>Feature sequence001 120 686 gene locus_tag LOCUS_00010 120 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1099 839 gene locus_tag LOCUS_00020 1099 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1520 1269 gene locus_tag LOCUS_00030 1520 1269 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_00030 2013 1528 gene locus_tag LOCUS_00040 gene coaD 2013 1528 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_00040 2560 2006 gene locus_tag LOCUS_00050 gene rsmD 2560 2006 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_00050 3880 2576 gene locus_tag LOCUS_00060 3880 2576 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_00060 6693 3925 gene locus_tag LOCUS_00070 gene ppc 6693 3925 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_00070 6815 7771 gene locus_tag LOCUS_00080 gene hemC 6815 7771 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 protein_id gnl|my_center|LOCUS_00080 7864 8568 gene locus_tag LOCUS_00090 gene hemD 7864 8568 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026069.1 protein_id gnl|my_center|LOCUS_00090 8723 9898 gene locus_tag LOCUS_00100 8723 9898 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193604.1 protein_id gnl|my_center|LOCUS_00100 10959 9922 gene locus_tag LOCUS_00110 10959 9922 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_00110 11009 11905 gene locus_tag LOCUS_00120 11009 11905 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194782.1 protein_id gnl|my_center|LOCUS_00120 12122 13369 gene locus_tag LOCUS_00130 12122 13369 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_00130 13362 14054 gene locus_tag LOCUS_00140 gene lolD 13362 14054 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_00140 14118 15830 gene locus_tag LOCUS_00150 14118 15830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140176.1 protein_id gnl|my_center|LOCUS_00150 15981 16610 gene locus_tag LOCUS_00160 15981 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16949 16665 gene locus_tag LOCUS_00170 16949 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18064 16964 gene locus_tag LOCUS_00180 18064 16964 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074249.1 protein_id gnl|my_center|LOCUS_00180 18942 18061 gene locus_tag LOCUS_00190 gene cysW 18942 18061 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_00190 19786 18953 gene locus_tag LOCUS_00200 gene cysT 19786 18953 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 protein_id gnl|my_center|LOCUS_00200 20666 19848 gene locus_tag LOCUS_00210 20666 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21169 20774 gene locus_tag LOCUS_00220 21169 20774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22170 21172 gene locus_tag LOCUS_00230 22170 21172 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_00230 23802 22201 gene locus_tag LOCUS_00240 23802 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25643 24411 gene locus_tag LOCUS_00250 25643 24411 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525896.1 protein_id gnl|my_center|LOCUS_00250 26330 25806 gene locus_tag LOCUS_00260 26330 25806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26776 27618 gene locus_tag LOCUS_00270 26776 27618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28776 27766 gene locus_tag LOCUS_00280 28776 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29079 29549 gene locus_tag LOCUS_00290 gene pncC 29079 29549 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 protein_id gnl|my_center|LOCUS_00290 30189 29569 gene locus_tag LOCUS_00300 30189 29569 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448628.1 protein_id gnl|my_center|LOCUS_00300 31940 30447 gene locus_tag LOCUS_00310 31940 30447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33147 31951 gene locus_tag LOCUS_00320 33147 31951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31976 32075 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34473 33586 gene locus_tag LOCUS_00330 gene sucD 34473 33586 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 protein_id gnl|my_center|LOCUS_00330 35664 34483 gene locus_tag LOCUS_00340 35664 34483 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_00340 36716 35769 gene locus_tag LOCUS_00350 36716 35769 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_00350 40821 37063 gene locus_tag LOCUS_00360 40821 37063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_00360 42332 40818 gene locus_tag LOCUS_00370 42332 40818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43811 42840 gene locus_tag LOCUS_00380 43811 42840 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940539.1 protein_id gnl|my_center|LOCUS_00380 44014 43832 gene locus_tag LOCUS_00390 44014 43832 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422539.1 protein_id gnl|my_center|LOCUS_00390 44894 44055 gene locus_tag LOCUS_00400 44894 44055 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_00400 45704 44946 gene locus_tag LOCUS_00410 45704 44946 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195817.1 protein_id gnl|my_center|LOCUS_00410 46405 45758 gene locus_tag LOCUS_00420 gene rsmG 46405 45758 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226919.1 protein_id gnl|my_center|LOCUS_00420 48300 46402 gene locus_tag LOCUS_00430 gene mnmG 48300 46402 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_00430 52068 48772 gene locus_tag LOCUS_00440 52068 48772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52714 52247 gene locus_tag LOCUS_00450 52714 52247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52899 53363 gene locus_tag LOCUS_00460 52899 53363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 53674 55203 gene locus_tag LOCUS_00470 53674 55203 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189772.1 protein_id gnl|my_center|LOCUS_00470 55373 55738 gene locus_tag LOCUS_00480 55373 55738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55810 56586 gene locus_tag LOCUS_00490 55810 56586 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 protein_id gnl|my_center|LOCUS_00490 56720 56908 gene locus_tag LOCUS_00500 56720 56908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57181 57495 gene locus_tag LOCUS_00510 57181 57495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 58488 57652 gene locus_tag LOCUS_00520 58488 57652 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_00520 58628 58993 gene locus_tag LOCUS_00530 58628 58993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60497 59082 gene locus_tag LOCUS_00540 60497 59082 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112966.1 protein_id gnl|my_center|LOCUS_00540 61883 60501 gene locus_tag LOCUS_00550 61883 60501 CDS product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763651.1 protein_id gnl|my_center|LOCUS_00550 62051 62755 gene locus_tag LOCUS_00560 62051 62755 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_00560 62950 62774 gene locus_tag LOCUS_00570 62950 62774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 64908 62998 gene locus_tag LOCUS_00580 64908 62998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65709 64918 gene locus_tag LOCUS_00590 65709 64918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 66895 65885 gene locus_tag LOCUS_00600 66895 65885 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_00600 67778 67002 gene locus_tag LOCUS_00610 67778 67002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 68072 70543 gene locus_tag LOCUS_00620 68072 70543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 70644 70859 gene locus_tag LOCUS_00630 70644 70859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 70889 71239 gene locus_tag LOCUS_00640 70889 71239 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986793.1 protein_id gnl|my_center|LOCUS_00640 71914 71273 gene locus_tag LOCUS_00650 71914 71273 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_00650 72304 73392 gene locus_tag LOCUS_00660 72304 73392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 73687 76155 gene locus_tag LOCUS_00670 73687 76155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 76167 79157 gene locus_tag LOCUS_00680 76167 79157 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319769.1 protein_id gnl|my_center|LOCUS_00680 79160 79810 gene locus_tag LOCUS_00690 79160 79810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 79807 80565 gene locus_tag LOCUS_00700 79807 80565 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901594.1 protein_id gnl|my_center|LOCUS_00700 80577 81671 gene locus_tag LOCUS_00710 80577 81671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_00710 82516 81707 gene locus_tag LOCUS_00720 82516 81707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_00720 82687 83160 gene locus_tag LOCUS_00730 82687 83160 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_00730 84313 83264 gene locus_tag LOCUS_00740 84313 83264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 84507 85430 gene locus_tag LOCUS_00750 84507 85430 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_00750 85991 85440 gene locus_tag LOCUS_00760 gene yjgA 85991 85440 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853313.1 protein_id gnl|my_center|LOCUS_00760 86087 87445 gene locus_tag LOCUS_00770 gene pmbA 86087 87445 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_00770 87750 87523 gene locus_tag LOCUS_00780 87750 87523 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_00780 89112 87865 gene locus_tag LOCUS_00790 89112 87865 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626309.1 protein_id gnl|my_center|LOCUS_00790 90380 89628 gene locus_tag LOCUS_00800 90380 89628 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945798.1 protein_id gnl|my_center|LOCUS_00800 90918 91226 gene locus_tag LOCUS_00810 90918 91226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 92672 91272 gene locus_tag LOCUS_00820 gene hemN 92672 91272 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689506.1 protein_id gnl|my_center|LOCUS_00820 93002 93667 gene locus_tag LOCUS_00830 gene fnr 93002 93667 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_00830 93970 94692 gene locus_tag LOCUS_00840 gene rpsB 93970 94692 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_00840 94931 95815 gene locus_tag LOCUS_00850 gene tsf 94931 95815 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_00850 95846 96562 gene locus_tag LOCUS_00860 gene pyrH 95846 96562 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_00860 96619 97176 gene locus_tag LOCUS_00870 gene frr 96619 97176 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811796.1 protein_id gnl|my_center|LOCUS_00870 97178 97948 gene locus_tag LOCUS_00880 gene uppS 97178 97948 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_00880 97971 98795 gene locus_tag LOCUS_00890 gene cdsA 97971 98795 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922441.1 protein_id gnl|my_center|LOCUS_00890 98792 99979 gene locus_tag LOCUS_00900 gene ispC 98792 99979 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_00900 100127 101494 gene locus_tag LOCUS_00910 gene rseP 100127 101494 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063746.1 protein_id gnl|my_center|LOCUS_00910 101498 103876 gene locus_tag LOCUS_00920 gene bamA 101498 103876 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197083.1 protein_id gnl|my_center|LOCUS_00920 103951 104433 gene locus_tag LOCUS_00930 103951 104433 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_00930 104502 104945 gene locus_tag LOCUS_00940 gene fabZ 104502 104945 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_00940 104969 105607 gene locus_tag LOCUS_00950 gene rnhB 104969 105607 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 protein_id gnl|my_center|LOCUS_00950 105799 106278 gene locus_tag LOCUS_00960 105799 106278 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_00960 108908 106308 gene locus_tag LOCUS_00970 gene mutS 108908 106308 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_00970 109646 109314 gene locus_tag LOCUS_00980 109646 109314 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400923.1 protein_id gnl|my_center|LOCUS_00980 112245 109651 gene locus_tag LOCUS_00990 gene alaS 112245 109651 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_00990 112604 112242 gene locus_tag LOCUS_01000 112604 112242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 113059 112601 gene locus_tag LOCUS_01010 gene recX 113059 112601 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930990.1 protein_id gnl|my_center|LOCUS_01010 114113 113064 gene locus_tag LOCUS_01020 gene recA 114113 113064 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812760.1 protein_id gnl|my_center|LOCUS_01020 114429 114983 gene locus_tag LOCUS_01030 gene adk 114429 114983 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_01030 115126 116385 gene locus_tag LOCUS_01040 115126 116385 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_01040 116616 118673 gene locus_tag LOCUS_01050 116616 118673 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_01050 119509 118781 gene locus_tag LOCUS_01060 119509 118781 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_01060 119996 119565 gene locus_tag LOCUS_01070 119996 119565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 123223 120008 gene locus_tag LOCUS_01080 123223 120008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 125907 123625 gene locus_tag LOCUS_01090 125907 123625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 128104 126041 gene locus_tag LOCUS_01100 128104 126041 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_01100 128570 128241 gene locus_tag LOCUS_01110 128570 128241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 129601 128771 gene locus_tag LOCUS_01120 129601 128771 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_01120 130137 129613 gene locus_tag LOCUS_01130 130137 129613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 130286 131206 gene locus_tag LOCUS_01140 130286 131206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 131256 132434 gene locus_tag LOCUS_01150 131256 132434 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527148.1 protein_id gnl|my_center|LOCUS_01150 132540 132944 gene locus_tag LOCUS_01160 132540 132944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 133396 132989 gene locus_tag LOCUS_01170 133396 132989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 134017 133478 gene locus_tag LOCUS_01180 134017 133478 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 protein_id gnl|my_center|LOCUS_01180 134481 134014 gene locus_tag LOCUS_01190 134481 134014 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968682.1 protein_id gnl|my_center|LOCUS_01190 134644 135549 gene locus_tag LOCUS_01200 gene ttcA 134644 135549 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693987.1 protein_id gnl|my_center|LOCUS_01200 135928 135551 gene locus_tag LOCUS_01210 135928 135551 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_01210 136603 136088 gene locus_tag LOCUS_01220 136603 136088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 137394 136807 gene locus_tag LOCUS_01230 137394 136807 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_01230 139380 137440 gene locus_tag LOCUS_01240 gene dsbD 139380 137440 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_01240 139729 139397 gene locus_tag LOCUS_01250 139729 139397 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038658.1 protein_id gnl|my_center|LOCUS_01250 139916 140125 gene locus_tag LOCUS_01260 139916 140125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 141135 140143 gene locus_tag LOCUS_01270 gene ala 141135 140143 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_01270 141286 143100 gene locus_tag LOCUS_01280 gene typA 141286 143100 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 protein_id gnl|my_center|LOCUS_01280 144251 143250 gene locus_tag LOCUS_01290 144251 143250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 147591 144475 gene locus_tag LOCUS_01300 147591 144475 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068838.1 protein_id gnl|my_center|LOCUS_01300 147995 147588 gene locus_tag LOCUS_01310 147995 147588 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649049.1 protein_id gnl|my_center|LOCUS_01310 148246 147992 gene locus_tag LOCUS_01320 148246 147992 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649046.1 protein_id gnl|my_center|LOCUS_01320 149630 148377 gene locus_tag LOCUS_01330 149630 148377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 152214 149632 gene locus_tag LOCUS_01340 152214 149632 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068835.1 protein_id gnl|my_center|LOCUS_01340 154913 152487 gene locus_tag LOCUS_01350 gene gyrB 154913 152487 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816022.1 protein_id gnl|my_center|LOCUS_01350 156113 154998 gene locus_tag LOCUS_01360 gene dnaN 156113 154998 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223059.1 protein_id gnl|my_center|LOCUS_01360 157718 156303 gene locus_tag LOCUS_01370 gene dnaA 157718 156303 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_01370 158576 157752 gene locus_tag LOCUS_01380 gene panC 158576 157752 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192993.1 protein_id gnl|my_center|LOCUS_01380 159382 158591 gene locus_tag LOCUS_01390 gene panB 159382 158591 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_01390 159831 160085 gene locus_tag LOCUS_01400 159831 160085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 160095 160529 gene locus_tag LOCUS_01410 160095 160529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 161005 162252 gene locus_tag LOCUS_01420 161005 162252 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199991.1 protein_id gnl|my_center|LOCUS_01420 162265 164442 gene locus_tag LOCUS_01430 162265 164442 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_01430 164945 164451 gene locus_tag LOCUS_01440 gene folK 164945 164451 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 protein_id gnl|my_center|LOCUS_01440 166347 164938 gene locus_tag LOCUS_01450 gene pcnB 166347 164938 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522151.1 protein_id gnl|my_center|LOCUS_01450 168061 167360 gene locus_tag LOCUS_01460 168061 167360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 168879 168355 gene locus_tag LOCUS_01470 168879 168355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 169337 172648 gene locus_tag LOCUS_01480 gene mscK 169337 172648 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463895.1 protein_id gnl|my_center|LOCUS_01480 174054 172717 gene locus_tag LOCUS_01490 174054 172717 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_01490 174796 174143 gene locus_tag LOCUS_01500 174796 174143 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_01500 175001 176896 gene locus_tag LOCUS_01510 gene thiC 175001 176896 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807441.1 protein_id gnl|my_center|LOCUS_01510 176952 177776 gene locus_tag LOCUS_01520 176952 177776 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_01520 178244 179575 gene locus_tag LOCUS_01530 178244 179575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 180984 179608 gene locus_tag LOCUS_01540 180984 179608 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_01540 181640 181098 gene locus_tag LOCUS_01550 181640 181098 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_01550 181655 182386 gene locus_tag LOCUS_01560 181655 182386 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_01560 182426 182656 gene locus_tag LOCUS_01570 182426 182656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 182756 184420 gene locus_tag LOCUS_01580 gene ettA 182756 184420 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_01580 184570 184755 gene locus_tag LOCUS_01590 184570 184755 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971060.1 protein_id gnl|my_center|LOCUS_01590 184780 185883 gene locus_tag LOCUS_01600 184780 185883 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_01600 185852 186580 gene locus_tag LOCUS_01610 185852 186580 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_01610 186757 187008 gene locus_tag LOCUS_01620 gene yefM 186757 187008 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259253.1 protein_id gnl|my_center|LOCUS_01620 187033 187362 gene locus_tag LOCUS_01630 187033 187362 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_01630 188527 187379 gene locus_tag LOCUS_01640 188527 187379 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_01640 188739 190076 gene locus_tag LOCUS_01650 188739 190076 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_01650 190613 190122 gene locus_tag LOCUS_01660 190613 190122 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064084.1 protein_id gnl|my_center|LOCUS_01660 192552 190633 gene locus_tag LOCUS_01670 192552 190633 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038717.1 protein_id gnl|my_center|LOCUS_01670 194046 192703 gene locus_tag LOCUS_01680 gene gdhA 194046 192703 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206092.1 protein_id gnl|my_center|LOCUS_01680 194548 197148 gene locus_tag LOCUS_01690 194548 197148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 197175 197834 gene locus_tag LOCUS_01700 197175 197834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 197838 198788 gene locus_tag LOCUS_01710 gene trxB 197838 198788 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_01710 198842 199387 gene locus_tag LOCUS_01720 198842 199387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 199776 199405 gene locus_tag LOCUS_01730 199776 199405 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679887.1 protein_id gnl|my_center|LOCUS_01730 200415 199879 gene locus_tag LOCUS_01740 gene bcp 200415 199879 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_01740 201663 200431 gene locus_tag LOCUS_01750 201663 200431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_01750 201694 201769 gene locus_tag LOCUS_t00010 201694 201769 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 203360 201882 gene locus_tag LOCUS_01760 203360 201882 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_01760 204670 203651 gene locus_tag LOCUS_01770 204670 203651 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_01770 206223 204667 gene locus_tag LOCUS_01780 206223 204667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 206719 206360 gene locus_tag LOCUS_01790 206719 206360 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_01790 209635 206822 gene locus_tag LOCUS_01800 209635 206822 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_01800 209908 210300 gene locus_tag LOCUS_01810 209908 210300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 210639 210388 gene locus_tag LOCUS_01820 210639 210388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 211929 210757 gene locus_tag LOCUS_01830 211929 210757 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769400.1 protein_id gnl|my_center|LOCUS_01830 212196 212038 gene locus_tag LOCUS_01840 212196 212038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01840 212711 212379 gene locus_tag LOCUS_01850 212711 212379 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_01850 212985 212695 gene locus_tag LOCUS_01860 212985 212695 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_01860 213242 213589 gene locus_tag LOCUS_01870 213242 213589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 214025 213672 gene locus_tag LOCUS_01880 214025 213672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 218363 214332 gene locus_tag LOCUS_01890 218363 214332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 218676 219359 gene locus_tag LOCUS_01900 218676 219359 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_01900 219535 219966 gene locus_tag LOCUS_01910 gene gspG 219535 219966 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088760.1 protein_id gnl|my_center|LOCUS_01910 219976 221160 gene locus_tag LOCUS_01920 219976 221160 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_01920 221157 222848 gene locus_tag LOCUS_01930 221157 222848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 222829 223662 gene locus_tag LOCUS_01940 222829 223662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 223650 224198 gene locus_tag LOCUS_01950 223650 224198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 224195 224776 gene locus_tag LOCUS_01960 224195 224776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 225272 225371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 225515 227824 gene locus_tag LOCUS_01970 225515 227824 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942422.1 protein_id gnl|my_center|LOCUS_01970 227837 228346 gene locus_tag LOCUS_01980 227837 228346 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_01980 228352 228735 gene locus_tag LOCUS_01990 228352 228735 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_01990 228782 229705 gene locus_tag LOCUS_02000 228782 229705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 230335 229832 gene locus_tag LOCUS_02010 230335 229832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 230602 231579 gene locus_tag LOCUS_02020 gene speB 230602 231579 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_02020 232956 231718 gene locus_tag LOCUS_02030 232956 231718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 235124 233427 gene locus_tag LOCUS_02040 235124 233427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 236088 235216 gene locus_tag LOCUS_02050 236088 235216 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966857.1 protein_id gnl|my_center|LOCUS_02050 236563 238386 gene locus_tag LOCUS_02060 236563 238386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 238482 239378 gene locus_tag LOCUS_02070 238482 239378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 239561 240634 gene locus_tag LOCUS_02080 239561 240634 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_02080 240698 242404 gene locus_tag LOCUS_02090 240698 242404 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_02090 242410 243279 gene locus_tag LOCUS_02100 242410 243279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 243385 244743 gene locus_tag LOCUS_02110 243385 244743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 244682 244882 gene locus_tag LOCUS_02120 244682 244882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 244913 246205 gene locus_tag LOCUS_02130 244913 246205 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194395.1 protein_id gnl|my_center|LOCUS_02130 246345 246421 gene locus_tag LOCUS_t00020 246345 246421 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 246599 247198 gene locus_tag LOCUS_02140 246599 247198 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_02140 247217 248317 gene locus_tag LOCUS_02150 gene ribBA 247217 248317 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_02150 248378 248860 gene locus_tag LOCUS_02160 gene ribH 248378 248860 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_02160 248857 249357 gene locus_tag LOCUS_02170 gene nusB 248857 249357 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039075.1 protein_id gnl|my_center|LOCUS_02170 249370 250341 gene locus_tag LOCUS_02180 gene thiL 249370 250341 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_02180 250322 250870 gene locus_tag LOCUS_02190 250322 250870 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_02190 251024 252286 gene locus_tag LOCUS_02200 251024 252286 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921546.1 protein_id gnl|my_center|LOCUS_02200 252297 254210 gene locus_tag LOCUS_02210 252297 254210 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615998.1 protein_id gnl|my_center|LOCUS_02210 254170 254607 gene locus_tag LOCUS_02220 254170 254607 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_02220 254863 254663 gene locus_tag LOCUS_02230 254863 254663 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094856.1 protein_id gnl|my_center|LOCUS_02230 256953 254881 gene locus_tag LOCUS_02240 256953 254881 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 protein_id gnl|my_center|LOCUS_02240 257710 259197 gene locus_tag LOCUS_02250 257710 259197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 259762 260742 gene locus_tag LOCUS_02260 259762 260742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 260809 261942 gene locus_tag LOCUS_02270 gene wecB 260809 261942 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_02270 261942 262928 gene locus_tag LOCUS_02280 261942 262928 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_02280 262970 263758 gene locus_tag LOCUS_02290 262970 263758 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427759.1 protein_id gnl|my_center|LOCUS_02290 263742 265097 gene locus_tag LOCUS_02300 263742 265097 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229161.1 protein_id gnl|my_center|LOCUS_02300 265363 267129 gene locus_tag LOCUS_02310 265363 267129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 268048 267155 gene locus_tag LOCUS_02320 gene rsgA 268048 267155 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550124.1 protein_id gnl|my_center|LOCUS_02320 268428 268087 gene locus_tag LOCUS_02330 268428 268087 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_02330 269681 268425 gene locus_tag LOCUS_02340 269681 268425 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_02340 269823 270413 gene locus_tag LOCUS_02350 gene orn 269823 270413 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_02350 270551 270928 gene locus_tag LOCUS_02360 270551 270928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 272429 271029 gene locus_tag LOCUS_02370 272429 271029 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_02370 272506 273540 gene locus_tag LOCUS_02380 272506 273540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 273586 274239 gene locus_tag LOCUS_02390 gene ftsE 273586 274239 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_02390 274236 275147 gene locus_tag LOCUS_02400 gene ftsX 274236 275147 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393643.1 protein_id gnl|my_center|LOCUS_02400 275270 276118 gene locus_tag LOCUS_02410 gene rpoH 275270 276118 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815756.1 protein_id gnl|my_center|LOCUS_02410 276164 276256 gene locus_tag LOCUS_t00030 276164 276256 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 276791 277822 gene locus_tag LOCUS_02420 276791 277822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 279604 278078 gene locus_tag LOCUS_02430 279604 278078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 <281214 279604 gene locus_tag LOCUS_02440 <281214 279604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267513.1:PAS domain S-box protein >Feature sequence002 1443 547 gene locus_tag LOCUS_02450 1443 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941721.1 protein_id gnl|my_center|LOCUS_02450 1975 3570 gene locus_tag LOCUS_02460 1975 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 3881 4354 gene locus_tag LOCUS_02470 3881 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 4549 4334 gene locus_tag LOCUS_02480 4549 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5108 5647 gene locus_tag LOCUS_02490 5108 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 6503 5754 gene locus_tag LOCUS_02500 6503 5754 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_02500 7105 6500 gene locus_tag LOCUS_02510 7105 6500 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_02510 8183 7119 gene locus_tag LOCUS_02520 gene cobT 8183 7119 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038174.1 protein_id gnl|my_center|LOCUS_02520 8710 8180 gene locus_tag LOCUS_02530 gene cobU 8710 8180 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_02530 10194 8704 gene locus_tag LOCUS_02540 10194 8704 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404269.1 protein_id gnl|my_center|LOCUS_02540 11183 10191 gene locus_tag LOCUS_02550 gene cobD 11183 10191 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_02550 12120 11206 gene locus_tag LOCUS_02560 gene cbiB 12120 11206 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268581.1 protein_id gnl|my_center|LOCUS_02560 12799 12137 gene locus_tag LOCUS_02570 gene bluB 12799 12137 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766675.1 protein_id gnl|my_center|LOCUS_02570 13449 12868 gene locus_tag LOCUS_02580 13449 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 protein_id gnl|my_center|LOCUS_02580 15313 13463 gene locus_tag LOCUS_02590 gene btuB 15313 13463 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_02590 15521 15760 gene locus_tag LOCUS_02600 15521 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 17040 15781 gene locus_tag LOCUS_02610 17040 15781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183611247.1 protein_id gnl|my_center|LOCUS_02610 17928 17200 gene locus_tag LOCUS_02620 17928 17200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 18292 18441 gene locus_tag LOCUS_02630 18292 18441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 19858 18557 gene locus_tag LOCUS_02640 19858 18557 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065115.1 protein_id gnl|my_center|LOCUS_02640 21318 19933 gene locus_tag LOCUS_02650 gene fumC 21318 19933 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099094.1 protein_id gnl|my_center|LOCUS_02650 21876 21544 gene locus_tag LOCUS_02660 21876 21544 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669261.1 protein_id gnl|my_center|LOCUS_02660 22221 21985 gene locus_tag LOCUS_02670 22221 21985 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669263.1 protein_id gnl|my_center|LOCUS_02670 22755 22357 gene locus_tag LOCUS_02680 22755 22357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 23635 22757 gene locus_tag LOCUS_02690 23635 22757 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_02690 24873 23683 gene locus_tag LOCUS_02700 24873 23683 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_02700 27779 24909 gene locus_tag LOCUS_02710 27779 24909 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194230.1 protein_id gnl|my_center|LOCUS_02710 28135 28743 gene locus_tag LOCUS_02720 28135 28743 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090002.1 protein_id gnl|my_center|LOCUS_02720 28842 29696 gene locus_tag LOCUS_02730 28842 29696 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 protein_id gnl|my_center|LOCUS_02730 29697 30200 gene locus_tag LOCUS_02740 29697 30200 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_02740 31465 30251 gene locus_tag LOCUS_02750 31465 30251 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_02750 34317 31555 gene locus_tag LOCUS_02760 34317 31555 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_02760 34855 34484 gene locus_tag LOCUS_02770 34855 34484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 35228 34887 gene locus_tag LOCUS_02780 35228 34887 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_02780 36948 35452 gene locus_tag LOCUS_02790 gene pepA 36948 35452 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071577.1 protein_id gnl|my_center|LOCUS_02790 37254 38720 gene locus_tag LOCUS_02800 37254 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 38772 39602 gene locus_tag LOCUS_02810 gene serB 38772 39602 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_02810 41269 39653 gene locus_tag LOCUS_02820 41269 39653 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_02820 41497 41922 gene locus_tag LOCUS_02830 41497 41922 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 protein_id gnl|my_center|LOCUS_02830 42158 43825 gene locus_tag LOCUS_02840 42158 43825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 44629 43832 gene locus_tag LOCUS_02850 44629 43832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 45581 44742 gene locus_tag LOCUS_02860 gene ccsA 45581 44742 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448047.1 protein_id gnl|my_center|LOCUS_02860 45722 47071 gene locus_tag LOCUS_02870 gene ffh 45722 47071 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194338.1 protein_id gnl|my_center|LOCUS_02870 47737 47288 gene locus_tag LOCUS_02880 gene dut 47737 47288 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_02880 48959 47757 gene locus_tag LOCUS_02890 gene coaBC 48959 47757 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039645.1 protein_id gnl|my_center|LOCUS_02890 49180 49854 gene locus_tag LOCUS_02900 gene radC 49180 49854 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_02900 50381 49902 gene locus_tag LOCUS_02910 50381 49902 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_02910 50859 50371 gene locus_tag LOCUS_02920 gene tadA 50859 50371 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552523.1 protein_id gnl|my_center|LOCUS_02920 51032 51931 gene locus_tag LOCUS_02930 gene prmB 51032 51931 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_02930 52294 52713 gene locus_tag LOCUS_02940 52294 52713 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_02940 52826 54814 gene locus_tag LOCUS_02950 52826 54814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 54811 55320 gene locus_tag LOCUS_02960 54811 55320 CDS product CNP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195111.1 protein_id gnl|my_center|LOCUS_02960 55654 57021 gene locus_tag LOCUS_02970 55654 57021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 57461 57069 gene locus_tag LOCUS_02980 57461 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 57924 58784 gene locus_tag LOCUS_02990 gene motA 57924 58784 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_02990 58826 59761 gene locus_tag LOCUS_03000 gene motB 58826 59761 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 protein_id gnl|my_center|LOCUS_03000 59786 60538 gene locus_tag LOCUS_03010 59786 60538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 61943 60561 gene locus_tag LOCUS_03020 gene cysS 61943 60561 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355798.1 protein_id gnl|my_center|LOCUS_03020 62089 62679 gene locus_tag LOCUS_03030 62089 62679 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_03030 62710 63201 gene locus_tag LOCUS_03040 62710 63201 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_03040 64438 63263 gene locus_tag LOCUS_03050 64438 63263 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_03050 66090 64570 gene locus_tag LOCUS_03060 gene purF 66090 64570 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_03060 66725 66219 gene locus_tag LOCUS_03070 66725 66219 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957874.1 protein_id gnl|my_center|LOCUS_03070 67465 66779 gene locus_tag LOCUS_03080 67465 66779 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525194.1 protein_id gnl|my_center|LOCUS_03080 68786 67479 gene locus_tag LOCUS_03090 gene folC 68786 67479 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_03090 69449 68841 gene locus_tag LOCUS_03100 69449 68841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 69481 69675 gene locus_tag LOCUS_03110 69481 69675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 70553 69732 gene locus_tag LOCUS_03120 gene dapD 70553 69732 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 protein_id gnl|my_center|LOCUS_03120 71782 70586 gene locus_tag LOCUS_03130 gene dapC 71782 70586 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_03130 72163 73236 gene locus_tag LOCUS_03140 72163 73236 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187735.1 protein_id gnl|my_center|LOCUS_03140 74449 73280 gene locus_tag LOCUS_03150 74449 73280 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925859.1 protein_id gnl|my_center|LOCUS_03150 74999 74559 gene locus_tag LOCUS_03160 gene fur 74999 74559 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_03160 75044 75478 gene locus_tag LOCUS_03170 75044 75478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 75534 76340 gene locus_tag LOCUS_03180 gene dapB 75534 76340 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_03180 76364 77167 gene locus_tag LOCUS_03190 76364 77167 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929738.1 protein_id gnl|my_center|LOCUS_03190 77912 77118 gene locus_tag LOCUS_03200 77912 77118 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_03200 78488 79315 gene locus_tag LOCUS_03210 gene pbpG 78488 79315 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706303.1 protein_id gnl|my_center|LOCUS_03210 80842 79325 gene locus_tag LOCUS_03220 80842 79325 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_03220 80989 81423 gene locus_tag LOCUS_03230 gene hemJ 80989 81423 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377457.1 protein_id gnl|my_center|LOCUS_03230 82034 81420 gene locus_tag LOCUS_03240 82034 81420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 