>Feature sequence01 229 47 gene locus_tag LOCUS_00010 229 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 396 1871 gene locus_tag LOCUS_00020 396 1871 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348025.1 protein_id gnl|my_center|LOCUS_00020 3113 2367 gene locus_tag LOCUS_00030 3113 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4648 3113 gene locus_tag LOCUS_00040 4648 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00040 5214 4906 gene locus_tag LOCUS_00050 5214 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6690 5224 gene locus_tag LOCUS_00060 6690 5224 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037929.1 protein_id gnl|my_center|LOCUS_00060 6889 7326 gene locus_tag LOCUS_00070 6889 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8177 7380 gene locus_tag LOCUS_00080 8177 7380 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813469.1 protein_id gnl|my_center|LOCUS_00080 9381 8206 gene locus_tag LOCUS_00090 9381 8206 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813463.1 protein_id gnl|my_center|LOCUS_00090 10983 9415 gene locus_tag LOCUS_00100 10983 9415 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_00100 11688 11023 gene locus_tag LOCUS_00110 11688 11023 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813455.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00110 12854 11802 gene locus_tag LOCUS_00120 12854 11802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00120 13878 12859 gene locus_tag LOCUS_00130 13878 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00130 12866 12875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15188 13920 gene locus_tag LOCUS_00140 15188 13920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 protein_id gnl|my_center|LOCUS_00140 15541 15855 gene locus_tag LOCUS_00150 15541 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16018 16203 gene locus_tag LOCUS_00160 16018 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00160 16402 16635 gene locus_tag LOCUS_00170 16402 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00170 16666 16965 gene locus_tag LOCUS_00180 16666 16965 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129559.1 protein_id gnl|my_center|LOCUS_00180 17223 17828 gene locus_tag LOCUS_00190 17223 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19271 18003 gene locus_tag LOCUS_00200 19271 18003 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813994.1 protein_id gnl|my_center|LOCUS_00200 20554 19307 gene locus_tag LOCUS_00210 20554 19307 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813458.1 protein_id gnl|my_center|LOCUS_00210 22052 20808 gene locus_tag LOCUS_00220 gene caiB 22052 20808 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345588.1 protein_id gnl|my_center|LOCUS_00220 22236 23471 gene locus_tag LOCUS_00230 gene caiB 22236 23471 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345588.1 protein_id gnl|my_center|LOCUS_00230 24152 24003 gene locus_tag LOCUS_00240 24152 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25632 24628 gene locus_tag LOCUS_00250 25632 24628 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081212.1 protein_id gnl|my_center|LOCUS_00250 25753 26232 gene locus_tag LOCUS_00260 25753 26232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26578 27168 gene locus_tag LOCUS_00270 26578 27168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27181 27915 gene locus_tag LOCUS_00280 27181 27915 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681221.1 protein_id gnl|my_center|LOCUS_00280 27915 29309 gene locus_tag LOCUS_00290 27915 29309 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681219.1 protein_id gnl|my_center|LOCUS_00290 29311 31116 gene locus_tag LOCUS_00300 29311 31116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460630.1 protein_id gnl|my_center|LOCUS_00300 31106 32857 gene locus_tag LOCUS_00310 31106 32857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_00310 33991 32891 gene locus_tag LOCUS_00320 33991 32891 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_00320 35019 34048 gene locus_tag LOCUS_00330 35019 34048 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_00330 36249 35107 gene locus_tag LOCUS_00340 36249 35107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37385 36330 gene locus_tag LOCUS_00350 37385 36330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37668 37405 gene locus_tag LOCUS_00360 37668 37405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38651 37695 gene locus_tag LOCUS_00370 38651 37695 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 protein_id gnl|my_center|LOCUS_00370 38860 39759 gene locus_tag LOCUS_00380 38860 39759 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_00380 40829 39819 gene locus_tag LOCUS_00390 40829 39819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41479 40862 gene locus_tag LOCUS_00400 41479 40862 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_00400 42637 41765 gene locus_tag LOCUS_00410 42637 41765 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464393.1 protein_id gnl|my_center|LOCUS_00410 43223 42714 gene locus_tag LOCUS_00420 43223 42714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43355 44221 gene locus_tag LOCUS_00430 43355 44221 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_00430 44332 45282 gene locus_tag LOCUS_00440 44332 45282 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817700.1 protein_id gnl|my_center|LOCUS_00440 45735 45538 gene locus_tag LOCUS_00450 45735 45538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 45971 47752 gene locus_tag LOCUS_00460 45971 47752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 48060 47914 gene locus_tag LOCUS_00470 48060 47914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48115 49575 gene locus_tag LOCUS_00480 48115 49575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_00480 49896 51104 gene locus_tag LOCUS_00490 49896 51104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51110 52744 gene locus_tag LOCUS_00500 51110 52744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52741 55677 gene locus_tag LOCUS_00510 52741 55677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 55683 56750 gene locus_tag LOCUS_00520 55683 56750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 56765 56980 gene locus_tag LOCUS_00530 56765 56980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 56866 58350 gene locus_tag LOCUS_00540 gene cas1 56866 58350 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_00540 58347 58646 gene locus_tag LOCUS_00550 58347 58646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58928 59822 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atggctgggatattttcccagtcccttcgttgaggg 59875 60687 gene locus_tag LOCUS_00560 59875 60687 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_00560 61783 60839 gene locus_tag LOCUS_00570 61783 60839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 62002 63075 gene locus_tag LOCUS_00580 62002 63075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 64301 63156 gene locus_tag LOCUS_00590 64301 63156 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_00590 65806 64298 gene locus_tag LOCUS_00600 65806 64298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 66866 65949 gene locus_tag LOCUS_00610 gene modA 66866 65949 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461081.1 protein_id gnl|my_center|LOCUS_00610 68668 67289 gene locus_tag LOCUS_00620 68668 67289 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704269.1 protein_id gnl|my_center|LOCUS_00620 69663 68767 gene locus_tag LOCUS_00630 69663 68767 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146742.1 protein_id gnl|my_center|LOCUS_00630 70822 69935 gene locus_tag LOCUS_00640 70822 69935 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439900.1 protein_id gnl|my_center|LOCUS_00640 71514 70975 gene locus_tag LOCUS_00650 71514 70975 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816608.1 protein_id gnl|my_center|LOCUS_00650 71739 73847 gene locus_tag LOCUS_00660 71739 73847 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545767.1 protein_id gnl|my_center|LOCUS_00660 74041 74526 gene locus_tag LOCUS_00670 74041 74526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 76112 74742 gene locus_tag LOCUS_00680 76112 74742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005118518.1 protein_id gnl|my_center|LOCUS_00680 76575 76156 gene locus_tag LOCUS_00690 76575 76156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 76861 76559 gene locus_tag LOCUS_00700 76861 76559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 78425 77202 gene locus_tag LOCUS_00710 78425 77202 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_00710 79624 78422 gene locus_tag LOCUS_00720 79624 78422 CDS product 5-bromo-4-chloroindolyl phosphate hydrolysis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890534.1 protein_id gnl|my_center|LOCUS_00720 80102 79764 gene locus_tag LOCUS_00730 gene glnK1 80102 79764 CDS product P-II family nitrogen regulator GlnK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869551.1 protein_id gnl|my_center|LOCUS_00730 81416 80142 gene locus_tag LOCUS_00740 81416 80142 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906047.1 protein_id gnl|my_center|LOCUS_00740 81806 83416 gene locus_tag LOCUS_00750 81806 83416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 83430 84116 gene locus_tag LOCUS_00760 83430 84116 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 protein_id gnl|my_center|LOCUS_00760 84210 84785 gene locus_tag LOCUS_00770 84210 84785 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_00770 84812 85462 gene locus_tag LOCUS_00780 84812 85462 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111955.1 protein_id gnl|my_center|LOCUS_00780 86903 85602 gene locus_tag LOCUS_00790 86903 85602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87598 86909 gene locus_tag LOCUS_00800 87598 86909 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_00800 87860 88852 gene locus_tag LOCUS_00810 gene pstB 87860 88852 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_00810 89035 89991 gene locus_tag LOCUS_00820 89035 89991 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722632.1 protein_id gnl|my_center|LOCUS_00820 90065 91003 gene locus_tag LOCUS_00830 gene pstC 90065 91003 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316421.1 protein_id gnl|my_center|LOCUS_00830 90996 91934 gene locus_tag LOCUS_00840 gene pstA 90996 91934 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722630.1 protein_id gnl|my_center|LOCUS_00840 91931 92698 gene locus_tag LOCUS_00850 gene pstB 91931 92698 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990004.1 protein_id gnl|my_center|LOCUS_00850 92875 94035 gene locus_tag LOCUS_00860 92875 94035 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_00860 94301 95491 gene locus_tag LOCUS_00870 94301 95491 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_00870 97212 95701 gene locus_tag LOCUS_00880 97212 95701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00880 97678 97226 gene locus_tag LOCUS_00890 97678 97226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 98761 99066 gene locus_tag LOCUS_00900 98761 99066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 99165 102329 gene locus_tag LOCUS_00910 99165 102329 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024289.1 protein_id gnl|my_center|LOCUS_00910 103354 102566 gene locus_tag LOCUS_00920 103354 102566 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_00920 103476 105668 gene locus_tag LOCUS_00930 103476 105668 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_00930 105785 105624 gene locus_tag LOCUS_00940 105785 105624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 105863 106453 gene locus_tag LOCUS_00950 105863 106453 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_00950 106485 107450 gene locus_tag LOCUS_00960 106485 107450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 107499 108038 gene locus_tag LOCUS_00970 107499 108038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 109937 108216 gene locus_tag LOCUS_00980 109937 108216 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812277.1 protein_id gnl|my_center|LOCUS_00980 110448 110074 gene locus_tag LOCUS_00990 110448 110074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_00990 110668 111231 gene locus_tag LOCUS_01000 110668 111231 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_01000 111562 112659 gene locus_tag LOCUS_01010 gene aroF 111562 112659 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_01010 112661 113647 gene locus_tag LOCUS_01020 112661 113647 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_01020 113744 114892 gene locus_tag LOCUS_01030 gene pheA 113744 114892 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_01030 116135 114993 gene locus_tag LOCUS_01040 116135 114993 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_01040 118080 116359 gene locus_tag LOCUS_01050 118080 116359 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809849.1 protein_id gnl|my_center|LOCUS_01050 118303 119217 gene locus_tag LOCUS_01060 118303 119217 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705115.1 protein_id gnl|my_center|LOCUS_01060 119219 120940 gene locus_tag LOCUS_01070 119219 120940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 120964 121755 gene locus_tag LOCUS_01080 120964 121755 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258317.1 protein_id gnl|my_center|LOCUS_01080 123500 121914 gene locus_tag LOCUS_01090 123500 121914 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944154.1 protein_id gnl|my_center|LOCUS_01090 124007 124342 gene locus_tag LOCUS_01100 124007 124342 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811486.1 protein_id gnl|my_center|LOCUS_01100 124342 124944 gene locus_tag LOCUS_01110 124342 124944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 125072 125914 gene locus_tag LOCUS_01120 125072 125914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 126005 126409 gene locus_tag LOCUS_01130 126005 126409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 126427 126753 gene locus_tag LOCUS_01140 126427 126753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 130700 127017 gene locus_tag LOCUS_01150 130700 127017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 131035 132081 gene locus_tag LOCUS_01160 131035 132081 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_01160 132553 132074 gene locus_tag LOCUS_01170 132553 132074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 133077 132553 gene locus_tag LOCUS_01180 133077 132553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 133944 133363 gene locus_tag LOCUS_01190 133944 133363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 134437 133958 gene locus_tag LOCUS_01200 134437 133958 