 13062 12682 gene locus_tag LOCUS_20640 13062 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 14850 13501 gene locus_tag LOCUS_20650 14850 13501 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_20650 15170 14988 gene locus_tag LOCUS_20660 15170 14988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 15601 15344 gene locus_tag LOCUS_20670 15601 15344 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_20670 16343 15729 gene locus_tag LOCUS_20680 16343 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 16663 16376 gene locus_tag LOCUS_20690 16663 16376 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939018.1 protein_id gnl|my_center|LOCUS_20690 16955 16677 gene locus_tag LOCUS_20700 16955 16677 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_20700 17386 17958 gene locus_tag LOCUS_20710 17386 17958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 19198 18059 gene locus_tag LOCUS_20720 19198 18059 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_20720 19877 19200 gene locus_tag LOCUS_20730 gene modB 19877 19200 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_20730 21217 20390 gene locus_tag LOCUS_20740 gene modA 21217 20390 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_20740 22259 21324 gene locus_tag LOCUS_20750 22259 21324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 23347 22352 gene locus_tag LOCUS_20760 gene moaA 23347 22352 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_20760 24564 23359 gene locus_tag LOCUS_20770 24564 23359 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272494.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence30 1263 157 gene locus_tag LOCUS_20780 gene ychF 1263 157 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_20780 1927 1289 gene locus_tag LOCUS_20790 gene upp 1927 1289 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_20790 2387 1932 gene locus_tag LOCUS_20800 gene rpiB 2387 1932 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_20800 3824 2769 gene locus_tag LOCUS_20810 3824 2769 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_20810 4589 3855 gene locus_tag LOCUS_20820 4589 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 4828 4541 gene locus_tag LOCUS_20830 4828 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5708 4821 gene locus_tag LOCUS_20840 gene prmC 5708 4821 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_20840 6797 5730 gene locus_tag LOCUS_20850 gene prfA 6797 5730 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_20850 7779 6805 gene locus_tag LOCUS_20860 7779 6805 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_20860 8071 7874 gene locus_tag LOCUS_20870 gene rpmE 8071 7874 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715284.1 protein_id gnl|my_center|LOCUS_20870 8344 9639 gene locus_tag LOCUS_20880 gene clpX 8344 9639 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965927.1 protein_id gnl|my_center|LOCUS_20880 10649 9792 gene locus_tag LOCUS_20890 gene pheA 10649 9792 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813040.1 protein_id gnl|my_center|LOCUS_20890 11442 10783 gene locus_tag LOCUS_20900 11442 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 12109 11456 gene locus_tag LOCUS_20910 12109 11456 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_20910 13839 12127 gene locus_tag LOCUS_20920 13839 12127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 15334 14045 gene locus_tag LOCUS_20930 15334 14045 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476122.1 protein_id gnl|my_center|LOCUS_20930 15543 16202 gene locus_tag LOCUS_20940 15543 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 17873 16284 gene locus_tag LOCUS_20950 17873 16284 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_20950 18188 17955 gene locus_tag LOCUS_20960 gene rpsR 18188 17955 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_20960 18659 18204 gene locus_tag LOCUS_20970 gene ssb 18659 18204 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_20970 18994 18707 gene locus_tag LOCUS_20980 gene rpsF 18994 18707 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_20980 19775 19149 gene locus_tag LOCUS_20990 19775 19149 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_20990 19741 19932 gene locus_tag LOCUS_21000 19741 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 20433 19858 gene locus_tag LOCUS_21010 20433 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 20577 20502 gene locus_tag LOCUS_t00570 20577 20502 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 20656 20580 gene locus_tag LOCUS_t00580 20656 20580 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 20739 20664 gene locus_tag LOCUS_t00590 20739 20664 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 21411 20869 gene locus_tag LOCUS_21020 21411 20869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence31 560 636 gene locus_tag LOCUS_t00600 560 636 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 952 1761 gene locus_tag LOCUS_21030 952 1761 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272230.