82579 82046 gene locus_tag LOCUS_03250 gene def 82579 82046 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_03250 83315 82569 gene locus_tag LOCUS_03260 83315 82569 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_03260 83873 83328 gene locus_tag LOCUS_03270 83873 83328 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002242054.1 protein_id gnl|my_center|LOCUS_03270 84145 84768 gene locus_tag LOCUS_03280 84145 84768 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933138.1 protein_id gnl|my_center|LOCUS_03280 84770 85336 gene locus_tag LOCUS_03290 84770 85336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 87425 85398 gene locus_tag LOCUS_03300 gene ligA 87425 85398 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_03300 87689 88570 gene locus_tag LOCUS_03310 87689 88570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 88637 89182 gene locus_tag LOCUS_03320 88637 89182 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_03320 89368 90396 gene locus_tag LOCUS_03330 89368 90396 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 protein_id gnl|my_center|LOCUS_03330 90430 91281 gene locus_tag LOCUS_03340 90430 91281 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_03340 91339 91605 gene locus_tag LOCUS_03350 91339 91605 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818417.1 protein_id gnl|my_center|LOCUS_03350 91612 92262 gene locus_tag LOCUS_03360 gene lipB 91612 92262 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488805.1 protein_id gnl|my_center|LOCUS_03360 92276 93220 gene locus_tag LOCUS_03370 gene lipA 92276 93220 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807146.1 protein_id gnl|my_center|LOCUS_03370 93693 93262 gene locus_tag LOCUS_03380 93693 93262 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401957.1 protein_id gnl|my_center|LOCUS_03380 94121 93810 gene locus_tag LOCUS_03390 gene nirM 94121 93810 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_03390 96072 94399 gene locus_tag LOCUS_03400 gene ilvD 96072 94399 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_03400 96179 97003 gene locus_tag LOCUS_03410 gene lgt 96179 97003 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_03410 97323 97745 gene locus_tag LOCUS_03420 97323 97745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 99150 97810 gene locus_tag LOCUS_03430 99150 97810 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_03430 99742 100122 gene locus_tag LOCUS_03440 99742 100122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 100572 100294 gene locus_tag LOCUS_03450 100572 100294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 102126 100813 gene locus_tag LOCUS_03460 gene phoR 102126 100813 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_03460 102865 102143 gene locus_tag LOCUS_03470 gene phoB 102865 102143 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192125.1 protein_id gnl|my_center|LOCUS_03470 102965 103378 gene locus_tag LOCUS_03480 102965 103378 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_03480 103475 104209 gene locus_tag LOCUS_03490 gene ubiE 103475 104209 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217627.1 protein_id gnl|my_center|LOCUS_03490 105178 104390 gene locus_tag LOCUS_03500 105178 104390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 105967 105218 gene locus_tag LOCUS_03510 105967 105218 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811326.1 protein_id gnl|my_center|LOCUS_03510 106579 106211 gene locus_tag LOCUS_03520 106579 106211 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965849.1 protein_id gnl|my_center|LOCUS_03520 108712 106604 gene locus_tag LOCUS_03530 gene metG 108712 106604 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538477.1 protein_id gnl|my_center|LOCUS_03530 108838 109926 gene locus_tag LOCUS_03540 gene apbC 108838 109926 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_03540 109940 110506 gene locus_tag LOCUS_03550 gene dcd 109940 110506 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_03550 111246 112421 gene locus_tag LOCUS_03560 111246 112421 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545474.1 protein_id gnl|my_center|LOCUS_03560 113035 112526 gene locus_tag LOCUS_03570 gene folA 113035 112526 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_03570 113826 113032 gene locus_tag LOCUS_03580 113826 113032 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_03580 113997 115460 gene locus_tag LOCUS_03590 113997 115460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 116794 115505 gene locus_tag LOCUS_03600 116794 115505 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120244.1 protein_id gnl|my_center|LOCUS_03600 117368 116949 gene locus_tag LOCUS_03610 gene queF 117368 116949 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_03610 117472 121020 gene locus_tag LOCUS_03620 gene smc 117472 121020 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198894.1 protein_id gnl|my_center|LOCUS_03620 121101 122261 gene locus_tag LOCUS_03630 121101 122261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 122401 122646 gene locus_tag LOCUS_03640 122401 122646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 122753 122974 gene locus_tag LOCUS_03650 122753 122974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 122964 123266 gene locus_tag LOCUS_03660 122964 123266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 123541 124179 gene locus_tag LOCUS_03670 123541 124179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 125013 124249 gene locus_tag LOCUS_03680 125013 124249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 125168 125623 gene locus_tag LOCUS_03690 125168 125623 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_03690 125680 126477 gene locus_tag LOCUS_03700 125680 126477 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_03700 126641 127819 gene locus_tag LOCUS_03710 126641 127819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 128054 128143 gene locus_tag LOCUS_t00040 128054 128143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 2415 1792 gene locus_tag LOCUS_03720 2415 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_03720 2466 2609 gene locus_tag LOCUS_03730 2466 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3693 5084 gene locus_tag LOCUS_03740 3693 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5102 5560 gene locus_tag LOCUS_03750 5102 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6477 5674 gene locus_tag LOCUS_03760 6477 5674 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_03760 7795 6587 gene locus_tag LOCUS_03770 gene hemW 7795 6587 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_03770 10323 7813 gene locus_tag LOCUS_03780 10323 7813 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_03780 11097 10411 gene locus_tag LOCUS_03790 11097 10411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707237.1 protein_id gnl|my_center|LOCUS_03790 11096 11758 gene locus_tag LOCUS_03800 11096 11758 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447512.1 protein_id gnl|my_center|LOCUS_03800 12633 11791 gene locus_tag LOCUS_03810 12633 11791 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_03810 13274 15838 gene locus_tag LOCUS_03820 13274 15838 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980758.1 protein_id gnl|my_center|LOCUS_03820 18629 15885 gene locus_tag LOCUS_03830 gene polA 18629 15885 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_03830 18645 19364 gene locus_tag LOCUS_03840 18645 19364 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_03840 19422 19820 gene locus_tag LOCUS_03850 19422 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 19896 20846 gene locus_tag LOCUS_03860 19896 20846 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_03860 20891 21874 gene locus_tag LOCUS_03870 20891 21874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 22453 23874 gene locus_tag LOCUS_03880 22453 23874 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 protein_id gnl|my_center|LOCUS_03880 26199 23998 gene locus_tag LOCUS_03890 26199 23998 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812546.1 protein_id gnl|my_center|LOCUS_03890 27296 26424 gene locus_tag LOCUS_03900 27296 26424 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_03900 27592 28149 gene locus_tag LOCUS_03910 27592 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 28159 28713 gene locus_tag LOCUS_03920 28159 28713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 28949 29461 gene locus_tag LOCUS_03930 28949 29461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 29519 29881 gene locus_tag LOCUS_03940 29519 29881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 30457 29969 gene locus_tag LOCUS_03950 30457 29969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 31040 30606 gene locus_tag LOCUS_03960 31040 30606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 31198 32238 gene locus_tag LOCUS_03970 31198 32238 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_03970 32984 32298 gene locus_tag LOCUS_03980 32984 32298 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168989238.1 protein_id gnl|my_center|LOCUS_03980 33469 34932 gene locus_tag LOCUS_03990 33469 34932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 35355 35624 gene locus_tag LOCUS_04000 gene rpsO 35355 35624 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814002.1 protein_id gnl|my_center|LOCUS_04000 35753 37873 gene locus_tag LOCUS_04010 gene pnp 35753 37873 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_04010 38423 37998 gene locus_tag LOCUS_04020 gene dksA 38423 37998 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140367.1 protein_id gnl|my_center|LOCUS_04020 38679 38755 gene locus_tag LOCUS_t00050 38679 38755 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38791 38867 gene locus_tag LOCUS_t00060 38791 38867 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38949 39024 gene locus_tag LOCUS_t00070 38949 39024 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 39212 42073 gene locus_tag LOCUS_04030 gene acnA 39212 42073 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208374.1 protein_id gnl|my_center|LOCUS_04030 43110 42235 gene locus_tag LOCUS_04040 gene galU 43110 42235 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_04040 44221 43187 gene locus_tag LOCUS_04050 gene galE 44221 43187 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_04050 45257 44295 gene locus_tag LOCUS_04060 45257 44295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_04060 47237 45333 gene locus_tag LOCUS_04070 gene cysN 47237 45333 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_04070 48133 47237 gene locus_tag LOCUS_04080 gene cysD 48133 47237 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175227789.1 protein_id gnl|my_center|LOCUS_04080 48367 48600 gene locus_tag LOCUS_04090 48367 48600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 48713 50284 gene locus_tag LOCUS_04100 48713 50284 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_04100 50711 50331 gene locus_tag LOCUS_04110 50711 50331 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_04110 50986 52236 gene locus_tag LOCUS_04120 50986 52236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 52372 52908 gene locus_tag LOCUS_04130 52372 52908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 53020 53322 gene locus_tag LOCUS_04140 gene lsrG 53020 53322 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098845.1 protein_id gnl|my_center|LOCUS_04140 53322 54506 gene locus_tag LOCUS_04150 53322 54506 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_04150 55373 54660 gene locus_tag LOCUS_04160 55373 54660 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958017.1 protein_id gnl|my_center|LOCUS_04160 55503 56024 gene locus_tag LOCUS_04170 55503 56024 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971406.1 protein_id gnl|my_center|LOCUS_04170 57065 56025 gene locus_tag LOCUS_04180 57065 56025 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_04180 57696 57058 gene locus_tag LOCUS_04190 gene tmk 57696 57058 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_04190 57767 58342 gene locus_tag LOCUS_04200 gene ampD 57767 58342 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927521.1 protein_id gnl|my_center|LOCUS_04200 59705 58311 gene locus_tag LOCUS_04210 59705 58311 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_04210 61983 59698 gene locus_tag LOCUS_04220 61983 59698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 62951 62049 gene locus_tag LOCUS_04230 62951 62049 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 protein_id gnl|my_center|LOCUS_04230 64362 63151 gene locus_tag LOCUS_04240 gene purT 64362 63151 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522466.1 protein_id gnl|my_center|LOCUS_04240 65471 64359 gene locus_tag LOCUS_04250 gene queG 65471 64359 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_04250 65466 65969 gene locus_tag LOCUS_04260 gene tsaE 65466 65969 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070930.1 protein_id gnl|my_center|LOCUS_04260 65936 67444 gene locus_tag LOCUS_04270 65936 67444 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_04270 67634 68764 gene locus_tag LOCUS_04280 67634 68764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522941.1 protein_id gnl|my_center|LOCUS_04280 68769 69578 gene locus_tag LOCUS_04290 68769 69578 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038701.1 protein_id gnl|my_center|LOCUS_04290 69551 70450 gene locus_tag LOCUS_04300 69551 70450 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807132.1 protein_id gnl|my_center|LOCUS_04300 70447 71070 gene locus_tag LOCUS_04310 70447 71070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 71296 72549 gene locus_tag LOCUS_04320 gene lysA 71296 72549 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073968.1 protein_id gnl|my_center|LOCUS_04320 72620 73690 gene locus_tag LOCUS_04330 72620 73690 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_04330 73759 74751 gene locus_tag LOCUS_04340 73759 74751 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_04340 75036 75437 gene locus_tag LOCUS_04350 gene cheY 75036 75437 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_04350 75479 76228 gene locus_tag LOCUS_04360 gene cheZ 75479 76228 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524402.1 protein_id gnl|my_center|LOCUS_04360 77084 76359 gene locus_tag LOCUS_04370 gene dnaQ 77084 76359 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_04370 77559 77086 gene locus_tag LOCUS_04380 gene rnhA 77559 77086 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_04380 78335 77586 gene locus_tag LOCUS_04390 78335 77586 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814735.1 protein_id gnl|my_center|LOCUS_04390 78428 79201 gene locus_tag LOCUS_04400 gene gloB 78428 79201 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456739.1 protein_id gnl|my_center|LOCUS_04400 79958 79362 gene locus_tag LOCUS_04410 79958 79362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 80656 80189 gene locus_tag LOCUS_04420 80656 80189 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792733.1 protein_id gnl|my_center|LOCUS_04420 81060 80653 gene locus_tag LOCUS_04430 81060 80653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 82591 81161 gene locus_tag LOCUS_04440 gene nhaC 82591 81161 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_04440 83067 82600 gene locus_tag LOCUS_04450 83067 82600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 83060 84262 gene locus_tag LOCUS_04460 gene rlmD 83060 84262 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_04460 87058 84527 gene locus_tag LOCUS_04470 87058 84527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 88088 87411 gene locus_tag LOCUS_04480 88088 87411 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_04480 89137 88088 gene locus_tag LOCUS_04490 gene devC 89137 88088 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_04490 90153 89254 gene locus_tag LOCUS_04500 90153 89254 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence004 635 174 gene locus_tag LOCUS_04510 635 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2009 1236 gene locus_tag LOCUS_04520 2009 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2526 3827 gene locus_tag LOCUS_04530 2526 3827 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979634.1 protein_id gnl|my_center|LOCUS_04530 3837 5384 gene locus_tag LOCUS_04540 3837 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 7094 5418 gene locus_tag LOCUS_04550 gene recN 7094 5418 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_04550 7989 7117 gene locus_tag LOCUS_04560 7989 7117 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_04560 8263 9282 gene locus_tag LOCUS_04570 gene hrcA 8263 9282 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814090.1 protein_id gnl|my_center|LOCUS_04570 9370 10455 gene locus_tag LOCUS_04580 gene hemH 9370 10455 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_04580 10924 10544 gene locus_tag LOCUS_04590 10924 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 11218 11006 gene locus_tag LOCUS_04600 11218 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 11537 13228 gene locus_tag LOCUS_04610 gene ubiB 11537 13228 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_04610 13638 13273 gene locus_tag LOCUS_04620 13638 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 14891 13635 gene locus_tag LOCUS_04630 14891 13635 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 protein_id gnl|my_center|LOCUS_04630 15661 14939 gene locus_tag LOCUS_04640 15661 14939 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_04640 16685 15681 gene locus_tag LOCUS_04650 16685 15681 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 protein_id gnl|my_center|LOCUS_04650 16903 17211 gene locus_tag LOCUS_04660 16903 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 17291 18790 gene locus_tag LOCUS_04670 17291 18790 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697442.1 protein_id gnl|my_center|LOCUS_04670 18800 20050 gene locus_tag LOCUS_04680 18800 20050 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_04680 20443 21123 gene locus_tag LOCUS_04690 20443 21123 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_04690 22007 21309 gene locus_tag LOCUS_04700 22007 21309 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_04700 22097 23080 gene locus_tag LOCUS_04710 gene rlmJ 22097 23080 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198120.1 protein_id gnl|my_center|LOCUS_04710 23289 25313 gene locus_tag LOCUS_04720 23289 25313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 25533 26012 gene locus_tag LOCUS_04730 25533 26012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 26088 27941 gene locus_tag LOCUS_04740 26088 27941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 28539 29630 gene locus_tag LOCUS_04750 gene gcvT 28539 29630 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202927.1 protein_id gnl|my_center|LOCUS_04750 29677 30066 gene locus_tag LOCUS_04760 gene gcvH 29677 30066 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_04760 30142 31494 gene locus_tag LOCUS_04770 gene gcvPA 30142 31494 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_04770 31560 32054 gene locus_tag LOCUS_04780 gene tpx 31560 32054 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_04780 32078 33553 gene locus_tag LOCUS_04790 gene gcvPB 32078 33553 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945875.1 protein_id gnl|my_center|LOCUS_04790 33657 34592 gene locus_tag LOCUS_04800 33657 34592 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_04800 34706 35317 gene locus_tag LOCUS_04810 34706 35317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 35759 35379 gene locus_tag LOCUS_04820 35759 35379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 36607 35759 gene locus_tag LOCUS_04830 36607 35759 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192869.1 protein_id gnl|my_center|LOCUS_04830 36720 37568 gene locus_tag LOCUS_04840 36720 37568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 38145 37663 gene locus_tag LOCUS_04850 38145 37663 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 protein_id gnl|my_center|LOCUS_04850 39580 38354 gene locus_tag LOCUS_04860 gene zigA 39580 38354 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_04860 39814 41862 gene locus_tag LOCUS_04870 39814 41862 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_04870 42222 42617 gene locus_tag LOCUS_04880 42222 42617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 46597 42833 gene locus_tag LOCUS_04890 gene hrpA 46597 42833 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_04890 47835 48728 gene locus_tag LOCUS_04900 47835 48728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 49431 48886 gene locus_tag LOCUS_04910 49431 48886 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700187.1 protein_id gnl|my_center|LOCUS_04910 49912 50052 gene locus_tag LOCUS_04920 49912 50052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04920 50165 50416 gene locus_tag LOCUS_04930 50165 50416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_04930 50567 51025 gene locus_tag LOCUS_04940 50567 51025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263497.1 protein_id gnl|my_center|LOCUS_04940 52460 51276 gene locus_tag LOCUS_04950 52460 51276 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_04950 53143 52535 gene locus_tag LOCUS_04960 53143 52535 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_04960 54110 53322 gene locus_tag LOCUS_04970 gene djlA 54110 53322 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_04970 54466 54224 gene locus_tag LOCUS_04980 54466 54224 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_04980 55286 54531 gene locus_tag LOCUS_04990 55286 54531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_04990 56203 55283 gene locus_tag LOCUS_05000 56203 55283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_05000 56602 56264 gene locus_tag LOCUS_05010 56602 56264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 57166 56612 gene locus_tag LOCUS_05020 57166 56612 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_05020 57768 57301 gene locus_tag LOCUS_05030 gene mlaD 57768 57301 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_05030 58565 57768 gene locus_tag LOCUS_05040 gene mlaE 58565 57768 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199929.1 protein_id gnl|my_center|LOCUS_05040 59370 58558 gene locus_tag LOCUS_05050 59370 58558 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946577.1 protein_id gnl|my_center|LOCUS_05050 59779 60672 gene locus_tag LOCUS_05060 59779 60672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 62284 60770 gene locus_tag LOCUS_05070 62284 60770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 62984 62298 gene locus_tag LOCUS_05080 62984 62298 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704726.1 protein_id gnl|my_center|LOCUS_05080 64825 63062 gene locus_tag LOCUS_05090 gene sdhA 64825 63062 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688397.1 protein_id gnl|my_center|LOCUS_05090 65180 64827 gene locus_tag LOCUS_05100 gene sdhD 65180 64827 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_05100 65563 65174 gene locus_tag LOCUS_05110 gene sdhC 65563 65174 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 protein_id gnl|my_center|LOCUS_05110 66170 65790 gene locus_tag LOCUS_05120 66170 65790 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352231.1 protein_id gnl|my_center|LOCUS_05120 67068 66202 gene locus_tag LOCUS_05130 67068 66202 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_05130 67198 68127 gene locus_tag LOCUS_05140 67198 68127 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814158.1 protein_id gnl|my_center|LOCUS_05140 69298 68285 gene locus_tag LOCUS_05150 69298 68285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 69679 69882 gene locus_tag LOCUS_05160 gene thiS 69679 69882 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_05160 69936 70742 gene locus_tag LOCUS_05170 69936 70742 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_05170 70795 71460 gene locus_tag LOCUS_05180 gene trmB 70795 71460 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527577.1 protein_id gnl|my_center|LOCUS_05180 71599 72582 gene locus_tag LOCUS_05190 71599 72582 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148287.1 protein_id gnl|my_center|LOCUS_05190 72698 73228 gene locus_tag LOCUS_05200 72698 73228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 73498 73881 gene locus_tag LOCUS_05210 gene crcB 73498 73881 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_05210 73899 74216 gene locus_tag LOCUS_05220 73899 74216 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 protein_id gnl|my_center|LOCUS_05220 75617 74373 gene locus_tag LOCUS_05230 75617 74373 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_05230 75707 76207 gene locus_tag LOCUS_05240 75707 76207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 77132 76233 gene locus_tag LOCUS_05250 gene cysB 77132 76233 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406770.1 protein_id gnl|my_center|LOCUS_05250 77377 78237 gene locus_tag LOCUS_05260 77377 78237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 78712 78362 gene locus_tag LOCUS_05270 78712 78362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 83257 78713 gene locus_tag LOCUS_05280 83257 78713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence005 3671 2766 gene locus_tag LOCUS_05290 3671 2766 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_05290 3777 6074 gene locus_tag LOCUS_05300 gene metE 3777 6074 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 protein_id gnl|my_center|LOCUS_05300 6156 6905 gene locus_tag LOCUS_05310 6156 6905 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883398.1 protein_id gnl|my_center|LOCUS_05310 7954 6986 gene locus_tag LOCUS_05320 gene gshB 7954 6986 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071123.1 protein_id gnl|my_center|LOCUS_05320 9299 7962 gene locus_tag LOCUS_05330 gene gshA 9299 7962 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_05330 9360 11366 gene locus_tag LOCUS_05340 9360 11366 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_05340 11629 12729 gene locus_tag LOCUS_05350 gene nirK 11629 12729 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965519.1 protein_id gnl|my_center|LOCUS_05350 12857 13384 gene locus_tag LOCUS_05360 gene apt 12857 13384 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206218.1 protein_id gnl|my_center|LOCUS_05360 14811 13423 gene locus_tag LOCUS_05370 gene mpl 14811 13423 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_05370 15010 15894 gene locus_tag LOCUS_05380 gene gluQRS 15010 15894 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951304.1 protein_id gnl|my_center|LOCUS_05380 16078 17235 gene locus_tag LOCUS_05390 16078 17235 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100962.1 protein_id gnl|my_center|LOCUS_05390 17262 17741 gene locus_tag LOCUS_05400 17262 17741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 17796 18248 gene locus_tag LOCUS_05410 17796 18248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 18483 20747 gene locus_tag LOCUS_05420 18483 20747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 20753 21421 gene locus_tag LOCUS_05430 20753 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 21697 22506 gene locus_tag LOCUS_05440 21697 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 22624 23181 gene locus_tag LOCUS_05450 22624 23181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 24286 23693 gene locus_tag LOCUS_05460 24286 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 24949 24413 gene locus_tag LOCUS_05470 24949 24413 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704610.1 protein_id gnl|my_center|LOCUS_05470 25045 25215 gene locus_tag LOCUS_05480 25045 25215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 25236 25925 gene locus_tag LOCUS_05490 25236 25925 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_05490 26099 29278 gene locus_tag LOCUS_05500 26099 29278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 29501 29905 gene locus_tag LOCUS_05510 29501 29905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 30082 30663 gene locus_tag LOCUS_05520 30082 30663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 32999 30804 gene locus_tag LOCUS_05530 gene rlmKL 32999 30804 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_05530 33339 33127 gene locus_tag LOCUS_05540 33339 33127 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189709.1 protein_id gnl|my_center|LOCUS_05540 33593 33336 gene locus_tag LOCUS_05550 33593 33336 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_05550 34517 33804 gene locus_tag LOCUS_05560 34517 33804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155662648.1 protein_id gnl|my_center|LOCUS_05560 34657 34756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 35084 35911 gene locus_tag LOCUS_05570 35084 35911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705991.1 protein_id gnl|my_center|LOCUS_05570 35901 37247 gene locus_tag LOCUS_05580 35901 37247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 protein_id gnl|my_center|LOCUS_05580 37244 39256 gene locus_tag LOCUS_05590 37244 39256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 39249 40874 gene locus_tag LOCUS_05600 39249 40874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 40884 42140 gene locus_tag LOCUS_05610 40884 42140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 43744 42335 gene locus_tag LOCUS_05620 43744 42335 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945973.1 protein_id gnl|my_center|LOCUS_05620 44032 45756 gene locus_tag LOCUS_05630 44032 45756 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 protein_id gnl|my_center|LOCUS_05630 45982 45803 gene locus_tag LOCUS_05640 45982 45803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 46044 47096 gene locus_tag LOCUS_05650 46044 47096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 47548 47207 gene locus_tag LOCUS_05660 47548 47207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 48386 47922 gene locus_tag LOCUS_05670 48386 47922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 50010 48940 gene locus_tag LOCUS_05680 50010 48940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 50701 50985 gene locus_tag LOCUS_05690 50701 50985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 51025 51813 gene locus_tag LOCUS_05700 51025 51813 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964340.1 protein_id gnl|my_center|LOCUS_05700 51901 55584 gene locus_tag LOCUS_05710 51901 55584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 55514 55948 gene locus_tag LOCUS_05720 55514 55948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 57151 55949 gene locus_tag LOCUS_05730 57151 55949 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536056.1 protein_id gnl|my_center|LOCUS_05730 57744 57253 gene locus_tag LOCUS_05740 57744 57253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 58360 59181 gene locus_tag LOCUS_05750 58360 59181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 59181 61391 gene locus_tag LOCUS_05760 59181 61391 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_05760 62525 61485 gene locus_tag LOCUS_05770 62525 61485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 62979 63647 gene locus_tag LOCUS_05780 62979 63647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 63898 64650 gene locus_tag LOCUS_05790 63898 64650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 64691 66922 gene locus_tag LOCUS_05800 64691 66922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 68180 67362 gene locus_tag LOCUS_05810 68180 67362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 68668 69168 gene locus_tag LOCUS_05820 68668 69168 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_05820 69168 70115 gene locus_tag LOCUS_05830 69168 70115 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_05830 70237 72633 gene locus_tag LOCUS_05840 70237 72633 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929425.1 protein_id gnl|my_center|LOCUS_05840 72980 74362 gene locus_tag LOCUS_05850 72980 74362 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403254.1 protein_id gnl|my_center|LOCUS_05850 74409 75671 gene locus_tag LOCUS_05860 74409 75671 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_05860 75668 78136 gene locus_tag LOCUS_05870 75668 78136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05870 78085 78834 gene locus_tag LOCUS_05880 78085 78834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05880 79638 79393 gene locus_tag LOCUS_05890 79638 79393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 79880 79635 gene locus_tag LOCUS_05900 79880 79635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence006 400 325 gene locus_tag LOCUS_t00080 400 325 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 702 2378 gene locus_tag LOCUS_05910 702 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2594 2911 gene locus_tag LOCUS_05920 gene flhD 2594 2911 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_05920 2944 3480 gene locus_tag LOCUS_05930 gene flhC 2944 3480 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_05930 4705 3509 gene locus_tag LOCUS_05940 4705 3509 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_05940 4785 6815 gene locus_tag LOCUS_05950 gene uvrB 4785 6815 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_05950 7171 6818 gene locus_tag LOCUS_05960 7171 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 8050 7223 gene locus_tag LOCUS_05970 8050 7223 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222468.1 protein_id gnl|my_center|LOCUS_05970 9406 8102 gene locus_tag LOCUS_05980 gene hisD 9406 8102 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527888.1 protein_id gnl|my_center|LOCUS_05980 10091 9447 gene locus_tag LOCUS_05990 gene hisG 10091 9447 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_05990 10744 10103 gene locus_tag LOCUS_06000 10744 10103 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_06000 11284 10853 gene locus_tag LOCUS_06010 11284 10853 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_06010 11435 11923 gene locus_tag LOCUS_06020 gene purE 11435 11923 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_06020 11923 13071 gene locus_tag LOCUS_06030 11923 13071 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 protein_id gnl|my_center|LOCUS_06030 13068 13958 gene locus_tag LOCUS_06040 13068 13958 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_06040 15145 14006 gene locus_tag LOCUS_06050 15145 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 15659 16771 gene locus_tag LOCUS_06060 gene corA 15659 16771 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_06060 17060 16863 gene locus_tag LOCUS_06070 17060 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 18531 17335 gene locus_tag LOCUS_06080 18531 17335 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_06080 19248 18805 gene locus_tag LOCUS_06090 19248 18805 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_06090 19778 20353 gene locus_tag LOCUS_06100 19778 20353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 20751 21323 gene locus_tag LOCUS_06110 20751 21323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 21381 24203 gene locus_tag LOCUS_06120 21381 24203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 25217 24222 gene locus_tag LOCUS_06130 25217 24222 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_06130 25478 26947 gene locus_tag LOCUS_06140 25478 26947 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_06140 27016 28257 gene locus_tag LOCUS_06150 27016 28257 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_06150 28254 31430 gene locus_tag LOCUS_06160 28254 31430 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_06160 31646 32083 gene locus_tag LOCUS_06170 31646 32083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 32099 32650 gene locus_tag LOCUS_06180 32099 32650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 33159 32800 gene locus_tag LOCUS_06190 33159 32800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 33564 34940 gene locus_tag LOCUS_06200 gene purB 33564 34940 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224850.1 protein_id gnl|my_center|LOCUS_06200 35081 35674 gene locus_tag LOCUS_06210 gene grpE 35081 35674 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_06210 35743 37680 gene locus_tag LOCUS_06220 gene dnaK 35743 37680 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039219.1 protein_id gnl|my_center|LOCUS_06220 37823 38935 gene locus_tag LOCUS_06230 gene dnaJ 37823 38935 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_06230 39250 39014 gene locus_tag LOCUS_06240 39250 39014 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688536.1 protein_id gnl|my_center|LOCUS_06240 41516 39330 gene locus_tag LOCUS_06250 41516 39330 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195838.1 protein_id gnl|my_center|LOCUS_06250 42922 41651 gene locus_tag LOCUS_06260 42922 41651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 42870 43088 gene locus_tag LOCUS_06270 42870 43088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 43291 44397 gene locus_tag LOCUS_06280 43291 44397 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_06280 44440 45300 gene locus_tag LOCUS_06290 44440 45300 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_06290 45387 45746 gene locus_tag LOCUS_06300 45387 45746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 45855 46340 gene locus_tag LOCUS_06310 45855 46340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 46319 46726 gene locus_tag LOCUS_06320 46319 46726 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_06320 46767 47285 gene locus_tag LOCUS_06330 46767 47285 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_06330 47384 47656 gene locus_tag LOCUS_06340 47384 47656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 47689 48474 gene locus_tag LOCUS_06350 47689 48474 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965276.1 protein_id gnl|my_center|LOCUS_06350 50761 48635 gene locus_tag LOCUS_06360 50761 48635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 51123 50794 gene locus_tag LOCUS_06370 51123 50794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 51584 52861 gene locus_tag LOCUS_06380 51584 52861 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_06380 54927 53197 gene locus_tag LOCUS_06390 54927 53197 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452234.1 protein_id gnl|my_center|LOCUS_06390 55491 54979 gene locus_tag LOCUS_06400 gene cheW 55491 54979 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_06400 55972 57795 gene locus_tag LOCUS_06410 gene ftsH 55972 57795 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_06410 59504 57921 gene locus_tag LOCUS_06420 59504 57921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 60923 59922 gene locus_tag LOCUS_06430 60923 59922 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_06430 62049 61012 gene locus_tag LOCUS_06440 62049 61012 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073877.1 protein_id gnl|my_center|LOCUS_06440 63030 62221 gene locus_tag LOCUS_06450 63030 62221 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_06450 64672 63380 gene locus_tag LOCUS_06460 64672 63380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 65742 64933 gene locus_tag LOCUS_06470 65742 64933 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728286.1 protein_id gnl|my_center|LOCUS_06470 66560 65742 gene locus_tag LOCUS_06480 66560 65742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_06480 67506 66538 gene locus_tag LOCUS_06490 67506 66538 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812034.1 protein_id gnl|my_center|LOCUS_06490 67674 69707 gene locus_tag LOCUS_06500 67674 69707 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089686.1 protein_id gnl|my_center|LOCUS_06500 70154 70253 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 71757 71119 gene locus_tag LOCUS_06510 gene ureG 71757 71119 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_06510 72452 71775 gene locus_tag LOCUS_06520 72452 71775 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533998.1 protein_id gnl|my_center|LOCUS_06520 72993 72457 gene locus_tag LOCUS_06530 gene ureE 72993 72457 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_06530 74844 73138 gene locus_tag LOCUS_06540 gene ureC 74844 73138 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_06540 75198 74878 gene locus_tag LOCUS_06550 75198 74878 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391866.1 protein_id gnl|my_center|LOCUS_06550 75526 75224 gene locus_tag LOCUS_06560 75526 75224 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814830.1 protein_id gnl|my_center|LOCUS_06560 76506 75631 gene locus_tag LOCUS_06570 76506 75631 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763106.1 protein_id gnl|my_center|LOCUS_06570 77847 76627 gene locus_tag LOCUS_06580 77847 76627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence007 2720 4042 gene locus_tag LOCUS_06590 2720 4042 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626085.1 protein_id gnl|my_center|LOCUS_06590 4157 4681 gene locus_tag LOCUS_06600 gene pvdS 4157 4681 CDS product pyoverdine signaling pathway sigma factor PvdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113068.1 protein_id gnl|my_center|LOCUS_06600 4877 5092 gene locus_tag LOCUS_06610 4877 5092 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003304661.1 protein_id gnl|my_center|LOCUS_06610 5159 5842 gene locus_tag LOCUS_06620 5159 5842 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267336.1 protein_id gnl|my_center|LOCUS_06620 5820 6527 gene locus_tag LOCUS_06630 5820 6527 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527401.1 protein_id gnl|my_center|LOCUS_06630 6643 11928 gene locus_tag LOCUS_06640 6643 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 11928 16526 gene locus_tag LOCUS_06650 11928 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 16604 19933 gene locus_tag LOCUS_06660 16604 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 19934 31840 gene locus_tag LOCUS_06670 19934 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 33187 31925 gene locus_tag LOCUS_06680 33187 31925 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087276.1 protein_id gnl|my_center|LOCUS_06680 34721 33192 gene locus_tag LOCUS_06690 34721 33192 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193739.1 protein_id gnl|my_center|LOCUS_06690 35196 36260 gene locus_tag LOCUS_06700 35196 36260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 36271 37572 gene locus_tag LOCUS_06710 gene pvdA 36271 37572 CDS product L-ornithine N(5)-monooxygenase PvdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114509.1 protein_id gnl|my_center|LOCUS_06710 37638 39917 gene locus_tag LOCUS_06720 37638 39917 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923125.1 protein_id gnl|my_center|LOCUS_06720 39969 40934 gene locus_tag LOCUS_06730 39969 40934 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521279.1 protein_id gnl|my_center|LOCUS_06730 41063 42379 gene locus_tag LOCUS_06740 41063 42379 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188537.1 protein_id gnl|my_center|LOCUS_06740 42428 43618 gene locus_tag LOCUS_06750 42428 43618 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_06750 43615 46725 gene locus_tag LOCUS_06760 43615 46725 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_06760 46779 48398 gene locus_tag LOCUS_06770 46779 48398 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_06770 48517 50706 gene locus_tag LOCUS_06780 48517 50706 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_06780 52237 51095 gene locus_tag LOCUS_06790 52237 51095 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769496.1 protein_id gnl|my_center|LOCUS_06790 53081 52284 gene locus_tag LOCUS_06800 53081 52284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 53651 54832 gene locus_tag LOCUS_06810 53651 54832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 54798 55577 gene locus_tag LOCUS_06820 54798 55577 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978862.1 protein_id gnl|my_center|LOCUS_06820 55626 59495 gene locus_tag LOCUS_06830 55626 59495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 59554 60537 gene locus_tag LOCUS_06840 59554 60537 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946516.1 protein_id gnl|my_center|LOCUS_06840 63663 60574 gene locus_tag LOCUS_06850 63663 60574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 64142 65038 gene locus_tag LOCUS_06860 64142 65038 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_06860 65047 65934 gene locus_tag LOCUS_06870 65047 65934 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_06870 66071 67861 gene locus_tag LOCUS_06880 gene aprD 66071 67861 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_06880 67919 69271 gene locus_tag LOCUS_06890 67919 69271 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_06890 69277 70611 gene locus_tag LOCUS_06900 69277 70611 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405041.1 protein_id gnl|my_center|LOCUS_06900 71164 70697 gene locus_tag LOCUS_06910 71164 70697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 71851 72123 gene locus_tag LOCUS_06920 71851 72123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 72590 74410 gene locus_tag LOCUS_06930 gene yidC 72590 74410 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_06930 74480 75838 gene locus_tag LOCUS_06940 gene mnmE 74480 75838 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 protein_id gnl|my_center|LOCUS_06940 76110 76853 gene locus_tag LOCUS_06950 76110 76853 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093250.