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887321.1 protein_id gnl|my_center|LOCUS_01200 135912 134437 gene locus_tag LOCUS_01210 135912 134437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 136607 135933 gene locus_tag LOCUS_01220 136607 135933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 137071 136622 gene locus_tag LOCUS_01230 137071 136622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240220.1 protein_id gnl|my_center|LOCUS_01230 137975 137037 gene locus_tag LOCUS_01240 137975 137037 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813629.1 protein_id gnl|my_center|LOCUS_01240 138130 139743 gene locus_tag LOCUS_01250 138130 139743 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 protein_id gnl|my_center|LOCUS_01250 139918 140676 gene locus_tag LOCUS_01260 139918 140676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 141727 140816 gene locus_tag LOCUS_01270 141727 140816 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203249.1 protein_id gnl|my_center|LOCUS_01270 142775 141939 gene locus_tag LOCUS_01280 142775 141939 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 protein_id gnl|my_center|LOCUS_01280 143420 142866 gene locus_tag LOCUS_01290 143420 142866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 143632 143417 gene locus_tag LOCUS_01300 143632 143417 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001843884.1 protein_id gnl|my_center|LOCUS_01300 144374 143859 gene locus_tag LOCUS_01310 144374 143859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 144713 145672 gene locus_tag LOCUS_01320 144713 145672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 145832 146569 gene locus_tag LOCUS_01330 145832 146569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 protein_id gnl|my_center|LOCUS_01330 146566 147888 gene locus_tag LOCUS_01340 146566 147888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 148443 148207 gene locus_tag LOCUS_01350 148443 148207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 148837 149616 gene locus_tag LOCUS_01360 148837 149616 CDS product 2-hydroxy-6-oxo-6-phenylhexa-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964779.1 protein_id gnl|my_center|LOCUS_01360 153888 149698 gene locus_tag LOCUS_01370 153888 149698 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460558.1 protein_id gnl|my_center|LOCUS_01370 154151 153900 gene locus_tag LOCUS_01380 154151 153900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 154928 154215 gene locus_tag LOCUS_01390 154928 154215 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_01390 156203 154932 gene locus_tag LOCUS_01400 156203 154932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 157349 156219 gene locus_tag LOCUS_01410 157349 156219 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence02 1910 264 gene locus_tag LOCUS_01420 1910 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4347 2017 gene locus_tag LOCUS_01430 4347 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 5086 5634 gene locus_tag LOCUS_01440 5086 5634 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997886.1 protein_id gnl|my_center|LOCUS_01440 6856 5708 gene locus_tag LOCUS_01450 gene galE 6856 5708 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_01450 7142 8323 gene locus_tag LOCUS_01460 gene fucO 7142 8323 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_01460 8506 12078 gene locus_tag LOCUS_01470 gene rpoB 8506 12078 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272205.1 protein_id gnl|my_center|LOCUS_01470 12082 16587 gene locus_tag LOCUS_01480 12082 16587 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222587.1 protein_id gnl|my_center|LOCUS_01480 16728 18065 gene locus_tag LOCUS_01490 gene glmM 16728 18065 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_01490 18078 19814 gene locus_tag LOCUS_01500 18078 19814 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461189.1 protein_id gnl|my_center|LOCUS_01500 19863 20774 gene locus_tag LOCUS_01510 19863 20774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 21051 21755 gene locus_tag LOCUS_01520 21051 21755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 21720 21729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21805 22056 gene locus_tag LOCUS_01530 21805 22056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 22058 22573 gene locus_tag LOCUS_01540 gene moaC 22058 22573 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971801.1 protein_id gnl|my_center|LOCUS_01540 22636 23406 gene locus_tag LOCUS_01550 22636 23406 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052855.1 protein_id gnl|my_center|LOCUS_01550 24010 25263 gene locus_tag LOCUS_01560 24010 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 25531 26256 gene locus_tag LOCUS_01570 25531 26256 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_01570 26256 27653 gene locus_tag LOCUS_01580 gene hemA 26256 27653 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_01580 27650 28648 gene locus_tag LOCUS_01590 gene hemC 27650 28648 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820470.1 protein_id gnl|my_center|LOCUS_01590 28645 30243 gene locus_tag LOCUS_01600 gene cobA 28645 30243 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_01600 30240 31484 gene locus_tag LOCUS_01610 gene ahbC 30240 31484 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_01610 31501 32493 gene locus_tag LOCUS_01620 gene hemB 31501 32493 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_01620 32496 34856 gene locus_tag LOCUS_01630 32496 34856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 34866 36170 gene locus_tag LOCUS_01640 gene hemL 34866 36170 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_01640 36277 36352 gene locus_tag LOCUS_t00010 36277 36352 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 37174 36389 gene locus_tag LOCUS_01650 37174 36389 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392938.1 protein_id gnl|my_center|LOCUS_01650 37465 40863 gene locus_tag LOCUS_01660 37465 40863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 41141 42310 gene locus_tag LOCUS_01670 41141 42310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 42360 43319 gene locus_tag LOCUS_01680 gene ppx2 42360 43319 CDS product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405299.1 protein_id gnl|my_center|LOCUS_01680 43400 43483 gene locus_tag LOCUS_t00020 43400 43483 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43722 44813 gene locus_tag LOCUS_01690 gene idsA 43722 44813 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_01690 44848 45753 gene locus_tag LOCUS_01700 44848 45753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 45789 47168 gene locus_tag LOCUS_01710 gene glmU 45789 47168 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458919.1 protein_id gnl|my_center|LOCUS_01710 47266 48246 gene locus_tag LOCUS_01720 47266 48246 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_01720 48413 49000 gene locus_tag LOCUS_01730 gene pth 48413 49000 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_01730 49147 52503 gene locus_tag LOCUS_01740 49147 52503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 52487 55012 gene locus_tag LOCUS_01750 gene relA 52487 55012 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_01750 55009 55686 gene locus_tag LOCUS_01760 55009 55686 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_01760 55715 56422 gene locus_tag LOCUS_01770 55715 56422 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812798.1 protein_id gnl|my_center|LOCUS_01770 57579 56497 gene locus_tag LOCUS_01780 57579 56497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 57737 59020 gene locus_tag LOCUS_01790 57737 59020 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855724.1 protein_id gnl|my_center|LOCUS_01790 59025 60083 gene locus_tag LOCUS_01800 59025 60083 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_01800 60820 60212 gene locus_tag LOCUS_01810 60820 60212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 64154 61284 gene locus_tag LOCUS_01820 64154 61284 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421678.1 protein_id gnl|my_center|LOCUS_01820 64551 66335 gene locus_tag LOCUS_01830 64551 66335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 66628 67644 gene locus_tag LOCUS_01840 66628 67644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 67722 69188 gene locus_tag LOCUS_01850 gene purF 67722 69188 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085623.1 protein_id gnl|my_center|LOCUS_01850 69266 70639 gene locus_tag LOCUS_01860 69266 70639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 70668 71396 gene locus_tag LOCUS_01870 gene purN 70668 71396 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_01870 71450 72058 gene locus_tag LOCUS_01880 71450 72058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 73209 72343 gene locus_tag LOCUS_01890 73209 72343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 73354 75120 gene locus_tag LOCUS_01900 73354 75120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 75341 75994 gene locus_tag LOCUS_01910 75341 75994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 76165 77502 gene locus_tag LOCUS_01920 gene hisS 76165 77502 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_01920 77606 79387 gene locus_tag LOCUS_01930 gene aspS 77606 79387 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_01930 79515 80510 gene locus_tag LOCUS_01940 gene argF 79515 80510 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_01940 80872 80633 gene locus_tag LOCUS_01950 80872 80633 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893611.1 protein_id gnl|my_center|LOCUS_01950 81564 80884 gene locus_tag LOCUS_01960 81564 80884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 81899 83512 gene locus_tag LOCUS_01970 81899 83512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 83825 84547 gene locus_tag LOCUS_01980 gene pyrH 83825 84547 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_01980 84686 85249 gene locus_tag LOCUS_01990 gene frr 84686 85249 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_01990 85292 86077 gene locus_tag LOCUS_02000 85292 86077 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_02000 86115 87101 gene locus_tag LOCUS_02010 86115 87101 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869681.1 protein_id gnl|my_center|LOCUS_02010 87085 88374 gene locus_tag LOCUS_02020 gene dxr 87085 88374 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 protein_id gnl|my_center|LOCUS_02020 88439 89524 gene locus_tag LOCUS_02030 88439 89524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 89647 90657 gene locus_tag LOCUS_02040 gene ispG 89647 90657 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_02040 90657 92459 gene locus_tag LOCUS_02050 90657 92459 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_02050 92495 93232 gene locus_tag LOCUS_02060 gene ppaX 92495 93232 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_02060 93373 94764 gene locus_tag LOCUS_02070 93373 94764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 94857 97070 gene locus_tag LOCUS_02080 94857 97070 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618734.1 protein_id gnl|my_center|LOCUS_02080 97216 98058 gene locus_tag LOCUS_02090 97216 98058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 98058 98816 gene locus_tag LOCUS_02100 98058 98816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 99415 98915 gene locus_tag LOCUS_02110 99415 98915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 99619 100884 gene locus_tag LOCUS_02120 99619 100884 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_02120 100881 101411 gene locus_tag LOCUS_02130 gene mog 100881 101411 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986482.1 protein_id gnl|my_center|LOCUS_02130 101484 102749 gene locus_tag LOCUS_02140 gene alr 101484 102749 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143807.1 protein_id gnl|my_center|LOCUS_02140 102890 103564 gene locus_tag LOCUS_02150 102890 103564 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_02150 103603 105036 gene locus_tag LOCUS_02160 103603 105036 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_02160 105741 105229 gene locus_tag LOCUS_02170 105741 105229 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800927.1 protein_id gnl|my_center|LOCUS_02170 106433 106254 gene locus_tag LOCUS_02180 106433 106254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 106348 107037 gene locus_tag LOCUS_02190 106348 107037 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390357.1 protein_id gnl|my_center|LOCUS_02190 107041 109281 gene locus_tag LOCUS_02200 107041 109281 CDS product DNA polymerase III subunits gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296293.1 protein_id gnl|my_center|LOCUS_02200 109422 109730 gene locus_tag LOCUS_02210 109422 109730 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_02210 109755 110351 gene locus_tag LOCUS_02220 gene recR 109755 110351 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_02220 110351 111637 gene locus_tag LOCUS_02230 110351 111637 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_02230 112043 112426 gene locus_tag LOCUS_02240 112043 112426 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_02240 112833 114320 gene locus_tag LOCUS_02250 gene pyk 112833 114320 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_02250 114324 115811 gene locus_tag LOCUS_02260 gene rhaB 114324 115811 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243094.1 protein_id gnl|my_center|LOCUS_02260 116191 117444 gene locus_tag LOCUS_02270 gene rhaA 116191 117444 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_02270 117519 118361 gene locus_tag LOCUS_02280 gene rhaD 117519 118361 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179745.1 protein_id gnl|my_center|LOCUS_02280 118389 118736 gene locus_tag LOCUS_02290 gene rhaM 118389 118736 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009913470.1 protein_id gnl|my_center|LOCUS_02290 120556 118979 gene locus_tag LOCUS_02300 120556 118979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 120714 122309 gene locus_tag LOCUS_02310 120714 122309 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 protein_id gnl|my_center|LOCUS_02310 122617 123996 gene locus_tag LOCUS_02320 122617 123996 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725797.1 protein_id gnl|my_center|LOCUS_02320 124849 124277 gene locus_tag LOCUS_02330 gene raiA 124849 124277 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829676.1 protein_id gnl|my_center|LOCUS_02330 125246 126436 gene locus_tag LOCUS_02340 125246 126436 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963631.1 protein_id gnl|my_center|LOCUS_02340 126618 127820 gene locus_tag LOCUS_02350 126618 127820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 128014 128090 gene locus_tag