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21030 1902 2678 gene locus_tag LOCUS_21040 1902 2678 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073498.1 protein_id gnl|my_center|LOCUS_21040 2939 4198 gene locus_tag LOCUS_21050 2939 4198 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_21050 4256 5587 gene locus_tag LOCUS_21060 4256 5587 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_21060 7503 5860 gene locus_tag LOCUS_21070 7503 5860 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966914.1 protein_id gnl|my_center|LOCUS_21070 7974 8993 gene locus_tag LOCUS_21080 7974 8993 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_21080 9028 9840 gene locus_tag LOCUS_21090 9028 9840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309981.1 protein_id gnl|my_center|LOCUS_21090 9846 10643 gene locus_tag LOCUS_21100 9846 10643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970689.1 protein_id gnl|my_center|LOCUS_21100 10648 11625 gene locus_tag LOCUS_21110 10648 11625 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_21110 11727 13586 gene locus_tag LOCUS_21120 gene iorA 11727 13586 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250594.1 protein_id gnl|my_center|LOCUS_21120 13590 14195 gene locus_tag LOCUS_21130 13590 14195 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_21130 14220 16244 gene locus_tag LOCUS_21140 14220 16244 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541107.1 protein_id gnl|my_center|LOCUS_21140 16296 16622 gene locus_tag LOCUS_21150 16296 16622 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963577.1 protein_id gnl|my_center|LOCUS_21150 16644 16997 gene locus_tag LOCUS_21160 16644 16997 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877171.1 protein_id gnl|my_center|LOCUS_21160 17031 17837 gene locus_tag LOCUS_21170 17031 17837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970689.1 protein_id gnl|my_center|LOCUS_21170 17893 19152 gene locus_tag LOCUS_21180 17893 19152 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_21180 19158 20357 gene locus_tag LOCUS_21190 19158 20357 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147112.1 protein_id gnl|my_center|LOCUS_21190 20359 20772 gene locus_tag LOCUS_21200 20359 20772 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence32 399 1193 gene locus_tag LOCUS_21210 399 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1396 1320 gene locus_tag LOCUS_t00610 1396 1320 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1479 1403 gene locus_tag LOCUS_t00620 1479 1403 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1688 3397 gene locus_tag LOCUS_21220 1688 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3570 4847 gene locus_tag LOCUS_21230 3570 4847 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545209.1 protein_id gnl|my_center|LOCUS_21230 5000 5272 gene locus_tag LOCUS_21240 5000 5272 CDS product DUF4321 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403495.1 protein_id gnl|my_center|LOCUS_21240 5308 5997 gene locus_tag LOCUS_21250 gene radC 5308 5997 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013390.1 protein_id gnl|my_center|LOCUS_21250 6146 7186 gene locus_tag LOCUS_21260 6146 7186 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_21260 7209 8201 gene locus_tag LOCUS_21270 gene mreC 7209 8201 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392075.1 protein_id gnl|my_center|LOCUS_21270 8198 8692 gene locus_tag LOCUS_21280 8198 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 8773 10578 gene locus_tag LOCUS_21290 gene mrdA 8773 10578 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_21290 10593 11237 gene locus_tag LOCUS_21300 gene minC 10593 11237 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255923.1 protein_id gnl|my_center|LOCUS_21300 11248 12036 gene locus_tag LOCUS_21310 gene minD 11248 12036 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_21310 12049 12324 gene locus_tag LOCUS_21320 gene minE 12049 12324 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816777.1 protein_id gnl|my_center|LOCUS_21320 12321 13424 gene locus_tag LOCUS_21330 gene rodA 12321 13424 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_21330 13647 16283 gene locus_tag LOCUS_21340 13647 16283 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_21340 16318 17760 gene locus_tag LOCUS_21350 16318 17760 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_21350 18111 19940 gene locus_tag LOCUS_21360 gene glmS 18111 19940 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_21360 20083 20544 gene locus_tag LOCUS_21370 20083 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence33 <1 903 gene locus_tag LOCUS_21380 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392003.1:ABC transporter substrate-binding