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence008 2642 360 gene locus_tag LOCUS_06960 2642 360 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971506.1 protein_id gnl|my_center|LOCUS_06960 5079 3157 gene locus_tag LOCUS_06970 5079 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 7186 5066 gene locus_tag LOCUS_06980 7186 5066 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044977.1 protein_id gnl|my_center|LOCUS_06980 9954 7183 gene locus_tag LOCUS_06990 9954 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 10610 9954 gene locus_tag LOCUS_07000 10610 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 12542 10623 gene locus_tag LOCUS_07010 12542 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 14830 12938 gene locus_tag LOCUS_07020 gene cirA 14830 12938 CDS product catecholate siderophore receptor CirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420204.1 protein_id gnl|my_center|LOCUS_07020 17049 15124 gene locus_tag LOCUS_07030 17049 15124 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074140.1 protein_id gnl|my_center|LOCUS_07030 19232 17358 gene locus_tag LOCUS_07040 19232 17358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263365.1 protein_id gnl|my_center|LOCUS_07040 20482 19241 gene locus_tag LOCUS_07050 20482 19241 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_07050 20784 21263 gene locus_tag LOCUS_07060 20784 21263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 22995 21295 gene locus_tag LOCUS_07070 22995 21295 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_07070 24059 23001 gene locus_tag LOCUS_07080 gene hypE 24059 23001 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_07080 25207 24059 gene locus_tag LOCUS_07090 gene hypD 25207 24059 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_07090 25463 25227 gene locus_tag LOCUS_07100 25463 25227 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_07100 25598 26107 gene locus_tag LOCUS_07110 25598 26107 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236185.1 protein_id gnl|my_center|LOCUS_07110 26323 26646 gene locus_tag LOCUS_07120 26323 26646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 27737 26736 gene locus_tag LOCUS_07130 27737 26736 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103925.1 protein_id gnl|my_center|LOCUS_07130 28301 29470 gene locus_tag LOCUS_07140 28301 29470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 29611 30039 gene locus_tag LOCUS_07150 29611 30039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 30077 30619 gene locus_tag LOCUS_07160 30077 30619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 31904 30633 gene locus_tag LOCUS_07170 31904 30633 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_07170 34720 31901 gene locus_tag LOCUS_07180 gene uvrA 34720 31901 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195192.1 protein_id gnl|my_center|LOCUS_07180 34787 36190 gene locus_tag LOCUS_07190 34787 36190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 protein_id gnl|my_center|LOCUS_07190 36174 36623 gene locus_tag LOCUS_07200 gene ssb 36174 36623 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_07200 36826 36620 gene locus_tag LOCUS_07210 36826 36620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 38435 37971 gene locus_tag LOCUS_07220 gene bfr 38435 37971 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188572.1 protein_id gnl|my_center|LOCUS_07220 39150 40166 gene locus_tag LOCUS_07230 39150 40166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 41082 40222 gene locus_tag LOCUS_07240 41082 40222 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_07240 43516 41618 gene locus_tag LOCUS_07250 43516 41618 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191791.1 protein_id gnl|my_center|LOCUS_07250 44064 44393 gene locus_tag LOCUS_07260 44064 44393 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807250.1 protein_id gnl|my_center|LOCUS_07260 44548 45384 gene locus_tag LOCUS_07270 44548 45384 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266172.1 protein_id gnl|my_center|LOCUS_07270 45935 45423 gene locus_tag LOCUS_07280 45935 45423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 46079 48796 gene locus_tag LOCUS_07290 46079 48796 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_07290 48932 50242 gene locus_tag LOCUS_07300 48932 50242 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_07300 51102 50377 gene locus_tag LOCUS_07310 51102 50377 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_07310 51172 52524 gene locus_tag LOCUS_07320 51172 52524 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_07320 52542 52889 gene locus_tag LOCUS_07330 52542 52889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 53005 53946 gene locus_tag LOCUS_07340 53005 53946 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480142.1 protein_id gnl|my_center|LOCUS_07340 54497 53979 gene locus_tag LOCUS_07350 54497 53979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 56039 54540 gene locus_tag LOCUS_07360 56039 54540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 56496 57545 gene locus_tag LOCUS_07370 56496 57545 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_07370 57701 58138 gene locus_tag LOCUS_07380 57701 58138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 58591 58806 gene locus_tag LOCUS_07390 58591 58806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 58939 59556 gene locus_tag LOCUS_07400 gene nudF 58939 59556 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_07400 60675 59557 gene locus_tag LOCUS_07410 gene tyrS 60675 59557 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957422.1 protein_id gnl|my_center|LOCUS_07410 60911 62242 gene locus_tag LOCUS_07420 60911 62242 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_07420 62396 63511 gene locus_tag LOCUS_07430 62396 63511 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269098.1 protein_id gnl|my_center|LOCUS_07430 63920 63552 gene locus_tag LOCUS_07440 gene erpA 63920 63552 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_07440 64423 63989 gene locus_tag LOCUS_07450 64423 63989 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_07450 65046 64441 gene locus_tag LOCUS_07460 65046 64441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 66433 65405 gene locus_tag LOCUS_07470 gene argC 66433 65405 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767875.1 protein_id gnl|my_center|LOCUS_07470 66926 66534 gene locus_tag LOCUS_07480 gene rpsI 66926 66534 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549989.1 protein_id gnl|my_center|LOCUS_07480 67415 66930 gene locus_tag LOCUS_07490 gene rplM 67415 66930 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_07490 67647 69353 gene locus_tag LOCUS_07500 67647 69353 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193654.1 protein_id gnl|my_center|LOCUS_07500 69462 69641 gene locus_tag LOCUS_07510 69462 69641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 69720 69980 gene locus_tag LOCUS_07520 69720 69980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 71279 70350 gene locus_tag LOCUS_07530 71279 70350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 71421 72935 gene locus_tag LOCUS_07540 71421 72935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 72932 74377 gene locus_tag LOCUS_07550 72932 74377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 75451 74390 gene locus_tag LOCUS_07560 75451 74390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 76168 75455 gene locus_tag LOCUS_07570 76168 75455 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946869.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence009 1850 186 gene locus_tag LOCUS_07580 1850 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 2548 3447 gene locus_tag LOCUS_07590 2548 3447 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250141.1 protein_id gnl|my_center|LOCUS_07590 3588 4028 gene locus_tag LOCUS_07600 3588 4028 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_07600 4867 4061 gene locus_tag LOCUS_07610 4867 4061 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244053.1 protein_id gnl|my_center|LOCUS_07610 4866 5891 gene locus_tag LOCUS_07620 gene rluD 4866 5891 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073400.1 protein_id gnl|my_center|LOCUS_07620 7405 6029 gene locus_tag LOCUS_07630 7405 6029 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_07630 9895 7820 gene locus_tag LOCUS_07640 9895 7820 CDS product 10S-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114857.1 protein_id gnl|my_center|LOCUS_07640 10124 11392 gene locus_tag LOCUS_07650 10124 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 11389 12561 gene locus_tag LOCUS_07660 11389 12561 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942781.1 protein_id gnl|my_center|LOCUS_07660 12571 15765 gene locus_tag LOCUS_07670 12571 15765 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942780.1 protein_id gnl|my_center|LOCUS_07670 17195 15936 gene locus_tag LOCUS_07680 17195 15936 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_07680 18081 17332 gene locus_tag LOCUS_07690 18081 17332 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_07690 18469 20058 gene locus_tag LOCUS_07700 18469 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 20354 20151 gene locus_tag LOCUS_07710 20354 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 20778 22145 gene locus_tag LOCUS_07720 20778 22145 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_07720 22957 22235 gene locus_tag LOCUS_07730 22957 22235 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_07730 24414 23065 gene locus_tag LOCUS_07740 gene radA 24414 23065 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_07740 24971 24423 gene locus_tag LOCUS_07750 gene rfbC 24971 24423 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_07750 25937 25005 gene locus_tag LOCUS_07760 gene rfbA 25937 25005 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_07760 26092 27777 gene locus_tag LOCUS_07770 gene msbA 26092 27777 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097303.1 protein_id gnl|my_center|LOCUS_07770 29727 27841 gene locus_tag LOCUS_07780 29727 27841 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_07780 30718 29729 gene locus_tag LOCUS_07790 30718 29729 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_07790 32050 30833 gene locus_tag LOCUS_07800 32050 30833 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_07800 32564 34000 gene locus_tag LOCUS_07810 32564 34000 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082330.1 protein_id gnl|my_center|LOCUS_07810 34029 34763 gene locus_tag LOCUS_07820 34029 34763 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_07820 34750 35421 gene locus_tag LOCUS_07830 34750 35421 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405298.1 protein_id gnl|my_center|LOCUS_07830 35449 39069 gene locus_tag LOCUS_07840 gene uca 35449 39069 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045751776.1 protein_id gnl|my_center|LOCUS_07840 40924 39536 gene locus_tag LOCUS_07850 40924 39536 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_07850 41498 41043 gene locus_tag LOCUS_07860 gene rplI 41498 41043 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813092.1 protein_id gnl|my_center|LOCUS_07860 41791 41510 gene locus_tag LOCUS_07870 gene rpsR 41791 41510 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193360.1 protein_id gnl|my_center|LOCUS_07870 42107 41811 gene locus_tag LOCUS_07880 gene priB 42107 41811 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_07880 42527 42120 gene locus_tag LOCUS_07890 gene rpsF 42527 42120 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193673.1 protein_id gnl|my_center|LOCUS_07890 42779 43360 gene locus_tag LOCUS_07900 42779 43360 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217367.1 protein_id gnl|my_center|LOCUS_07900 43357 44400 gene locus_tag LOCUS_07910 gene trpD 43357 44400 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_07910 44409 45281 gene locus_tag LOCUS_07920 gene trpC 44409 45281 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_07920 45421 46257 gene locus_tag LOCUS_07930 45421 46257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 46663 47823 gene locus_tag LOCUS_07940 46663 47823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 48245 47910 gene locus_tag LOCUS_07950 48245 47910 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038005.1 protein_id gnl|my_center|LOCUS_07950 48416 48670 gene locus_tag LOCUS_07960 48416 48670 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460845.1 protein_id gnl|my_center|LOCUS_07960 48759 49829 gene locus_tag LOCUS_07970 gene mutY 48759 49829 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195232.1 protein_id gnl|my_center|LOCUS_07970 49844 50458 gene locus_tag LOCUS_07980 49844 50458 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531468.1 protein_id gnl|my_center|LOCUS_07980 51088 50474 gene locus_tag LOCUS_07990 gene ubiX 51088 50474 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_07990 52114 51155 gene locus_tag LOCUS_08000 gene hprK 52114 51155 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687702.1 protein_id gnl|my_center|LOCUS_08000 52568 52101 gene locus_tag LOCUS_08010 gene ptsN 52568 52101 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_08010 52992 52666 gene locus_tag LOCUS_08020 gene hpf 52992 52666 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_08020 54463 53012 gene locus_tag LOCUS_08030 54463 53012 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_08030 55233 54511 gene locus_tag LOCUS_08040 gene lptB 55233 54511 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_08040 55807 55277 gene locus_tag LOCUS_08050 55807 55277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 56385 55819 gene locus_tag LOCUS_08060 56385 55819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 56605 57702 gene locus_tag LOCUS_08070 gene nadA 56605 57702 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_08070 57743 58915 gene locus_tag LOCUS_08080 gene clsB 57743 58915 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_08080 58985 60052 gene locus_tag LOCUS_08090 58985 60052 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809529.1 protein_id gnl|my_center|LOCUS_08090 60039 60809 gene locus_tag LOCUS_08100 60039 60809 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_08100 61993 60920 gene locus_tag LOCUS_08110 61993 60920 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065597567.1 protein_id gnl|my_center|LOCUS_08110 62647 62012 gene locus_tag LOCUS_08120 62647 62012 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406213.1 protein_id gnl|my_center|LOCUS_08120 63464 62721 gene locus_tag LOCUS_08130 gene surE 63464 62721 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_08130 63639 63563 gene locus_tag LOCUS_t00090 63639 63563 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 64077 63700 gene locus_tag LOCUS_08140 64077 63700 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161056164.1 protein_id gnl|my_center|LOCUS_08140 64363 64055 gene locus_tag LOCUS_08150 64363 64055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 66906 64546 gene locus_tag LOCUS_08160 gene pheT 66906 64546 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_08160 67965 66946 gene locus_tag LOCUS_08170 gene pheS 67965 66946 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382398.1 protein_id gnl|my_center|LOCUS_08170 68428 68069 gene locus_tag LOCUS_08180 gene rplT 68428 68069 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_08180 68638 68441 gene locus_tag LOCUS_08190 gene rpmI 68638 68441 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_08190 69265 68750 gene locus_tag LOCUS_08200 gene infC 69265 68750 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_08200 71260 69353 gene locus_tag LOCUS_08210 gene thrS 71260 69353 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_08210 72112 71351 gene locus_tag LOCUS_08220 72112 71351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence010 719 78 gene locus_tag LOCUS_08230 719 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1261 1539 gene locus_tag LOCUS_08240 1261 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08240 2612 1731 gene locus_tag LOCUS_08250 2612 1731 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529711.1 protein_id gnl|my_center|LOCUS_08250 3036 3818 gene locus_tag LOCUS_08260 gene yaaA 3036 3818 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207208.1 protein_id gnl|my_center|LOCUS_08260 3862 4233 gene locus_tag LOCUS_08270 3862 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4273 5394 gene locus_tag LOCUS_08280 4273 5394 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103404.1 protein_id gnl|my_center|LOCUS_08280 5690 6349 gene locus_tag LOCUS_08290 gene rpiA 5690 6349 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770348.1 protein_id gnl|my_center|LOCUS_08290 6411 7118 gene locus_tag LOCUS_08300 gene phoU 6411 7118 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813242.1 protein_id gnl|my_center|LOCUS_08300 7614 7156 gene locus_tag LOCUS_08310 7614 7156 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_08310 11291 7776 gene locus_tag LOCUS_08320 11291 7776 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_08320 11896 11324 gene locus_tag LOCUS_08330 11896 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 12690 11893 gene locus_tag LOCUS_08340 12690 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 13720 13184 gene locus_tag LOCUS_08350 13720 13184 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 protein_id gnl|my_center|LOCUS_08350 13958 15067 gene locus_tag LOCUS_08360 gene thiO 13958 15067 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_08360 16019 15075 gene locus_tag LOCUS_08370 gene ispH 16019 15075 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_08370 17246 16128 gene locus_tag LOCUS_08380 gene aroF 17246 16128 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 protein_id gnl|my_center|LOCUS_08380 17563 18822 gene locus_tag LOCUS_08390 17563 18822 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_08390 18831 19391 gene locus_tag LOCUS_08400 18831 19391 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_08400 20495 19404 gene locus_tag LOCUS_08410 gene ribD 20495 19404 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_08410 21058 20576 gene locus_tag LOCUS_08420 gene nrdR 21058 20576 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185666.1 protein_id gnl|my_center|LOCUS_08420 22361 21114 gene locus_tag LOCUS_08430 22361 21114 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951137.1 protein_id gnl|my_center|LOCUS_08430 25196 22938 gene locus_tag LOCUS_08440 gene clpA 25196 22938 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_08440 25506 25198 gene locus_tag LOCUS_08450 gene clpS 25506 25198 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064083.1 protein_id gnl|my_center|LOCUS_08450 25792 25995 gene locus_tag LOCUS_08460 25792 25995 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_08460 27342 26092 gene locus_tag LOCUS_08470 gene icd 27342 26092 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_08470 27930 28973 gene locus_tag LOCUS_08480 27930 28973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_08480 29057 30556 gene locus_tag LOCUS_08490 29057 30556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 32026 30647 gene locus_tag LOCUS_08500 32026 30647 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813039.1 protein_id gnl|my_center|LOCUS_08500 32335 32027 gene locus_tag LOCUS_08510 32335 32027 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813037.1 protein_id gnl|my_center|LOCUS_08510 33551 32424 gene locus_tag LOCUS_08520 33551 32424 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813035.1 protein_id gnl|my_center|LOCUS_08520 34649 33849 gene locus_tag LOCUS_08530 34649 33849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 38440 34937 gene locus_tag LOCUS_08540 38440 34937 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388324.1 protein_id gnl|my_center|LOCUS_08540 39755 38532 gene locus_tag LOCUS_08550 39755 38532 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_08550 40217 39810 gene locus_tag LOCUS_08560 40217 39810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 42060 40786 gene locus_tag LOCUS_08570 42060 40786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 43087 42182 gene locus_tag LOCUS_08580 gene cysD 43087 42182 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_08580 43869 43171 gene locus_tag LOCUS_08590 43869 43171 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_08590 44395 43862 gene locus_tag LOCUS_08600 44395 43862 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_08600 46142 44400 gene locus_tag LOCUS_08610 46142 44400 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192117.1 protein_id gnl|my_center|LOCUS_08610 46482 46252 gene locus_tag LOCUS_08620 46482 46252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 46529 46759 gene locus_tag LOCUS_08630 46529 46759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 47031 47969 gene locus_tag LOCUS_08640 gene cysB 47031 47969 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_08640 48071 48622 gene locus_tag LOCUS_08650 48071 48622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 49256 50125 gene locus_tag LOCUS_08660 49256 50125 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948323.1 protein_id gnl|my_center|LOCUS_08660 50624 50217 gene locus_tag LOCUS_08670 50624 50217 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199588.1 protein_id gnl|my_center|LOCUS_08670 51634 50681 gene locus_tag LOCUS_08680 51634 50681 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_08680 52611 51631 gene locus_tag LOCUS_08690 gene cysK 52611 51631 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 protein_id gnl|my_center|LOCUS_08690 55694 52782 gene locus_tag LOCUS_08700 55694 52782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 55866 56576 gene locus_tag LOCUS_08710 55866 56576 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 protein_id gnl|my_center|LOCUS_08710 57256 56579 gene locus_tag LOCUS_08720 57256 56579 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_08720 58640 57366 gene locus_tag LOCUS_08730 58640 57366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 59582 58752 gene locus_tag LOCUS_08740 59582 58752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 61204 59981 gene locus_tag LOCUS_08750 61204 59981 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_08750 61335 62204 gene locus_tag LOCUS_08760 61335 62204 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_08760 62251 62883 gene locus_tag LOCUS_08770 62251 62883 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 protein_id gnl|my_center|LOCUS_08770 62876 63541 gene locus_tag LOCUS_08780 62876 63541 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_08780 63711 64913 gene locus_tag LOCUS_08790 63711 64913 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_08790 65031 65771 gene locus_tag LOCUS_08800 65031 65771 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_08800 65746 66378 gene locus_tag LOCUS_08810 65746 66378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 66632 66441 gene locus_tag LOCUS_08820 66632 66441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 67548 66718 gene locus_tag LOCUS_08830 67548 66718 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence011 1697 609 gene locus_tag LOCUS_08840 gene prfB 1697 609 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_08840 2009 2659 gene locus_tag LOCUS_08850 gene ispD 2009 2659 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_08850 2656 3138 gene locus_tag LOCUS_08860 gene ispF 2656 3138 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_08860 3145 3693 gene locus_tag LOCUS_08870 gene thpR 3145 3693 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294685.1 protein_id gnl|my_center|LOCUS_08870 3792 4466 gene locus_tag LOCUS_08880 gene tsaB 3792 4466 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 protein_id gnl|my_center|LOCUS_08880 4463 4924 gene locus_tag LOCUS_08890 gene rimI 4463 4924 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_08890 4921 5655 gene locus_tag LOCUS_08900 4921 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6970 5696 gene locus_tag LOCUS_08910 gene lplT 6970 5696 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_08910 7222 8304 gene locus_tag LOCUS_08920 gene dadX 7222 8304 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705840.1 protein_id gnl|my_center|LOCUS_08920 9137 8343 gene locus_tag LOCUS_08930 9137 8343 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_08930 9597 9295 gene locus_tag LOCUS_08940 9597 9295 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096279.1 protein_id gnl|my_center|LOCUS_08940 10205 9597 gene locus_tag LOCUS_08950 10205 9597 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_08950 11426 10275 gene locus_tag LOCUS_08960 11426 10275 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_08960 11594 11430 gene locus_tag LOCUS_08970 gene rubA 11594 11430 CDS product rubredoxin RubA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760495.1 protein_id gnl|my_center|LOCUS_08970 12583 11813 gene locus_tag LOCUS_08980 12583 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 14926 12833 gene locus_tag LOCUS_08990 14926 12833 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191126.1 protein_id gnl|my_center|LOCUS_08990 16274 15000 gene locus_tag LOCUS_09000 16274 15000 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_09000 17245 16286 gene locus_tag LOCUS_09010 17245 16286 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_09010 17751 17242 gene locus_tag LOCUS_09020 gene pyrR 17751 17242 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_09020 18217 17732 gene locus_tag LOCUS_09030 gene ruvX 18217 17732 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213272.1 protein_id gnl|my_center|LOCUS_09030 18789 18229 gene locus_tag LOCUS_09040 18789 18229 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_09040 19482 18856 gene locus_tag LOCUS_09050 gene coq7 19482 18856 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527787.1 protein_id gnl|my_center|LOCUS_09050 20909 19647 gene locus_tag LOCUS_09060 20909 19647 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057500.1 protein_id gnl|my_center|LOCUS_09060 21137 21403 gene locus_tag LOCUS_09070 gene rpsP 21137 21403 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926757.1 protein_id gnl|my_center|LOCUS_09070 21420 21926 gene locus_tag LOCUS_09080 gene rimM 21420 21926 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690619.1 protein_id gnl|my_center|LOCUS_09080 21938 22708 gene locus_tag LOCUS_09090 gene trmD 21938 22708 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_09090 22733 23152 gene locus_tag LOCUS_09100 gene rplS 22733 23152 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_09100 23636 23259 gene locus_tag LOCUS_09110 gene arsC 23636 23259 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166449.1 protein_id gnl|my_center|LOCUS_09110 24177 23662 gene locus_tag LOCUS_09120 24177 23662 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_09120 24534 24280 gene locus_tag LOCUS_09130 24534 24280 CDS product DUF2024 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086057.1 protein_id gnl|my_center|LOCUS_09130 25398 24739 gene locus_tag LOCUS_09140 25398 24739 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902491.1 protein_id gnl|my_center|LOCUS_09140 26297 25437 gene locus_tag LOCUS_09150 26297 25437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 27795 26776 gene locus_tag LOCUS_09160 27795 26776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 28669 27905 gene locus_tag LOCUS_09170 28669 27905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 30009 28738 gene locus_tag LOCUS_09180 30009 28738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 30355 30116 gene locus_tag LOCUS_09190 30355 30116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 30378 31043 gene locus_tag LOCUS_09200 30378 31043 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937648.1 protein_id gnl|my_center|LOCUS_09200 31052 31822 gene locus_tag LOCUS_09210 31052 31822 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_09210 31819 32757 gene locus_tag LOCUS_09220 31819 32757 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_09220 32762 33691 gene locus_tag LOCUS_09230 32762 33691 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_09230 33701 34342 gene locus_tag LOCUS_09240 33701 34342 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_09240 34359 35039 gene locus_tag LOCUS_09250 gene pgl 34359 35039 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_09250 35069 35743 gene locus_tag LOCUS_09260 35069 35743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 36797 35877 gene locus_tag LOCUS_09270 36797 35877 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_09270 37366 36944 gene locus_tag LOCUS_09280 37366 36944 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_09280 37530 38369 gene locus_tag LOCUS_09290 37530 38369 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_09290 39023 38415 gene locus_tag LOCUS_09300 gene metW 39023 38415 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688371.1 protein_id gnl|my_center|LOCUS_09300 40175 39048 gene locus_tag LOCUS_09310 40175 39048 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_09310 41976 40249 gene locus_tag LOCUS_09320 gene ptsP 41976 40249 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_09320 42242 41973 gene locus_tag LOCUS_09330 42242 41973 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_09330 42636 42244 gene locus_tag LOCUS_09340 42636 42244 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_09340 42861 44369 gene locus_tag LOCUS_09350 gene lysS 42861 44369 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192783.1 protein_id gnl|my_center|LOCUS_09350 45044 44382 gene locus_tag LOCUS_09360 45044 44382 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_09360 45724 45041 gene locus_tag LOCUS_09370 gene hda 45724 45041 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_09370 46832 45768 gene locus_tag LOCUS_09380 46832 45768 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_09380 48350 46953 gene locus_tag LOCUS_09390 gene hpnO 48350 46953 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_09390 49489 48743 gene locus_tag LOCUS_09400 49489 48743 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_09400 49716 49907 gene locus_tag LOCUS_09410 49716 49907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 51377 50097 gene locus_tag LOCUS_09420 51377 50097 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082852.1 protein_id gnl|my_center|LOCUS_09420 53481 51424 gene locus_tag LOCUS_09430 53481 51424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 53941 55332 gene locus_tag LOCUS_09440 53941 55332 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_09440 55507 56649 gene locus_tag LOCUS_09450 gene carA 55507 56649 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_09450 56717 59941 gene locus_tag LOCUS_09460 gene carB 56717 59941 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_09460 59993 60469 gene locus_tag LOCUS_09470 gene greA 59993 60469 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_09470 60848 60489 gene locus_tag LOCUS_09480 60848 60489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 60879 61499 gene locus_tag LOCUS_09490 gene rlmE 60879 61499 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235573.1 protein_id gnl|my_center|LOCUS_09490 61656 63575 gene locus_tag LOCUS_09500 gene ftsH 61656 63575 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_09500 63706 64491 gene locus_tag LOCUS_09510 gene folP 63706 64491 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_09510 64556 65920 gene locus_tag LOCUS_09520 gene glmM 64556 65920 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_09520 66149 67153 gene locus_tag LOCUS_09530 66149 67153 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_09530 67286 68716 gene locus_tag LOCUS_09540 gene cysG 67286 68716 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405073.