LOCUS_t00030 128014 128090 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 128179 128589 gene locus_tag LOCUS_02360 128179 128589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 128702 129169 gene locus_tag LOCUS_02370 gene greA 128702 129169 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_02370 129517 131817 gene locus_tag LOCUS_02380 129517 131817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 132070 134862 gene locus_tag LOCUS_02390 132070 134862 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125259.1 protein_id gnl|my_center|LOCUS_02390 135078 135992 gene locus_tag LOCUS_02400 gene ispD 135078 135992 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_02400 135993 136568 gene locus_tag LOCUS_02410 gene ispF 135993 136568 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_02410 136664 137680 gene locus_tag LOCUS_02420 136664 137680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 137734 139245 gene locus_tag LOCUS_02430 gene cysS 137734 139245 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015680.1 protein_id gnl|my_center|LOCUS_02430 139331 140803 gene locus_tag LOCUS_02440 139331 140803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 141013 141780 gene locus_tag LOCUS_02450 141013 141780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 141782 143497 gene locus_tag LOCUS_02460 141782 143497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 143500 144786 gene locus_tag LOCUS_02470 143500 144786 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_02470 144783 145751 gene locus_tag LOCUS_02480 144783 145751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 145753 146754 gene locus_tag LOCUS_02490 145753 146754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 146800 147057 gene locus_tag LOCUS_02500 146800 147057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 147054 147335 gene locus_tag LOCUS_02510 147054 147335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 147412 147864 gene locus_tag LOCUS_02520 147412 147864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 147984 150056 gene locus_tag LOCUS_02530 147984 150056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 150056 150514 gene locus_tag LOCUS_02540 150056 150514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 150557 151108 gene locus_tag LOCUS_02550 150557 151108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 151160 151510 gene locus_tag LOCUS_02560 151160 151510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 151548 152066 gene locus_tag LOCUS_02570 151548 152066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 152322 153710 gene locus_tag LOCUS_02580 152322 153710 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_02580 154197 153838 gene locus_tag LOCUS_02590 154197 153838 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938853.1 protein_id gnl|my_center|LOCUS_02590 156129 154453 gene locus_tag LOCUS_02600 gene thrC 156129 154453 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101905.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence03 98 400 gene locus_tag LOCUS_02610 98 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 397 1899 gene locus_tag LOCUS_02620 gene panF 397 1899 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 protein_id gnl|my_center|LOCUS_02620 2060 3886 gene locus_tag LOCUS_02630 2060 3886 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_02630 4807 3926 gene locus_tag LOCUS_02640 4807 3926 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_02640 5661 5002 gene locus_tag LOCUS_02650 gene hisIE 5661 5002 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_02650 6457 5684 gene locus_tag LOCUS_02660 gene hisF 6457 5684 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_02660 7287 6454 gene locus_tag LOCUS_02670 gene hisA 7287 6454 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_02670 7906 7298 gene locus_tag LOCUS_02680 gene hisH 7906 7298 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020951.1 protein_id gnl|my_center|LOCUS_02680 8503 7916 gene locus_tag LOCUS_02690 gene hisB 8503 7916 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_02690 9561 8500 gene locus_tag LOCUS_02700 gene hisC 9561 8500 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_02700 10878 9604 gene locus_tag LOCUS_02710 gene hisD 10878 9604 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909411.1 protein_id gnl|my_center|LOCUS_02710 12575 10932 gene locus_tag LOCUS_02720 12575 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 12904 12575 gene locus_tag LOCUS_02730 12904 12575 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_02730 13406 14407 gene locus_tag LOCUS_02740 13406 14407 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_02740 15435 14536 gene locus_tag LOCUS_02750 15435 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 16781 15522 gene locus_tag LOCUS_02760 16781 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 17704 16778 gene locus_tag LOCUS_02770 17704 16778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 18364 17708 gene locus_tag LOCUS_02780 18364 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 19185 18376 gene locus_tag LOCUS_02790 19185 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 20195 19200 gene locus_tag LOCUS_02800 20195 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 21970 20192 gene locus_tag LOCUS_02810 21970 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 22620 22081 gene locus_tag LOCUS_02820 22620 22081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 24080 22617 gene locus_tag LOCUS_02830 24080 22617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 24395 27469 gene locus_tag LOCUS_02840 24395 27469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 27472 28110 gene locus_tag LOCUS_02850 27472 28110 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_02850 28107 28976 gene locus_tag LOCUS_02860 28107 28976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 30036 29245 gene locus_tag LOCUS_02870 30036 29245 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081708.1 protein_id gnl|my_center|LOCUS_02870 31392 30310 gene locus_tag LOCUS_02880 31392 30310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 34481 31401 gene locus_tag LOCUS_02890 34481 31401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 33524 33623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34851 34926 gene locus_tag LOCUS_t00040 34851 34926 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 36468 34999 gene locus_tag LOCUS_02900 36468 34999 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_02900 41087 36471 gene locus_tag LOCUS_02910 gene gltB 41087 36471 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_02910 41534 42478 gene locus_tag LOCUS_02920 41534 42478 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052232.1 protein_id gnl|my_center|LOCUS_02920 44465 42585 gene locus_tag LOCUS_02930 44465 42585 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966424.1 protein_id gnl|my_center|LOCUS_02930 47119 44549 gene locus_tag LOCUS_02940 gene priA 47119 44549 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_02940 48377 47109 gene locus_tag LOCUS_02950 gene metK 48377 47109 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_02950 48511 49911 gene locus_tag LOCUS_02960 48511 49911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 49901 50737 gene locus_tag LOCUS_02970 49901 50737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 50843 52345 gene locus_tag LOCUS_02980 gene gltX 50843 52345 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_02980 52350 53462 gene locus_tag LOCUS_02990 52350 53462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 53622 54122 gene locus_tag LOCUS_03000 53622 54122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 55851 54688 gene locus_tag LOCUS_03010 55851 54688 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813989.1 protein_id gnl|my_center|LOCUS_03010 57413 55848 gene locus_tag LOCUS_03020 57413 55848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 58226 57447 gene locus_tag LOCUS_03030 58226 57447 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902652.1 protein_id gnl|my_center|LOCUS_03030 59404 58247 gene locus_tag LOCUS_03040 59404 58247 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813989.1 protein_id gnl|my_center|LOCUS_03040 59658 59518 gene locus_tag LOCUS_03050 59658 59518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 61888 60899 gene locus_tag LOCUS_03060 61888 60899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 62007 62144 gene locus_tag LOCUS_03070 62007 62144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 63391 62261 gene locus_tag LOCUS_03080 63391 62261 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902650.1 protein_id gnl|my_center|LOCUS_03080 64633 63395 gene locus_tag LOCUS_03090 gene fldB 64633 63395 CDS product phenyllactyl-CoA dehydratase subunit FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_03090 65919 64675 gene locus_tag LOCUS_03100 gene fldA 65919 64675 CDS product 3-(aryl)acryloyl-CoA:(R)-3-(aryl)lactate CoA-transferase FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048238.1 protein_id gnl|my_center|LOCUS_03100 66184 66867 gene locus_tag LOCUS_03110 66184 66867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 67087 67608 gene locus_tag LOCUS_03120 67087 67608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 71488 67781 gene locus_tag LOCUS_03130 gene mfd 71488 67781 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_03130 71736 72407 gene locus_tag LOCUS_03140 gene nth 71736 72407 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116115.1 protein_id gnl|my_center|LOCUS_03140 73430 72555 gene locus_tag LOCUS_03150 73430 72555 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_03150 74268 73543 gene locus_tag LOCUS_03160 74268 73543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 75093 74404 gene locus_tag LOCUS_03170 gene cybH 75093 74404 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811610.1 protein_id gnl|my_center|LOCUS_03170 76748 75096 gene locus_tag LOCUS_03180 76748 75096 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939208.1 protein_id gnl|my_center|LOCUS_03180 78094 76748 gene locus_tag LOCUS_03190 78094 76748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 79102 78563 gene locus_tag LOCUS_03200 79102 78563 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_03200 80320 79403 gene locus_tag LOCUS_03210 80320 79403 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_03210 80951 80397 gene locus_tag LOCUS_03220 80951 80397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 82590 80929 gene locus_tag LOCUS_03230 82590 80929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 83766 82945 gene locus_tag LOCUS_03240 83766 82945 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707670.1 protein_id gnl|my_center|LOCUS_03240 85808 83871 gene locus_tag LOCUS_03250 85808 83871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_03250 87955 85805 gene locus_tag LOCUS_03260 87955 85805 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_03260 88548 87946 gene locus_tag LOCUS_03270 88548 87946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 88786 90033 gene locus_tag LOCUS_03280 gene mtnK 88786 90033 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033250.1 protein_id gnl|my_center|LOCUS_03280 90084 91199 gene locus_tag LOCUS_03290 gene mtnA 90084 91199 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_03290 92330 91320 gene locus_tag LOCUS_03300 gene ansB 92330 91320 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479812.1 protein_id gnl|my_center|LOCUS_03300 93248 92412 gene locus_tag LOCUS_03310 93248 92412 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905004.1 protein_id gnl|my_center|LOCUS_03310 93564 93488 gene locus_tag LOCUS_t00050 93564 93488 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 94429 93740 gene locus_tag LOCUS_03320 94429 93740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03320 96302 94422 gene locus_tag LOCUS_03330 96302 94422 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_03330 97486 96314 gene locus_tag LOCUS_03340 97486 96314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 98844 97660 gene locus_tag LOCUS_03350 gene rodA 98844 97660 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_03350 100974 98845 gene locus_tag LOCUS_03360 gene mrdA 100974 98845 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_03360 101510 100986 gene locus_tag LOCUS_03370 101510 100986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 102632 101748 gene locus_tag LOCUS_03380 102632 101748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 103692 102643 gene locus_tag LOCUS_03390 103692 102643 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_03390 104354 103950 gene locus_tag LOCUS_03400 gene ndk 104354 103950 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_03400 105933 104506 gene locus_tag LOCUS_03410 105933 104506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 106642 106106 gene locus_tag LOCUS_03420 106642 106106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 106795 106720 gene locus_tag LOCUS_t00060 106795 106720 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 106872 108221 gene locus_tag LOCUS_03430 gene rlmD 106872 108221 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143127.