protein 923 1528 gene locus_tag LOCUS_21390 923 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 1627 2499 gene locus_tag LOCUS_21400 1627 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 2764 4035 gene locus_tag LOCUS_21410 2764 4035 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926512.1 protein_id gnl|my_center|LOCUS_21410 4032 5357 gene locus_tag LOCUS_21420 4032 5357 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_21420 5404 7416 gene locus_tag LOCUS_21430 5404 7416 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680599.1 protein_id gnl|my_center|LOCUS_21430 7512 8768 gene locus_tag LOCUS_21440 gene hutI 7512 8768 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_21440 9258 10529 gene locus_tag LOCUS_21450 gene hutH 9258 10529 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21450 10662 11489 gene locus_tag LOCUS_21460 10662 11489 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_21460 11534 12178 gene locus_tag LOCUS_21470 11534 12178 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 protein_id gnl|my_center|LOCUS_21470 12192 13016 gene locus_tag LOCUS_21480 12192 13016 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_21480 13429 14772 gene locus_tag LOCUS_21490 13429 14772 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167439.1 protein_id gnl|my_center|LOCUS_21490 14907 16181 gene locus_tag LOCUS_21500 gene larA 14907 16181 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_21500 18271 16565 gene locus_tag LOCUS_21510 18271 16565 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948958.1 protein_id gnl|my_center|LOCUS_21510 19171 18287 gene locus_tag LOCUS_21520 19171 18287 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530542.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence34 3040 995 gene locus_tag LOCUS_21530 gene uvrB 3040 995 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_21530 4298 3387 gene locus_tag LOCUS_21540 4298 3387 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814758.1 protein_id gnl|my_center|LOCUS_21540 5605 4490 gene locus_tag LOCUS_21550 5605 4490 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_21550 7228 5696 gene locus_tag LOCUS_21560 7228 5696 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963679.1 protein_id gnl|my_center|LOCUS_21560 8774 7272 gene locus_tag LOCUS_21570 gene pelB 8774 7272 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_21570 9940 8978 gene locus_tag LOCUS_21580 9940 8978 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_21580 10742 9972 gene locus_tag LOCUS_21590 10742 9972 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_21590 12089 10794 gene locus_tag LOCUS_21600 12089 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 13340 12435 gene locus_tag LOCUS_21610 13340 12435 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_21610 14826 13414 gene locus_tag LOCUS_21620 14826 13414 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705189.1 protein_id gnl|my_center|LOCUS_21620 15308 16504 gene locus_tag LOCUS_21630 15308 16504 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence35 387 97 gene locus_tag LOCUS_21640 gene cas2 387 97 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_21640 1463 432 gene locus_tag LOCUS_21650 gene cas1c 1463 432 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_21650 2017 1463 gene locus_tag LOCUS_21660 gene cas4 2017 1463 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_21660 3033 2122 gene locus_tag LOCUS_21670 gene cas7c 3033 2122 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_21670 4837 3026 gene locus_tag LOCUS_21680 gene cas8c 4837 3026 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092684710.1 protein_id gnl|my_center|LOCUS_21680 5496 4837 gene locus_tag LOCUS_21690 gene cas5c 5496 4837 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_21690 7780 5537 gene locus_tag LOCUS_21700 7780 5537 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_21700 8849 7998 gene locus_tag LOCUS_21710 8849 7998 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393254.1 protein_id gnl|my_center|LOCUS_21710 9295 8942 gene locus_tag LOCUS_21720 gene rplT 9295 8942 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_21720 9551 9354 gene locus_tag LOCUS_21730 gene rpmI 9551 9354 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_21730 10089 9538 gene locus_tag LOCUS_21740 gene infC 10089 9538 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_21740 12269 10350 gene locus_tag LOCUS_21750 gene thrS 12269 10350 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_21750 12803 13063 gene locus_tag LOCUS_21760 12803 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 14067 13105 gene locus_tag LOCUS_21770 14067 13105 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138161721.1 protein_id gnl|my_center|LOCUS_21770 14610 14140 gene locus_tag LOCUS_21780 14610 14140 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964044.1 