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence012 143 595 gene locus_tag LOCUS_09550 143 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1174 662 gene locus_tag LOCUS_09560 1174 662 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_09560 1219 2715 gene locus_tag LOCUS_09570 gene ppx 1219 2715 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731673.1 protein_id gnl|my_center|LOCUS_09570 2891 5920 gene locus_tag LOCUS_09580 2891 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 8110 6035 gene locus_tag LOCUS_09590 gene ppk1 8110 6035 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_09590 9414 8287 gene locus_tag LOCUS_09600 9414 8287 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027989172.1 protein_id gnl|my_center|LOCUS_09600 11519 9534 gene locus_tag LOCUS_09610 gene pqqU 11519 9534 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_09610 11756 12607 gene locus_tag LOCUS_09620 11756 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 12736 12942 gene locus_tag LOCUS_09630 12736 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 12890 13588 gene locus_tag LOCUS_09640 12890 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09640 13537 13947 gene locus_tag LOCUS_09650 13537 13947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 13972 14220 gene locus_tag LOCUS_09660 gene acpP 13972 14220 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014607275.1 protein_id gnl|my_center|LOCUS_09660 14397 15566 gene locus_tag LOCUS_09670 14397 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 15779 16126 gene locus_tag LOCUS_09680 15779 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 16174 16527 gene locus_tag LOCUS_09690 16174 16527 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 protein_id gnl|my_center|LOCUS_09690 16705 19233 gene locus_tag LOCUS_09700 16705 19233 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 protein_id gnl|my_center|LOCUS_09700 19283 20482 gene locus_tag LOCUS_09710 19283 20482 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 protein_id gnl|my_center|LOCUS_09710 20788 22194 gene locus_tag LOCUS_09720 20788 22194 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_09720 23577 22198 gene locus_tag LOCUS_09730 23577 22198 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971847.1 protein_id gnl|my_center|LOCUS_09730 23954 27298 gene locus_tag LOCUS_09740 23954 27298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 27977 27315 gene locus_tag LOCUS_09750 27977 27315 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809767.1 protein_id gnl|my_center|LOCUS_09750 28121 29326 gene locus_tag LOCUS_09760 28121 29326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 29486 30454 gene locus_tag LOCUS_09770 29486 30454 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_09770 30492 30824 gene locus_tag LOCUS_09780 30492 30824 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_09780 31986 30829 gene locus_tag LOCUS_09790 31986 30829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 32338 32892 gene locus_tag LOCUS_09800 gene greB 32338 32892 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_09800 33264 32953 gene locus_tag LOCUS_09810 33264 32953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 33670 33398 gene locus_tag LOCUS_09820 33670 33398 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 protein_id gnl|my_center|LOCUS_09820 33861 34526 gene locus_tag LOCUS_09830 33861 34526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 34960 34571 gene locus_tag LOCUS_09840 34960 34571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 35312 36349 gene locus_tag LOCUS_09850 35312 36349 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_09850 36407 37759 gene locus_tag LOCUS_09860 gene chrA 36407 37759 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_09860 37927 39519 gene locus_tag LOCUS_09870 37927 39519 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_09870 39698 40033 gene locus_tag LOCUS_09880 39698 40033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940668.1 protein_id gnl|my_center|LOCUS_09880 40349 41986 gene locus_tag LOCUS_09890 40349 41986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 42744 43595 gene locus_tag LOCUS_09900 42744 43595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 43748 44602 gene locus_tag LOCUS_09910 43748 44602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 44812 45324 gene locus_tag LOCUS_09920 44812 45324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 45417 46451 gene locus_tag LOCUS_09930 45417 46451 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192663.1 protein_id gnl|my_center|LOCUS_09930 46676 46849 gene locus_tag LOCUS_09940 46676 46849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 47385 46894 gene locus_tag LOCUS_09950 gene lspA 47385 46894 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_09950 50250 47449 gene locus_tag LOCUS_09960 gene ileS 50250 47449 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699451.1 protein_id gnl|my_center|LOCUS_09960 51244 50300 gene locus_tag LOCUS_09970 51244 50300 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_09970 51420 52010 gene locus_tag LOCUS_09980 gene slmA 51420 52010 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_09980 52780 52016 gene locus_tag LOCUS_09990 gene moeB 52780 52016 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929912.1 protein_id gnl|my_center|LOCUS_09990 54222 52792 gene locus_tag LOCUS_10000 gene cptA 54222 52792 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_10000 55420 54269 gene locus_tag LOCUS_10010 55420 54269 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_10010 56291 55542 gene locus_tag LOCUS_10020 gene gpmA 56291 55542 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_10020 56621 57058 gene locus_tag LOCUS_10030 56621 57058 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_10030 57068 57325 gene locus_tag LOCUS_10040 gene grxC 57068 57325 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_10040 57391 57828 gene locus_tag LOCUS_10050 gene secB 57391 57828 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_10050 57965 58345 gene locus_tag LOCUS_10060 57965 58345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 58342 59334 gene locus_tag LOCUS_10070 58342 59334 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_10070 59572 59844 gene locus_tag LOCUS_10080 59572 59844 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_10080 59859 59934 gene locus_tag LOCUS_t00100 59859 59934 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 59950 60026 gene locus_tag LOCUS_t00110 59950 60026 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 60102 61991 gene locus_tag LOCUS_10090 60102 61991 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527215.1 protein_id gnl|my_center|LOCUS_10090 62806 62021 gene locus_tag LOCUS_10100 gene fabI 62806 62021 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_10100 62947 65136 gene locus_tag LOCUS_10110 62947 65136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_10110 65154 66134 gene locus_tag LOCUS_10120 65154 66134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence013 166 510 gene locus_tag LOCUS_10130 166 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1501 617 gene locus_tag LOCUS_10140 gene htpX 1501 617 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 protein_id gnl|my_center|LOCUS_10140 2123 1848 gene locus_tag LOCUS_10150 2123 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3406 2123 gene locus_tag LOCUS_10160 gene eno 3406 2123 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813700.1 protein_id gnl|my_center|LOCUS_10160 5201 3522 gene locus_tag LOCUS_10170 5201 3522 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_10170 6174 5290 gene locus_tag LOCUS_10180 6174 5290 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_10180 7592 6210 gene locus_tag LOCUS_10190 gene argH 7592 6210 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225520.1 protein_id gnl|my_center|LOCUS_10190 7907 8515 gene locus_tag LOCUS_10200 7907 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9856 8603 gene locus_tag LOCUS_10210 gene murA 9856 8603 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_10210 10055 10441 gene locus_tag LOCUS_10220 10055 10441 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_10220 10487 12526 gene locus_tag LOCUS_10230 gene recG 10487 12526 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_10230 12630 13499 gene locus_tag LOCUS_10240 12630 13499 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198488.1 protein_id gnl|my_center|LOCUS_10240 13699 13448 gene locus_tag LOCUS_10250 13699 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 13897 14259 gene locus_tag LOCUS_10260 13897 14259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 14256 15125 gene locus_tag LOCUS_10270 gene ubiA 14256 15125 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_10270 15151 16614 gene locus_tag LOCUS_10280 gene ubiD 15151 16614 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_10280 16699 16992 gene locus_tag LOCUS_10290 16699 16992 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068360.1 protein_id gnl|my_center|LOCUS_10290 17944 17009 gene locus_tag LOCUS_10300 gene truB 17944 17009 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_10300 18370 17972 gene locus_tag LOCUS_10310 gene rbfA 18370 17972 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_10310 21057 18400 gene locus_tag LOCUS_10320 gene infB 21057 18400 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025871401.1 protein_id gnl|my_center|LOCUS_10320 22598 21126 gene locus_tag LOCUS_10330 gene nusA 22598 21126 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_10330 23053 22625 gene locus_tag LOCUS_10340 gene rimP 23053 22625 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_10340 23320 25290 gene locus_tag LOCUS_10350 gene acs 23320 25290 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_10350 25342 26310 gene locus_tag LOCUS_10360 25342 26310 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_10360 26640 26428 gene locus_tag LOCUS_10370 26640 26428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 26909 28075 gene locus_tag LOCUS_10380 gene dinB 26909 28075 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810865.1 protein_id gnl|my_center|LOCUS_10380 28180 29253 gene locus_tag LOCUS_10390 28180 29253 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175517123.1 protein_id gnl|my_center|LOCUS_10390 29238 29801 gene locus_tag LOCUS_10400 29238 29801 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 protein_id gnl|my_center|LOCUS_10400 30006 30572 gene locus_tag LOCUS_10410 30006 30572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 31903 30704 gene locus_tag LOCUS_10420 31903 30704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125074.1 protein_id gnl|my_center|LOCUS_10420 33102 31900 gene locus_tag LOCUS_10430 33102 31900 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_10430 33769 33089 gene locus_tag LOCUS_10440 33769 33089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609100.1 protein_id gnl|my_center|LOCUS_10440 34920 33772 gene locus_tag LOCUS_10450 34920 33772 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384341.1 protein_id gnl|my_center|LOCUS_10450 35052 36686 gene locus_tag LOCUS_10460 35052 36686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 36783 37952 gene locus_tag LOCUS_10470 gene sucC 36783 37952 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812749.1 protein_id gnl|my_center|LOCUS_10470 37988 38863 gene locus_tag LOCUS_10480 gene sucD 37988 38863 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812748.1 protein_id gnl|my_center|LOCUS_10480 38900 39229 gene locus_tag LOCUS_10490 38900 39229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 39242 40696 gene locus_tag LOCUS_10500 gene dacB 39242 40696 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_10500 40822 41412 gene locus_tag LOCUS_10510 40822 41412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 42972 41500 gene locus_tag LOCUS_10520 gene trpE 42972 41500 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_10520 43814 43092 gene locus_tag LOCUS_10530 43814 43092 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_10530 44535 43858 gene locus_tag LOCUS_10540 gene rpe 44535 43858 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070664.1 protein_id gnl|my_center|LOCUS_10540 44679 45062 gene locus_tag LOCUS_10550 gene apaG 44679 45062 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_10550 45117 45821 gene locus_tag LOCUS_10560 45117 45821 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_10560 46249 45860 gene locus_tag LOCUS_10570 gene gloA 46249 45860 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_10570 46439 46251 gene locus_tag LOCUS_10580 46439 46251 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_10580 46492 47361 gene locus_tag LOCUS_10590 46492 47361 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_10590 47342 47974 gene locus_tag LOCUS_10600 gene thiE 47342 47974 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368782.1 protein_id gnl|my_center|LOCUS_10600 48024 49304 gene locus_tag LOCUS_10610 gene hemL 48024 49304 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_10610 50052 49396 gene locus_tag LOCUS_10620 50052 49396 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349084.1 protein_id gnl|my_center|LOCUS_10620 50190 50783 gene locus_tag LOCUS_10630 50190 50783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 50974 51073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 51109 51876 gene locus_tag LOCUS_10640 gene map 51109 51876 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_10640 51903 52637 gene locus_tag LOCUS_10650 gene rph 51903 52637 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_10650 52630 53232 gene locus_tag LOCUS_10660 gene rdgB 52630 53232 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930449.1 protein_id gnl|my_center|LOCUS_10660 53851 54126 gene locus_tag LOCUS_10670 53851 54126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 54391 54882 gene locus_tag LOCUS_10680 54391 54882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 55805 54966 gene locus_tag LOCUS_10690 gene fghA 55805 54966 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526232.1 protein_id gnl|my_center|LOCUS_10690 57073 55901 gene locus_tag LOCUS_10700 57073 55901 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064805.1 protein_id gnl|my_center|LOCUS_10700 55973 56072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 57579 57073 gene locus_tag LOCUS_10710 57579 57073 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_10710 57891 58148 gene locus_tag LOCUS_10720 57891 58148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence014 3 1115 gene locus_tag LOCUS_10730 3 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3175 1244 gene locus_tag LOCUS_10740 3175 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4212 3415 gene locus_tag LOCUS_10750 gene fliR 4212 3415 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_10750 4575 4303 gene locus_tag LOCUS_10760 gene fliQ 4575 4303 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211131.1 protein_id gnl|my_center|LOCUS_10760 5287 4589 gene locus_tag LOCUS_10770 gene fliP 5287 4589 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 protein_id gnl|my_center|LOCUS_10770 5864 5427 gene locus_tag LOCUS_10780 5864 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6425 5874 gene locus_tag LOCUS_10790 gene fliN 6425 5874 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_10790 7419 6442 gene locus_tag LOCUS_10800 gene fliM 7419 6442 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524547.1 protein_id gnl|my_center|LOCUS_10800 7914 7426 gene locus_tag LOCUS_10810 gene fliL 7914 7426 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039846.1 protein_id gnl|my_center|LOCUS_10810 9723 8197 gene locus_tag LOCUS_10820 9723 8197 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204776.1 protein_id gnl|my_center|LOCUS_10820 10271 9804 gene locus_tag LOCUS_10830 10271 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 11689 10286 gene locus_tag LOCUS_10840 gene fliI 11689 10286 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811843.1 protein_id gnl|my_center|LOCUS_10840 12404 11691 gene locus_tag LOCUS_10850 gene fliH 12404 11691 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930338.1 protein_id gnl|my_center|LOCUS_10850 13481 12486 gene locus_tag LOCUS_10860 gene fliG 13481 12486 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_10860 15159 13474 gene locus_tag LOCUS_10870 gene fliF 15159 13474 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_10870 15549 16739 gene locus_tag LOCUS_10880 gene fleS 15549 16739 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_10880 16744 18057 gene locus_tag LOCUS_10890 16744 18057 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457658.1 protein_id gnl|my_center|LOCUS_10890 18120 18443 gene locus_tag LOCUS_10900 gene fliE 18120 18443 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_10900 18779 19693 gene locus_tag LOCUS_10910 18779 19693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 20328 20053 gene locus_tag LOCUS_10920 20328 20053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 20975 22828 gene locus_tag LOCUS_10930 20975 22828 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_10930 24770 23052 gene locus_tag LOCUS_10940 24770 23052 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063733.1 protein_id gnl|my_center|LOCUS_10940 25326 24814 gene locus_tag LOCUS_10950 gene cheW 25326 24814 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_10950 25952 25416 gene locus_tag LOCUS_10960 25952 25416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 26351 27082 gene locus_tag LOCUS_10970 gene trmJ 26351 27082 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_10970 28016 27132 gene locus_tag LOCUS_10980 gene argB 28016 27132 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_10980 28610 28077 gene locus_tag LOCUS_10990 28610 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 28854 29432 gene locus_tag LOCUS_11000 28854 29432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 29453 30820 gene locus_tag LOCUS_11010 29453 30820 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_11010 31857 30964 gene locus_tag LOCUS_11020 gene cyoE 31857 30964 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522902.1 protein_id gnl|my_center|LOCUS_11020 32516 31935 gene locus_tag LOCUS_11030 32516 31935 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553808.1 protein_id gnl|my_center|LOCUS_11030 33207 32485 gene locus_tag LOCUS_11040 33207 32485 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_11040 34261 33404 gene locus_tag LOCUS_11050 34261 33404 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_11050 34505 34296 gene locus_tag LOCUS_11060 34505 34296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 35063 34518 gene locus_tag LOCUS_11070 35063 34518 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_11070 36768 35182 gene locus_tag LOCUS_11080 gene ctaD 36768 35182 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197996.1 protein_id gnl|my_center|LOCUS_11080 37539 36781 gene locus_tag LOCUS_11090 37539 36781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 38695 38066 gene locus_tag LOCUS_11100 38695 38066 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_11100 39032 39493 gene locus_tag LOCUS_11110 gene iscR 39032 39493 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_11110 39691 40032 gene locus_tag LOCUS_11120 gene iscA 39691 40032 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_11120 40146 41582 gene locus_tag LOCUS_11130 gene sufB 40146 41582 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_11130 41579 42373 gene locus_tag LOCUS_11140 gene sufC 41579 42373 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_11140 42370 43671 gene locus_tag LOCUS_11150 gene sufD 42370 43671 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_11150 43668 44933 gene locus_tag LOCUS_11160 43668 44933 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_11160 44933 45412 gene locus_tag LOCUS_11170 44933 45412 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_11170 45552 46112 gene locus_tag LOCUS_11180 45552 46112 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_11180 46766 46203 gene locus_tag LOCUS_11190 gene efp 46766 46203 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707002.1 protein_id gnl|my_center|LOCUS_11190 47899 46844 gene locus_tag LOCUS_11200 gene earP 47899 46844 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766776.1 protein_id gnl|my_center|LOCUS_11200 49361 48024 gene locus_tag LOCUS_11210 gene rimO 49361 48024 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704839.1 protein_id gnl|my_center|LOCUS_11210 49791 49567 gene locus_tag LOCUS_11220 49791 49567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 protein_id gnl|my_center|LOCUS_11220 50530 49829 gene locus_tag LOCUS_11230 50530 49829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 51520 50606 gene locus_tag LOCUS_11240 51520 50606 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_11240 51714 53135 gene locus_tag LOCUS_11250 51714 53135 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_11250 53215 53571 gene locus_tag LOCUS_11260 53215 53571 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_11260 53678 54484 gene locus_tag LOCUS_11270 53678 54484 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence015 1956 2031 gene locus_tag LOCUS_t00120 1956 2031 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2149 2222 gene locus_tag LOCUS_t00130 2149 2222 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3765 2299 gene locus_tag LOCUS_11280 3765 2299 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011342568.1 protein_id gnl|my_center|LOCUS_11280 4102 4191 gene locus_tag LOCUS_t00140 4102 4191 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4616 5164 gene locus_tag LOCUS_11290 gene ppa 4616 5164 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_11290 5600 5307 gene locus_tag LOCUS_11300 5600 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 6943 5705 gene locus_tag LOCUS_11310 6943 5705 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 protein_id gnl|my_center|LOCUS_11310 7372 8283 gene locus_tag LOCUS_11320 gene miaA 7372 8283 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814337.1 protein_id gnl|my_center|LOCUS_11320 8465 8800 gene locus_tag LOCUS_11330 8465 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 9068 9373 gene locus_tag LOCUS_11340 9068 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 9373 9828 gene locus_tag LOCUS_11350 9373 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 10635 9844 gene locus_tag LOCUS_11360 gene motD 10635 9844 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408098.1 protein_id gnl|my_center|LOCUS_11360 11443 10685 gene locus_tag LOCUS_11370 11443 10685 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436124.1 protein_id gnl|my_center|LOCUS_11370 12201 11485 gene locus_tag LOCUS_11380 12201 11485 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_11380 13094 12207 gene locus_tag LOCUS_11390 13094 12207 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073096.1 protein_id gnl|my_center|LOCUS_11390 14370 13096 gene locus_tag LOCUS_11400 14370 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 16448 14367 gene locus_tag LOCUS_11410 gene flhA 16448 14367 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_11410 17659 16517 gene locus_tag LOCUS_11420 gene flhB 17659 16517 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_11420 17890 20274 gene locus_tag LOCUS_11430 17890 20274 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_11430 20534 21238 gene locus_tag LOCUS_11440 20534 21238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 21351 23264 gene locus_tag LOCUS_11450 21351 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 23676 23452 gene locus_tag LOCUS_11460 23676 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11460 25547 23760 gene locus_tag LOCUS_11470 25547 23760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 26285 27796 gene locus_tag LOCUS_11480 26285 27796 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_11480 27793 29868 gene locus_tag LOCUS_11490 27793 29868 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_11490 29858 31465 gene locus_tag LOCUS_11500 29858 31465 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815895.1 protein_id gnl|my_center|LOCUS_11500 31466 32542 gene locus_tag LOCUS_11510 31466 32542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_11510 32539 33405 gene locus_tag LOCUS_11520 32539 33405 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_11520 34558 33443 gene locus_tag LOCUS_11530 gene ald 34558 33443 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958016.1 protein_id gnl|my_center|LOCUS_11530 35417 34677 gene locus_tag LOCUS_11540 35417 34677 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121677.1 protein_id gnl|my_center|LOCUS_11540 36077 35454 gene locus_tag LOCUS_11550 36077 35454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 36876 36091 gene locus_tag LOCUS_11560 36876 36091 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930598.1 protein_id gnl|my_center|LOCUS_11560 37394 36894 gene locus_tag LOCUS_11570 gene queD 37394 36894 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189793.1 protein_id gnl|my_center|LOCUS_11570 37551 38249 gene locus_tag LOCUS_11580 37551 38249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 38621 40333 gene locus_tag LOCUS_11590 38621 40333 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_11590 41494 40595 gene locus_tag LOCUS_11600 41494 40595 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389591.1 protein_id gnl|my_center|LOCUS_11600 41868 42893 gene locus_tag LOCUS_11610 gene lpxK 41868 42893 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693863.1 protein_id gnl|my_center|LOCUS_11610 44232 42901 gene locus_tag LOCUS_11620 gene hslU 44232 42901 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198316.1 protein_id gnl|my_center|LOCUS_11620 44877 44356 gene locus_tag LOCUS_11630 gene hslV 44877 44356 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_11630 45859 44966 gene locus_tag LOCUS_11640 gene xerC 45859 44966 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523080.1 protein_id gnl|my_center|LOCUS_11640 46553 45843 gene locus_tag LOCUS_11650 46553 45843 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931281.1 protein_id gnl|my_center|LOCUS_11650 47395 46568 gene locus_tag LOCUS_11660 gene dapF 47395 46568 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073967.1 protein_id gnl|my_center|LOCUS_11660 47917 47399 gene locus_tag LOCUS_11670 47917 47399 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202944.1 protein_id gnl|my_center|LOCUS_11670 48533 48105 gene locus_tag LOCUS_11680 48533 48105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 49503 48694 gene locus_tag LOCUS_11690 49503 48694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 49880 51565 gene locus_tag LOCUS_11700 49880 51565 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117790.1 protein_id gnl|my_center|LOCUS_11700 51708 52241 gene locus_tag LOCUS_11710 51708 52241 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_11710 52435 52510 gene locus_tag LOCUS_t00150 52435 52510 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 53390 52536 gene locus_tag LOCUS_11720 53390 52536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 53812 53465 gene locus_tag LOCUS_11730 53812 53465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 54368 53940 gene locus_tag LOCUS_11740 54368 53940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence016 243 79 gene locus_tag LOCUS_11750 243 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 824 243 gene locus_tag LOCUS_11760 824 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11760 3172 1040 gene locus_tag LOCUS_11770 3172 1040 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_11770 3703 5568 gene locus_tag LOCUS_11780 3703 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6051 7007 gene locus_tag LOCUS_11790 6051 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7485 9614 gene locus_tag LOCUS_11800 7485 9614 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266825.1 protein_id gnl|my_center|LOCUS_11800 9604 10425 gene locus_tag LOCUS_11810 9604 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 10445 11149 gene locus_tag LOCUS_11820 10445 11149 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_11820 11494 12102 gene locus_tag LOCUS_11830 11494 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 12131 13951 gene locus_tag LOCUS_11840 12131 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 13951 14691 gene locus_tag LOCUS_11850 13951 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 14698 15243 gene locus_tag LOCUS_11860 14698 15243 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_11860 15264 16739 gene locus_tag LOCUS_11870 15264 16739 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_11870 16952 16752 gene locus_tag LOCUS_11880 16952 16752 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040115264.1 protein_id gnl|my_center|LOCUS_11880 17646 17119 gene locus_tag LOCUS_11890 17646 17119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 17798 17956 gene locus_tag LOCUS_11900 17798 17956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 18017 18475 gene locus_tag LOCUS_11910 18017 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 18483 18824 gene locus_tag LOCUS_11920 gene hypA 18483 18824 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173942.1 protein_id gnl|my_center|LOCUS_11920 18838 19752 gene locus_tag LOCUS_11930 gene hypB 18838 19752 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337646.1 protein_id gnl|my_center|LOCUS_11930 19745 20866 gene locus_tag LOCUS_11940 19745 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 20904 21758 gene locus_tag LOCUS_11950 gene hslO 20904 21758 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_11950 22197 22595 gene locus_tag LOCUS_11960 22197 22595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 22604 24076 gene locus_tag LOCUS_11970 22604 24076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 26505 24064 gene locus_tag LOCUS_11980 26505 24064 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_11980 27049 28197 gene locus_tag LOCUS_11990 27049 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 28190 28837 gene locus_tag LOCUS_12000 28190 28837 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_12000 31273 28874 gene locus_tag LOCUS_12010 31273 28874 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_12010 31633 32682 gene locus_tag LOCUS_12020 gene fbaB 31633 32682 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129542.1 protein_id gnl|my_center|LOCUS_12020 38084 32904 gene locus_tag LOCUS_12030 38084 32904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 38731 40455 gene locus_tag LOCUS_12040 38731 40455 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_12040 45872 40728 gene locus_tag LOCUS_12050 45872 40728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 46703 48532 gene locus_tag LOCUS_12060 46703 48532 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_12060 48549 49235 gene locus_tag LOCUS_12070 48549 49235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 49831 49397 gene locus_tag LOCUS_12080 49831 49397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 50441 49941 gene locus_tag LOCUS_12090 50441 49941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence017 82 1131 gene locus_tag LOCUS_12100 gene pstS 82 1131 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_12100 1296 2258 gene locus_tag LOCUS_12110 gene pstC 1296 2258 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_12110 2268 3113 gene locus_tag LOCUS_12120 gene pstA 2268 3113 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_12120 3130 3894 gene locus_tag LOCUS_12130 gene pstB 3130 3894 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215562.1 protein_id gnl|my_center|LOCUS_12130 4113 4553 gene locus_tag LOCUS_12140 4113 4553 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188457.1 protein_id gnl|my_center|LOCUS_12140 4665 5453 gene locus_tag LOCUS_12150 4665 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 6004 7929 gene locus_tag LOCUS_12160 6004 7929 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_12160 7904 10024 gene locus_tag LOCUS_12170 7904 10024 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_12170 10034 10615 gene locus_tag LOCUS_12180 10034 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 11048 13003 gene locus_tag LOCUS_12190 11048 13003 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262962.1 protein_id gnl|my_center|LOCUS_12190 13666 14112 gene locus_tag LOCUS_12200 13666 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 14452 15333 gene locus_tag LOCUS_12210 14452 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 15924 15703 gene locus_tag LOCUS_12220 15924 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 16609 16241 gene locus_tag LOCUS_12230 16609 16241 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_12230 17046 16774 gene locus_tag LOCUS_12240 17046 16774 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_12240 17871 17137 gene locus_tag LOCUS_12250 gene flgA 17871 17137 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197247.1 protein_id gnl|my_center|LOCUS_12250 18066 18476 gene locus_tag LOCUS_12260 gene flgB 18066 18476 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160463.1 protein_id gnl|my_center|LOCUS_12260 18480 18884 gene locus_tag LOCUS_12270 gene flgC 18480 18884 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367329.1 protein_id gnl|my_center|LOCUS_12270 18896 19558 gene locus_tag LOCUS_12280 gene flgD 18896 19558 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020450.1 protein_id gnl|my_center|LOCUS_12280 19572 20831 gene locus_tag LOCUS_12290 gene flgE 19572 20831 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_12290 20901 21644 gene locus_tag LOCUS_12300 gene flgF 20901 21644 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_12300 21676 22458 gene locus_tag LOCUS_12310 gene flgG 21676 22458 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050114401.1 protein_id gnl|my_center|LOCUS_12310 22485 23195 gene locus_tag LOCUS_12320 gene flgH 22485 23195 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211116.1 protein_id gnl|my_center|LOCUS_12320 23221 24351 gene locus_tag LOCUS_12330 23221 24351 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817185.1 protein_id gnl|my_center|LOCUS_12330 24371 25381 gene locus_tag LOCUS_12340 gene flgJ 24371 25381 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 protein_id gnl|my_center|LOCUS_12340 25460 27373 gene locus_tag LOCUS_12350 gene flgK 25460 27373 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_12350 27409 28617 gene locus_tag LOCUS_12360 gene flgL 27409 28617 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946958.1 protein_id gnl|my_center|LOCUS_12360 29986 28673 gene locus_tag LOCUS_12370 gene purD 29986 28673 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_12370 31563 30004 gene locus_tag LOCUS_12380 gene purH 31563 30004 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527723.1 protein_id gnl|my_center|LOCUS_12380 31802 31560 gene locus_tag LOCUS_12390 31802 31560 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_12390 32709 31780 gene locus_tag LOCUS_12400 gene dusB 32709 31780 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_12400 34170 32998 gene locus_tag LOCUS_12410 34170 32998 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_12410 34515 35264 gene locus_tag LOCUS_12420 34515 35264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 35345 36025 gene locus_tag LOCUS_12430 35345 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 36681 37532 gene locus_tag LOCUS_12440 36681 37532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 37882 39687 gene locus_tag LOCUS_12450 37882 39687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 39832 41250 gene locus_tag LOCUS_12460 39832 41250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 44077 41369 gene locus_tag LOCUS_12470 44077 41369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 44771 46717 gene locus_tag LOCUS_12480 44771 46717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 47305 47006 gene locus_tag LOCUS_12490 47305 47006 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_12490 47543 47289 gene locus_tag LOCUS_12500 47543 47289 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010433119.1 protein_id gnl|my_center|LOCUS_12500 <48772 47844 gene locus_tag LOCUS_12510 <48772 47844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068670.1:Fic family protein >Feature sequence018 3501 1276 gene locus_tag LOCUS_12520 3501 1276 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_12520 3921 3583 gene locus_tag LOCUS_12530 3921 3583 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064795.1 protein_id gnl|my_center|LOCUS_12530 3986 4876 gene locus_tag LOCUS_12540 3986 4876 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_12540 5572 4886 gene locus_tag LOCUS_12550 5572 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 6928 5612 gene locus_tag LOCUS_12560 gene serS 6928 5612 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_12560 8274 6961 gene locus_tag LOCUS_12570 8274 6961 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_12570 8896 8267 gene locus_tag LOCUS_12580 gene lolA 8896 8267 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_12580 11254 8954 gene locus_tag LOCUS_12590 11254 8954 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186104.1 protein_id gnl|my_center|LOCUS_12590 12374 11442 gene locus_tag LOCUS_12600 12374 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 13279 13995 gene locus_tag LOCUS_12610 13279 13995 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530728.1 protein_id gnl|my_center|LOCUS_12610 13999 14760 gene locus_tag LOCUS_12620 13999 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 14760 15179 gene locus_tag LOCUS_12630 14760 15179 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194258.1 protein_id gnl|my_center|LOCUS_12630 15585 15791 gene locus_tag LOCUS_12640 15585 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 16161 18485 gene locus_tag LOCUS_12650 16161 18485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 18637 20889 gene locus_tag LOCUS_12660 18637 20889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 21246 21028 gene locus_tag LOCUS_12670 21246 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 21746 23200 gene locus_tag LOCUS_12680 21746 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 23980 23336 gene locus_tag LOCUS_12690 23980 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 24178 25758 gene locus_tag LOCUS_12700 24178 25758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 25917 26594 gene locus_tag LOCUS_12710 25917 26594 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556719.1 protein_id gnl|my_center|LOCUS_12710 26591 27889 gene locus_tag LOCUS_12720 26591 27889 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494096.1 protein_id gnl|my_center|LOCUS_12720 29151 27994 gene locus_tag LOCUS_12730 29151 27994 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_12730 29410 29186 gene locus_tag LOCUS_12740 29410 29186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 29985 29668 gene locus_tag LOCUS_12750 29985 29668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 30936 29989 gene locus_tag LOCUS_12760 30936 29989 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_12760 32265 31099 gene locus_tag LOCUS_12770 32265 31099 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_12770 32417 32779 gene locus_tag LOCUS_12780 32417 32779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 33998 32868 gene locus_tag LOCUS_12790 33998 32868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 34850 34038 gene locus_tag LOCUS_12800 34850 34038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 35423 34914 gene locus_tag LOCUS_12810 35423 34914 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045300.1 protein_id gnl|my_center|LOCUS_12810 35666 36586 gene locus_tag LOCUS_12820 35666 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 37221 36709 gene locus_tag LOCUS_12830 37221 36709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 37614 38324 gene locus_tag LOCUS_12840 37614 38324 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 protein_id gnl|my_center|LOCUS_12840 39347 38379 gene locus_tag LOCUS_12850 gene pip 39347 38379 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387845.1 protein_id gnl|my_center|LOCUS_12850 39498 39755 gene locus_tag LOCUS_12860 39498 39755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 39748 40917 gene locus_tag LOCUS_12870 39748 40917 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_12870 40979 41701 gene locus_tag LOCUS_12880 40979 41701 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_12880 41740 42165 gene locus_tag LOCUS_12890 41740 42165 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_12890 42191 42955 gene locus_tag LOCUS_12900 42191 42955 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence019 1512 52 gene locus_tag LOCUS_12910 gene lpdA 1512 52 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065168.1 protein_id gnl|my_center|LOCUS_12910 2647 1595 gene locus_tag LOCUS_12920 gene nagZ 2647 1595 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810348.1 protein_id gnl|my_center|LOCUS_12920 3027 2650 gene locus_tag LOCUS_12930 gene acpS 3027 2650 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_12930 3764 3024 gene locus_tag LOCUS_12940 gene pdxJ 3764 3024 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550143.1 protein_id gnl|my_center|LOCUS_12940 4684 3791 gene locus_tag LOCUS_12950 gene era 4684 3791 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_12950 5449 4742 gene locus_tag LOCUS_12960 5449 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5829 5461 gene locus_tag LOCUS_12970 5829 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6661 5858 gene locus_tag LOCUS_12980 gene lepB 6661 5858 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_12980 8561 6768 gene locus_tag LOCUS_12990 gene lepA 8561 6768 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_12990 8960 8667 gene locus_tag LOCUS_13000 8960 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 10368 8947 gene locus_tag LOCUS_13010 10368 8947 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363717.1 protein_id gnl|my_center|LOCUS_13010 11611 10625 gene locus_tag LOCUS_13020 11611 10625 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_13020 12165 11608 gene locus_tag LOCUS_13030 12165 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 12766 12167 gene locus_tag LOCUS_13040 gene rpoE 12766 12167 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_13040 13039 14637 gene locus_tag LOCUS_13050 gene nadB 13039 14637 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_13050 15614 14976 gene locus_tag LOCUS_13060 15614 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 16388 15630 gene locus_tag LOCUS_13070 16388 15630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 16949 17965 gene locus_tag LOCUS_13080 16949 17965 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_13080 18199 21747 gene locus_tag LOCUS_13090 gene dnaE 18199 21747 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 protein_id gnl|my_center|LOCUS_13090 21786 22544 gene locus_tag LOCUS_13100 21786 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 23848 22595 gene locus_tag LOCUS_13110 gene odhB 23848 22595 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065167.1 protein_id gnl|my_center|LOCUS_13110 26705 23862 gene locus_tag LOCUS_13120 26705 23862 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_13120 28031 26730 gene locus_tag LOCUS_13130 gene gltA 28031 26730 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188362.1 protein_id gnl|my_center|LOCUS_13130 28346 28113 gene locus_tag LOCUS_13140 28346 28113 