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence04 20 1015 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgaagatctgccttctgactagctgatatactta 3003 1423 gene locus_tag LOCUS_03440 3003 1423 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254595.1 protein_id gnl|my_center|LOCUS_03440 3225 3851 gene locus_tag LOCUS_03450 gene yihA 3225 3851 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416925.1 protein_id gnl|my_center|LOCUS_03450 4126 5334 gene locus_tag LOCUS_03460 4126 5334 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459382.1 protein_id gnl|my_center|LOCUS_03460 5482 6963 gene locus_tag LOCUS_03470 5482 6963 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_03470 7095 8237 gene locus_tag LOCUS_03480 7095 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8253 9074 gene locus_tag LOCUS_03490 8253 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 9106 12123 gene locus_tag LOCUS_03500 9106 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 12896 12126 gene locus_tag LOCUS_03510 12896 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 13382 15478 gene locus_tag LOCUS_03520 13382 15478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 16371 15727 gene locus_tag LOCUS_03530 16371 15727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 18081 16480 gene locus_tag LOCUS_03540 gene serA 18081 16480 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391569.1 protein_id gnl|my_center|LOCUS_03540 19372 18278 gene locus_tag LOCUS_03550 gene serC 19372 18278 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 protein_id gnl|my_center|LOCUS_03550 20791 19502 gene locus_tag LOCUS_03560 20791 19502 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054178.1 protein_id gnl|my_center|LOCUS_03560 22534 20963 gene locus_tag LOCUS_03570 22534 20963 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867494.1 protein_id gnl|my_center|LOCUS_03570 23803 22850 gene locus_tag LOCUS_03580 23803 22850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 24321 26864 gene locus_tag LOCUS_03590 24321 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_03590 27574 26930 gene locus_tag LOCUS_03600 27574 26930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 29380 27584 gene locus_tag LOCUS_03610 29380 27584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 30239 31489 gene locus_tag LOCUS_03620 30239 31489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 31811 33598 gene locus_tag LOCUS_03630 31811 33598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 33886 37044 gene locus_tag LOCUS_03640 gene fdnG 33886 37044 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 protein_id gnl|my_center|LOCUS_03640 37057 37941 gene locus_tag LOCUS_03650 37057 37941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 37943 38734 gene locus_tag LOCUS_03660 37943 38734 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073667.1 protein_id gnl|my_center|LOCUS_03660 39039 39947 gene locus_tag LOCUS_03670 39039 39947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 40227 41516 gene locus_tag LOCUS_03680 40227 41516 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774553.1 protein_id gnl|my_center|LOCUS_03680 41561 42940 gene locus_tag LOCUS_03690 41561 42940 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_03690 43821 43018 gene locus_tag LOCUS_03700 43821 43018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 protein_id gnl|my_center|LOCUS_03700 44918 43818 gene locus_tag LOCUS_03710 44918 43818 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_03710 46135 44915 gene locus_tag LOCUS_03720 46135 44915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 47592 46135 gene locus_tag LOCUS_03730 47592 46135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 48344 47595 gene locus_tag LOCUS_03740 48344 47595 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948411.1 protein_id gnl|my_center|LOCUS_03740 49645 48479 gene locus_tag LOCUS_03750 49645 48479 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 protein_id gnl|my_center|LOCUS_03750 50201 50291 gene locus_tag LOCUS_t00070 50201 50291 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 50334 50426 gene locus_tag LOCUS_t00080 50334 50426 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 51189 50554 gene locus_tag LOCUS_03760 51189 50554 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_03760 51360 53132 gene locus_tag LOCUS_03770 51360 53132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 53295 53591 gene locus_tag LOCUS_03780 53295 53591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 53949 54152 gene locus_tag LOCUS_03790 53949 54152 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085446.1 protein_id gnl|my_center|LOCUS_03790 54422 55075 gene locus_tag LOCUS_03800 54422 55075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 55326 55619 gene locus_tag LOCUS_03810 gene rpsF 55326 55619 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_03810 55672 56178 gene locus_tag LOCUS_03820 55672 56178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 56201 56467 gene locus_tag LOCUS_03830 gene rpsR 56201 56467 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_03830 56485 57066 gene locus_tag LOCUS_03840 gene rplI 56485 57066 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_03840 57280 58728 gene locus_tag LOCUS_03850 gene dnaB 57280 58728 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721677.1 protein_id gnl|my_center|LOCUS_03850 58729 60015 gene locus_tag LOCUS_03860 58729 60015 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065381.1 protein_id gnl|my_center|LOCUS_03860 60012 62525 gene locus_tag LOCUS_03870 60012 62525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 62586 63878 gene locus_tag LOCUS_03880 62586 63878 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_03880 64015 65307 gene locus_tag LOCUS_03890 gene purD 64015 65307 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175672.1 protein_id gnl|my_center|LOCUS_03890 65322 66647 gene locus_tag LOCUS_03900 65322 66647 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_03900 66982 67764 gene locus_tag LOCUS_03910 66982 67764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 67858 67933 gene locus_tag LOCUS_t00090 67858 67933 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 68196 69125 gene locus_tag LOCUS_03920 68196 69125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 69422 69886 gene locus_tag LOCUS_03930 gene purE 69422 69886 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_03930 70043 72115 gene locus_tag LOCUS_03940 gene iorA 70043 72115 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392452.1 protein_id gnl|my_center|LOCUS_03940 72112 72777 gene locus_tag LOCUS_03950 72112 72777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 72768 74003 gene locus_tag LOCUS_03960 72768 74003 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_03960 75337 74018 gene locus_tag LOCUS_03970 75337 74018 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_03970 76690 75344 gene locus_tag LOCUS_03980 76690 75344 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_03980 77047 76971 gene locus_tag LOCUS_t00100 77047 76971 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78241 77474 gene locus_tag LOCUS_03990 78241 77474 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693825.1 protein_id gnl|my_center|LOCUS_03990 78479 78567 gene locus_tag LOCUS_t00110 78479 78567 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78671 79435 gene locus_tag LOCUS_04000 78671 79435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 79493 80503 gene locus_tag LOCUS_04010 gene ispE 79493 80503 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_04010 80606 81181 gene locus_tag LOCUS_04020 80606 81181 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_04020 82438 81323 gene locus_tag LOCUS_04030 82438 81323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 82718 82628 gene locus_tag LOCUS_t00120 82718 82628 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 82791 84833 gene locus_tag LOCUS_04040 82791 84833 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068420.1 protein_id gnl|my_center|LOCUS_04040 84834 85403 gene locus_tag LOCUS_04050 84834 85403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 87054 85501 gene locus_tag LOCUS_04060 87054 85501 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_04060 87254 87329 gene locus_tag LOCUS_t00130 87254 87329 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 87480 88412 gene locus_tag LOCUS_04070 87480 88412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 88416 89183 gene locus_tag LOCUS_04080 88416 89183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence05 1691 96 gene locus_tag LOCUS_04090 gene gpmI 1691 96 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964031.1 protein_id gnl|my_center|LOCUS_04090 2564 1791 gene locus_tag LOCUS_04100 2564 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3914 2730 gene locus_tag LOCUS_04110 3914 2730 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_04110 4937 3930 gene locus_tag LOCUS_04120 gene gap 4937 3930 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_04120 5867 5007 gene locus_tag LOCUS_04130 gene whiA 5867 5007 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_04130 7048 5921 gene locus_tag LOCUS_04140 7048 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 8141 7062 gene locus_tag LOCUS_04150 gene rapZ 8141 7062 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462179.1 protein_id gnl|my_center|LOCUS_04150 10212 8197 gene locus_tag LOCUS_04160 gene uvrC 10212 8197 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_04160 11194 10220 gene locus_tag LOCUS_04170 11194 10220 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 protein_id gnl|my_center|LOCUS_04170 12672 11269 gene locus_tag LOCUS_04180 12672 11269 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114561.1 protein_id gnl|my_center|LOCUS_04180 13673 12720 gene locus_tag LOCUS_04190 13673 12720 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113476.1 protein_id gnl|my_center|LOCUS_04190 14583 13822 gene locus_tag LOCUS_04200 14583 13822 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566220.1 protein_id gnl|my_center|LOCUS_04200 15531 14590 gene locus_tag LOCUS_04210 15531 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 18526 15698 gene locus_tag LOCUS_04220 gene uvrA 18526 15698 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813285.1 protein_id gnl|my_center|LOCUS_04220 19387 18620 gene locus_tag LOCUS_04230 gene dapB 19387 18620 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728512.1 protein_id gnl|my_center|LOCUS_04230 20870 19566 gene locus_tag LOCUS_04240 20870 19566 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_04240 21113 22474 gene locus_tag LOCUS_04250 21113 22474 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_04250 23609 22602 gene locus_tag LOCUS_04260 23609 22602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 24075 23773 gene locus_tag LOCUS_04270 gene rplW 24075 23773 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_04270 24698 24075 gene locus_tag LOCUS_04280 gene rplD 24698 24075 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701303.1 protein_id gnl|my_center|LOCUS_04280 25347 24727 gene locus_tag LOCUS_04290 gene rplC 25347 24727 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 protein_id gnl|my_center|LOCUS_04290 25669 25361 gene locus_tag LOCUS_04300 gene rpsJ 25669 25361 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393938.1 protein_id gnl|my_center|LOCUS_04300 27824 25716 gene locus_tag LOCUS_04310 gene fusA 27824 25716 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_04310 28311 27841 gene locus_tag LOCUS_04320 gene rpsG 28311 27841 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055588.1 protein_id gnl|my_center|LOCUS_04320 28727 28353 gene locus_tag LOCUS_04330 gene rpsL 28727 28353 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102113.1 protein_id gnl|my_center|LOCUS_04330 29144 30790 gene locus_tag LOCUS_04340 29144 30790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 31022 31501 gene locus_tag LOCUS_04350 31022 31501 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066673.1 protein_id gnl|my_center|LOCUS_04350 33075 31726 gene locus_tag LOCUS_04360 33075 31726 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393891.1 protein_id gnl|my_center|LOCUS_04360 35289 33109 gene locus_tag LOCUS_04370 35289 33109 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804532.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 35611 35279 gene locus_tag LOCUS_04380 35611 35279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04380 35304 35313 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36538 35675 gene locus_tag LOCUS_04390 36538 35675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 36909 36535 gene locus_tag LOCUS_04400 36909 36535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 37187 38779 gene locus_tag LOCUS_04410 gene guaA 37187 38779 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817253.1 protein_id gnl|my_center|LOCUS_04410 39996 39121 gene locus_tag LOCUS_04420 39996 39121 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101367.1 protein_id gnl|my_center|LOCUS_04420 40365 40003 gene locus_tag LOCUS_04430 40365 40003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101365.1 protein_id gnl|my_center|LOCUS_04430 41307 40408 gene locus_tag LOCUS_04440 41307 40408 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101364.1 protein_id gnl|my_center|LOCUS_04440 42354 41338 gene locus_tag LOCUS_04450 42354 41338 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949061.1 protein_id gnl|my_center|LOCUS_04450 42539 42916 gene locus_tag LOCUS_04460 42539 42916 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 protein_id gnl|my_center|LOCUS_04460 43889 44134 gene locus_tag LOCUS_04470 43889 44134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 45599 44349 gene locus_tag LOCUS_04480 45599 44349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 46067 46447 gene locus_tag LOCUS_04490 46067 46447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 46581 46426 gene locus_tag LOCUS_04500 46581 46426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 46706 47191 gene locus_tag LOCUS_04510 46706 47191 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_04510 47222 47740 gene locus_tag LOCUS_04520 47222 47740 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_04520 47764 48132 gene locus_tag LOCUS_04530 47764 48132 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642398.1 protein_id gnl|my_center|LOCUS_04530 48473 49084 gene locus_tag LOCUS_04540 48473 49084 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101945.1 protein_id gnl|my_center|LOCUS_04540 50339 49470 gene locus_tag LOCUS_04550 50339 49470 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_04550 51372 50479 gene locus_tag LOCUS_04560 51372 50479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 52416 51505 gene locus_tag LOCUS_04570 52416 51505 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705118.1 protein_id gnl|my_center|LOCUS_04570 53257 52439 gene locus_tag LOCUS_04580 53257 52439 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174466.1 protein_id gnl|my_center|LOCUS_04580 54378 53458 gene locus_tag LOCUS_04590 54378 53458 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102012.1 protein_id gnl|my_center|LOCUS_04590 54629 55507 gene locus_tag LOCUS_04600 54629 55507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 56310 55540 gene locus_tag LOCUS_04610 56310 55540 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_04610 57474 56338 gene locus_tag LOCUS_04620 57474 56338 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_04620 57621 57499 gene locus_tag LOCUS_04630 57621 57499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 58671 57661 gene locus_tag LOCUS_04640 58671 57661 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202737.1 protein_id gnl|my_center|LOCUS_04640 58868 59731 gene locus_tag LOCUS_04650 58868 59731 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_04650 60287 60943 gene locus_tag LOCUS_04660 60287 60943 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_04660 61851 61243 gene locus_tag LOCUS_04670 61851 61243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 62463 62047 gene locus_tag LOCUS_04680 62463 