protein_id gnl|my_center|LOCUS_21780 16223 14607 gene locus_tag LOCUS_21790 16223 14607 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_21790 <16828 16289 gene locus_tag LOCUS_21800 <16828 16289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130435197.1:ATP-binding protein >Feature sequence36 750 2855 gene locus_tag LOCUS_21810 750 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2852 4219 gene locus_tag LOCUS_21820 2852 4219 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_21820 4226 6436 gene locus_tag LOCUS_21830 4226 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 6581 8014 gene locus_tag LOCUS_21840 6581 8014 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 protein_id gnl|my_center|LOCUS_21840 8072 9511 gene locus_tag LOCUS_21850 8072 9511 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_21850 9650 9871 gene locus_tag LOCUS_21860 9650 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 10769 11122 gene locus_tag LOCUS_21870 10769 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 11216 11650 gene locus_tag LOCUS_21880 11216 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 11892 12119 gene locus_tag LOCUS_21890 11892 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 12174 12389 gene locus_tag LOCUS_21900 12174 12389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 12401 12559 gene locus_tag LOCUS_21910 12401 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 13460 13993 gene locus_tag LOCUS_21920 13460 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 13990 14667 gene locus_tag LOCUS_21930 13990 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 15692 14799 gene locus_tag LOCUS_21940 15692 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence37 <1 693 gene locus_tag LOCUS_21950 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815883.1:4Fe-4S dicluster domain-containing protein 690 1871 gene locus_tag LOCUS_21960 gene hybB 690 1871 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815882.1 protein_id gnl|my_center|LOCUS_21960 2021 2338 gene locus_tag LOCUS_21970 2021 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2335 3441 gene locus_tag LOCUS_21980 2335 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3444 6776 gene locus_tag LOCUS_21990 3444 6776 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_21990 7213 6929 gene locus_tag LOCUS_22000 7213 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 7467 8300 gene locus_tag LOCUS_22010 gene larE 7467 8300 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_22010 8445 9416 gene locus_tag LOCUS_22020 8445 9416 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_22020 10944 9526 gene locus_tag LOCUS_22030 10944 9526 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228708.1 protein_id gnl|my_center|LOCUS_22030 11276 12079 gene locus_tag LOCUS_22040 11276 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 12197 12919 gene locus_tag LOCUS_22050 12197 12919 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_22050 12944 13603 gene locus_tag LOCUS_22060 12944 13603 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence38 1565 570 gene locus_tag LOCUS_22070 1565 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 1981 2137 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcattttgacagattggg 2959 2696 gene locus_tag LOCUS_22080 2959 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3200 3622 gene locus_tag LOCUS_22090 3200 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 3603 3974 gene locus_tag LOCUS_22100 3603 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 4109 5194 gene locus_tag LOCUS_22110 4109 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 6243 5191 gene locus_tag LOCUS_22120 6243 5191 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_22120 7264 6467 gene locus_tag LOCUS_22130 gene trmD 7264 6467 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 protein_id gnl|my_center|LOCUS_22130 7805 7242 gene locus_tag LOCUS_22140 gene rimM 7805 7242 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_22140 8199 7777 gene locus_tag LOCUS_22150 8199 7777 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_22150 8510 8283 gene locus_tag LOCUS_22160 8510 8283 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_22160 8798 8529 gene locus_tag LOCUS_22170 gene rpsP 8798 8529 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813195.1 protein_id gnl|my_center|LOCUS_22170 10272 8887 gene locus_tag LOCUS_22180 gene ffh 10272 8887 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_22180 10628 10275 gene locus_tag LOCUS_22190 10628 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 10817 12037 gene locus_tag LOCUS_22200 10817 12037 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964839.1 protein_id gnl|my_center|LOCUS_22200 12965 12141 gene locus_tag LOCUS_22210 12965 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 13664 13113 gene locus_tag