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768810.1 protein_id gnl|my_center|LOCUS_13140 29038 28343 gene locus_tag LOCUS_13150 29038 28343 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_13150 29324 29518 gene locus_tag LOCUS_13160 29324 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 31171 29780 gene locus_tag LOCUS_13170 gene thrC 31171 29780 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_13170 32632 31319 gene locus_tag LOCUS_13180 32632 31319 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_13180 33953 32712 gene locus_tag LOCUS_13190 33953 32712 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_13190 34264 36270 gene locus_tag LOCUS_13200 34264 36270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 38590 36479 gene locus_tag LOCUS_13210 38590 36479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 41242 38801 gene locus_tag LOCUS_13220 41242 38801 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_13220 43139 41529 gene locus_tag LOCUS_13230 43139 41529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 43572 43294 gene locus_tag LOCUS_13240 43572 43294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence020 1541 390 gene locus_tag LOCUS_13250 gene ftsZ 1541 390 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 protein_id gnl|my_center|LOCUS_13250 2849 1611 gene locus_tag LOCUS_13260 gene ftsA 2849 1611 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_13260 3646 2870 gene locus_tag LOCUS_13270 3646 2870 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_13270 4556 3636 gene locus_tag LOCUS_13280 gene ddlB 4556 3636 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130042.1 protein_id gnl|my_center|LOCUS_13280 5476 4553 gene locus_tag LOCUS_13290 gene murB 5476 4553 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_13290 6989 5559 gene locus_tag LOCUS_13300 gene murC 6989 5559 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_13300 8070 6979 gene locus_tag LOCUS_13310 gene murG 8070 6979 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_13310 9227 8067 gene locus_tag LOCUS_13320 gene ftsW 9227 8067 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_13320 10645 9227 gene locus_tag LOCUS_13330 gene murD 10645 9227 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203798.1 protein_id gnl|my_center|LOCUS_13330 11727 10642 gene locus_tag LOCUS_13340 gene mraY 11727 10642 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_13340 13180 11801 gene locus_tag LOCUS_13350 13180 11801 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_13350 14730 13180 gene locus_tag LOCUS_13360 14730 13180 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705692.1 protein_id gnl|my_center|LOCUS_13360 16460 14736 gene locus_tag LOCUS_13370 16460 14736 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446492.1 protein_id gnl|my_center|LOCUS_13370 16759 16457 gene locus_tag LOCUS_13380 gene ftsL 16759 16457 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739040.1 protein_id gnl|my_center|LOCUS_13380 17715 16765 gene locus_tag LOCUS_13390 gene rsmH 17715 16765 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224919.1 protein_id gnl|my_center|LOCUS_13390 18177 17731 gene locus_tag LOCUS_13400 gene mraZ 18177 17731 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_13400 18553 19113 gene locus_tag LOCUS_13410 18553 19113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 19216 20367 gene locus_tag LOCUS_13420 gene nifS 19216 20367 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_13420 20385 21137 gene locus_tag LOCUS_13430 20385 21137 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_13430 21156 21623 gene locus_tag LOCUS_13440 21156 21623 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 protein_id gnl|my_center|LOCUS_13440 21646 22707 gene locus_tag LOCUS_13450 21646 22707 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_13450 22716 23450 gene locus_tag LOCUS_13460 gene gpmA 22716 23450 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_13460 23470 24015 gene locus_tag LOCUS_13470 23470 24015 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 protein_id gnl|my_center|LOCUS_13470 24372 25421 gene locus_tag LOCUS_13480 24372 25421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 26000 25611 gene locus_tag LOCUS_13490 26000 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 26130 27572 gene locus_tag LOCUS_13500 gene sbcB 26130 27572 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_13500 27733 29244 gene locus_tag LOCUS_13510 gene ilvA 27733 29244 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_13510 29405 31513 gene locus_tag LOCUS_13520 gene pilJ 29405 31513 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_13520 31553 36154 gene locus_tag LOCUS_13530 31553 36154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 36258 36518 gene locus_tag LOCUS_13540 36258 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 36630 36908 gene locus_tag LOCUS_13550 36630 36908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13550 38227 37007 gene locus_tag LOCUS_13560 38227 37007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 38610 38266 gene locus_tag LOCUS_13570 38610 38266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 39578 38637 gene locus_tag LOCUS_13580 gene cbbX 39578 38637 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532058.1 protein_id gnl|my_center|LOCUS_13580 40170 39736 gene locus_tag LOCUS_13590 40170 39736 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 protein_id gnl|my_center|LOCUS_13590 <41665 40191 gene locus_tag LOCUS_13600 <41665 40191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532056.1:ribulose-bisphosphate carboxylase large subunit >Feature sequence021 125 433 gene locus_tag LOCUS_13610 gene rpsJ 125 433 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_13610 521 1174 gene locus_tag LOCUS_13620 gene rplC 521 1174 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521904.1 protein_id gnl|my_center|LOCUS_13620 1209 1826 gene locus_tag LOCUS_13630 gene rplD 1209 1826 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215402.1 protein_id gnl|my_center|LOCUS_13630 1823 2158 gene locus_tag LOCUS_13640 gene rplW 1823 2158 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_13640 2158 2991 gene locus_tag LOCUS_13650 gene rplB 2158 2991 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_13650 2999 3280 gene locus_tag LOCUS_13660 gene rpsS 2999 3280 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690082.1 protein_id gnl|my_center|LOCUS_13660 3290 3649 gene locus_tag LOCUS_13670 gene rplV 3290 3649 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925688.1 protein_id gnl|my_center|LOCUS_13670 3651 4505 gene locus_tag LOCUS_13680 gene rpsC 3651 4505 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_13680 4489 4905 gene locus_tag LOCUS_13690 gene rplP 4489 4905 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_13690 4908 5108 gene locus_tag LOCUS_13700 gene rpmC 4908 5108 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199856.1 protein_id gnl|my_center|LOCUS_13700 5098 5361 gene locus_tag LOCUS_13710 gene rpsQ 5098 5361 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215433.1 protein_id gnl|my_center|LOCUS_13710 5492 5860 gene locus_tag LOCUS_13720 gene rplN 5492 5860 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215434.1 protein_id gnl|my_center|LOCUS_13720 5879 6196 gene locus_tag LOCUS_13730 gene rplX 5879 6196 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116820.1 protein_id gnl|my_center|LOCUS_13730 6214 6753 gene locus_tag LOCUS_13740 gene rplE 6214 6753 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_13740 6761 7066 gene locus_tag LOCUS_13750 gene rpsN 6761 7066 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 protein_id gnl|my_center|LOCUS_13750 7133 7528 gene locus_tag LOCUS_13760 gene rpsH 7133 7528 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215438.1 protein_id gnl|my_center|LOCUS_13760 7542 8075 gene locus_tag LOCUS_13770 gene rplF 7542 8075 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_13770 8087 8443 gene locus_tag LOCUS_13780 gene rplR 8087 8443 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771517.1 protein_id gnl|my_center|LOCUS_13780 8459 8995 gene locus_tag LOCUS_13790 gene rpsE 8459 8995 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215445.1 protein_id gnl|my_center|LOCUS_13790 8995 9180 gene locus_tag LOCUS_13800 gene rpmD 8995 9180 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202755.1 protein_id gnl|my_center|LOCUS_13800 9184 9615 gene locus_tag LOCUS_13810 gene rplO 9184 9615 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064755.1 protein_id gnl|my_center|LOCUS_13810 9633 10967 gene locus_tag LOCUS_13820 gene secY 9633 10967 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_13820 10988 11206 gene locus_tag LOCUS_13830 gene infA 10988 11206 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 protein_id gnl|my_center|LOCUS_13830 11404 11763 gene locus_tag LOCUS_13840 gene rpsM 11404 11763 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 protein_id gnl|my_center|LOCUS_13840 11806 12195 gene locus_tag LOCUS_13850 gene rpsK 11806 12195 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_13850 12206 12832 gene locus_tag LOCUS_13860 gene rpsD 12206 12832 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_13860 12871 13875 gene locus_tag LOCUS_13870 gene rpoA 12871 13875 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_13870 13862 14269 gene locus_tag LOCUS_13880 gene rplQ 13862 14269 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_13880 14359 15339 gene locus_tag LOCUS_13890 gene birA 14359 15339 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_13890 15346 16119 gene locus_tag LOCUS_13900 15346 16119 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_13900 16181 16771 gene locus_tag LOCUS_13910 gene yihA 16181 16771 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 protein_id gnl|my_center|LOCUS_13910 16982 17947 gene locus_tag LOCUS_13920 gene hemB 16982 17947 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027069842.1 protein_id gnl|my_center|LOCUS_13920 20330 18012 gene locus_tag LOCUS_13930 20330 18012 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_13930 20544 21647 gene locus_tag LOCUS_13940 20544 21647 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_13940 21644 22204 gene locus_tag LOCUS_13950 21644 22204 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765503.1 protein_id gnl|my_center|LOCUS_13950 22257 22868 gene locus_tag LOCUS_13960 gene pilO 22257 22868 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_13960 22872 23387 gene locus_tag LOCUS_13970 22872 23387 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946665.1 protein_id gnl|my_center|LOCUS_13970 23398 25509 gene locus_tag LOCUS_13980 23398 25509 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_13980 25981 25517 gene locus_tag LOCUS_13990 gene trmL 25981 25517 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 protein_id gnl|my_center|LOCUS_13990 26535 26059 gene locus_tag LOCUS_14000 26535 26059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 26888 27892 gene locus_tag LOCUS_14010 gene bioB 26888 27892 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_14010 27896 29062 gene locus_tag LOCUS_14020 gene bioF 27896 29062 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189736.1 protein_id gnl|my_center|LOCUS_14020 29059 29832 gene locus_tag LOCUS_14030 gene bioH 29059 29832 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_14030 29807 30682 gene locus_tag LOCUS_14040 29807 30682 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_14040 30696 31373 gene locus_tag LOCUS_14050 gene bioD 30696 31373 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_14050 31519 32157 gene locus_tag LOCUS_14060 31519 32157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 32158 32257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 32425 33180 gene locus_tag LOCUS_14070 32425 33180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 33213 33794 gene locus_tag LOCUS_14080 33213 33794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905778.1 protein_id gnl|my_center|LOCUS_14080 33740 33955 gene locus_tag LOCUS_14090 33740 33955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 33981 34463 gene locus_tag LOCUS_14100 33981 34463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 35014 34622 gene locus_tag LOCUS_14110 35014 34622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 35448 35260 gene locus_tag LOCUS_14120 35448 35260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 36980 35721 gene locus_tag LOCUS_14130 36980 35721 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_14130 37314 38570 gene locus_tag LOCUS_14140 37314 38570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 38649 39071 gene locus_tag LOCUS_14150 38649 39071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14150 >Feature sequence022 337 56 gene locus_tag LOCUS_14160 337 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3546 1132 gene locus_tag LOCUS_14170 gene lon 3546 1132 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_14170 5007 3730 gene locus_tag LOCUS_14180 gene clpX 5007 3730 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_14180 5719 5078 gene locus_tag LOCUS_14190 gene clpP 5719 5078 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095857.1 protein_id gnl|my_center|LOCUS_14190 7031 5721 gene locus_tag LOCUS_14200 gene tig 7031 5721 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002226314.1 protein_id gnl|my_center|LOCUS_14200 7216 7132 gene locus_tag LOCUS_t00160 7216 7132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8028 7270 gene locus_tag LOCUS_14210 8028 7270 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_14210 9837 8188 gene locus_tag LOCUS_14220 gene groL 9837 8188 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185913.1 protein_id gnl|my_center|LOCUS_14220 10184 9894 gene locus_tag LOCUS_14230 gene groES 10184 9894 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235240.1 protein_id gnl|my_center|LOCUS_14230 11748 10654 gene locus_tag LOCUS_14240 gene mnmA 11748 10654 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_14240 12193 11738 gene locus_tag LOCUS_14250 12193 11738 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_14250 12576 13208 gene locus_tag LOCUS_14260 12576 13208 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931872.1 protein_id gnl|my_center|LOCUS_14260 13298 15946 gene locus_tag LOCUS_14270 13298 15946 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_14270 17646 16081 gene locus_tag LOCUS_14280 17646 16081 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_14280 18166 17783 gene locus_tag LOCUS_14290 18166 17783 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_14290 18303 19013 gene locus_tag LOCUS_14300 18303 19013 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_14300 20690 19059 gene locus_tag LOCUS_14310 20690 19059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966542.1 protein_id gnl|my_center|LOCUS_14310 22078 21080 gene locus_tag LOCUS_14320 22078 21080 CDS product ribonuclease T2 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443921.1 protein_id gnl|my_center|LOCUS_14320 22498 22313 gene locus_tag LOCUS_14330 22498 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 24558 22414 gene locus_tag LOCUS_14340 24558 22414 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_14340 25543 24581 gene locus_tag LOCUS_14350 25543 24581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 26592 25546 gene locus_tag LOCUS_14360 26592 25546 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812925.1 protein_id gnl|my_center|LOCUS_14360 27322 26633 gene locus_tag LOCUS_14370 27322 26633 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_14370 28022 27315 gene locus_tag LOCUS_14380 28022 27315 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142307.1 protein_id gnl|my_center|LOCUS_14380 28234 30348 gene locus_tag LOCUS_14390 gene ovoA 28234 30348 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_14390 30345 31514 gene locus_tag LOCUS_14400 30345 31514 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_14400 32226 32831 gene locus_tag LOCUS_14410 32226 32831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 33526 34017 gene locus_tag LOCUS_14420 33526 34017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 34364 34188 gene locus_tag LOCUS_14430 34364 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 36516 34711 gene locus_tag LOCUS_14440 gene recQ 36516 34711 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_14440 36537 36770 gene locus_tag LOCUS_14450 36537 36770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 36912 38321 gene locus_tag LOCUS_14460 gene glnA 36912 38321 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 protein_id gnl|my_center|LOCUS_14460 38526 39008 gene locus_tag LOCUS_14470 38526 39008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 39048 39506 gene locus_tag LOCUS_14480 39048 39506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 40282 39509 gene locus_tag LOCUS_14490 gene xth 40282 39509 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_14490 40990 40283 gene locus_tag LOCUS_14500 40990 40283 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence023 694 2166 gene locus_tag LOCUS_14510 694 2166 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_14510 2177 5449 gene locus_tag LOCUS_14520 2177 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5451 7019 gene locus_tag LOCUS_14530 5451 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 7027 8610 gene locus_tag LOCUS_14540 7027 8610 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142531.1 protein_id gnl|my_center|LOCUS_14540 8612 10117 gene locus_tag LOCUS_14550 8612 10117 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396789.1 protein_id gnl|my_center|LOCUS_14550 10155 11237 gene locus_tag LOCUS_14560 10155 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 11411 12793 gene locus_tag LOCUS_14570 11411 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 13278 12826 gene locus_tag LOCUS_14580 gene nudB 13278 12826 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 protein_id gnl|my_center|LOCUS_14580 15079 13298 gene locus_tag LOCUS_14590 gene aspS 15079 13298 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 protein_id gnl|my_center|LOCUS_14590 15514 15218 gene locus_tag LOCUS_14600 15514 15218 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929971.1 protein_id gnl|my_center|LOCUS_14600 16586 15882 gene locus_tag LOCUS_14610 16586 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 17096 18034 gene locus_tag LOCUS_14620 17096 18034 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_14620 18519 18028 gene locus_tag LOCUS_14630 18519 18028 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_14630 19279 18704 gene locus_tag LOCUS_14640 19279 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14640 19747 19280 gene locus_tag LOCUS_14650 19747 19280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 21934 19991 gene locus_tag LOCUS_14660 21934 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 22540 22800 gene locus_tag LOCUS_14670 22540 22800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 22963 23748 gene locus_tag LOCUS_14680 22963 23748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 25848 24286 gene locus_tag LOCUS_14690 gene guaA 25848 24286 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_14690 27324 25861 gene locus_tag LOCUS_14700 gene guaB 27324 25861 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213540.1 protein_id gnl|my_center|LOCUS_14700 27496 27945 gene locus_tag LOCUS_14710 27496 27945 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_14710 27966 29213 gene locus_tag LOCUS_14720 27966 29213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 31215 29248 gene locus_tag LOCUS_14730 31215 29248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 33523 31835 gene locus_tag LOCUS_14740 33523 31835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 36446 34332 gene locus_tag LOCUS_14750 36446 34332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 37428 36586 gene locus_tag LOCUS_14760 37428 36586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 39099 37927 gene locus_tag LOCUS_14770 39099 37927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence024 183 1409 gene locus_tag LOCUS_14780 gene argJ 183 1409 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549958.1 protein_id gnl|my_center|LOCUS_14780 1421 2293 gene locus_tag LOCUS_14790 1421 2293 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_14790 2294 3274 gene locus_tag LOCUS_14800 2294 3274 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_14800 3633 4217 gene locus_tag LOCUS_14810 3633 4217 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_14810 4214 4780 gene locus_tag LOCUS_14820 4214 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 5117 7414 gene locus_tag LOCUS_14830 5117 7414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_14830 7411 7884 gene locus_tag LOCUS_14840 7411 7884 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_14840 7970 10300 gene locus_tag LOCUS_14850 gene cphA 7970 10300 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_14850 10297 12867 gene locus_tag LOCUS_14860 gene cphA 10297 12867 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_14860 13238 14719 gene locus_tag LOCUS_14870 13238 14719 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_14870 15936 15013 gene locus_tag LOCUS_14880 15936 15013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 16071 16769 gene locus_tag LOCUS_14890 gene aat 16071 16769 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_14890 16781 17488 gene locus_tag LOCUS_14900 16781 17488 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521637.1 protein_id gnl|my_center|LOCUS_14900 17529 18551 gene locus_tag LOCUS_14910 17529 18551 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207200.1 protein_id gnl|my_center|LOCUS_14910 18580 19260 gene locus_tag LOCUS_14920 gene rsxB 18580 19260 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813855.1 protein_id gnl|my_center|LOCUS_14920 19247 19879 gene locus_tag LOCUS_14930 gene nth 19247 19879 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_14930 19895 20332 gene locus_tag LOCUS_14940 19895 20332 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_14940 20739 20407 gene locus_tag LOCUS_14950 20739 20407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14950 21090 20767 gene locus_tag LOCUS_14960 21090 20767 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814065.1 protein_id gnl|my_center|LOCUS_14960 23131 21206 gene locus_tag LOCUS_14970 23131 21206 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553869.1 protein_id gnl|my_center|LOCUS_14970 23743 23318 gene locus_tag LOCUS_14980 23743 23318 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_14980 24630 23986 gene locus_tag LOCUS_14990 24630 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 25612 24911 gene locus_tag LOCUS_15000 25612 24911 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_15000 26343 25615 gene locus_tag LOCUS_15010 26343 25615 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_15010 26879 26340 gene locus_tag LOCUS_15020 gene gmhB 26879 26340 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064982.1 protein_id gnl|my_center|LOCUS_15020 29049 26881 gene locus_tag LOCUS_15030 gene glyS 29049 26881 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_15030 29969 29046 gene locus_tag LOCUS_15040 gene glyQ 29969 29046 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_15040 31355 30012 gene locus_tag LOCUS_15050 gene lnt 31355 30012 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687663.1 protein_id gnl|my_center|LOCUS_15050 31904 33640 gene locus_tag LOCUS_15060 31904 33640 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_15060 33888 34655 gene locus_tag LOCUS_15070 gene minC 33888 34655 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_15070 34679 35491 gene locus_tag LOCUS_15080 gene minD 34679 35491 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 protein_id gnl|my_center|LOCUS_15080 35488 35766 gene locus_tag LOCUS_15090 gene minE 35488 35766 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_15090 35942 36496 gene locus_tag LOCUS_15100 gene lolB 35942 36496 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_15100 36526 37368 gene locus_tag LOCUS_15110 gene ispE 36526 37368 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266731.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence025 2274 133 gene locus_tag LOCUS_15120 2274 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2491 2267 gene locus_tag LOCUS_15130 2491 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 5304 3190 gene locus_tag LOCUS_15140 5304 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 5845 5633 gene locus_tag LOCUS_15150 5845 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 8266 5873 gene locus_tag LOCUS_15160 8266 5873 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_15160 8998 8372 gene locus_tag LOCUS_15170 8998 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 9914 9120 gene locus_tag LOCUS_15180 gene tatC 9914 9120 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199900.1 protein_id gnl|my_center|LOCUS_15180 10381 9986 gene locus_tag LOCUS_15190 10381 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 10853 10470 gene locus_tag LOCUS_15200 10853 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 11235 10885 gene locus_tag LOCUS_15210 11235 10885 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_15210 11565 11239 gene locus_tag LOCUS_15220 11565 11239 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687491.1 protein_id gnl|my_center|LOCUS_15220 11951 11562 gene locus_tag LOCUS_15230 gene hisI 11951 11562 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_15230 12773 12000 gene locus_tag LOCUS_15240 gene hisF 12773 12000 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_15240 13595 12840 gene locus_tag LOCUS_15250 gene hisA 13595 12840 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_15250 14294 13629 gene locus_tag LOCUS_15260 gene hisH 14294 13629 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_15260 14908 14321 gene locus_tag LOCUS_15270 gene hisB 14908 14321 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815795.1 protein_id gnl|my_center|LOCUS_15270 16036 14951 gene locus_tag LOCUS_15280 gene hisC 16036 14951 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_15280 17400 16207 gene locus_tag LOCUS_15290 17400 16207 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038719.1 protein_id gnl|my_center|LOCUS_15290 17487 18227 gene locus_tag LOCUS_15300 17487 18227 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_15300 18586 18248 gene locus_tag LOCUS_15310 18586 18248 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 protein_id gnl|my_center|LOCUS_15310 19697 18573 gene locus_tag LOCUS_15320 19697 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 19708 20565 gene locus_tag LOCUS_15330 gene rsmI 19708 20565 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210149.1 protein_id gnl|my_center|LOCUS_15330 20615 21652 gene locus_tag LOCUS_15340 gene pyrC 20615 21652 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_15340 22064 21696 gene locus_tag LOCUS_15350 22064 21696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 22169 22960 gene locus_tag LOCUS_15360 22169 22960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 23079 23876 gene locus_tag LOCUS_15370 23079 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15370 23876 24466 gene locus_tag LOCUS_15380 23876 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15380 24459 25556 gene locus_tag LOCUS_15390 gene amrS 24459 25556 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_15390 25553 26182 gene locus_tag LOCUS_15400 25553 26182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 28461 26287 gene locus_tag LOCUS_15410 28461 26287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 29469 28555 gene locus_tag LOCUS_15420 29469 28555 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_15420 30061 29612 gene locus_tag LOCUS_15430 30061 29612 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204701.1 protein_id gnl|my_center|LOCUS_15430 30392 30111 gene locus_tag LOCUS_15440 30392 30111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 33052 30677 gene locus_tag LOCUS_15450 gene lon 33052 30677 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_15450 33650 33201 gene locus_tag LOCUS_15460 33650 33201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 34214 33711 gene locus_tag LOCUS_15470 34214 33711 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_15470 34544 34320 gene locus_tag LOCUS_15480 34544 34320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 34889 36673 gene locus_tag LOCUS_15490 gene polX 34889 36673 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_15490 36740 37366 gene locus_tag LOCUS_15500 36740 37366 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence026 392 604 gene locus_tag LOCUS_15510 392 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1624 764 gene locus_tag LOCUS_15520 1624 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2325 1756 gene locus_tag LOCUS_15530 2325 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3891 2362 gene locus_tag LOCUS_15540 3891 2362 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_15540 4136 5143 gene locus_tag LOCUS_15550 4136 5143 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_15550 5266 7821 gene locus_tag LOCUS_15560 5266 7821 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_15560 8241 7855 gene locus_tag LOCUS_15570 8241 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 8501 8881 gene locus_tag LOCUS_15580 8501 8881 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_15580 10705 9287 gene locus_tag LOCUS_15590 10705 9287 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_15590 13120 11027 gene locus_tag LOCUS_15600 13120 11027 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_15600 15447 13366 gene locus_tag LOCUS_15610 gene glgB 15447 13366 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_15610 15694 17013 gene locus_tag LOCUS_15620 gene glgC 15694 17013 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_15620 17047 18747 gene locus_tag LOCUS_15630 17047 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 18845 20851 gene locus_tag LOCUS_15640 18845 20851 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_15640 21025 22602 gene locus_tag LOCUS_15650 gene pgi 21025 22602 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_15650 22613 24088 gene locus_tag LOCUS_15660 gene glgA 22613 24088 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089199.1 protein_id gnl|my_center|LOCUS_15660 24614 24967 gene locus_tag LOCUS_15670 24614 24967 CDS product CZB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918730.1 protein_id gnl|my_center|LOCUS_15670 28960 25250 gene locus_tag LOCUS_15680 gene metH 28960 25250 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_15680 29909 29061 gene locus_tag LOCUS_15690 29909 29061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 30938 30021 gene locus_tag LOCUS_15700 gene prmA 30938 30021 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223022.1 protein_id gnl|my_center|LOCUS_15700 32392 31037 gene locus_tag LOCUS_15710 gene accC 32392 31037 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522043.1 protein_id gnl|my_center|LOCUS_15710 32946 32461 gene locus_tag LOCUS_15720 gene accB 32946 32461 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_15720 33641 33186 gene locus_tag LOCUS_15730 gene aroQ 33641 33186 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814953.1 protein_id gnl|my_center|LOCUS_15730 33868 33943 gene locus_tag LOCUS_t00170 33868 33943 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35379 34495 gene locus_tag LOCUS_15740 35379 34495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 35846 35472 gene locus_tag LOCUS_15750 35846 35472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 36310 35843 gene locus_tag LOCUS_15760 36310 35843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence027 243 875 gene locus_tag LOCUS_15770 243 875 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090916.1 protein_id gnl|my_center|LOCUS_15770 894 1214 gene locus_tag LOCUS_15780 894 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1323 1559 gene locus_tag LOCUS_15790 1323 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1556 2605 gene locus_tag LOCUS_15800 1556 2605 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_15800 2678 2944 gene locus_tag LOCUS_15810 2678 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15810 3058 3795 gene locus_tag LOCUS_15820 3058 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15820 5652 4327 gene locus_tag LOCUS_15830 5652 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 5724 5914 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgcctaaactgtcaccttt 6728 6267 gene locus_tag LOCUS_15840 6728 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 7456 6725 gene locus_tag LOCUS_15850 7456 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 7827 7456 gene locus_tag LOCUS_15860 7827 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 8153 8536 gene locus_tag LOCUS_15870 gene traJ 8153 8536 CDS product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039733.1 protein_id gnl|my_center|LOCUS_15870 8690 9793 gene locus_tag LOCUS_15880 8690 9793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 9793 11655 gene locus_tag LOCUS_15890 9793 11655 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 protein_id gnl|my_center|LOCUS_15890 11652 12224 gene locus_tag LOCUS_15900 gene traF 11652 12224 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970269.1 protein_id gnl|my_center|LOCUS_15900 12238 12441 gene locus_tag LOCUS_15910 12238 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 12428 14749 gene locus_tag LOCUS_15920 12428 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 14791 14970 gene locus_tag LOCUS_15930 14791 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 15133 15543 gene locus_tag LOCUS_15940 15133 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 15632 16249 gene locus_tag LOCUS_15950 gene umuD 15632 16249 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069871.1 protein_id gnl|my_center|LOCUS_15950 16314 17588 gene locus_tag LOCUS_15960 gene umuC 16314 17588 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457628.1 protein_id gnl|my_center|LOCUS_15960 17673 18539 gene locus_tag LOCUS_15970 17673 18539 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083635.1 protein_id gnl|my_center|LOCUS_15970 18744 20456 gene locus_tag LOCUS_15980 18744 20456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 20656 22260 gene locus_tag LOCUS_15990 20656 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 25019 22332 gene locus_tag LOCUS_16000 25019 22332 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081335.1 protein_id gnl|my_center|LOCUS_16000 25195 25016 gene locus_tag LOCUS_16010 25195 25016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 25707 25192 gene locus_tag LOCUS_16020 25707 25192 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_16020 27493 25832 gene locus_tag LOCUS_16030 27493 25832 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105162.1 protein_id gnl|my_center|LOCUS_16030 29724 27490 gene locus_tag LOCUS_16040 29724 27490 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091102695.1 protein_id gnl|my_center|LOCUS_16040 31061 29784 gene locus_tag LOCUS_16050 31061 29784 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_16050 33946 31091 gene locus_tag LOCUS_16060 33946 31091 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_16060 34352 35188 gene locus_tag LOCUS_16070 34352 35188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 35222 36094 gene locus_tag LOCUS_16080 35222 36094 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480548.