62047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 64348 62630 gene locus_tag LOCUS_04690 64348 62630 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_04690 64662 65594 gene locus_tag LOCUS_04700 64662 65594 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_04700 66188 66346 gene locus_tag LOCUS_04710 66188 66346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 66343 66624 gene locus_tag LOCUS_04720 66343 66624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 66869 68380 gene locus_tag LOCUS_04730 66869 68380 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_04730 69420 68476 gene locus_tag LOCUS_04740 69420 68476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 69936 69433 gene locus_tag LOCUS_04750 69936 69433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 70198 72612 gene locus_tag LOCUS_04760 gene feoB 70198 72612 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_04760 72922 73410 gene locus_tag LOCUS_04770 72922 73410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 75341 73599 gene locus_tag LOCUS_04780 75341 73599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_04780 77224 75335 gene locus_tag LOCUS_04790 77224 75335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_04790 78377 77244 gene locus_tag LOCUS_04800 78377 77244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 78573 79193 gene locus_tag LOCUS_04810 78573 79193 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_04810 79195 79938 gene locus_tag LOCUS_04820 79195 79938 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815503.1 protein_id gnl|my_center|LOCUS_04820 79925 81535 gene locus_tag LOCUS_04830 79925 81535 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_04830 81815 81489 gene locus_tag LOCUS_04840 gene emrE 81815 81489 CDS product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070439.1 protein_id gnl|my_center|LOCUS_04840 82261 81818 gene locus_tag LOCUS_04850 82261 81818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 82523 85123 gene locus_tag LOCUS_04860 82523 85123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 86578 85178 gene locus_tag LOCUS_04870 86578 85178 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence06 2155 227 gene locus_tag LOCUS_04880 gene thrS 2155 227 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_04880 2944 2456 gene locus_tag LOCUS_04890 2944 2456 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_04890 5815 3137 gene locus_tag LOCUS_04900 5815 3137 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_04900 7341 5923 gene locus_tag LOCUS_04910 gene clpX 7341 5923 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_04910 8321 7662 gene locus_tag LOCUS_04920 gene clpP 8321 7662 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_04920 10072 8558 gene locus_tag LOCUS_04930 gene tig 10072 8558 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093116.1 protein_id gnl|my_center|LOCUS_04930 10260 10174 gene locus_tag LOCUS_t00140 10260 10174 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10657 10370 gene locus_tag LOCUS_04940 10657 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 10917 11360 gene locus_tag LOCUS_04950 10917 11360 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_04950 13137 11557 gene locus_tag LOCUS_04960 13137 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 14691 13279 gene locus_tag LOCUS_04970 14691 13279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 15006 16451 gene locus_tag LOCUS_04980 15006 16451 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_04980 16455 17345 gene locus_tag LOCUS_04990 16455 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 17338 17508 gene locus_tag LOCUS_05000 17338 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 18475 17462 gene locus_tag LOCUS_05010 18475 17462 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_05010 19418 18408 gene locus_tag LOCUS_05020 19418 18408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 20431 19499 gene locus_tag LOCUS_05030 20431 19499 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_05030 21378 20443 gene locus_tag LOCUS_05040 21378 20443 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_05040 22369 21458 gene locus_tag LOCUS_05050 22369 21458 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814610.1 protein_id gnl|my_center|LOCUS_05050 23942 22488 gene locus_tag LOCUS_05060 23942 22488 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_05060 25546 23948 gene locus_tag LOCUS_05070 25546 23948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 26654 25518 gene locus_tag LOCUS_05080 gene holB 26654 25518 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_05080 27466 26654 gene locus_tag LOCUS_05090 27466 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 30175 27620 gene locus_tag LOCUS_05100 30175 27620 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_05100 30492 31007 gene locus_tag LOCUS_05110 30492 31007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 32402 31155 gene locus_tag LOCUS_05120 32402 31155 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_05120 33206 32442 gene locus_tag LOCUS_05130 gene thyX 33206 32442 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_05130 33439 34290 gene locus_tag LOCUS_05140 33439 34290 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903995.1 protein_id gnl|my_center|LOCUS_05140 34871 34383 gene locus_tag LOCUS_05150 34871 34383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 36390 35041 gene locus_tag LOCUS_05160 36390 35041 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_05160 38671 36635 gene locus_tag LOCUS_05170 38671 36635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 40780 38753 gene locus_tag LOCUS_05180 40780 38753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 41439 40777 gene locus_tag LOCUS_05190 gene fsa 41439 40777 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_05190 42626 41817 gene locus_tag LOCUS_05200 gene thiD 42626 41817 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_05200 43490 42738 gene locus_tag LOCUS_05210 43490 42738 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_05210 44972 44100 gene locus_tag LOCUS_05220 44972 44100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 45106 45228 gene locus_tag LOCUS_05230 45106 45228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 46535 45387 gene locus_tag LOCUS_05240 46535 45387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 47267 46575 gene locus_tag LOCUS_05250 47267 46575 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082246.1 protein_id gnl|my_center|LOCUS_05250 48168 47254 gene locus_tag LOCUS_05260 gene pgeF 48168 47254 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_05260 49310 48165 gene locus_tag LOCUS_05270 gene ftsZ 49310 48165 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069588917.1 protein_id gnl|my_center|LOCUS_05270 50445 49699 gene locus_tag LOCUS_05280 gene ftsQ 50445 49699 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860375.1 protein_id gnl|my_center|LOCUS_05280 50577 50933 gene locus_tag LOCUS_05290 50577 50933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 51829 50897 gene locus_tag LOCUS_05300 gene murB 51829 50897 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_05300 53357 51819 gene locus_tag LOCUS_05310 gene murC 53357 51819 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972052.1 protein_id gnl|my_center|LOCUS_05310 54631 53534 gene locus_tag LOCUS_05320 gene murG 54631 53534 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_05320 56049 54634 gene locus_tag LOCUS_05330 56049 54634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 57566 56052 gene locus_tag LOCUS_05340 gene murD 57566 56052 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860115.1 protein_id gnl|my_center|LOCUS_05340 58604 57567 gene locus_tag LOCUS_05350 gene mraY 58604 57567 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224924.1 protein_id gnl|my_center|LOCUS_05350 60049 58601 gene locus_tag LOCUS_05360 60049 58601 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_05360 61541 60063 gene locus_tag LOCUS_05370 61541 60063 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_05370 63333 61552 gene locus_tag LOCUS_05380 63333 61552 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_05380 63898 63422 gene locus_tag LOCUS_05390 63898 63422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 64951 63962 gene locus_tag LOCUS_05400 gene rsmH 64951 63962 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_05400 65398 64970 gene locus_tag LOCUS_05410 gene mraZ 65398 64970 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729664.1 protein_id gnl|my_center|LOCUS_05410 66862 65750 gene locus_tag LOCUS_05420 66862 65750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 68541 66874 gene locus_tag LOCUS_05430 gene pyrG 68541 66874 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_05430 68886 68644 gene locus_tag LOCUS_05440 68886 68644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 69982 69116 gene locus_tag LOCUS_05450 69982 69116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 70274 72031 gene locus_tag LOCUS_05460 gene murJ 70274 72031 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806275.1 protein_id gnl|my_center|LOCUS_05460 74168 72207 gene locus_tag LOCUS_05470 gene asnB 74168 72207 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703387.1 protein_id gnl|my_center|LOCUS_05470 74400 75668 gene locus_tag LOCUS_05480 74400 75668 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804838.1 protein_id gnl|my_center|LOCUS_05480 76281 75799 gene locus_tag LOCUS_05490 gene ybaK 76281 75799 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_05490 76404 76477 gene locus_tag LOCUS_t00150 76404 76477 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 77564 76689 gene locus_tag LOCUS_05500 77564 76689 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_05500 78402 77686 gene locus_tag LOCUS_05510 gene rplA 78402 77686 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892735.1 protein_id gnl|my_center|LOCUS_05510 79002 78505 gene locus_tag LOCUS_05520 gene rplK 79002 78505 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_05520 79685 79155 gene locus_tag LOCUS_05530 gene nusG 79685 79155 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_05530 80105 79689 gene locus_tag LOCUS_05540 80105 79689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 80260 80184 gene locus_tag LOCUS_t00160 80260 80184 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 80434 80285 gene locus_tag LOCUS_05550 gene rpmG 80434 80285 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881260.1 protein_id gnl|my_center|LOCUS_05550 81759 80554 gene locus_tag LOCUS_05560 gene tuf 81759 80554 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040568.1 protein_id gnl|my_center|LOCUS_05560 81935 81859 gene locus_tag LOCUS_t00170 81935 81859 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 82018 81943 gene locus_tag LOCUS_t00180 82018 81943 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 82105 82021 gene locus_tag LOCUS_t00190 82105 82021 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 83914 82352 gene locus_tag LOCUS_05570 83914 82352 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence07 51 1118 gene locus_tag LOCUS_05580 gene ychF 51 1118 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 protein_id gnl|my_center|LOCUS_05580 1124 1585 gene locus_tag LOCUS_05590 gene rnhA 1124 1585 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948171.1 protein_id gnl|my_center|LOCUS_05590 1727 3460 gene locus_tag LOCUS_05600 1727 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3662 5455 gene locus_tag LOCUS_05610 3662 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7618 5618 gene locus_tag LOCUS_05620 7618 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 7650 8543 gene locus_tag LOCUS_05630 7650 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 8720 9895 gene locus_tag LOCUS_05640 8720 9895 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_05640 10893 10039 gene locus_tag LOCUS_05650 10893 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 12043 10880 gene locus_tag LOCUS_05660 12043 10880 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051205.1 protein_id gnl|my_center|LOCUS_05660 12924 12142 gene locus_tag LOCUS_05670 12924 12142 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_05670 14392 12917 gene locus_tag LOCUS_05680 14392 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 15261 14428 gene locus_tag LOCUS_05690 15261 14428 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_05690 16505 15600 gene locus_tag LOCUS_05700 16505 15600 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852410.1 protein_id gnl|my_center|LOCUS_05700 17237 16560 gene locus_tag LOCUS_05710 17237 16560 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_05710 17999 17238 gene locus_tag LOCUS_05720 17999 17238 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115441.1 protein_id gnl|my_center|LOCUS_05720 20379 18352 gene locus_tag LOCUS_05730 20379 18352 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068199.1 protein_id gnl|my_center|LOCUS_05730 20518 21702 gene locus_tag LOCUS_05740 gene nifS 20518 21702 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_05740 21728 22990 gene locus_tag LOCUS_05750 gene mnmA 21728 22990 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_05750 23228 24088 gene locus_tag LOCUS_05760 23228 24088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 24081 24920 gene locus_tag LOCUS_05770 24081 24920 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_05770 25156 27072 gene locus_tag LOCUS_05780 25156 27072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 28451 27150 gene locus_tag LOCUS_05790 gene thiC 28451 27150 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015816.1 protein_id gnl|my_center|LOCUS_05790 30617 28755 gene locus_tag LOCUS_05800 30617 28755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 30819 31727 gene locus_tag LOCUS_05810 30819 31727 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067966.1 protein_id gnl|my_center|LOCUS_05810 31787 32614 gene locus_tag LOCUS_05820 31787 32614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 33608 32652 gene locus_tag LOCUS_05830 gene bsh 33608 32652 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052221.1 protein_id gnl|my_center|LOCUS_05830 34632 33718 gene locus_tag LOCUS_05840 34632 33718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 34856 35380 gene locus_tag LOCUS_05850 34856 35380 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_05850 35505 35948 gene locus_tag LOCUS_05860 35505 35948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 36027 36347 gene locus_tag LOCUS_05870 36027 36347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 36500 37948 gene locus_tag LOCUS_05880 gene nhaA 