LOCUS_22220 13664 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 14406 13759 gene locus_tag LOCUS_22230 gene gmhA 14406 13759 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence39 1021 110 gene locus_tag LOCUS_22240 1021 110 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_22240 1891 1058 gene locus_tag LOCUS_22250 1891 1058 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 protein_id gnl|my_center|LOCUS_22250 3598 1922 gene locus_tag LOCUS_22260 3598 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4678 3608 gene locus_tag LOCUS_22270 gene hisC 4678 3608 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390315.1 protein_id gnl|my_center|LOCUS_22270 4951 6150 gene locus_tag LOCUS_22280 4951 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 6826 6128 gene locus_tag LOCUS_22290 6826 6128 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583890.1 protein_id gnl|my_center|LOCUS_22290 7984 6830 gene locus_tag LOCUS_22300 gene nifS 7984 6830 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_22300 8445 7981 gene locus_tag LOCUS_22310 8445 7981 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_22310 9905 8559 gene locus_tag LOCUS_22320 9905 8559 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_22320 10375 9911 gene locus_tag LOCUS_22330 10375 9911 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_22330 10701 10447 gene locus_tag LOCUS_22340 gene hfq 10701 10447 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_22340 11704 10751 gene locus_tag LOCUS_22350 gene miaA 11704 10751 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504930.1 protein_id gnl|my_center|LOCUS_22350 12386 11709 gene locus_tag LOCUS_22360 12386 11709 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_22360 12474 13205 gene locus_tag LOCUS_22370 12474 13205 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869654.1 protein_id gnl|my_center|LOCUS_22370 13775 13314 gene locus_tag LOCUS_22380 13775 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 14203 13781 gene locus_tag LOCUS_22390 14203 13781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence40 1549 659 gene locus_tag LOCUS_22400 1549 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22400 2156 1593 gene locus_tag LOCUS_22410 2156 1593 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942088.1 protein_id gnl|my_center|LOCUS_22410 2587 2324 gene locus_tag LOCUS_22420 2587 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2471 3415 gene locus_tag LOCUS_22430 2471 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3396 4883 gene locus_tag LOCUS_22440 3396 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 4870 5610 gene locus_tag LOCUS_22450 4870 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 5612 10093 gene locus_tag LOCUS_22460 5612 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 11818 10193 gene locus_tag LOCUS_22470 11818 10193 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence41 189 1202 gene locus_tag LOCUS_22480 gene alr 189 1202 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_22480 1551 1742 gene locus_tag LOCUS_22490 1551 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1735 3042 gene locus_tag LOCUS_22500 1735 3042 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905157.1 protein_id gnl|my_center|LOCUS_22500 3652 3164 gene locus_tag LOCUS_22510 3652 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3752 4177 gene locus_tag LOCUS_22520 3752 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22520 4146 4517 gene locus_tag LOCUS_22530 4146 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4507 5289 gene locus_tag LOCUS_22540 gene yidA 4507 5289 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985571.1 protein_id gnl|my_center|LOCUS_22540 5339 6274 gene locus_tag LOCUS_22550 gene rapZ 5339 6274 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_22550 6278 7576 gene locus_tag LOCUS_22560 6278 7576 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391803.1 protein_id gnl|my_center|LOCUS_22560 7590 8537 gene locus_tag LOCUS_22570 gene whiA 7590 8537 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_22570 8554 9345 gene locus_tag LOCUS_22580 8554 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 9362 10654 gene locus_tag LOCUS_22590 9362 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence42 787 107 gene locus_tag LOCUS_22600 787 107 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732391.1 protein_id gnl|my_center|LOCUS_22600 2042 930 gene locus_tag LOCUS_22610 2042 930 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_22610 3361 2090 gene locus_tag LOCUS_22620 3361 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 5089 3380 gene locus_tag LOCUS_22630 5089 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6750 5152 gene locus_tag LOCUS_22640 6750 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 7033 7680 gene locus_tag LOCUS_22650 7033 