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence028 237 611 gene locus_tag LOCUS_16090 237 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 4030 854 gene locus_tag LOCUS_16100 4030 854 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524131.1 protein_id gnl|my_center|LOCUS_16100 5553 4060 gene locus_tag LOCUS_16110 5553 4060 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109532.1 protein_id gnl|my_center|LOCUS_16110 6953 5586 gene locus_tag LOCUS_16120 6953 5586 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_16120 7516 7130 gene locus_tag LOCUS_16130 7516 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 8211 7615 gene locus_tag LOCUS_16140 8211 7615 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925884.1 protein_id gnl|my_center|LOCUS_16140 8268 8783 gene locus_tag LOCUS_16150 8268 8783 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951421.1 protein_id gnl|my_center|LOCUS_16150 8802 8981 gene locus_tag LOCUS_16160 gene rpmF 8802 8981 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_16160 9048 10070 gene locus_tag LOCUS_16170 gene plsX 9048 10070 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_16170 10078 11034 gene locus_tag LOCUS_16180 10078 11034 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_16180 11038 11976 gene locus_tag LOCUS_16190 gene fabD 11038 11976 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193828.1 protein_id gnl|my_center|LOCUS_16190 12030 12773 gene locus_tag LOCUS_16200 gene fabG 12030 12773 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097120.1 protein_id gnl|my_center|LOCUS_16200 12963 13199 gene locus_tag LOCUS_16210 gene acpP 12963 13199 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065130.1 protein_id gnl|my_center|LOCUS_16210 13235 14476 gene locus_tag LOCUS_16220 gene fabF 13235 14476 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_16220 14494 15486 gene locus_tag LOCUS_16230 gene mltG 14494 15486 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_16230 15534 18128 gene locus_tag LOCUS_16240 15534 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 18559 18143 gene locus_tag LOCUS_16250 18559 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 19404 18601 gene locus_tag LOCUS_16260 19404 18601 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_16260 20224 19478 gene locus_tag LOCUS_16270 gene pgeF 20224 19478 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_16270 20653 21816 gene locus_tag LOCUS_16280 20653 21816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 21924 22604 gene locus_tag LOCUS_16290 21924 22604 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_16290 22601 24193 gene locus_tag LOCUS_16300 22601 24193 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_16300 24166 25593 gene locus_tag LOCUS_16310 gene glpK 24166 25593 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874407.1 protein_id gnl|my_center|LOCUS_16310 25981 26574 gene locus_tag LOCUS_16320 25981 26574 CDS product protoglobin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256689.1 protein_id gnl|my_center|LOCUS_16320 27432 27713 gene locus_tag LOCUS_16330 27432 27713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 28466 27990 gene locus_tag LOCUS_16340 28466 27990 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_16340 30405 28765 gene locus_tag LOCUS_16350 30405 28765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 33273 30889 gene locus_tag LOCUS_16360 33273 30889 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929425.1 protein_id gnl|my_center|LOCUS_16360 34378 33425 gene locus_tag LOCUS_16370 34378 33425 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019084282.1 protein_id gnl|my_center|LOCUS_16370 34919 34413 gene locus_tag LOCUS_16380 gene fpvI 34919 34413 CDS product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence029 594 187 gene locus_tag LOCUS_16390 594 187 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244191.1 protein_id gnl|my_center|LOCUS_16390 2051 687 gene locus_tag LOCUS_16400 2051 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3796 2522 gene locus_tag LOCUS_16410 3796 2522 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380966.1 protein_id gnl|my_center|LOCUS_16410 4466 3777 gene locus_tag LOCUS_16420 4466 3777 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 protein_id gnl|my_center|LOCUS_16420 5571 4510 gene locus_tag LOCUS_16430 gene hemE 5571 4510 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706638.1 protein_id gnl|my_center|LOCUS_16430 6862 5741 gene locus_tag LOCUS_16440 6862 5741 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521919.1 protein_id gnl|my_center|LOCUS_16440 8561 6855 gene locus_tag LOCUS_16450 8561 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 11788 8630 gene locus_tag LOCUS_16460 11788 8630 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_16460 12936 11800 gene locus_tag LOCUS_16470 12936 11800 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_16470 13378 15093 gene locus_tag LOCUS_16480 13378 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 15086 16048 gene locus_tag LOCUS_16490 15086 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 16655 16191 gene locus_tag LOCUS_16500 16655 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 17033 16695 gene locus_tag LOCUS_16510 17033 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 17449 18342 gene locus_tag LOCUS_16520 gene mak 17449 18342 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816918.1 protein_id gnl|my_center|LOCUS_16520 19977 18451 gene locus_tag LOCUS_16530 19977 18451 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_16530 20063 24079 gene locus_tag LOCUS_16540 gene purL 20063 24079 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103562.1 protein_id gnl|my_center|LOCUS_16540 24139 25368 gene locus_tag LOCUS_16550 24139 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 25387 27420 gene locus_tag LOCUS_16560 25387 27420 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943762.1 protein_id gnl|my_center|LOCUS_16560 27329 27541 gene locus_tag LOCUS_16570 27329 27541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 27538 27753 gene locus_tag LOCUS_16580 27538 27753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16580 28539 27904 gene locus_tag LOCUS_16590 28539 27904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 29543 28617 gene locus_tag LOCUS_16600 29543 28617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 29966 29565 gene locus_tag LOCUS_16610 29966 29565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 30456 31739 gene locus_tag LOCUS_16620 30456 31739 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_16620 32146 33474 gene locus_tag LOCUS_16630 32146 33474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 34218 33733 gene locus_tag LOCUS_16640 34218 33733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence030 1536 472 gene locus_tag LOCUS_16650 gene fba 1536 472 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190157.1 protein_id gnl|my_center|LOCUS_16650 3123 1672 gene locus_tag LOCUS_16660 gene pyk 3123 1672 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_16660 4324 3146 gene locus_tag LOCUS_16670 4324 3146 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704731.1 protein_id gnl|my_center|LOCUS_16670 5467 4469 gene locus_tag LOCUS_16680 gene gap 5467 4469 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_16680 7556 5541 gene locus_tag LOCUS_16690 gene tkt 7556 5541 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 protein_id gnl|my_center|LOCUS_16690 8985 7720 gene locus_tag LOCUS_16700 8985 7720 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 protein_id gnl|my_center|LOCUS_16700 11322 9151 gene locus_tag LOCUS_16710 11322 9151 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_16710 11924 11322 gene locus_tag LOCUS_16720 11924 11322 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_16720 13206 11929 gene locus_tag LOCUS_16730 gene rsmB 13206 11929 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224763.1 protein_id gnl|my_center|LOCUS_16730 14155 13199 gene locus_tag LOCUS_16740 gene fmt 14155 13199 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958586.1 protein_id gnl|my_center|LOCUS_16740 14790 14287 gene locus_tag LOCUS_16750 gene def 14790 14287 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201745.1 protein_id gnl|my_center|LOCUS_16750 14886 15920 gene locus_tag LOCUS_16760 14886 15920 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_16760 15939 17039 gene locus_tag LOCUS_16770 gene dprA 15939 17039 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_16770 17107 17565 gene locus_tag LOCUS_16780 17107 17565 CDS product DUF494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040781.1 protein_id gnl|my_center|LOCUS_16780 17730 20258 gene locus_tag LOCUS_16790 17730 20258 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200734.1 protein_id gnl|my_center|LOCUS_16790 20617 20369 gene locus_tag LOCUS_16800 20617 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 20904 22226 gene locus_tag LOCUS_16810 20904 22226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 22267 22947 gene locus_tag LOCUS_16820 gene cmK 22267 22947 CDS product cytidylate kinase CmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189396.1 protein_id gnl|my_center|LOCUS_16820 23073 24785 gene locus_tag LOCUS_16830 gene rpsA 23073 24785 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_16830 24795 25085 gene locus_tag LOCUS_16840 24795 25085 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_16840 25403 25502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26168 25929 gene locus_tag LOCUS_16850 26168 25929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 28899 26368 gene locus_tag LOCUS_16860 gene rsaA 28899 26368 CDS product S-layer protein RsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265658.1 protein_id gnl|my_center|LOCUS_16860 28991 29090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29695 30942 gene locus_tag LOCUS_16870 29695 30942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 30947 32776 gene locus_tag LOCUS_16880 30947 32776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence031 241 167 gene locus_tag LOCUS_t00180 241 167 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 995 1843 gene locus_tag LOCUS_16890 995 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1924 3336 gene locus_tag LOCUS_16900 gene leuC 1924 3336 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_16900 3343 3981 gene locus_tag LOCUS_16910 gene leuD 3343 3981 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_16910 4007 5068 gene locus_tag LOCUS_16920 gene leuB 4007 5068 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_16920 5227 6339 gene locus_tag LOCUS_16930 gene asd 5227 6339 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_16930 6498 8990 gene locus_tag LOCUS_16940 gene fimV 6498 8990 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_16940 9052 9849 gene locus_tag LOCUS_16950 gene truA 9052 9849 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_16950 9877 10494 gene locus_tag LOCUS_16960 9877 10494 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_16960 10491 11690 gene locus_tag LOCUS_16970 gene trpB 10491 11690 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_16970 11751 12632 gene locus_tag LOCUS_16980 gene trpA 11751 12632 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_16980 12657 13526 gene locus_tag LOCUS_16990 gene accD 12657 13526 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_16990 13999 14499 gene locus_tag LOCUS_17000 13999 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 14724 15149 gene locus_tag LOCUS_17010 gene ndk 14724 15149 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_17010 15169 16260 gene locus_tag LOCUS_17020 gene rlmN 15169 16260 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_17020 16349 17050 gene locus_tag LOCUS_17030 gene pilW 16349 17050 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688950.1 protein_id gnl|my_center|LOCUS_17030 17050 18252 gene locus_tag LOCUS_17040 17050 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 18291 19529 gene locus_tag LOCUS_17050 gene ispG 18291 19529 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_17050 19529 20806 gene locus_tag LOCUS_17060 gene hisS 19529 20806 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_17060 20883 21521 gene locus_tag LOCUS_17070 20883 21521 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810700.1 protein_id gnl|my_center|LOCUS_17070 21530 22756 gene locus_tag LOCUS_17080 gene bamB 21530 22756 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193323.1 protein_id gnl|my_center|LOCUS_17080 22871 24268 gene locus_tag LOCUS_17090 gene der 22871 24268 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_17090 28180 24338 gene locus_tag LOCUS_17100 28180 24338 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204931.1 protein_id gnl|my_center|LOCUS_17100 29905 28190 gene locus_tag LOCUS_17110 29905 28190 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_17110 30143 30814 gene locus_tag LOCUS_17120 30143 30814 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_17120 30850 31038 gene locus_tag LOCUS_17130 30850 31038 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123298.1 protein_id gnl|my_center|LOCUS_17130 31044 32861 gene locus_tag LOCUS_17140 gene uvrC 31044 32861 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930726.1 protein_id gnl|my_center|LOCUS_17140 32964 33548 gene locus_tag LOCUS_17150 gene pgsA 32964 33548 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192722.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence032 479 1066 gene locus_tag LOCUS_17160 479 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1219 1683 gene locus_tag LOCUS_17170 1219 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2097 2834 gene locus_tag LOCUS_17180 2097 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3384 3483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3654 4091 gene locus_tag LOCUS_17190 3654 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 4133 4360 gene locus_tag LOCUS_17200 4133 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 4411 7113 gene locus_tag LOCUS_17210 4411 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 7318 8259 gene locus_tag LOCUS_17220 7318 8259 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_17220 9733 8288 gene locus_tag LOCUS_17230 9733 8288 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521883.1 protein_id gnl|my_center|LOCUS_17230 10505 10678 gene locus_tag LOCUS_17240 10505 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 12313 10880 gene locus_tag LOCUS_17250 12313 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 13543 12416 gene locus_tag LOCUS_17260 13543 12416 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_17260 14166 15722 gene locus_tag LOCUS_17270 14166 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 15737 16060 gene locus_tag LOCUS_17280 15737 16060 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_17280 16209 17042 gene locus_tag LOCUS_17290 16209 17042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 18016 17147 gene locus_tag LOCUS_17300 18016 17147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 19030 18185 gene locus_tag LOCUS_17310 19030 18185 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_17310 19643 19879 gene locus_tag LOCUS_17320 gene rpmB 19643 19879 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_17320 19911 20066 gene locus_tag LOCUS_17330 gene rpmG 19911 20066 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185395.1 protein_id gnl|my_center|LOCUS_17330 21347 20157 gene locus_tag LOCUS_17340 21347 20157 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_17340 22186 21632 gene locus_tag LOCUS_17350 22186 21632 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_17350 22674 22222 gene locus_tag LOCUS_17360 gene sixA 22674 22222 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_17360 23054 22761 gene locus_tag LOCUS_17370 gene yggU 23054 22761 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718491.1 protein_id gnl|my_center|LOCUS_17370 23642 23061 gene locus_tag LOCUS_17380 23642 23061 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_17380 24515 23703 gene locus_tag LOCUS_17390 gene proC 24515 23703 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_17390 25451 24621 gene locus_tag LOCUS_17400 gene mutM 25451 24621 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_17400 26326 25451 gene locus_tag LOCUS_17410 26326 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 27688 26327 gene locus_tag LOCUS_17420 27688 26327 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_17420 28450 27707 gene locus_tag LOCUS_17430 28450 27707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 29202 28465 gene locus_tag LOCUS_17440 29202 28465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 29666 30337 gene locus_tag LOCUS_17450 29666 30337 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189892.1 protein_id gnl|my_center|LOCUS_17450 30406 31737 gene locus_tag LOCUS_17460 30406 31737 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_17460 31757 32464 gene locus_tag LOCUS_17470 gene ubiG 31757 32464 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_17470 32529 33176 gene locus_tag LOCUS_17480 gene gph 32529 33176 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence033 <1 932 gene locus_tag LOCUS_17490 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 1301 3223 gene locus_tag LOCUS_17500 1301 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3281 4339 gene locus_tag LOCUS_17510 3281 4339 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_17510 4492 5730 gene locus_tag LOCUS_17520 4492 5730 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_17520 5732 6139 gene locus_tag LOCUS_17530 5732 6139 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194347.1 protein_id gnl|my_center|LOCUS_17530 6211 6996 gene locus_tag LOCUS_17540 6211 6996 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084054.1 protein_id gnl|my_center|LOCUS_17540 7105 7181 gene locus_tag LOCUS_t00190 7105 7181 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7403 7735 gene locus_tag LOCUS_17550 7403 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 9371 7809 gene locus_tag LOCUS_17560 9371 7809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 10413 9844 gene locus_tag LOCUS_17570 10413 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 10879 10421 gene locus_tag LOCUS_17580 10879 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 11763 11179 gene locus_tag LOCUS_17590 11763 11179 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_17590 12704 12417 gene locus_tag LOCUS_17600 12704 12417 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_17600 13128 12691 gene locus_tag LOCUS_17610 13128 12691 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_17610 13220 13663 gene locus_tag LOCUS_17620 gene smpB 13220 13663 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_17620 13721 14734 gene locus_tag LOCUS_17630 13721 14734 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532214.1 protein_id gnl|my_center|LOCUS_17630 16222 14810 gene locus_tag LOCUS_17640 gene pilR 16222 14810 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_17640 17532 16213 gene locus_tag LOCUS_17650 gene pilS 17532 16213 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_17650 19421 18492 gene locus_tag LOCUS_17660 gene ispB 19421 18492 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929988.1 protein_id gnl|my_center|LOCUS_17660 19617 19928 gene locus_tag LOCUS_17670 gene rplU 19617 19928 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_17670 19938 20195 gene locus_tag LOCUS_17680 gene rpmA 19938 20195 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339028.1 protein_id gnl|my_center|LOCUS_17680 20301 21359 gene locus_tag LOCUS_17690 gene obgE 20301 21359 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_17690 21363 22472 gene locus_tag LOCUS_17700 gene proB 21363 22472 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_17700 22503 23618 gene locus_tag LOCUS_17710 22503 23618 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_17710 23741 24076 gene locus_tag LOCUS_17720 23741 24076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 24161 24457 gene locus_tag LOCUS_17730 24161 24457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 24530 25216 gene locus_tag LOCUS_17740 24530 25216 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_17740 25213 26553 gene locus_tag LOCUS_17750 25213 26553 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 protein_id gnl|my_center|LOCUS_17750 26867 26595 gene locus_tag LOCUS_17760 26867 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 27075 28079 gene locus_tag LOCUS_17770 27075 28079 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_17770 28520 29626 gene locus_tag LOCUS_17780 28520 29626 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532210.1 protein_id gnl|my_center|LOCUS_17780 30689 30246 gene locus_tag LOCUS_17790 30689 30246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 31352 30981 gene locus_tag LOCUS_17800 31352 30981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 31583 31798 gene locus_tag LOCUS_17810 31583 31798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 32329 32685 gene locus_tag LOCUS_17820 32329 32685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 32813 33118 gene locus_tag LOCUS_17830 32813 33118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence034 95 3 gene locus_tag LOCUS_t00200 95 3 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1385 156 gene locus_tag LOCUS_17840 1385 156 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 protein_id gnl|my_center|LOCUS_17840 2282 1494 gene locus_tag LOCUS_17850 gene rsmA 2282 1494 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225484.1 protein_id gnl|my_center|LOCUS_17850 3285 2272 gene locus_tag LOCUS_17860 gene pdxA 3285 2272 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103187.1 protein_id gnl|my_center|LOCUS_17860 4630 3278 gene locus_tag LOCUS_17870 4630 3278 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079997984.1 protein_id gnl|my_center|LOCUS_17870 6856 4646 gene locus_tag LOCUS_17880 6856 4646 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189876.1 protein_id gnl|my_center|LOCUS_17880 7418 9343 gene locus_tag LOCUS_17890 7418 9343 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_17890 9716 10246 gene locus_tag LOCUS_17900 9716 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 10287 10892 gene locus_tag LOCUS_17910 10287 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 10931 11428 gene locus_tag LOCUS_17920 gene creA 10931 11428 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 protein_id gnl|my_center|LOCUS_17920 11557 12810 gene locus_tag LOCUS_17930 gene hemA 11557 12810 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_17930 12807 13886 gene locus_tag LOCUS_17940 gene prfA 12807 13886 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186862.1 protein_id gnl|my_center|LOCUS_17940 13922 14758 gene locus_tag LOCUS_17950 gene prmC 13922 14758 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948043.1 protein_id gnl|my_center|LOCUS_17950 14829 15155 gene locus_tag LOCUS_17960 gene grxD 14829 15155 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_17960 15655 15236 gene locus_tag LOCUS_17970 15655 15236 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370062.1 protein_id gnl|my_center|LOCUS_17970 16335 16135 gene locus_tag LOCUS_17980 16335 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 17520 16501 gene locus_tag LOCUS_17990 gene wecB 17520 16501 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_17990 18119 17556 gene locus_tag LOCUS_18000 18119 17556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 19561 18587 gene locus_tag LOCUS_18010 19561 18587 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_18010 19811 20998 gene locus_tag LOCUS_18020 19811 20998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 21680 22957 gene locus_tag LOCUS_18030 21680 22957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 23211 24026 gene locus_tag LOCUS_18040 23211 24026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 24042 24950 gene locus_tag LOCUS_18050 24042 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 24963 25688 gene locus_tag LOCUS_18060 24963 25688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 25698 26789 gene locus_tag LOCUS_18070 25698 26789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 26786 27727 gene locus_tag LOCUS_18080 26786 27727 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065630.1 protein_id gnl|my_center|LOCUS_18080 27888 30566 gene locus_tag LOCUS_18090 27888 30566 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_18090 30627 30791 gene locus_tag LOCUS_18100 30627 30791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 31270 31440 gene locus_tag LOCUS_18110 31270 31440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 31518 32426 gene locus_tag LOCUS_18120 31518 32426 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence035 1252 41 gene locus_tag LOCUS_18130 gene zapE 1252 41 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_18130 2651 1275 gene locus_tag LOCUS_18140 2651 1275 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 protein_id gnl|my_center|LOCUS_18140 3421 2648 gene locus_tag LOCUS_18150 3421 2648 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686889.1 protein_id gnl|my_center|LOCUS_18150 3450 4091 gene locus_tag LOCUS_18160 gene pyrE 3450 4091 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_18160 4272 4084 gene locus_tag LOCUS_18170 4272 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 5739 4372 gene locus_tag LOCUS_18180 5739 4372 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478321.1 protein_id gnl|my_center|LOCUS_18180 6395 5742 gene locus_tag LOCUS_18190 6395 5742 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375180.1 protein_id gnl|my_center|LOCUS_18190 7116 6514 gene locus_tag LOCUS_18200 7116 6514 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 protein_id gnl|my_center|LOCUS_18200 8790 7162 gene locus_tag LOCUS_18210 8790 7162 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072006.1 protein_id gnl|my_center|LOCUS_18210 9151 10005 gene locus_tag LOCUS_18220 9151 10005 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_18220 10060 11733 gene locus_tag LOCUS_18230 10060 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 18410 11808 gene locus_tag LOCUS_18240 18410 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 19355 18474 gene locus_tag LOCUS_18250 19355 18474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 20201 19476 gene locus_tag LOCUS_18260 20201 19476 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_18260 20434 21672 gene locus_tag LOCUS_18270 20434 21672 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383637.1 protein_id gnl|my_center|LOCUS_18270 21669 23222 gene locus_tag LOCUS_18280 21669 23222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 23299 24048 gene locus_tag LOCUS_18290 23299 24048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 24185 25198 gene locus_tag LOCUS_18300 24185 25198 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096289.1 protein_id gnl|my_center|LOCUS_18300 25205 26869 gene locus_tag LOCUS_18310 25205 26869 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266271.1 protein_id gnl|my_center|LOCUS_18310 26874 27953 gene locus_tag LOCUS_18320 26874 27953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_18320 28852 28097 gene locus_tag LOCUS_18330 28852 28097 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087633.1 protein_id gnl|my_center|LOCUS_18330 29731 30057 gene locus_tag LOCUS_18340 gene trxA 29731 30057 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_18340 30201 31460 gene locus_tag LOCUS_18350 gene rho 30201 31460 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_18350 32226 31909 gene locus_tag LOCUS_18360 32226 31909 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_18360 32602 32345 gene locus_tag LOCUS_18370 32602 32345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18370 >Feature sequence036 2185 1379 gene locus_tag LOCUS_18380 gene folE2 2185 1379 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_18380 4140 2296 gene locus_tag LOCUS_18390 gene dxs 4140 2296 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_18390 5070 4177 gene locus_tag LOCUS_18400 5070 4177 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 protein_id gnl|my_center|LOCUS_18400 5314 5060 gene locus_tag LOCUS_18410 5314 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5798 6301 gene locus_tag LOCUS_18420 5798 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6499 7653 gene locus_tag LOCUS_18430 gene yghO 6499 7653 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305975.1 protein_id gnl|my_center|LOCUS_18430 7650 8492 gene locus_tag LOCUS_18440 7650 8492 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_18440 8554 9633 gene locus_tag LOCUS_18450 gene lptF 8554 9633 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779645.1 protein_id gnl|my_center|LOCUS_18450 9630 10691 gene locus_tag LOCUS_18460 gene lptG 9630 10691 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387073.1 protein_id gnl|my_center|LOCUS_18460 10810 12057 gene locus_tag LOCUS_18470 10810 12057 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_18470 12067 14061 gene locus_tag LOCUS_18480 12067 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 14130 14777 gene locus_tag LOCUS_18490 14130 14777 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_18490 14962 15324 gene locus_tag LOCUS_18500 14962 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 16281 15433 gene locus_tag LOCUS_18510 gene nadC 16281 15433 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 protein_id gnl|my_center|LOCUS_18510 16432 17949 gene locus_tag LOCUS_18520 16432 17949 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_18520 18041 20653 gene locus_tag LOCUS_18530 gene clpB 18041 20653 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_18530 20801 21688 gene locus_tag LOCUS_18540 gene dapA 20801 21688 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_18540 21690 22853 gene locus_tag LOCUS_18550 gene bamC 21690 22853 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_18550 23785 23588 gene locus_tag LOCUS_18560 23785 23588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 25486 24365 gene locus_tag LOCUS_18570 25486 24365 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_18570 26150 25497 gene locus_tag LOCUS_18580 gene msrA 26150 25497 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_18580 26682 26155 gene locus_tag LOCUS_18590 gene msrB 26682 26155 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404837.1 protein_id gnl|my_center|LOCUS_18590 26874 27842 gene locus_tag LOCUS_18600 26874 27842 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691155.1 protein_id gnl|my_center|LOCUS_18600 27811 29163 gene locus_tag LOCUS_18610 gene tilS 27811 29163 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_18610 29249 30307 gene locus_tag LOCUS_18620 gene rfbB 29249 30307 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_18620 30304 31200 gene locus_tag LOCUS_18630 gene rfbD 30304 31200 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_18630 32182 31238 gene locus_tag LOCUS_18640 32182 31238 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_18640 32536 32429 gene locus_tag LOCUS_r00010 32536 32429 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence037 235 429 gene locus_tag LOCUS_18650 235 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 426 836 gene locus_tag LOCUS_18660 426 836 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_18660 1443 1099 gene locus_tag LOCUS_18670 1443 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2500 1448 gene locus_tag LOCUS_18680 2500 1448 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557587.1 protein_id gnl|my_center|LOCUS_18680 2699 3058 gene locus_tag LOCUS_18690 2699 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3137 4105 gene locus_tag LOCUS_18700 gene trbB 3137 4105 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 protein_id gnl|my_center|LOCUS_18700 4127 4540 gene locus_tag LOCUS_18710 4127 4540 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875430.1 protein_id gnl|my_center|LOCUS_18710 4569 4880 gene locus_tag LOCUS_18720 4569 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4877 7414 gene locus_tag LOCUS_18730 4877 7414 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028755117.1 protein_id gnl|my_center|LOCUS_18730 7411 8187 gene locus_tag LOCUS_18740 7411 8187 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875423.1 protein_id gnl|my_center|LOCUS_18740 8202 9128 gene locus_tag LOCUS_18750 gene trbG 8202 9128 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 protein_id gnl|my_center|LOCUS_18750 9128 9610 gene locus_tag LOCUS_18760 9128 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 9620 11017 gene locus_tag LOCUS_18770 gene trbI 9620 11017 CDS product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086083981.1 protein_id gnl|my_center|LOCUS_18770 11033 11833 gene locus_tag LOCUS_18780 gene trbJ 11033 11833 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039736.1 protein_id gnl|my_center|LOCUS_18780 11857 12033 gene locus_tag LOCUS_18790 11857 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 12077 13174 gene locus_tag LOCUS_18800 12077 13174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 13174 13590 gene locus_tag LOCUS_18810 13174 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 15089 13713 gene locus_tag LOCUS_18820 gene chrA 15089 13713 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_18820 15412 15888 gene locus_tag LOCUS_18830 15412 15888 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_18830 15900 16358 gene locus_tag LOCUS_18840 gene cueR 15900 16358 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770083.1 protein_id gnl|my_center|LOCUS_18840 16421 18007 gene locus_tag LOCUS_18850 16421 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 18339 18692 gene locus_tag LOCUS_18860 18339 18692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 19332 20666 gene locus_tag LOCUS_18870 19332 20666 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_18870 20691 22280 gene locus_tag LOCUS_18880 20691 22280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 22282 25416 gene locus_tag LOCUS_18890 22282 25416 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_18890 25437 25958 gene locus_tag LOCUS_18900 25437 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 26948 25989 gene locus_tag LOCUS_18910 26948 25989 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_18910 27117 27347 gene locus_tag LOCUS_18920 27117 27347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 27340 27684 gene locus_tag LOCUS_18930 27340 27684 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_18930 28488 28294 gene locus_tag LOCUS_18940 28488 28294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 28847 32416 gene locus_tag LOCUS_18950 28847 32416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 32437 32586 gene locus_tag LOCUS_18960 32437 32586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence038 485 1648 gene locus_tag LOCUS_18970 gene metK 485 1648 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_18970 1792 3225 gene locus_tag LOCUS_18980 gene ahcY 1792 3225 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198634.1 protein_id gnl|my_center|LOCUS_18980 3374 4234 gene locus_tag LOCUS_18990 gene metF 3374 4234 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_18990 4393 5082 gene locus_tag LOCUS_19000 4393 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 5177 6034 gene locus_tag LOCUS_19010 gene folD 5177 6034 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524717.1 protein_id gnl|my_center|LOCUS_19010 6071 8731 gene locus_tag LOCUS_19020 gene aceE 6071 8731 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199569.1 protein_id gnl|my_center|LOCUS_19020 8825 10153 gene locus_tag LOCUS_19030 gene aceF 8825 10153 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_19030 10210 10887 gene locus_tag LOCUS_19040 gene nadD 10210 10887 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816837.1 protein_id gnl|my_center|LOCUS_19040 10884 11210 gene locus_tag LOCUS_19050 10884 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 11301 11738 gene locus_tag LOCUS_19060 gene rlmH 11301 11738 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_19060 11941 12468 gene locus_tag LOCUS_19070 11941 12468 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813200.1 protein_id gnl|my_center|LOCUS_19070 12535 13989 gene locus_tag LOCUS_19080 gene rng 12535 13989 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_19080 14577 14104 gene locus_tag LOCUS_19090 14577 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 15394 14738 gene locus_tag LOCUS_19100 15394 14738 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_19100 18275 15396 gene locus_tag LOCUS_19110 18275 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 19144 18533 gene locus_tag LOCUS_19120 19144 18533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 20514 19291 gene locus_tag LOCUS_19130 20514 19291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_19130 21333 20533 gene locus_tag LOCUS_19140 21333 20533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_19140 22478 21333 gene locus_tag LOCUS_19150 22478 21333 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_19150 24104 22587 gene locus_tag LOCUS_19160 24104 22587 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189765.1 protein_id gnl|my_center|LOCUS_19160 25776 24145 gene locus_tag LOCUS_19170 25776 24145 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_19170 27185 25806 gene locus_tag LOCUS_19180 27185 25806 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522260.1 protein_id gnl|my_center|LOCUS_19180 27491 27288 gene locus_tag LOCUS_19190 27491 27288 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_19190 28437 27517 gene locus_tag LOCUS_19200 28437 27517 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_19200 28735 28565 gene locus_tag LOCUS_19210 28735 28565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence039 486 79 gene locus_tag LOCUS_19220 486 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2124 592 gene locus_tag LOCUS_19230 2124 592 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_19230 3136 2354 gene locus_tag LOCUS_19240 gene pssA 3136 2354 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522420.1 protein_id gnl|my_center|LOCUS_19240 3944 3300 gene locus_tag LOCUS_19250 3944 3300 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_19250 5023 4007 gene locus_tag LOCUS_19260 gene ilvC 5023 4007 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_19260 5622 5131 gene locus_tag LOCUS_19270 gene ilvN 5622 5131 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_19270 7333 5630 gene locus_tag LOCUS_19280 7333 5630 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_19280 8877 7405 gene locus_tag LOCUS_19290 gene tldD 8877 7405 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_19290 9841 8978 gene locus_tag LOCUS_19300 9841 8978 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_19300 10082 12871 gene locus_tag LOCUS_19310 gene glnE 10082 12871 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951341.1 protein_id gnl|my_center|LOCUS_19310 13188 13287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14406 13351 gene locus_tag LOCUS_19320 14406 13351 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940869.1 protein_id gnl|my_center|LOCUS_19320 14701 17169 gene locus_tag LOCUS_19330 14701 17169 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205538.1 protein_id gnl|my_center|LOCUS_19330 18704 17247 gene locus_tag LOCUS_19340 18704 17247 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 protein_id gnl|my_center|LOCUS_19340 20409 18976 gene locus_tag LOCUS_19350 20409 18976 CDS product serralysin family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405046.1 protein_id gnl|my_center|LOCUS_19350 20912 21436 gene locus_tag LOCUS_19360 20912 21436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 23482 21608 gene locus_tag LOCUS_19370 23482 21608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 24096 26522 gene locus_tag LOCUS_19380 24096 26522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 26578 28008 gene locus_tag LOCUS_19390 26578 28008 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146465.