36500 37948 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_05880 39648 37978 gene locus_tag LOCUS_05890 39648 37978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 39810 40346 gene locus_tag LOCUS_05900 gene thpR 39810 40346 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_05900 41017 40328 gene locus_tag LOCUS_05910 41017 40328 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_05910 41256 41846 gene locus_tag LOCUS_05920 41256 41846 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_05920 43823 42093 gene locus_tag LOCUS_05930 43823 42093 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809087.1 protein_id gnl|my_center|LOCUS_05930 44051 45622 gene locus_tag LOCUS_05940 44051 45622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 45582 45782 gene locus_tag LOCUS_05950 45582 45782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 45779 47203 gene locus_tag LOCUS_05960 45779 47203 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552062.1 protein_id gnl|my_center|LOCUS_05960 48261 47377 gene locus_tag LOCUS_05970 48261 47377 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_05970 48378 49109 gene locus_tag LOCUS_05980 48378 49109 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_05980 50084 49218 gene locus_tag LOCUS_05990 gene fdhD 50084 49218 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393662.1 protein_id gnl|my_center|LOCUS_05990 50359 51687 gene locus_tag LOCUS_06000 50359 51687 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_06000 52992 51841 gene locus_tag LOCUS_06010 52992 51841 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096637.1 protein_id gnl|my_center|LOCUS_06010 53583 55169 gene locus_tag LOCUS_06020 53583 55169 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_06020 55354 56244 gene locus_tag LOCUS_06030 55354 56244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 56395 57300 gene locus_tag LOCUS_06040 56395 57300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_06040 57342 58322 gene locus_tag LOCUS_06050 57342 58322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 58495 59811 gene locus_tag LOCUS_06060 58495 59811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 59931 61133 gene locus_tag LOCUS_06070 59931 61133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 61252 62484 gene locus_tag LOCUS_06080 61252 62484 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134519.1 protein_id gnl|my_center|LOCUS_06080 62510 63166 gene locus_tag LOCUS_06090 62510 63166 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286451.1 protein_id gnl|my_center|LOCUS_06090 63168 64286 gene locus_tag LOCUS_06100 gene glf 63168 64286 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272526.1 protein_id gnl|my_center|LOCUS_06100 64502 64915 gene locus_tag LOCUS_06110 gene mutT 64502 64915 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_06110 64967 66310 gene locus_tag LOCUS_06120 gene glnA 64967 66310 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582594.1 protein_id gnl|my_center|LOCUS_06120 66311 67009 gene locus_tag LOCUS_06130 66311 67009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 68645 67110 gene locus_tag LOCUS_06140 68645 67110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 70691 69021 gene locus_tag LOCUS_06150 70691 69021 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263594.1 protein_id gnl|my_center|LOCUS_06150 70830 73595 gene locus_tag LOCUS_06160 gene polA 70830 73595 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_06160 73739 74893 gene locus_tag LOCUS_06170 73739 74893 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_06170 75056 76186 gene locus_tag LOCUS_06180 75056 76186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 76379 76984 gene locus_tag LOCUS_06190 76379 76984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 77001 77252 gene locus_tag LOCUS_06200 gene rpmA 77001 77252 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_06200 77406 78815 gene locus_tag LOCUS_06210 gene obgE 77406 78815 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_06210 78836 79420 gene locus_tag LOCUS_06220 gene nadD 78836 79420 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_06220 79525 80472 gene locus_tag LOCUS_06230 79525 80472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 80542 81021 gene locus_tag LOCUS_06240 80542 81021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 83515 81221 gene locus_tag LOCUS_06250 83515 81221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence08 <1 1076 gene locus_tag LOCUS_06260 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090665.1:3-carboxy-cis,cis-muconate cycloisomerase 2380 1361 gene locus_tag LOCUS_06270 2380 1361 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_06270 3790 2393 gene locus_tag LOCUS_06280 3790 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4113 5933 gene locus_tag LOCUS_06290 gene urdA 4113 5933 CDS product urocanate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074216.1 protein_id gnl|my_center|LOCUS_06290 6610 6152 gene locus_tag LOCUS_06300 6610 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 8342 6678 gene locus_tag LOCUS_06310 8342 6678 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 protein_id gnl|my_center|LOCUS_06310 9248 8520 gene locus_tag LOCUS_06320 9248 8520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 9355 9534 gene locus_tag LOCUS_06330 9355 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10111 12801 gene locus_tag LOCUS_06340 10111 12801 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389729.1 protein_id gnl|my_center|LOCUS_06340 12981 15167 gene locus_tag LOCUS_06350 12981 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 15843 17198 gene locus_tag LOCUS_06360 15843 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 17653 19224 gene locus_tag LOCUS_06370 gene trpE 17653 19224 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 protein_id gnl|my_center|LOCUS_06370 19221 19817 gene locus_tag LOCUS_06380 gene pabA 19221 19817 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_06380 19834 20856 gene locus_tag LOCUS_06390 gene trpD 19834 20856 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_06390 20853 22421 gene locus_tag LOCUS_06400 20853 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 22446 23669 gene locus_tag LOCUS_06410 gene trpB 22446 23669 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_06410 23662 24438 gene locus_tag LOCUS_06420 gene trpA 23662 24438 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_06420 25409 24543 gene locus_tag LOCUS_06430 25409 24543 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547290.1 protein_id gnl|my_center|LOCUS_06430 26499 25540 gene locus_tag LOCUS_06440 26499 25540 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082559.1 protein_id gnl|my_center|LOCUS_06440 26959 26534 gene locus_tag LOCUS_06450 26959 26534 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642396.1 protein_id gnl|my_center|LOCUS_06450 27525 27130 gene locus_tag LOCUS_06460 27525 27130 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807790.1 protein_id gnl|my_center|LOCUS_06460 28118 27663 gene locus_tag LOCUS_06470 28118 27663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 28540 29898 gene locus_tag LOCUS_06480 gene lysA 28540 29898 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963928.1 protein_id gnl|my_center|LOCUS_06480 30161 31450 gene locus_tag LOCUS_06490 30161 31450 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_06490 34440 31735 gene locus_tag LOCUS_06500 34440 31735 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_06500 34856 34452 gene locus_tag LOCUS_06510 34856 34452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 35283 35792 gene locus_tag LOCUS_06520 gene rplM 35283 35792 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016252.1 protein_id gnl|my_center|LOCUS_06520 35796 36188 gene locus_tag LOCUS_06530 gene rpsI 35796 36188 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_06530 36602 38389 gene locus_tag LOCUS_06540 36602 38389 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814208.1 protein_id gnl|my_center|LOCUS_06540 38669 40132 gene locus_tag LOCUS_06550 38669 40132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 40418 42511 gene locus_tag LOCUS_06560 40418 42511 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_06560 42687 43718 gene locus_tag LOCUS_06570 42687 43718 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_06570 43865 44221 gene locus_tag LOCUS_06580 43865 44221 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_06580 44218 45063 gene locus_tag LOCUS_06590 44218 45063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 45849 45184 gene locus_tag LOCUS_06600 45849 45184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 45936 47225 gene locus_tag LOCUS_06610 45936 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 47227 48039 gene locus_tag LOCUS_06620 47227 48039 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922402.1 protein_id gnl|my_center|LOCUS_06620 48094 49773 gene locus_tag LOCUS_06630 48094 49773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 49919 50632 gene locus_tag LOCUS_06640 49919 50632 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_06640 50663 52369 gene locus_tag LOCUS_06650 50663 52369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 52366 54867 gene locus_tag LOCUS_06660 gene hypF 52366 54867 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258631.1 protein_id gnl|my_center|LOCUS_06660 54889 55128 gene locus_tag LOCUS_06670 54889 55128 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_06670 55130 56236 gene locus_tag LOCUS_06680 gene hypD 55130 56236 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810717.1 protein_id gnl|my_center|LOCUS_06680 56328 57011 gene locus_tag LOCUS_06690 56328 57011 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_06690 57128 58549 gene locus_tag LOCUS_06700 57128 58549 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815077.1 protein_id gnl|my_center|LOCUS_06700 58678 59613 gene locus_tag LOCUS_06710 58678 59613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 59734 60390 gene locus_tag LOCUS_06720 59734 60390 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262971.1 protein_id gnl|my_center|LOCUS_06720 60404 61084 gene locus_tag LOCUS_06730 60404 61084 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_06730 61153 62496 gene locus_tag LOCUS_06740 gene purB 61153 62496 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817240.1 protein_id gnl|my_center|LOCUS_06740 62627 63625 gene locus_tag LOCUS_06750 62627 63625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 65126 63699 gene locus_tag LOCUS_06760 65126 63699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 65513 66304 gene locus_tag LOCUS_06770 65513 66304 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_06770 66317 67855 gene locus_tag LOCUS_06780 66317 67855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 67897 68778 gene locus_tag LOCUS_06790 67897 68778 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_06790 68896 69567 gene locus_tag LOCUS_06800 68896 69567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence09 288 1235 gene locus_tag LOCUS_06810 gene sufC 288 1235 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_06810 1235 2641 gene locus_tag LOCUS_06820 gene sufB 1235 2641 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_06820 2641 3903 gene locus_tag LOCUS_06830 2641 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3904 5202 gene locus_tag LOCUS_06840 3904 5202 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_06840 5189 5638 gene locus_tag LOCUS_06850 5189 5638 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_06850 6325 6549 gene locus_tag LOCUS_06860 6325 6549 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_06860 6656 9178 gene locus_tag LOCUS_06870 6656 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 9807 9355 gene locus_tag LOCUS_06880 9807 9355 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673217.1 protein_id gnl|my_center|LOCUS_06880 10632 10204 gene locus_tag LOCUS_06890 10632 10204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10953 11471 gene locus_tag LOCUS_06900 gene ruvC 10953 11471 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679556.1 protein_id gnl|my_center|LOCUS_06900 11468 12049 gene locus_tag LOCUS_06910 gene ruvA 11468 12049 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_06910 12046 13161 gene locus_tag LOCUS_06920 gene ruvB 12046 13161 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_06920 13165 13599 gene locus_tag LOCUS_06930 13165 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 14738 13656 gene locus_tag LOCUS_06940 gene queA 14738 13656 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641515.1 protein_id gnl|my_center|LOCUS_06940 15495 14866 gene locus_tag LOCUS_06950 15495 14866 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_06950 15609 16850 gene locus_tag LOCUS_06960 15609 16850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 16850 17995 gene locus_tag LOCUS_06970 gene tgt 16850 17995 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_06970 18318 21401 gene locus_tag LOCUS_06980 18318 21401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 21411 21761 gene locus_tag LOCUS_06990 21411 21761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 22625 21831 gene locus_tag LOCUS_07000 22625 21831 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_07000 24541 22622 gene locus_tag LOCUS_07010 24541 22622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 25244 24633 gene locus_tag LOCUS_07020 25244 24633 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_07020 25859 27220 gene locus_tag LOCUS_07030 25859 27220 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_07030 27474 28301 gene locus_tag LOCUS_07040 gene rpsB 27474 28301 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_07040 28399 29280 gene locus_tag LOCUS_07050 gene tsf 28399 29280 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_07050 29442 30737 gene locus_tag LOCUS_07060 gene murA 29442 30737 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_07060 30762 32192 gene locus_tag LOCUS_07070 30762 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 32573 32235 gene locus_tag LOCUS_07080 32573 32235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 32980 32750 gene locus_tag LOCUS_07090 32980 32750 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_07090 33134 33433 gene locus_tag LOCUS_07100 33134 33433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 33437 34381 gene locus_tag LOCUS_07110 gene lgt 33437 34381 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_07110 34417 35901 gene locus_tag LOCUS_07120 34417 35901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 35898 37643 gene locus_tag LOCUS_07130 35898 37643 