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 10505 7845 gene locus_tag LOCUS_22660 10505 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence43 1366 503 gene locus_tag LOCUS_22670 1366 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1554 1363 gene locus_tag LOCUS_22680 1554 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 2127 1762 gene locus_tag LOCUS_22690 2127 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 2706 2248 gene locus_tag LOCUS_22700 2706 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 4046 3210 gene locus_tag LOCUS_22710 4046 3210 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_22710 5770 4478 gene locus_tag LOCUS_22720 5770 4478 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_22720 6456 6031 gene locus_tag LOCUS_22730 6456 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 7425 6571 gene locus_tag LOCUS_22740 gene hpnK 7425 6571 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_22740 8402 7422 gene locus_tag LOCUS_22750 8402 7422 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229534.1 protein_id gnl|my_center|LOCUS_22750 9451 8417 gene locus_tag LOCUS_22760 9451 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 10617 9667 gene locus_tag LOCUS_22770 10617 9667 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099479831.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence44 892 347 gene locus_tag LOCUS_22780 892 347 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_22780 1273 1713 gene locus_tag LOCUS_22790 gene tsaE 1273 1713 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_22790 1694 2410 gene locus_tag LOCUS_22800 gene tsaB 1694 2410 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_22800 2401 2844 gene locus_tag LOCUS_22810 gene rimI 2401 2844 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243019.1 protein_id gnl|my_center|LOCUS_22810 2897 3940 gene locus_tag LOCUS_22820 gene tsaD 2897 3940 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_22820 3990 5030 gene locus_tag LOCUS_22830 3990 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 5073 5498 gene locus_tag LOCUS_22840 5073 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 5541 5936 gene locus_tag LOCUS_22850 gene crcB 5541 5936 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465059.1 protein_id gnl|my_center|LOCUS_22850 6061 7500 gene locus_tag LOCUS_22860 6061 7500 CDS product histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416886.1 protein_id gnl|my_center|LOCUS_22860 7514 8101 gene locus_tag LOCUS_22870 7514 8101 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_22870 8294 8575 gene locus_tag LOCUS_22880 gene groES 8294 8575 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392082.1 protein_id gnl|my_center|LOCUS_22880 8623 10251 gene locus_tag LOCUS_22890 gene groL 8623 10251 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence45 258 887 gene locus_tag LOCUS_22900 258 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 900 1136 gene locus_tag LOCUS_22910 900 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1213 1515 gene locus_tag LOCUS_22920 1213 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1537 2526 gene locus_tag LOCUS_22930 1537 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2540 2668 gene locus_tag LOCUS_22940 2540 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2640 3305 gene locus_tag LOCUS_22950 2640 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3687 3980 gene locus_tag LOCUS_22960 3687 3980 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646479.1 protein_id gnl|my_center|LOCUS_22960 4131 4631 gene locus_tag LOCUS_22970 4131 4631 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_22970 4700 5350 gene locus_tag LOCUS_22980 4700 5350 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202235.1 protein_id gnl|my_center|LOCUS_22980 5443 8067 gene locus_tag LOCUS_22990 gene alaS 5443 8067 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_22990 8152 9411 gene locus_tag LOCUS_23000 8152 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence46 113 1096 gene locus_tag LOCUS_23010 gene manA 113 1096 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_23010 1270 4662 gene locus_tag LOCUS_23020 gene hsdR 1270 4662 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence47 276 1154 gene locus_tag LOCUS_23030 276 1154 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732924.1 protein_id gnl|my_center|LOCUS_23030 1265 2986 gene locus_tag LOCUS_23040 1265 2986 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272214.1 protein_id gnl|my_center|LOCUS_23040 3523 3065 gene locus_tag LOCUS_23050 3523 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 <4220 3612 gene locus_tag LOCUS_23060 <4220 3612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461890.1:prolipoprotein diacylglyceryl transferase >Feature sequence48 1389 697 gene locus_tag LOCUS_23070 1389 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070