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence040 1129 524 gene locus_tag LOCUS_19400 gene cobO 1129 524 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_19400 6575 1998 gene locus_tag LOCUS_19410 6575 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 7274 6708 gene locus_tag LOCUS_19420 7274 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 8665 7418 gene locus_tag LOCUS_19430 8665 7418 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_19430 10588 8798 gene locus_tag LOCUS_19440 10588 8798 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_19440 10791 11195 gene locus_tag LOCUS_19450 10791 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 11494 11192 gene locus_tag LOCUS_19460 11494 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 13275 11557 gene locus_tag LOCUS_19470 13275 11557 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 protein_id gnl|my_center|LOCUS_19470 15254 13371 gene locus_tag LOCUS_19480 15254 13371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 17933 15567 gene locus_tag LOCUS_19490 17933 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_19490 18758 18066 gene locus_tag LOCUS_19500 18758 18066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 18992 19561 gene locus_tag LOCUS_19510 18992 19561 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_19510 19997 19782 gene locus_tag LOCUS_19520 19997 19782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 20379 20906 gene locus_tag LOCUS_19530 20379 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 22208 21006 gene locus_tag LOCUS_19540 22208 21006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 22876 22208 gene locus_tag LOCUS_19550 22876 22208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 23384 24292 gene locus_tag LOCUS_19560 23384 24292 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_19560 24670 26184 gene locus_tag LOCUS_19570 24670 26184 CDS product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929330.1 protein_id gnl|my_center|LOCUS_19570 26471 26863 gene locus_tag LOCUS_19580 26471 26863 CDS product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_19580 26856 27284 gene locus_tag LOCUS_19590 26856 27284 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence041 1398 592 gene locus_tag LOCUS_19600 1398 592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113878.1 protein_id gnl|my_center|LOCUS_19600 2295 1402 gene locus_tag LOCUS_19610 2295 1402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092241.1 protein_id gnl|my_center|LOCUS_19610 3405 2320 gene locus_tag LOCUS_19620 3405 2320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119359.1 protein_id gnl|my_center|LOCUS_19620 5019 3505 gene locus_tag LOCUS_19630 gene ubiB 5019 3505 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_19630 5737 5129 gene locus_tag LOCUS_19640 5737 5129 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064918.1 protein_id gnl|my_center|LOCUS_19640 7290 6295 gene locus_tag LOCUS_19650 7290 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 8387 7287 gene locus_tag LOCUS_19660 gene rodA 8387 7287 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_19660 10360 8447 gene locus_tag LOCUS_19670 gene mrdA 10360 8447 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_19670 10908 10357 gene locus_tag LOCUS_19680 gene mreD 10908 10357 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_19680 11779 10889 gene locus_tag LOCUS_19690 gene mreC 11779 10889 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_19690 12913 11855 gene locus_tag LOCUS_19700 12913 11855 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815204.1 protein_id gnl|my_center|LOCUS_19700 13043 13330 gene locus_tag LOCUS_19710 gene gatC 13043 13330 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688831.1 protein_id gnl|my_center|LOCUS_19710 13430 14878 gene locus_tag LOCUS_19720 gene gatA 13430 14878 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_19720 14925 16364 gene locus_tag LOCUS_19730 gene gatB 14925 16364 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_19730 16739 17425 gene locus_tag LOCUS_19740 16739 17425 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_19740 17700 18425 gene locus_tag LOCUS_19750 17700 18425 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_19750 18653 19660 gene locus_tag LOCUS_19760 18653 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 19690 22428 gene locus_tag LOCUS_19770 19690 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 22862 24301 gene locus_tag LOCUS_19780 22862 24301 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387757.1 protein_id gnl|my_center|LOCUS_19780 26633 24471 gene locus_tag LOCUS_19790 26633 24471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence042 3586 4416 gene locus_tag LOCUS_19800 3586 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 4551 4976 gene locus_tag LOCUS_19810 4551 4976 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071464.1 protein_id gnl|my_center|LOCUS_19810 5099 5698 gene locus_tag LOCUS_19820 5099 5698 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_19820 7140 5878 gene locus_tag LOCUS_19830 7140 5878 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_19830 8917 7130 gene locus_tag LOCUS_19840 gene recJ 8917 7130 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_19840 9810 8962 gene locus_tag LOCUS_19850 9810 8962 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_19850 10358 9891 gene locus_tag LOCUS_19860 gene ybeY 10358 9891 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 protein_id gnl|my_center|LOCUS_19860 11339 10371 gene locus_tag LOCUS_19870 11339 10371 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 protein_id gnl|my_center|LOCUS_19870 12720 11455 gene locus_tag LOCUS_19880 gene miaB 12720 11455 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927876.1 protein_id gnl|my_center|LOCUS_19880 13217 12822 gene locus_tag LOCUS_19890 13217 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 14725 13427 gene locus_tag LOCUS_19900 14725 13427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 15454 14753 gene locus_tag LOCUS_19910 15454 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 16063 15458 gene locus_tag LOCUS_19920 16063 15458 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036842.1 protein_id gnl|my_center|LOCUS_19920 16893 16159 gene locus_tag LOCUS_19930 16893 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 17959 19332 gene locus_tag LOCUS_19940 gene glmU 17959 19332 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531007.1 protein_id gnl|my_center|LOCUS_19940 19391 21238 gene locus_tag LOCUS_19950 gene glmS 19391 21238 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_19950 21382 22107 gene locus_tag LOCUS_19960 21382 22107 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185607.1 protein_id gnl|my_center|LOCUS_19960 22182 22652 gene locus_tag LOCUS_19970 gene ruvC 22182 22652 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_19970 22649 23233 gene locus_tag LOCUS_19980 gene ruvA 22649 23233 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_19980 23255 24301 gene locus_tag LOCUS_19990 gene ruvB 23255 24301 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_19990 24327 24767 gene locus_tag LOCUS_20000 24327 24767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 24991 25662 gene locus_tag LOCUS_20010 24991 25662 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence043 1173 622 gene locus_tag LOCUS_20020 1173 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2222 1170 gene locus_tag LOCUS_20030 2222 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3232 2336 gene locus_tag LOCUS_20040 3232 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 3723 3229 gene locus_tag LOCUS_20050 3723 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 4671 3727 gene locus_tag LOCUS_20060 4671 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5099 4947 gene locus_tag LOCUS_20070 5099 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 5593 5045 gene locus_tag LOCUS_20080 5593 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 8171 6078 gene locus_tag LOCUS_20090 gene brxL 8171 6078 CDS product BREX system Lon protease-like protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_20090 10684 8186 gene locus_tag LOCUS_20100 gene pglZ 10684 8186 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038873.1 protein_id gnl|my_center|LOCUS_20100 13680 10681 gene locus_tag LOCUS_20110 13680 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 17220 13690 gene locus_tag LOCUS_20120 gene pglX 17220 13690 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_20120 20771 17220 gene locus_tag LOCUS_20130 gene brxC 20771 17220 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228200.1 protein_id gnl|my_center|LOCUS_20130 21397 20786 gene locus_tag LOCUS_20140 21397 20786 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038867.1 protein_id gnl|my_center|LOCUS_20140 21987 21394 gene locus_tag LOCUS_20150 21987 21394 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205228220.1 protein_id gnl|my_center|LOCUS_20150 22424 22705 gene locus_tag LOCUS_20160 22424 22705 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 protein_id gnl|my_center|LOCUS_20160 25168 22832 gene locus_tag LOCUS_20170 25168 22832 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126413.1 protein_id gnl|my_center|LOCUS_20170 <26076 25175 gene locus_tag LOCUS_20180 <26076 25175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001273465.1:ATP-binding protein >Feature sequence044 386 1447 gene locus_tag LOCUS_20190 386 1447 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 protein_id gnl|my_center|LOCUS_20190 1598 2416 gene locus_tag LOCUS_20200 1598 2416 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_20200 2473 3960 gene locus_tag LOCUS_20210 2473 3960 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254000.1 protein_id gnl|my_center|LOCUS_20210 4902 3973 gene locus_tag LOCUS_20220 4902 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 5495 4917 gene locus_tag LOCUS_20230 5495 4917 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_20230 5699 6067 gene locus_tag LOCUS_20240 5699 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 6618 6127 gene locus_tag LOCUS_20250 6618 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 7098 8156 gene locus_tag LOCUS_20260 gene purM 7098 8156 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_20260 8178 8816 gene locus_tag LOCUS_20270 gene purN 8178 8816 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185746.1 protein_id gnl|my_center|LOCUS_20270 8813 9529 gene locus_tag LOCUS_20280 8813 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 9567 10853 gene locus_tag LOCUS_20290 9567 10853 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 protein_id gnl|my_center|LOCUS_20290 11609 11031 gene locus_tag LOCUS_20300 11609 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 12768 11638 gene locus_tag LOCUS_20310 12768 11638 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530058.1 protein_id gnl|my_center|LOCUS_20310 13934 12816 gene locus_tag LOCUS_20320 gene hpnH 13934 12816 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_20320 14887 14369 gene locus_tag LOCUS_20330 14887 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 15104 16264 gene locus_tag LOCUS_20340 15104 16264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_20340 16997 16347 gene locus_tag LOCUS_20350 16997 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 18313 17117 gene locus_tag LOCUS_20360 18313 17117 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524929.1 protein_id gnl|my_center|LOCUS_20360 18567 18313 gene locus_tag LOCUS_20370 18567 18313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 19510 18596 gene locus_tag LOCUS_20380 19510 18596 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077137.1 protein_id gnl|my_center|LOCUS_20380 21320 19518 gene locus_tag LOCUS_20390 21320 19518 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence045 366 4127 gene locus_tag LOCUS_20400 366 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 5404 4175 gene locus_tag LOCUS_20410 5404 4175 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_20410 5849 7168 gene locus_tag LOCUS_20420 5849 7168 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908805.1 protein_id gnl|my_center|LOCUS_20420 7266 7667 gene locus_tag LOCUS_20430 7266 7667 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194548.1 protein_id gnl|my_center|LOCUS_20430 10415 7863 gene locus_tag LOCUS_20440 10415 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 10870 10703 gene locus_tag LOCUS_20450 10870 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 10915 11445 gene locus_tag LOCUS_20460 10915 11445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 11652 11996 gene locus_tag LOCUS_20470 11652 11996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 12922 12167 gene locus_tag LOCUS_20480 12922 12167 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011945636.1 protein_id gnl|my_center|LOCUS_20480 13142 13729 gene locus_tag LOCUS_20490 13142 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 13807 15594 gene locus_tag LOCUS_20500 13807 15594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 17211 15676 gene locus_tag LOCUS_20510 17211 15676 CDS product M10 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104426.1 protein_id gnl|my_center|LOCUS_20510 18175 17447 gene locus_tag LOCUS_20520 gene phoB 18175 17447 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_20520 18415 20103 gene locus_tag LOCUS_20530 18415 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 20103 22949 gene locus_tag LOCUS_20540 20103 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 24172 23090 gene locus_tag LOCUS_20550 24172 23090 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967012.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence046 351 587 gene locus_tag LOCUS_20560 351 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 653 3253 gene locus_tag LOCUS_20570 gene leuS 653 3253 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_20570 3297 3794 gene locus_tag LOCUS_20580 gene lptE 3297 3794 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194132.1 protein_id gnl|my_center|LOCUS_20580 3848 4867 gene locus_tag LOCUS_20590 gene holA 3848 4867 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_20590 5273 5067 gene locus_tag LOCUS_20600 5273 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 5311 6273 gene locus_tag LOCUS_20610 gene mtrA 5311 6273 CDS product decaheme c-type cytochrome MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071900.1 protein_id gnl|my_center|LOCUS_20610 6288 8276 gene locus_tag LOCUS_20620 6288 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 6440 6539 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9400 8333 gene locus_tag LOCUS_20630 9400 8333 CDS product DUF3541 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981402.1 protein_id gnl|my_center|LOCUS_20630 11171 9471 gene locus_tag LOCUS_20640 11171 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 11736 11230 gene locus_tag LOCUS_20650 11736 11230 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065038.1 protein_id gnl|my_center|LOCUS_20650 12169 11768 gene locus_tag LOCUS_20660 12169 11768 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_20660 12502 12353 gene locus_tag LOCUS_20670 12502 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 12610 13029 gene locus_tag LOCUS_20680 12610 13029 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550737.1 protein_id gnl|my_center|LOCUS_20680 13064 13285 gene locus_tag LOCUS_20690 13064 13285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 13282 13644 gene locus_tag LOCUS_20700 13282 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 14632 13775 gene locus_tag LOCUS_20710 14632 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 15800 14940 gene locus_tag LOCUS_20720 15800 14940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 16160 17425 gene locus_tag LOCUS_20730 16160 17425 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_20730 17499 19274 gene locus_tag LOCUS_20740 gene lpdA 17499 19274 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035792.1 protein_id gnl|my_center|LOCUS_20740 19381 19788 gene locus_tag LOCUS_20750 19381 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 19833 20639 gene locus_tag LOCUS_20760 19833 20639 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418596.1 protein_id gnl|my_center|LOCUS_20760 20639 22186 gene locus_tag LOCUS_20770 20639 22186 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 protein_id gnl|my_center|LOCUS_20770 22167 23177 gene locus_tag LOCUS_20780 22167 23177 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506955.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence047 1205 6 gene locus_tag LOCUS_20790 1205 6 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549948.1 protein_id gnl|my_center|LOCUS_20790 2181 1435 gene locus_tag LOCUS_20800 2181 1435 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202811.1 protein_id gnl|my_center|LOCUS_20800 2260 3399 gene locus_tag LOCUS_20810 2260 3399 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_20810 3566 5134 gene locus_tag LOCUS_20820 3566 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 5312 5599 gene locus_tag LOCUS_20830 5312 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5696 6625 gene locus_tag LOCUS_20840 gene cysM 5696 6625 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532363.1 protein_id gnl|my_center|LOCUS_20840 6735 7145 gene locus_tag LOCUS_20850 gene ybgC 6735 7145 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693784.1 protein_id gnl|my_center|LOCUS_20850 7142 7822 gene locus_tag LOCUS_20860 gene tolQ 7142 7822 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_20860 7842 8255 gene locus_tag LOCUS_20870 gene tolR 7842 8255 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 protein_id gnl|my_center|LOCUS_20870 8266 9294 gene locus_tag LOCUS_20880 8266 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 9340 10638 gene locus_tag LOCUS_20890 gene tolB 9340 10638 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_20890 10672 11196 gene locus_tag LOCUS_20900 10672 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 11199 12092 gene locus_tag LOCUS_20910 gene ybgF 11199 12092 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_20910 12183 12839 gene locus_tag LOCUS_20920 gene queE 12183 12839 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_20920 12880 13581 gene locus_tag LOCUS_20930 gene queC 12880 13581 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_20930 13966 13619 gene locus_tag LOCUS_20940 13966 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 14911 14147 gene locus_tag LOCUS_20950 gene traT 14911 14147 CDS product conjugal transfer complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032641144.1 protein_id gnl|my_center|LOCUS_20950 15388 15035 gene locus_tag LOCUS_20960 15388 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 15973 15593 gene locus_tag LOCUS_20970 gene folB 15973 15593 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221051.1 protein_id gnl|my_center|LOCUS_20970 16092 16706 gene locus_tag LOCUS_20980 gene plsY 16092 16706 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_20980 17746 16715 gene locus_tag LOCUS_20990 gene tsaD 17746 16715 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_20990 17893 18105 gene locus_tag LOCUS_21000 gene rpsU 17893 18105 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_21000 18185 18631 gene locus_tag LOCUS_21010 18185 18631 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 protein_id gnl|my_center|LOCUS_21010 18733 20532 gene locus_tag LOCUS_21020 18733 20532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 20620 22818 gene locus_tag LOCUS_21030 gene rpoD 20620 22818 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence048 4186 1073 gene locus_tag LOCUS_21040 4186 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4502 4173 gene locus_tag LOCUS_21050 4502 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5328 4495 gene locus_tag LOCUS_21060 5328 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 9176 5301 gene locus_tag LOCUS_21070 9176 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 9614 9192 gene locus_tag LOCUS_21080 9614 9192 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_21080 9930 9631 gene locus_tag LOCUS_21090 9930 9631 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226572031.1 protein_id gnl|my_center|LOCUS_21090 11771 9981 gene locus_tag LOCUS_21100 11771 9981 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_21100 12484 11780 gene locus_tag LOCUS_21110 12484 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 12649 12485 gene locus_tag LOCUS_21120 12649 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 13138 12668 gene locus_tag LOCUS_21130 13138 12668 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_21130 13655 13194 gene locus_tag LOCUS_21140 13655 13194 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_21140 15235 13727 gene locus_tag LOCUS_21150 15235 13727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 18559 15470 gene locus_tag LOCUS_21160 18559 15470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 17696 17795 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18987 18565 gene locus_tag LOCUS_21170 18987 18565 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878970.1 protein_id gnl|my_center|LOCUS_21170 <22570 19003 gene locus_tag LOCUS_21180 <22570 19003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390159.1:EAL domain-containing protein >Feature sequence049 228 581 gene locus_tag LOCUS_21190 228 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 2707 737 gene locus_tag LOCUS_21200 2707 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3008 2760 gene locus_tag LOCUS_21210 3008 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4011 3715 gene locus_tag LOCUS_21220 4011 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4106 4300 gene locus_tag LOCUS_21230 4106 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 4297 5145 gene locus_tag LOCUS_21240 4297 5145 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770085.1 protein_id gnl|my_center|LOCUS_21240 6249 5140 gene locus_tag LOCUS_21250 6249 5140 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_21250 8807 6249 gene locus_tag LOCUS_21260 8807 6249 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915882.1 protein_id gnl|my_center|LOCUS_21260 9469 8804 gene locus_tag LOCUS_21270 9469 8804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037424.1 protein_id gnl|my_center|LOCUS_21270 9633 9914 gene locus_tag LOCUS_21280 9633 9914 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_21280 10004 11776 gene locus_tag LOCUS_21290 gene hcuC 10004 11776 CDS product hydrophobic compound transporter HcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_21290 12523 11780 gene locus_tag LOCUS_21300 12523 11780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 14517 12520 gene locus_tag LOCUS_21310 gene shc 14517 12520 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_21310 15471 14638 gene locus_tag LOCUS_21320 15471 14638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 16553 15537 gene locus_tag LOCUS_21330 16553 15537 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_21330 17264 16656 gene locus_tag LOCUS_21340 17264 16656 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_21340 17624 18970 gene locus_tag LOCUS_21350 gene xseA 17624 18970 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812887.1 protein_id gnl|my_center|LOCUS_21350 19401 19500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20702 19791 gene locus_tag LOCUS_21360 gene xerD 20702 19791 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765876.1 protein_id gnl|my_center|LOCUS_21360 21168 20689 gene locus_tag LOCUS_21370 21168 20689 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_21370 <22265 21317 gene locus_tag LOCUS_21380 <22265 21317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185742.1:molecular chaperone HtpG >Feature sequence050 2122 77 gene locus_tag LOCUS_21390 gene fusA 2122 77 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_21390 2697 2227 gene locus_tag LOCUS_21400 gene rpsG 2697 2227 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198359.1 protein_id gnl|my_center|LOCUS_21400 3136 2759 gene locus_tag LOCUS_21410 gene rpsL 3136 2759 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450478.1 protein_id gnl|my_center|LOCUS_21410 3875 3390 gene locus_tag LOCUS_21420 3875 3390 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_21420 5181 3961 gene locus_tag LOCUS_21430 5181 3961 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_21430 6186 5260 gene locus_tag LOCUS_21440 gene argF 6186 5260 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_21440 7395 6235 gene locus_tag LOCUS_21450 7395 6235 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_21450 7688 10276 gene locus_tag LOCUS_21460 gene gyrA 7688 10276 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_21460 10333 11424 gene locus_tag LOCUS_21470 gene serC 10333 11424 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_21470 11417 12613 gene locus_tag LOCUS_21480 11417 12613 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_21480 12661 13731 gene locus_tag LOCUS_21490 gene pheA 12661 13731 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_21490 13807 14925 gene locus_tag LOCUS_21500 gene hisC 13807 14925 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_21500 14922 15938 gene locus_tag LOCUS_21510 gene aroF 14922 15938 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_21510 15955 16848 gene locus_tag LOCUS_21520 15955 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 17035 17586 gene locus_tag LOCUS_21530 17035 17586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 19464 17797 gene locus_tag LOCUS_21540 19464 17797 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535875.1 protein_id gnl|my_center|LOCUS_21540 <20680 19968 gene locus_tag LOCUS_21550 <20680 19968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037048.1:methyl-accepting chemotaxis protein >Feature sequence051 2740 1295 gene locus_tag LOCUS_21560 gene nuoN 2740 1295 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_21560 4280 2796 gene locus_tag LOCUS_21570 4280 2796 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_21570 6311 4371 gene locus_tag LOCUS_21580 gene nuoL 6311 4371 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_21580 6671 6366 gene locus_tag LOCUS_21590 gene nuoK 6671 6366 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_21590 7338 6733 gene locus_tag LOCUS_21600 7338 6733 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_21600 7845 7357 gene locus_tag LOCUS_21610 gene nuoI 7845 7357 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_21610 8958 7861 gene locus_tag LOCUS_21620 gene nuoH 8958 7861 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_21620 10900 8981 gene locus_tag LOCUS_21630 gene nuoG 10900 8981 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186393.1 protein_id gnl|my_center|LOCUS_21630 12733 11456 gene locus_tag LOCUS_21640 gene nuoF 12733 11456 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_21640 13206 12730 gene locus_tag LOCUS_21650 gene nuoE 13206 12730 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185492.1 protein_id gnl|my_center|LOCUS_21650 14466 13213 gene locus_tag LOCUS_21660 14466 13213 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_21660 15145 14525 gene locus_tag LOCUS_21670 15145 14525 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_21670 15629 15153 gene locus_tag LOCUS_21680 15629 15153 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_21680 15990 15634 gene locus_tag LOCUS_21690 15990 15634 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_21690 16136 16052 gene locus_tag LOCUS_t00210 16136 16052 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16572 16195 gene locus_tag LOCUS_21700 gene secG 16572 16195 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214678.1 protein_id gnl|my_center|LOCUS_21700 17346 16591 gene locus_tag LOCUS_21710 gene tpiA 17346 16591 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_21710 18380 17580 gene locus_tag LOCUS_21720 gene pstB 18380 17580 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_21720 19242 18388 gene locus_tag LOCUS_21730 gene pstA 19242 18388 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_21730 20333 19401 gene locus_tag LOCUS_21740 gene pstC 20333 19401 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941759.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence052 550 720 gene locus_tag LOCUS_21750 550 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2026 1325 gene locus_tag LOCUS_21760 2026 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2379 2188 gene locus_tag LOCUS_21770 2379 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 5105 2778 gene locus_tag LOCUS_21780 5105 2778 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819019.1 protein_id gnl|my_center|LOCUS_21780 6283 5102 gene locus_tag LOCUS_21790 6283 5102 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209435792.1 protein_id gnl|my_center|LOCUS_21790 7734 6280 gene locus_tag LOCUS_21800 7734 6280 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_21800 8293 7910 gene locus_tag LOCUS_21810 8293 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 9570 8485 gene locus_tag LOCUS_21820 9570 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 10414 9563 gene locus_tag LOCUS_21830 10414 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 10640 10416 gene locus_tag LOCUS_21840 10640 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 11286 10756 gene locus_tag LOCUS_21850 11286 10756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 12445 11273 gene locus_tag LOCUS_21860 12445 11273 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_21860 13324 14466 gene locus_tag LOCUS_21870 13324 14466 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_21870 14500 16938 gene locus_tag LOCUS_21880 14500 16938 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210266672.1 protein_id gnl|my_center|LOCUS_21880 16886 17122 gene locus_tag LOCUS_21890 16886 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 17188 17427 gene locus_tag LOCUS_21900 17188 17427 CDS product plasmid stability protein stbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875326.1 protein_id gnl|my_center|LOCUS_21900 17424 17843 gene locus_tag LOCUS_21910 17424 17843 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_21910 18525 18292 gene locus_tag LOCUS_21920 18525 18292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence053 1156 41 gene locus_tag LOCUS_21930 1156 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1278 4667 gene locus_tag LOCUS_21940 1278 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 5456 4776 gene locus_tag LOCUS_21950 5456 4776 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120174.1 protein_id gnl|my_center|LOCUS_21950 5678 5923 gene locus_tag LOCUS_21960 5678 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 5942 6220 gene locus_tag LOCUS_21970 5942 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 7680 6418 gene locus_tag LOCUS_21980 7680 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 9918 7813 gene locus_tag LOCUS_21990 9918 7813 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 protein_id gnl|my_center|LOCUS_21990 10416 10210 gene locus_tag LOCUS_22000 gene rpoZ 10416 10210 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_22000 11104 10487 gene locus_tag LOCUS_22010 gene gmk 11104 10487 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_22010 11618 11154 gene locus_tag LOCUS_22020 gene msrA 11618 11154 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943782.1 protein_id gnl|my_center|LOCUS_22020 12332 11685 gene locus_tag LOCUS_22030 12332 11685 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804825.1 protein_id gnl|my_center|LOCUS_22030 13200 12391 gene locus_tag LOCUS_22040 13200 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 14982 13225 gene locus_tag LOCUS_22050 gene argS 14982 13225 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_22050 15825 15085 gene locus_tag LOCUS_22060 gene rlmB 15825 15085 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706327.1 protein_id gnl|my_center|LOCUS_22060 18248 16008 gene locus_tag LOCUS_22070 gene rnr 18248 16008 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945853.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence054 860 2206 gene locus_tag LOCUS_22080 860 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2214 4835 gene locus_tag LOCUS_22090 2214 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 4901 5524 gene locus_tag LOCUS_22100 4901 5524 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018676.1 protein_id gnl|my_center|LOCUS_22100 5854 5953 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6009 6833 gene locus_tag LOCUS_22110 6009 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 6958 7590 gene locus_tag LOCUS_22120 6958 7590 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_22120 8390 7587 gene locus_tag LOCUS_22130 8390 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 9743 8856 gene locus_tag LOCUS_22140 9743 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 10092 9811 gene locus_tag LOCUS_22150 10092 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 11738 10536 gene locus_tag LOCUS_22160 gene dapE 11738 10536 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 protein_id gnl|my_center|LOCUS_22160 11988 14615 gene locus_tag LOCUS_22170 11988 14615 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 protein_id gnl|my_center|LOCUS_22170 14498 14597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14761 16590 gene locus_tag LOCUS_22180 14761 16590 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_22180 16637 16996 gene locus_tag LOCUS_22190 16637 16996 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence055 3553 2132 gene locus_tag LOCUS_22200 3553 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_22200 3911 3522 gene locus_tag LOCUS_22210 3911 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166845236.1 protein_id gnl|my_center|LOCUS_22210 4795 4034 gene locus_tag LOCUS_22220 4795 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 6563 5328 gene locus_tag LOCUS_22230 6563 5328 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_22230 8146 6560 gene locus_tag LOCUS_22240 8146 6560 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_22240 8353 9747 gene locus_tag LOCUS_22250 gene gltX 8353 9747 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532170.1 protein_id gnl|my_center|LOCUS_22250 9801 9876 gene locus_tag LOCUS_t00220 9801 9876 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9913 9988 gene locus_tag LOCUS_t00230 9913 9988 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11019 10315 gene locus_tag LOCUS_22260 11019 10315 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_22260 14098 11030 gene locus_tag LOCUS_22270 14098 11030 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_22270 14733 14239 gene locus_tag LOCUS_22280 14733 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073933.1 protein_id gnl|my_center|LOCUS_22280 15437 14730 gene locus_tag LOCUS_22290 15437 14730 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_22290 <16669 15434 gene locus_tag LOCUS_22300 <16669 15434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476038.1:restriction endonuclease subunit S >Feature sequence056 77 2 gene locus_tag LOCUS_t00240 77 2 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 534 103 gene locus_tag LOCUS_22310 534 103 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948401.1 protein_id gnl|my_center|LOCUS_22310 1058 531 gene locus_tag LOCUS_22320 1058 531 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_22320 1911 1186 gene locus_tag LOCUS_22330 1911 1186 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181874519.1 protein_id gnl|my_center|LOCUS_22330 3160 1916 gene locus_tag LOCUS_22340 3160 1916 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_22340 3646 3161 gene locus_tag LOCUS_22350 gene petA 3646 3161 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_22350 6650 4014 gene locus_tag LOCUS_22360 gene secA 6650 4014 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814564.1 protein_id gnl|my_center|LOCUS_22360 7893 6976 gene locus_tag LOCUS_22370 7893 6976 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 protein_id gnl|my_center|LOCUS_22370 8072 8389 gene locus_tag LOCUS_22380 8072 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 9167 8466 gene locus_tag LOCUS_22390 9167 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22390 10081 11937 gene locus_tag LOCUS_22400 10081 11937 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014486102.1 protein_id gnl|my_center|LOCUS_22400 12125 12964 gene locus_tag LOCUS_22410 12125 12964 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_22410 13019 13837 gene locus_tag LOCUS_22420 gene aroE 13019 13837 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_22420 14074 15513 gene locus_tag LOCUS_22430 gene mgtE 14074 15513 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence057 619 131 gene locus_tag LOCUS_22440 619 131 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216102.1 protein_id gnl|my_center|LOCUS_22440 1749 670 gene locus_tag LOCUS_22450 1749 670 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_22450 2397 1786 gene locus_tag LOCUS_22460 gene cheD 2397 1786 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_22460 3265 2402 gene locus_tag LOCUS_22470 3265 2402 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525698.1 protein_id gnl|my_center|LOCUS_22470 3993 3481 gene locus_tag LOCUS_22480 gene cheW 3993 3481 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_22480 6241 4055 gene locus_tag LOCUS_22490 gene cheA 6241 4055 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205291.1 protein_id gnl|my_center|LOCUS_22490 6743 6378 gene locus_tag LOCUS_22500 6743 6378 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_22500 7390 6812 gene locus_tag LOCUS_22510 7390 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 9009 7771 gene locus_tag LOCUS_22520 9009 7771 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_22520 9986 9186 gene locus_tag LOCUS_22530 9986 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 11915 10197 gene locus_tag LOCUS_22540 11915 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 12697 12065 gene locus_tag LOCUS_22550 gene rqpR 12697 12065 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_22550 14287 12710 gene locus_tag LOCUS_22560 14287 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence058 1300 164 gene locus_tag LOCUS_22570 1300 164 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_22570 2382 1339 gene locus_tag LOCUS_22580 2382 1339 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_22580 2834 3034 gene locus_tag LOCUS_22590 2834 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 4016 3261 gene locus_tag LOCUS_22600 gene zapD 4016 3261 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_22600 4729 4115 gene locus_tag LOCUS_22610 gene coaE 4729 4115 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770017.1 protein_id gnl|my_center|LOCUS_22610 5593 4733 gene locus_tag LOCUS_22620 5593 4733 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_22620 6855 5632 gene locus_tag LOCUS_22630 6855 5632 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_22630 7366 7752 gene locus_tag LOCUS_22640 7366 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 7774 8583 gene locus_tag LOCUS_22650 gene atpB 7774 8583 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035796.1 protein_id gnl|my_center|LOCUS_22650 8642 8914 gene locus_tag LOCUS_22660 gene atpE 8642 8914 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195828.1 protein_id gnl|my_center|LOCUS_22660 8954 9427 gene locus_tag LOCUS_22670 gene atpF 8954 9427 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 protein_id gnl|my_center|LOCUS_22670 9427 9963 gene locus_tag LOCUS_22680 9427 9963 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195829.1 protein_id gnl|my_center|LOCUS_22680 9974 11515 gene locus_tag LOCUS_22690 gene atpA 9974 11515 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_22690 11519 12403 gene locus_tag LOCUS_22700 gene atpG 11519 12403 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_22700 12430 13809 gene locus_tag LOCUS_22710 gene atpD 12430 13809 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_22710 13826 14248 gene locus_tag LOCUS_22720 13826 14248 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_22720 >Feature sequence059 22 312 gene locus_tag LOCUS_22730 22 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 693 3611 gene locus_tag LOCUS_22740 693 3611 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_22740 3608 4183 gene locus_tag LOCUS_22750 3608 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 4609 5631 gene locus_tag LOCUS_22760 4609 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 5628 6614 gene locus_tag LOCUS_22770 5628 6614 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_22770 6791 6934 gene locus_tag LOCUS_22780 6791 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7343 7176 gene locus_tag LOCUS_22790 7343 7176 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096961.1 protein_id gnl|my_center|LOCUS_22790 7747 7463 gene locus_tag LOCUS_22800 7747 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 8900 8106 gene locus_tag LOCUS_22810 8900 8106 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_22810 9434 9649 gene locus_tag LOCUS_22820 9434 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 10866 9802 gene locus_tag LOCUS_22830 10866 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 11225 11929 gene locus_tag LOCUS_22840 11225 11929 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_22840 12057 12584 gene locus_tag LOCUS_22850 12057 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 13022 13429 gene locus_tag LOCUS_22860 13022 13429 CDS product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091008.