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_07130 37643 38632 gene locus_tag LOCUS_07140 37643 38632 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_07140 38620 40329 gene locus_tag LOCUS_07150 38620 40329 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 protein_id gnl|my_center|LOCUS_07150 40326 41018 gene locus_tag LOCUS_07160 40326 41018 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_07160 41097 41759 gene locus_tag LOCUS_07170 41097 41759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 41880 42845 gene locus_tag LOCUS_07180 41880 42845 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_07180 42906 44435 gene locus_tag LOCUS_07190 gene glpK 42906 44435 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113886.1 protein_id gnl|my_center|LOCUS_07190 44586 45032 gene locus_tag LOCUS_07200 gene rpiB 44586 45032 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_07200 45134 45772 gene locus_tag LOCUS_07210 gene upp 45134 45772 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_07210 45870 46529 gene locus_tag LOCUS_07220 45870 46529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 46708 46998 gene locus_tag LOCUS_07230 46708 46998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 47012 47794 gene locus_tag LOCUS_07240 47012 47794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 47962 48180 gene locus_tag LOCUS_07250 47962 48180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 48230 48844 gene locus_tag LOCUS_07260 48230 48844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 48834 49427 gene locus_tag LOCUS_07270 48834 49427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 49414 50997 gene locus_tag LOCUS_07280 gene atpA 49414 50997 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101724.1 protein_id gnl|my_center|LOCUS_07280 51009 51935 gene locus_tag LOCUS_07290 gene atpG 51009 51935 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_07290 51936 53381 gene locus_tag LOCUS_07300 gene atpD 51936 53381 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_07300 53385 53810 gene locus_tag LOCUS_07310 53385 53810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 54299 57793 gene locus_tag LOCUS_07320 54299 57793 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_07320 57793 58593 gene locus_tag LOCUS_07330 gene truA 57793 58593 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479529.1 protein_id gnl|my_center|LOCUS_07330 58604 58789 gene locus_tag LOCUS_07340 58604 58789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 59126 59728 gene locus_tag LOCUS_07350 59126 59728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence10 1757 897 gene locus_tag LOCUS_07360 1757 897 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_07360 1897 2511 gene locus_tag LOCUS_07370 1897 2511 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583841.1 protein_id gnl|my_center|LOCUS_07370 2753 5311 gene locus_tag LOCUS_07380 gene leuS 2753 5311 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_07380 5447 6106 gene locus_tag LOCUS_07390 5447 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 7691 6372 gene locus_tag LOCUS_07400 7691 6372 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_07400 8698 7946 gene locus_tag LOCUS_07410 gene pxpA 8698 7946 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261793.1 protein_id gnl|my_center|LOCUS_07410 10063 8714 gene locus_tag LOCUS_07420 10063 8714 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_07420 10579 10079 gene locus_tag LOCUS_07430 10579 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 11662 10583 gene locus_tag LOCUS_07440 11662 10583 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_07440 12399 11665 gene locus_tag LOCUS_07450 gene pxpB 12399 11665 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 protein_id gnl|my_center|LOCUS_07450 13490 12729 gene locus_tag LOCUS_07460 13490 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 13677 14867 gene locus_tag LOCUS_07470 13677 14867 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806343.1 protein_id gnl|my_center|LOCUS_07470 15043 16422 gene locus_tag LOCUS_07480 15043 16422 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_07480 16474 17181 gene locus_tag LOCUS_07490 16474 17181 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_07490 17722 17288 gene locus_tag LOCUS_07500 17722 17288 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_07500 18047 17724 gene locus_tag LOCUS_07510 18047 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 19233 18016 gene locus_tag LOCUS_07520 19233 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 19381 19875 gene locus_tag LOCUS_07530 19381 19875 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_07530 21721 20015 gene locus_tag LOCUS_07540 21721 20015 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809087.1 protein_id gnl|my_center|LOCUS_07540 22349 21714 gene locus_tag LOCUS_07550 22349 21714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 22860 22492 gene locus_tag LOCUS_07560 22860 22492 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818305.1 protein_id gnl|my_center|LOCUS_07560 23064 24386 gene locus_tag LOCUS_07570 gene rlmD 23064 24386 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707417.1 protein_id gnl|my_center|LOCUS_07570 24792 26843 gene locus_tag LOCUS_07580 24792 26843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 26840 28180 gene locus_tag LOCUS_07590 26840 28180 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891837.1 protein_id gnl|my_center|LOCUS_07590 28715 29041 gene locus_tag LOCUS_07600 28715 29041 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_07600 29674 29216 gene locus_tag LOCUS_07610 29674 29216 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_07610 30232 29696 gene locus_tag LOCUS_07620 30232 29696 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_07620 31019 30399 gene locus_tag LOCUS_07630 31019 30399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 31323 32018 gene locus_tag LOCUS_07640 31323 32018 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_07640 32936 32166 gene locus_tag LOCUS_07650 gene lipA 32936 32166 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_07650 33090 34280 gene locus_tag LOCUS_07660 33090 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 34277 35200 gene locus_tag LOCUS_07670 34277 35200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 35396 35944 gene locus_tag LOCUS_07680 gene hpt 35396 35944 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_07680 36122 38485 gene locus_tag LOCUS_07690 36122 38485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 38704 40020 gene locus_tag LOCUS_07700 38704 40020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 40042 41463 gene locus_tag LOCUS_07710 40042 41463 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861575.1 protein_id gnl|my_center|LOCUS_07710 42475 41621 gene locus_tag LOCUS_07720 42475 41621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 43390 42692 gene locus_tag LOCUS_07730 43390 42692 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_07730 43718 44533 gene locus_tag LOCUS_07740 43718 44533 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_07740 44712 46379 gene locus_tag LOCUS_07750 44712 46379 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_07750 46430 47041 gene locus_tag LOCUS_07760 46430 47041 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198967.1 protein_id gnl|my_center|LOCUS_07760 47042 47989 gene locus_tag LOCUS_07770 47042 47989 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_07770 47993 50902 gene locus_tag LOCUS_07780 47993 50902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 51043 51828 gene locus_tag LOCUS_07790 gene ubiE 51043 51828 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385128.1 protein_id gnl|my_center|LOCUS_07790 51912 52187 gene locus_tag LOCUS_07800 51912 52187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 52339 53367 gene locus_tag LOCUS_07810 52339 53367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 53370 54212 gene locus_tag LOCUS_07820 53370 54212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 54420 54983 gene locus_tag LOCUS_07830 54420 54983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 55147 55818 gene locus_tag LOCUS_07840 gene hypB 55147 55818 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_07840 56057 56890 gene locus_tag LOCUS_07850 56057 56890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence11 156 232 gene locus_tag LOCUS_t00200 156 232 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 313 388 gene locus_tag LOCUS_t00210 313 388 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 605 1153 gene locus_tag LOCUS_07860 605 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1299 3137 gene locus_tag LOCUS_07870 gene typA 1299 3137 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_07870 3573 3830 gene locus_tag LOCUS_07880 3573 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3836 4336 gene locus_tag LOCUS_07890 gene nikR 3836 4336 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_07890 4392 5414 gene locus_tag LOCUS_07900 gene hypE 4392 5414 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_07900 5684 5872 gene locus_tag LOCUS_07910 5684 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 6435 8411 gene locus_tag LOCUS_07920 gene dnaK 6435 8411 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_07920 8414 9424 gene locus_tag LOCUS_07930 8414 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 9490 10476 gene locus_tag LOCUS_07940 gene dnaJ 9490 10476 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565745.1 protein_id gnl|my_center|LOCUS_07940 10476 10940 gene locus_tag LOCUS_07950 10476 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 10937 13606 gene locus_tag LOCUS_07960 gene clpB 10937 13606 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230863.1 protein_id gnl|my_center|LOCUS_07960 13910 14101 gene locus_tag LOCUS_07970 13910 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 14120 15655 gene locus_tag LOCUS_07980 14120 15655 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871007.1 protein_id gnl|my_center|LOCUS_07980 15744 16376 gene locus_tag LOCUS_07990 15744 16376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 16380 17393 gene locus_tag LOCUS_08000 gene rsgA 16380 17393 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943166.1 protein_id gnl|my_center|LOCUS_08000 21180 17398 gene locus_tag LOCUS_08010 21180 17398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 24503 21291 gene locus_tag LOCUS_08020 24503 21291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 24774 25304 gene locus_tag LOCUS_08030 24774 25304 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021659.1 protein_id gnl|my_center|LOCUS_08030 25487 27130 gene locus_tag LOCUS_08040 25487 27130 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_08040 28817 27264 gene locus_tag LOCUS_08050 28817 27264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 29058 30956 gene locus_tag LOCUS_08060 29058 30956 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459421.1 protein_id gnl|my_center|LOCUS_08060 31628 31077 gene locus_tag LOCUS_08070 31628 31077 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_08070 33315 31972 gene locus_tag LOCUS_08080 33315 31972 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_08080 33642 33717 gene locus_tag LOCUS_t00220 33642 33717 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33962 34474 gene locus_tag LOCUS_08090 33962 34474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 35165 34770 gene locus_tag LOCUS_08100 35165 34770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 36407 38032 gene locus_tag LOCUS_08110 36407 38032 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101721463.1 protein_id gnl|my_center|LOCUS_08110 38261 39622 gene locus_tag LOCUS_08120 38261 39622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 protein_id gnl|my_center|LOCUS_08120 40141 41460 gene locus_tag LOCUS_08130 40141 41460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 protein_id gnl|my_center|LOCUS_08130 42292 41744 gene locus_tag LOCUS_08140 42292 41744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 44109 42295 gene locus_tag LOCUS_08150 44109 42295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 44368 45030 gene locus_tag LOCUS_08160 44368 45030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 45415 48990 gene locus_tag LOCUS_08170 45415 48990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 48999 49202 gene locus_tag LOCUS_08180 48999 49202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 49212 50132 gene locus_tag LOCUS_08190 gene cas1 49212 50132 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929489.1 protein_id gnl|my_center|LOCUS_08190 50122 50451 gene locus_tag LOCUS_08200 gene cas2 50122 50451 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_08200 50454 51321 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgaagatctgccttctgactagctgatatactta >Feature sequence12 121 2250 gene locus_tag LOCUS_08210 121 2250 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460252.1 protein_id gnl|my_center|LOCUS_08210 2254 2847 gene locus_tag LOCUS_08220 2254 2847 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460251.1 protein_id gnl|my_center|LOCUS_08220 2877 3614 gene locus_tag LOCUS_08230 2877 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4549 4004 gene locus_tag LOCUS_08240 4549 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5632 4613 gene locus_tag LOCUS_08250 5632 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 5835 6743 gene locus_tag LOCUS_08260 5835 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 6812 7558 gene locus_tag LOCUS_08270 6812 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7717 8880 gene locus_tag LOCUS_08280 7717 8880 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_08280 8877 9401 gene locus_tag LOCUS_08290 8877 9401 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_08290 9784 9482 gene locus_tag LOCUS_08300 9784 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 10157 10417 gene locus_tag LOCUS_08310 10157 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 11006 10491 gene locus_tag LOCUS_08320 11006 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 11246 12124 gene locus_tag LOCUS_08330 11246 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 12268 14451 gene locus_tag LOCUS_08340 12268 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 14461 15537 gene locus_tag LOCUS_08350 gene mcrC 14461 15537 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_08350 15534 16289 gene locus_tag LOCUS_08360 15534 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 16401 18527 gene locus_tag LOCUS_08370 16401 18527 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963214.1 protein_id gnl|my_center|LOCUS_08370 