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence060 395 231 gene locus_tag LOCUS_22870 395 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22870 750 2018 gene locus_tag LOCUS_22880 750 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2885 2229 gene locus_tag LOCUS_22890 2885 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 3842 2922 gene locus_tag LOCUS_22900 3842 2922 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140467.1 protein_id gnl|my_center|LOCUS_22900 4681 3899 gene locus_tag LOCUS_22910 4681 3899 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530227.1 protein_id gnl|my_center|LOCUS_22910 5855 4740 gene locus_tag LOCUS_22920 5855 4740 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922545.1 protein_id gnl|my_center|LOCUS_22920 7507 5984 gene locus_tag LOCUS_22930 7507 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 8721 7504 gene locus_tag LOCUS_22940 8721 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 10221 9238 gene locus_tag LOCUS_22950 10221 9238 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017275914.1 protein_id gnl|my_center|LOCUS_22950 11607 10450 gene locus_tag LOCUS_22960 11607 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 13514 13311 gene locus_tag LOCUS_22970 13514 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence061 3343 62 gene locus_tag LOCUS_22980 3343 62 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_22980 3710 3336 gene locus_tag LOCUS_22990 3710 3336 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968151.1 protein_id gnl|my_center|LOCUS_22990 3913 3719 gene locus_tag LOCUS_23000 3913 3719 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_23000 4552 3992 gene locus_tag LOCUS_23010 4552 3992 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_23010 5707 4601 gene locus_tag LOCUS_23020 5707 4601 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922229.1 protein_id gnl|my_center|LOCUS_23020 7311 5704 gene locus_tag LOCUS_23030 7311 5704 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_23030 7652 8164 gene locus_tag LOCUS_23040 7652 8164 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762644.1 protein_id gnl|my_center|LOCUS_23040 8497 8955 gene locus_tag LOCUS_23050 8497 8955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 9192 10514 gene locus_tag LOCUS_23060 9192 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 12440 10686 gene locus_tag LOCUS_23070 12440 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_23070 12763 12491 gene locus_tag LOCUS_23080 12763 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 13422 12826 gene locus_tag LOCUS_23090 13422 12826 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence062 1035 1367 gene locus_tag LOCUS_23100 1035 1367 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195781.1 protein_id gnl|my_center|LOCUS_23100 1837 1484 gene locus_tag LOCUS_23110 1837 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2026 2412 gene locus_tag LOCUS_23120 2026 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 2801 3325 gene locus_tag LOCUS_23130 2801 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23130 3413 4936 gene locus_tag LOCUS_23140 3413 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23140 4933 5595 gene locus_tag LOCUS_23150 4933 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 6113 5733 gene locus_tag LOCUS_23160 6113 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 7295 6468 gene locus_tag LOCUS_23170 7295 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23170 7597 7316 gene locus_tag LOCUS_23180 7597 7316 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_23180 7670 8464 gene locus_tag LOCUS_23190 7670 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 8475 10820 gene locus_tag LOCUS_23200 8475 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 10988 11203 gene locus_tag LOCUS_23210 10988 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 11673 11894 gene locus_tag LOCUS_23220 11673 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 13170 11941 gene locus_tag LOCUS_23230 13170 11941 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence063 942 217 gene locus_tag LOCUS_23240 942 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2418 1180 gene locus_tag LOCUS_23250 gene glcF 2418 1180 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522135.1 protein_id gnl|my_center|LOCUS_23250 3492 2419 gene locus_tag LOCUS_23260 gene glcE 3492 2419 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_23260 4952 3498 gene locus_tag LOCUS_23270 gene glcD 4952 3498 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_23270 5861 4956 gene locus_tag LOCUS_23280 5861 4956 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085952.1 protein_id gnl|my_center|LOCUS_23280 7906 5972 gene locus_tag LOCUS_23290 7906 5972 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086001.1 protein_id gnl|my_center|LOCUS_23290 8735 7911 gene locus_tag LOCUS_23300 8735 7911 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_23300 10085 8751 gene locus_tag LOCUS_23310 10085 8751 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 protein_id gnl|my_center|LOCUS_23310 10572 10120 gene locus_tag LOCUS_23320 10572 10120 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973802.1 protein_id gnl|my_center|LOCUS_23320 11120 12148 gene locus_tag LOCUS_23330 11120 12148 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_23330 12364 12861 gene locus_tag LOCUS_23340 12364 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence064 626 51 gene locus_tag LOCUS_23350 626 51 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019213468.1 protein_id gnl|my_center|LOCUS_23350 789 995 gene locus_tag LOCUS_23360 789 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 992 1960 gene locus_tag LOCUS_23370 992 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2942 2049 gene locus_tag LOCUS_23380 2942 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3157 3363 gene locus_tag LOCUS_23390 3157 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3356 3577 gene locus_tag LOCUS_23400 3356 3577 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_23400 3602 4999 gene locus_tag LOCUS_23410 3602 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 5454 5026 gene locus_tag LOCUS_23420 5454 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 6037 5801 gene locus_tag LOCUS_23430 6037 5801 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_23430 9792 6367 gene locus_tag LOCUS_23440 9792 6367 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_23440 12506 9789 gene locus_tag LOCUS_23450 12506 9789 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence065 177 1127 gene locus_tag LOCUS_23460 177 1127 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_23460 1192 1809 gene locus_tag LOCUS_23470 1192 1809 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_23470 1984 2553 gene locus_tag LOCUS_23480 gene pth 1984 2553 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185241.1 protein_id gnl|my_center|LOCUS_23480 2636 3727 gene locus_tag LOCUS_23490 gene ychF 2636 3727 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_23490 3874 9030 gene locus_tag LOCUS_23500 3874 9030 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_23500 9698 9396 gene locus_tag LOCUS_23510 9698 9396 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_23510 <12857 9832 gene locus_tag LOCUS_23520 <12857 9832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070913.1:RNA polymerase-associated protein RapA >Feature sequence066 475 1827 gene locus_tag LOCUS_23530 gene hflX 475 1827 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261607.1 protein_id gnl|my_center|LOCUS_23530 2307 4265 gene locus_tag LOCUS_23540 2307 4265 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033451799.1 protein_id gnl|my_center|LOCUS_23540 4272 6677 gene locus_tag LOCUS_23550 gene parC 4272 6677 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063976.1 protein_id gnl|my_center|LOCUS_23550 6761 7561 gene locus_tag LOCUS_23560 6761 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 7626 8468 gene locus_tag LOCUS_23570 7626 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 8481 8729 gene locus_tag LOCUS_23580 8481 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 9090 8752 gene locus_tag LOCUS_23590 9090 8752 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_23590 9475 9672 gene locus_tag LOCUS_23600 9475 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 10370 9756 gene locus_tag LOCUS_23610 10370 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 10428 10988 gene locus_tag LOCUS_23620 10428 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 11194 11577 gene locus_tag LOCUS_23630 11194 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence067 4304 99 gene locus_tag LOCUS_23640 gene rpoC 4304 99 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521902.1 protein_id gnl|my_center|LOCUS_23640 8478 4405 gene locus_tag LOCUS_23650 gene rpoB 8478 4405 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_23650 9017 8634 gene locus_tag LOCUS_23660 gene rplL 9017 8634 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_23660 9588 9073 gene locus_tag LOCUS_23670 gene rplJ 9588 9073 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_23670 10587 9889 gene locus_tag LOCUS_23680 gene rplA 10587 9889 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_23680 11023 10589 gene locus_tag LOCUS_23690 gene rplK 11023 10589 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_23690 11672 11139 gene locus_tag LOCUS_23700 gene nusG 11672 11139 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_23700 12038 11694 gene locus_tag LOCUS_23710 gene secE 12038 11694 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551020.1 protein_id gnl|my_center|LOCUS_23710 12303 12228 gene locus_tag LOCUS_t00250 12303 12228 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 305 1354 gene locus_tag LOCUS_23720 305 1354 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_23720 1855 2070 gene locus_tag LOCUS_23730 1855 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 2292 2666 gene locus_tag LOCUS_23740 2292 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 3046 3399 gene locus_tag LOCUS_23750 3046 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4055 5377 gene locus_tag LOCUS_23760 4055 5377 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_23760 5402 6997 gene locus_tag LOCUS_23770 5402 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 6999 10133 gene locus_tag LOCUS_23780 6999 10133 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244431.1 protein_id gnl|my_center|LOCUS_23780 10141 10341 gene locus_tag LOCUS_23790 10141 10341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 10728 11399 gene locus_tag LOCUS_23800 10728 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence069 489 58 gene locus_tag LOCUS_23810 489 58 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767420.1 protein_id gnl|my_center|LOCUS_23810 1821 520 gene locus_tag LOCUS_23820 1821 520 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_23820 3013 1856 gene locus_tag LOCUS_23830 3013 1856 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_23830 3241 3056 gene locus_tag LOCUS_23840 3241 3056 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193501.1 protein_id gnl|my_center|LOCUS_23840 4336 3461 gene locus_tag LOCUS_23850 gene hflC 4336 3461 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810713.1 protein_id gnl|my_center|LOCUS_23850 5515 4337 gene locus_tag LOCUS_23860 gene hflK 5515 4337 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_23860 6709 5537 gene locus_tag LOCUS_23870 gene hflX 6709 5537 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_23870 6972 6727 gene locus_tag LOCUS_23880 gene hfq 6972 6727 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_23880 8029 7244 gene locus_tag LOCUS_23890 8029 7244 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 protein_id gnl|my_center|LOCUS_23890 8977 8417 gene locus_tag LOCUS_23900 8977 8417 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_23900 9198 10907 gene locus_tag LOCUS_23910 9198 10907 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_23910 10895 11497 gene locus_tag LOCUS_23920 10895 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence070 1076 567 gene locus_tag LOCUS_23930 1076 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524989.1 protein_id gnl|my_center|LOCUS_23930 2265 1201 gene locus_tag LOCUS_23940 2265 1201 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_23940 3510 2674 gene locus_tag LOCUS_23950 3510 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 5438 3720 gene locus_tag LOCUS_23960 5438 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 5922 6245 gene locus_tag LOCUS_23970 5922 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6442 6900 gene locus_tag LOCUS_23980 6442 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 7297 7710 gene locus_tag LOCUS_23990 gene rnk 7297 7710 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_23990 8559 7765 gene locus_tag LOCUS_24000 8559 7765 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529223.1 protein_id gnl|my_center|LOCUS_24000 9586 8618 gene locus_tag LOCUS_24010 9586 8618 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247693.1 protein_id gnl|my_center|LOCUS_24010 10474 9704 gene locus_tag LOCUS_24020 10474 9704 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234254.1 protein_id gnl|my_center|LOCUS_24020 <11369 10704 gene locus_tag LOCUS_24030 <11369 10704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024108533.1:arsenite efflux transporter ATPase subunit ArsA >Feature sequence071 3677 201 gene locus_tag LOCUS_24040 3677 201 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_24040 6429 3679 gene locus_tag LOCUS_24050 6429 3679 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_24050 6781 6458 gene locus_tag LOCUS_24060 6781 6458 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_24060 7079 7732 gene locus_tag LOCUS_24070 7079 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 7845 8783 gene locus_tag LOCUS_24080 7845 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 8837 10831 gene locus_tag LOCUS_24090 8837 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence072 2226 943 gene locus_tag LOCUS_24100 2226 943 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_24100 3243 2365 gene locus_tag LOCUS_24110 3243 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3655 3254 gene locus_tag LOCUS_24120 3655 3254 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_24120 4289 3642 gene locus_tag LOCUS_24130 4289 3642 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_24130 4669 5058 gene locus_tag LOCUS_24140 4669 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 5906 5124 gene locus_tag LOCUS_24150 5906 5124 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208699.1 protein_id gnl|my_center|LOCUS_24150 6226 5909 gene locus_tag LOCUS_24160 6226 5909 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930342.1 protein_id gnl|my_center|LOCUS_24160 7247 6213 gene locus_tag LOCUS_24170 7247 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 7658 7314 gene locus_tag LOCUS_24180 7658 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 8097 7684 gene locus_tag LOCUS_24190 gene fliS 8097 7684 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 protein_id gnl|my_center|LOCUS_24190 10127 8160 gene locus_tag LOCUS_24200 10127 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 10520 10161 gene locus_tag LOCUS_24210 10520 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 <11296 10616 gene locus_tag LOCUS_24220 <11296 10616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947070.1:flagellin >Feature sequence073 931 416 gene locus_tag LOCUS_24230 931 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1542 943 gene locus_tag LOCUS_24240 1542 943 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693948.1 protein_id gnl|my_center|LOCUS_24240 1645 3438 gene locus_tag LOCUS_24250 gene mutL 1645 3438 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194266.1 protein_id gnl|my_center|LOCUS_24250 4784 3753 gene locus_tag LOCUS_24260 4784 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 5261 5046 gene locus_tag LOCUS_24270 5261 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 5640 5497 gene locus_tag LOCUS_24280 5640 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 5740 6657 gene locus_tag LOCUS_24290 5740 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 6722 7405 gene locus_tag LOCUS_24300 6722 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 8322 7492 gene locus_tag LOCUS_24310 8322 7492 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947257.1 protein_id gnl|my_center|LOCUS_24310 10696 8315 gene locus_tag LOCUS_24320 gene ppsA 10696 8315 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence074 2164 320 gene locus_tag LOCUS_24330 2164 320 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967198.1 protein_id gnl|my_center|LOCUS_24330 2382 2672 gene locus_tag LOCUS_24340 2382 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2917 2738 gene locus_tag LOCUS_24350 2917 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3576 5108 gene locus_tag LOCUS_24360 3576 5108 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117871.1 protein_id gnl|my_center|LOCUS_24360 5132 5851 gene locus_tag LOCUS_24370 5132 5851 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815182.1 protein_id gnl|my_center|LOCUS_24370 5848 7131 gene locus_tag LOCUS_24380 5848 7131 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929964.1 protein_id gnl|my_center|LOCUS_24380 7504 8760 gene locus_tag LOCUS_24390 gene istA 7504 8760 CDS product IS21-like element IS1326 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324342.1 protein_id gnl|my_center|LOCUS_24390 8753 9562 gene locus_tag LOCUS_24400 gene istB 8753 9562 CDS product IS21-like element IS1326 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence075 871 41 gene locus_tag LOCUS_24410 871 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24410 1062 865 gene locus_tag LOCUS_24420 1062 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24420 1679 2617 gene locus_tag LOCUS_24430 1679 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2632 3498 gene locus_tag LOCUS_24440 2632 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3577 4941 gene locus_tag LOCUS_24450 3577 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4973 5878 gene locus_tag LOCUS_24460 gene epsG 4973 5878 CDS product chain length determinant protein tyrosine kinase EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106760242.1 protein_id gnl|my_center|LOCUS_24460 5889 6752 gene locus_tag LOCUS_24470 gene xrt 5889 6752 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_24470 6923 7630 gene locus_tag LOCUS_24480 6923 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 8453 9490 gene locus_tag LOCUS_24490 8453 9490 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704484.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence076 3169 32 gene locus_tag LOCUS_24500 3169 32 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_24500 4676 3543 gene locus_tag LOCUS_24510 4676 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 5377 4739 gene locus_tag LOCUS_24520 5377 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 5794 5390 gene locus_tag LOCUS_24530 5794 5390 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_24530 6410 5796 gene locus_tag LOCUS_24540 6410 5796 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_24540 7917 6412 gene locus_tag LOCUS_24550 7917 6412 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707899.1 protein_id gnl|my_center|LOCUS_24550 8693 7914 gene locus_tag LOCUS_24560 8693 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence077 574 137 gene locus_tag LOCUS_24570 574 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1177 1791 gene locus_tag LOCUS_24580 gene ccmA 1177 1791 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209693.1 protein_id gnl|my_center|LOCUS_24580 1798 2451 gene locus_tag LOCUS_24590 gene ccmB 1798 2451 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_24590 2708 3391 gene locus_tag LOCUS_24600 gene ccmC 2708 3391 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_24600 3392 3589 gene locus_tag LOCUS_24610 3392 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 3573 4022 gene locus_tag LOCUS_24620 gene ccmE 3573 4022 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_24620 4092 6146 gene locus_tag LOCUS_24630 4092 6146 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_24630 6143 6673 gene locus_tag LOCUS_24640 6143 6673 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070641.1 protein_id gnl|my_center|LOCUS_24640 6673 7218 gene locus_tag LOCUS_24650 6673 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 7215 8534 gene locus_tag LOCUS_24660 gene ccmI 7215 8534 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_24660 8584 9048 gene locus_tag LOCUS_24670 8584 9048 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence078 360 67 gene locus_tag LOCUS_24680 360 67 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190833654.1 protein_id gnl|my_center|LOCUS_24680 603 361 gene locus_tag LOCUS_24690 603 361 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_24690 784 957 gene locus_tag LOCUS_24700 784 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1150 2094 gene locus_tag LOCUS_24710 1150 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3992 5050 gene locus_tag LOCUS_24720 3992 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5098 5505 gene locus_tag LOCUS_24730 5098 5505 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_24730 5512 6969 gene locus_tag LOCUS_24740 5512 6969 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545843.1 protein_id gnl|my_center|LOCUS_24740 6962 7594 gene locus_tag LOCUS_24750 6962 7594 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528392.1 protein_id gnl|my_center|LOCUS_24750 8240 7602 gene locus_tag LOCUS_24760 8240 7602 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_24760 8580 8272 gene locus_tag LOCUS_24770 8580 8272 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_24770 <9152 8618 gene locus_tag LOCUS_24780 <9152 8618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113877.1:spermidine/putrescine ABC transporter substrate-binding protein >Feature sequence079 315 1 gene locus_tag LOCUS_24790 315 1 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_24790 677 1156 gene locus_tag LOCUS_24800 677 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 1156 2292 gene locus_tag LOCUS_24810 1156 2292 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892004.1 protein_id gnl|my_center|LOCUS_24810 2533 2712 gene locus_tag LOCUS_24820 2533 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2842 3060 gene locus_tag LOCUS_24830 2842 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 3564 3298 gene locus_tag LOCUS_24840 3564 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4851 3721 gene locus_tag LOCUS_24850 4851 3721 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999116.1 protein_id gnl|my_center|LOCUS_24850 5372 5073 gene locus_tag LOCUS_24860 5372 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 5874 5491 gene locus_tag LOCUS_24870 5874 5491 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_24870 6759 6454 gene locus_tag LOCUS_24880 6759 6454 CDS product DUF1840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463615.1 protein_id gnl|my_center|LOCUS_24880 7865 7338 gene locus_tag LOCUS_24890 7865 7338 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844776.1 protein_id gnl|my_center|LOCUS_24890 >Feature sequence080 389 75 gene locus_tag LOCUS_24900 389 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 673 488 gene locus_tag LOCUS_24910 673 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1693 1617 gene locus_tag LOCUS_t00260 1693 1617 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2663 1776 gene locus_tag LOCUS_24920 2663 1776 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770085.1 protein_id gnl|my_center|LOCUS_24920 3034 4182 gene locus_tag LOCUS_24930 3034 4182 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_24930 5448 4210 gene locus_tag LOCUS_24940 5448 4210 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_24940 6467 5571 gene locus_tag LOCUS_24950 gene hemF 6467 5571 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703138.1 protein_id gnl|my_center|LOCUS_24950 6810 7976 gene locus_tag LOCUS_24960 gene aroC 6810 7976 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence081 1099 536 gene locus_tag LOCUS_24970 1099 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 1576 2187 gene locus_tag LOCUS_24980 1576 2187 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_24980 2184 3011 gene locus_tag LOCUS_24990 2184 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 3303 3082 gene locus_tag LOCUS_25000 3303 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 3885 5363 gene locus_tag LOCUS_25010 3885 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 6212 6775 gene locus_tag LOCUS_25020 6212 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 7019 7612 gene locus_tag LOCUS_25030 7019 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25030 7537 7938 gene locus_tag LOCUS_25040 7537 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25040 >Feature sequence082 104 760 gene locus_tag LOCUS_25050 104 760 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_25050 851 2182 gene locus_tag LOCUS_25060 851 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2515 2868 gene locus_tag LOCUS_25070 2515 2868 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019555.1 protein_id gnl|my_center|LOCUS_25070 3050 4336 gene locus_tag LOCUS_25080 3050 4336 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_25080 4338 4538 gene locus_tag LOCUS_25090 4338 4538 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_25090 4712 6121 gene locus_tag LOCUS_25100 4712 6121 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044950.1 protein_id gnl|my_center|LOCUS_25100 6132 7220 gene locus_tag LOCUS_25110 6132 7220 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_25110 >Feature sequence083 64 1131 gene locus_tag LOCUS_25120 64 1131 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_25120 2576 1254 gene locus_tag LOCUS_25130 2576 1254 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_25130 3662 2751 gene locus_tag LOCUS_25140 3662 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 4054 5082 gene locus_tag LOCUS_25150 4054 5082 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072067.1 protein_id gnl|my_center|LOCUS_25150 5079 5846 gene locus_tag LOCUS_25160 5079 5846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072068.1 protein_id gnl|my_center|LOCUS_25160 6802 5951 gene locus_tag LOCUS_25170 6802 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence084 547 161 gene locus_tag LOCUS_25180 gene pilG 547 161 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_25180 2178 721 gene locus_tag LOCUS_25190 2178 721 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807338.1 protein_id gnl|my_center|LOCUS_25190 3642 2191 gene locus_tag LOCUS_25200 gene trkA 3642 2191 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_25200 4480 3698 gene locus_tag LOCUS_25210 4480 3698 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_25210 5040 4483 gene locus_tag LOCUS_25220 5040 4483 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_25220 5266 6012 gene locus_tag LOCUS_25230 5266 6012 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_25230 6063 7403 gene locus_tag LOCUS_25240 gene argA 6063 7403 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930879.1 protein_id gnl|my_center|LOCUS_25240 7521 7799 gene locus_tag LOCUS_25250 7521 7799 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence085 234 845 gene locus_tag LOCUS_25260 234 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 961 1209 gene locus_tag LOCUS_25270 961 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1206 1532 gene locus_tag LOCUS_25280 1206 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1529 1828 gene locus_tag LOCUS_25290 1529 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1828 3978 gene locus_tag LOCUS_25300 1828 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 4248 4757 gene locus_tag LOCUS_25310 4248 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 4947 6017 gene locus_tag LOCUS_25320 4947 6017 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039177.1 protein_id gnl|my_center|LOCUS_25320 7425 6400 gene locus_tag LOCUS_25330 7425 6400 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence086 160 405 gene locus_tag LOCUS_25340 160 405 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532247.1 protein_id gnl|my_center|LOCUS_25340 405 680 gene locus_tag LOCUS_25350 405 680 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141822.1 protein_id gnl|my_center|LOCUS_25350 868 1974 gene locus_tag LOCUS_25360 868 1974 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_25360 2226 3485 gene locus_tag LOCUS_25370 2226 3485 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_25370 3489 6947 gene locus_tag LOCUS_25380 3489 6947 CDS product YhaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389025.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence087 <1 661 gene locus_tag LOCUS_25390 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932591.1:DEAD/DEAH box helicase family protein 782 4033 gene locus_tag LOCUS_25400 782 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 5225 5013 gene locus_tag LOCUS_25410 5225 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 6348 5230 gene locus_tag LOCUS_25420 6348 5230 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068555034.1 protein_id gnl|my_center|LOCUS_25420 6953 6348 gene locus_tag LOCUS_25430 6953 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence088 621 535 gene locus_tag LOCUS_t00270 621 535 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 728 1762 gene locus_tag LOCUS_25440 gene queA 728 1762 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073010.1 protein_id gnl|my_center|LOCUS_25440 1759 2844 gene locus_tag LOCUS_25450 gene tgt 1759 2844 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_25450 2898 3353 gene locus_tag LOCUS_25460 2898 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 3454 5535 gene locus_tag LOCUS_25470 gene secD 3454 5535 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_25470 5563 6501 gene locus_tag LOCUS_25480 gene secF 5563 6501 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence089 598 993 gene locus_tag LOCUS_25490 598 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1142 1558 gene locus_tag LOCUS_25500 1142 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 1752 2027 gene locus_tag LOCUS_25510 1752 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 2101 2418 gene locus_tag LOCUS_25520 2101 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 2424 2873 gene locus_tag LOCUS_25530 2424 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 2873 3241 gene locus_tag LOCUS_25540 2873 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 3406 4821 gene locus_tag LOCUS_25550 3406 4821 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815311.1 protein_id gnl|my_center|LOCUS_25550 5114 5410 gene locus_tag LOCUS_25560 5114 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 5571 6638 gene locus_tag LOCUS_25570 5571 6638 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence090 422 18 gene locus_tag LOCUS_25580 gene tnpA 422 18 CDS product IS200/IS605-like element ISH34 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903989.1 protein_id gnl|my_center|LOCUS_25580 628 443 gene locus_tag LOCUS_25590 628 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 782 1060 gene locus_tag LOCUS_25600 782 1060 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_25600 1057 1908 gene locus_tag LOCUS_25610 1057 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25610 1924 2205 gene locus_tag LOCUS_25620 1924 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 2566 2967 gene locus_tag LOCUS_25630 2566 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3794 2964 gene locus_tag LOCUS_25640 3794 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25640 4054 3788 gene locus_tag LOCUS_25650 4054 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25650 4129 6435 gene locus_tag LOCUS_25660 4129 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence091 404 1126 gene locus_tag LOCUS_25670 404 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 1296 2834 gene locus_tag LOCUS_25680 gene murJ 1296 2834 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211214.1 protein_id gnl|my_center|LOCUS_25680 4235 2967 gene locus_tag LOCUS_25690 4235 2967 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 protein_id gnl|my_center|LOCUS_25690 4905 4222 gene locus_tag LOCUS_25700 4905 4222 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_25700 5455 5045 gene locus_tag LOCUS_25710 5455 5045 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066673.1 protein_id gnl|my_center|LOCUS_25710 6216 5560 gene locus_tag LOCUS_25720 6216 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence092 1011 1325 gene locus_tag LOCUS_25730 1011 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1322 1834 gene locus_tag LOCUS_25740 1322 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 >Feature sequence093 3284 1548 gene locus_tag LOCUS_25750 3284 1548 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033452234.1 protein_id gnl|my_center|LOCUS_25750 3819 3325 gene locus_tag LOCUS_25760 gene cheW 3819 3325 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 protein_id gnl|my_center|LOCUS_25760 4158 4544 gene locus_tag LOCUS_25770 4158 4544 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_25770 5244 4549 gene locus_tag LOCUS_25780 5244 4549 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_25780 5515 5721 gene locus_tag LOCUS_25790 5515 5721 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence094 520 732 gene locus_tag LOCUS_25800 520 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 729 3122 gene locus_tag LOCUS_25810 729 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3142 4266 gene locus_tag LOCUS_25820 3142 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 4275 4691 gene locus_tag LOCUS_25830 4275 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence095 <1 2585 gene locus_tag LOCUS_25840 <1 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941062.1:efflux RND transporter permease subunit 3649 2642 gene locus_tag LOCUS_25850 3649 2642 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_25850 4085 3669 gene locus_tag LOCUS_25860 gene arfB 4085 3669 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_25860 4786 4139 gene locus_tag LOCUS_25870 4786 4139 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943063.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence096 318 1823 gene locus_tag LOCUS_25880 318 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 2873 1890 gene locus_tag LOCUS_25890 2873 1890 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921968.1 protein_id gnl|my_center|LOCUS_25890 3384 4364 gene locus_tag LOCUS_25900 3384 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 4435 4869 gene locus_tag LOCUS_25910 4435 4869 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214035.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence097 2240 678 gene locus_tag LOCUS_25920 2240 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2650 3303 gene locus_tag LOCUS_25930 2650 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4390 4091 gene locus_tag LOCUS_25940 4390 4091 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971862.1 protein_id gnl|my_center|LOCUS_25940 4635 4387 gene locus_tag LOCUS_25950 4635 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence098 316 122 gene locus_tag LOCUS_25960 316 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence099 2 268 gene locus_tag LOCUS_25970 2 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 884 666 gene locus_tag LOCUS_25980 884 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 1051 1179 gene locus_tag LOCUS_25990 1051 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1429 3639 gene locus_tag LOCUS_26000 1429 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 3660 4367 gene locus_tag LOCUS_26010 3660 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence100 199 579 gene locus_tag LOCUS_26020 199 579 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388677.1 protein_id gnl|my_center|LOCUS_26020 566 880 gene locus_tag LOCUS_26030 566 880 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141642.1 protein_id gnl|my_center|LOCUS_26030 937 1113 gene locus_tag LOCUS_26040 937 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 1148 1432 gene locus_tag LOCUS_26050 1148 1432 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390817.1 protein_id gnl|my_center|LOCUS_26050 1449 1781 gene locus_tag LOCUS_26060 1449 1781 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_26060 2063 2212 gene locus_tag LOCUS_26070 2063 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 2197 2478 gene locus_tag LOCUS_26080 2197 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 2959 3219 gene locus_tag LOCUS_26090 2959 3219 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529165.1 protein_id gnl|my_center|LOCUS_26090 3219 3527 gene locus_tag LOCUS_26100 3219 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 4063 3641 gene locus_tag LOCUS_26110 4063 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence101 913 1407 gene locus_tag LOCUS_26120 913 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1656 1781 gene locus_tag LOCUS_26130 1656 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 3683 2085 gene locus_tag LOCUS_26140 3683 2085 CDS product IS5-like element ISLca3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673997.1 protein_id gnl|my_center|LOCUS_26140 4068 3892 gene locus_tag LOCUS_26150 4068 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence102 <1 852 gene locus_tag LOCUS_26160 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112465.1:diguanylate cyclase 2298 901 gene locus_tag LOCUS_26170 2298 901 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_26170 3656 2319 gene locus_tag LOCUS_26180 3656 2319 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105299.1 protein_id gnl|my_center|LOCUS_26180 >Feature sequence103 705 1274 gene locus_tag LOCUS_26190 705 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1361 2545 gene locus_tag LOCUS_26200 1361 2545 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532464.1 protein_id gnl|my_center|LOCUS_26200 2617 3213 gene locus_tag LOCUS_26210 2617 3213 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196513.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence104 86 1336 gene locus_tag LOCUS_26220 86 1336 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019197495.1 protein_id gnl|my_center|LOCUS_26220 1350 1784 gene locus_tag LOCUS_26230 1350 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1899 2504 gene locus_tag LOCUS_26240 gene umuD 1899 2504 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_26240 2567 3853 gene locus_tag LOCUS_26250 gene umuC 2567 3853 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457628.1 protein_id gnl|my_center|LOCUS_26250 >Feature sequence105 703 89 gene locus_tag LOCUS_26260 703 89 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904941.1 protein_id gnl|my_center|LOCUS_26260 836 3805 gene locus_tag LOCUS_26270 836 3805 CDS product Tn3-like element ISPa38 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100881.1 protein_id gnl|my_center|LOCUS_26270 >Feature sequence106 1212 355 gene locus_tag LOCUS_26280 1212 355 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_26280 3134 1269 gene locus_tag LOCUS_26290 3134 1269 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_26290 3477 3902 gene locus_tag LOCUS_26300 3477 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence107 >Feature sequence108 <1 1332 gene locus_tag LOCUS_26310 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974832.1:IncP-type conjugal transfer protein TrbI 1440 2144 gene locus_tag LOCUS_26320 gene trbJ 1440 2144 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039736.1 protein_id gnl|my_center|LOCUS_26320 2172 2348 gene locus_tag LOCUS_26330 2172 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence109 <3040 908 gene locus_tag LOCUS_26340 <3040 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980934.1:iron-regulated protein FrpC >Feature sequence110 235 570 gene locus_tag LOCUS_26350 235 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 583 2607 gene locus_tag LOCUS_26360 583 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence111 <2974 386 gene locus_tag LOCUS_26370 <2974 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994041.1:glucoamylase family protein >Feature sequence112 1581 208 gene locus_tag LOCUS_26380 1581 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26380 2094 1762 gene locus_tag LOCUS_26390 2094 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2357 2091 gene locus_tag LOCUS_26400 2357 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2691 2422 gene locus_tag LOCUS_26410 2691 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence113 <1 1109 gene locus_tag LOCUS_26420 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028755117.1:conjugal transfer protein TrbE 1106 1870 gene locus_tag LOCUS_26430 1106 1870 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence114 1373 456 gene locus_tag LOCUS_26440 1373 456 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_26440 1706 1915 gene locus_tag LOCUS_26450 1706 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1923 2054 gene locus_tag LOCUS_26460 1923 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 2051 2173 gene locus_tag LOCUS_26470 2051 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence115 545 1270 gene locus_tag LOCUS_26480 545 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 <2324 1289 gene locus_tag LOCUS_26490 <2324 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000516666.1:catalase family protein >Feature sequence116 352 690 gene locus_tag LOCUS_26500 352 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 683 1009 gene locus_tag LOCUS_26510 683 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1164 1877 gene locus_tag LOCUS_26520 1164 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 >Feature sequence117 1125 166 gene locus_tag LOCUS_26530 1125 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 1768 1556 gene locus_tag LOCUS_26540 1768 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence118 884 63 gene locus_tag LOCUS_26550 884 63 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947780.1 protein_id gnl|my_center|LOCUS_26550 1261 1593 gene locus_tag LOCUS_26560 1261 1593 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198701.1 protein_id gnl|my_center|LOCUS_26560 1614 1811 gene locus_tag LOCUS_26570 1614 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence119 248 1753 gene locus_tag LOCUS_26580 248 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence120 482 1135 gene locus_tag LOCUS_26590 482 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1606 1316 gene locus_tag LOCUS_26600 1606 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence121 137 439 gene locus_tag LOCUS_26610 137 439 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_26610 844 1167 gene locus_tag LOCUS_26620 844 1167 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533331.1 protein_id gnl|my_center|LOCUS_26620 1164 1571 gene locus_tag LOCUS_26630 1164 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26630 >Feature sequence122 <1 1012 gene locus_tag LOCUS_26640 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000410378.1:ParB/RepB/Spo0J family partition protein 1052 1423 gene locus_tag LOCUS_26650 1052 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 >Feature sequence123 <1 800 gene locus_tag LOCUS_26660 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051345820.1:selenide, water dikinase SelD