18530 22180 gene locus_tag LOCUS_08380 18530 22180 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_08380 22180 24270 gene locus_tag LOCUS_08390 22180 24270 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013856.1 protein_id gnl|my_center|LOCUS_08390 25430 24396 gene locus_tag LOCUS_08400 25430 24396 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235899614.1 protein_id gnl|my_center|LOCUS_08400 25787 26146 gene locus_tag LOCUS_08410 25787 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 26701 26234 gene locus_tag LOCUS_08420 26701 26234 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_08420 27822 26686 gene locus_tag LOCUS_08430 27822 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 28078 28296 gene locus_tag LOCUS_08440 28078 28296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 28960 28412 gene locus_tag LOCUS_08450 28960 28412 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476275.1 protein_id gnl|my_center|LOCUS_08450 29185 30180 gene locus_tag LOCUS_08460 29185 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 30235 31488 gene locus_tag LOCUS_08470 30235 31488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 31540 31740 gene locus_tag LOCUS_08480 31540 31740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 33144 31867 gene locus_tag LOCUS_08490 33144 31867 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_08490 33391 33978 gene locus_tag LOCUS_08500 33391 33978 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389882.1 protein_id gnl|my_center|LOCUS_08500 34828 34034 gene locus_tag LOCUS_08510 34828 34034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 35026 35688 gene locus_tag LOCUS_08520 35026 35688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 36238 35891 gene locus_tag LOCUS_08530 36238 35891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 36978 36220 gene locus_tag LOCUS_08540 36978 36220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 37258 37923 gene locus_tag LOCUS_08550 37258 37923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 38010 38678 gene locus_tag LOCUS_08560 38010 38678 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254328.1 protein_id gnl|my_center|LOCUS_08560 39000 39833 gene locus_tag LOCUS_08570 39000 39833 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_08570 43405 39899 gene locus_tag LOCUS_08580 43405 39899 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068393.1 protein_id gnl|my_center|LOCUS_08580 44625 43576 gene locus_tag LOCUS_08590 44625 43576 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943774.1 protein_id gnl|my_center|LOCUS_08590 45868 44654 gene locus_tag LOCUS_08600 45868 44654 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 protein_id gnl|my_center|LOCUS_08600 46241 46591 gene locus_tag LOCUS_08610 46241 46591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 46476 48008 gene locus_tag LOCUS_08620 46476 48008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence13 <1 536 gene locus_tag LOCUS_08630 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000566608.1:2-hydroxy-3-oxopropionate reductase 663 1622 gene locus_tag LOCUS_08640 gene nudC 663 1622 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_08640 1687 2373 gene locus_tag LOCUS_08650 1687 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2620 3975 gene locus_tag LOCUS_08660 2620 3975 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101564.1 protein_id gnl|my_center|LOCUS_08660 4643 4026 gene locus_tag LOCUS_08670 4643 4026 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681208.1 protein_id gnl|my_center|LOCUS_08670 4979 4773 gene locus_tag LOCUS_08680 4979 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5142 5402 gene locus_tag LOCUS_08690 5142 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 5664 6017 gene locus_tag LOCUS_08700 5664 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7057 6014 gene locus_tag LOCUS_08710 7057 6014 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 protein_id gnl|my_center|LOCUS_08710 8185 7679 gene locus_tag LOCUS_08720 8185 7679 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_08720 8885 8310 gene locus_tag LOCUS_08730 8885 8310 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181706.1 protein_id gnl|my_center|LOCUS_08730 9041 10987 gene locus_tag LOCUS_08740 9041 10987 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_08740 11353 10892 gene locus_tag LOCUS_08750 11353 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 11456 12298 gene locus_tag LOCUS_08760 11456 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 12896 12357 gene locus_tag LOCUS_08770 12896 12357 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_08770 13848 12964 gene locus_tag LOCUS_08780 13848 12964 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_08780 14357 14034 gene locus_tag LOCUS_08790 14357 14034 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234907.1 protein_id gnl|my_center|LOCUS_08790 15427 14645 gene locus_tag LOCUS_08800 15427 14645 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254163.1 protein_id gnl|my_center|LOCUS_08800 16322 15483 gene locus_tag LOCUS_08810 16322 15483 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_08810 17454 16564 gene locus_tag LOCUS_08820 17454 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 17843 18421 gene locus_tag LOCUS_08830 17843 18421 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642400.1 protein_id gnl|my_center|LOCUS_08830 18600 19457 gene locus_tag LOCUS_08840 18600 19457 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_08840 19938 19585 gene locus_tag LOCUS_08850 19938 19585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 20356 19940 gene locus_tag LOCUS_08860 20356 19940 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_08860 21566 20412 gene locus_tag LOCUS_08870 21566 20412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 21837 21586 gene locus_tag LOCUS_08880 21837 21586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 21941 24013 gene locus_tag LOCUS_08890 21941 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 23910 24009 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24102 24599 gene locus_tag LOCUS_08900 24102 24599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 25251 24808 gene locus_tag LOCUS_08910 25251 24808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 25845 25327 gene locus_tag LOCUS_08920 25845 25327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 26925 25927 gene locus_tag LOCUS_08930 26925 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 27887 26922 gene locus_tag LOCUS_08940 27887 26922 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_08940 29033 27894 gene locus_tag LOCUS_08950 gene rffA 29033 27894 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176203.1 protein_id gnl|my_center|LOCUS_08950 30174 29104 gene locus_tag LOCUS_08960 gene rfbB 30174 29104 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_08960 31236 30340 gene locus_tag LOCUS_08970 gene rfbA 31236 30340 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_08970 32933 31332 gene locus_tag LOCUS_08980 32933 31332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 36362 34458 gene locus_tag LOCUS_08990 36362 34458 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068688.1 protein_id gnl|my_center|LOCUS_08990 36653 37348 gene locus_tag LOCUS_09000 36653 37348 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_09000 37752 37441 gene locus_tag LOCUS_09010 37752 37441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 38441 38010 gene locus_tag LOCUS_09020 38441 38010 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166793.1 protein_id gnl|my_center|LOCUS_09020 39356 38448 gene locus_tag LOCUS_09030 39356 38448 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_09030 40347 39346 gene locus_tag LOCUS_09040 40347 39346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_09040 41073 40438 gene locus_tag LOCUS_09050 41073 40438 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 protein_id gnl|my_center|LOCUS_09050 42245 41349 gene locus_tag LOCUS_09060 42245 41349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 42679 43947 gene locus_tag LOCUS_09070 42679 43947 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_09070 43940 44206 gene locus_tag LOCUS_09080 43940 44206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 44813 44193 gene locus_tag LOCUS_09090 44813 44193 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_09090 45009 45509 gene locus_tag LOCUS_09100 45009 45509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 47263 45632 gene locus_tag LOCUS_09110 47263 45632 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861309.1 protein_id gnl|my_center|LOCUS_09110 48908 47421 gene locus_tag LOCUS_09120 48908 47421 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803746.1 protein_id gnl|my_center|LOCUS_09120 49833 48979 gene locus_tag LOCUS_09130 49833 48979 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence14 4085 465 gene locus_tag LOCUS_09140 4085 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4834 4082 gene locus_tag LOCUS_09150 4834 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5801 4839 gene locus_tag LOCUS_09160 5801 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 7196 5889 gene locus_tag LOCUS_09170 7196 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 7598 8227 gene locus_tag LOCUS_09180 gene lepB 7598 8227 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965934.1 protein_id gnl|my_center|LOCUS_09180 9586 8375 gene locus_tag LOCUS_09190 gene tyrS 9586 8375 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_09190 12321 9802 gene locus_tag LOCUS_09200 12321 9802 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458989.1 protein_id gnl|my_center|LOCUS_09200 12960 12457 gene locus_tag LOCUS_09210 12960 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 15465 13159 gene locus_tag LOCUS_09220 15465 13159 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140166.1 protein_id gnl|my_center|LOCUS_09220 17074 15683 gene locus_tag LOCUS_09230 gene argH 17074 15683 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_09230 18429 17161 gene locus_tag LOCUS_09240 18429 17161 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837575.1 protein_id gnl|my_center|LOCUS_09240 19079 18648 gene locus_tag LOCUS_09250 19079 18648 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908325.1 protein_id gnl|my_center|LOCUS_09250 20287 19076 gene locus_tag LOCUS_09260 20287 19076 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_09260 21386 20391 gene locus_tag LOCUS_09270 gene argB 21386 20391 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174600.1 protein_id gnl|my_center|LOCUS_09270 22627 21383 gene locus_tag LOCUS_09280 gene argJ 22627 21383 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_09280 23743 22679 gene locus_tag LOCUS_09290 gene argC 23743 22679 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937798.1 protein_id gnl|my_center|LOCUS_09290 24263 23889 gene locus_tag LOCUS_09300 24263 23889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 24516 24256 gene locus_tag LOCUS_09310 24516 24256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 26590 24629 gene locus_tag LOCUS_09320 26590 24629 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_09320 26749 27402 gene locus_tag LOCUS_09330 26749 27402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 27351 28058 gene locus_tag LOCUS_09340 27351 28058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 28169 28597 gene locus_tag LOCUS_09350 28169 28597 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_09350 29385 28825 gene locus_tag LOCUS_09360 gene efp 29385 28825 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547948.1 protein_id gnl|my_center|LOCUS_09360 30537 29416 gene locus_tag LOCUS_09370 30537 29416 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_09370 31768 30608 gene locus_tag LOCUS_09380 31768 30608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 32951 31779 gene locus_tag LOCUS_09390 gene aroC 32951 31779 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 protein_id gnl|my_center|LOCUS_09390 33514 32948 gene locus_tag LOCUS_09400 33514 32948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 34794 33529 gene locus_tag LOCUS_09410 gene mltG 34794 33529 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_09410 35258 34809 gene locus_tag LOCUS_09420 gene ruvX 35258 34809 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_09420 37873 35303 gene locus_tag LOCUS_09430 gene alaS 37873 35303 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_09430 38897 38085 gene locus_tag LOCUS_09440 38897 38085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 40266 38953 gene locus_tag LOCUS_09450 40266 38953 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775673.1 protein_id gnl|my_center|LOCUS_09450 40920 40648 gene locus_tag LOCUS_09460 40920 40648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 41838 40942 gene locus_tag LOCUS_09470 41838 40942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 43192 42377 gene locus_tag LOCUS_09480 gene galU 43192 42377 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_09480 43547 43293 gene locus_tag LOCUS_09490 43547 43293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 44379 43648 gene locus_tag LOCUS_09500 44379 43648 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065117.1 protein_id gnl|my_center|LOCUS_09500 45200 44481 gene locus_tag LOCUS_09510 45200 44481 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_09510 45961 45200 gene locus_tag LOCUS_09520 45961 45200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_09520 48309 45967 gene locus_tag LOCUS_09530 48309 45967 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693418.1 protein_id gnl|my_center|LOCUS_09530 48981 48313 gene locus_tag LOCUS_09540 48981 48313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence15 1169 120 gene locus_tag LOCUS_09550 1169 120 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993737.1 protein_id gnl|my_center|LOCUS_09550 1600 1181 gene locus_tag LOCUS_09560 1600 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2454 1669 gene locus_tag LOCUS_09570 2454 1669 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_09570 3036 2548 gene locus_tag LOCUS_09580 3036 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3936 3289 gene locus_tag LOCUS_09590 3936 3289 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_09590 4874 3966 gene locus_tag LOCUS_09600 4874 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5547 4891 gene locus_tag LOCUS_09610 5547 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 6089 6250 gene locus_tag LOCUS_09620 6089 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6431 7054 gene locus_tag LOCUS_09630 6431 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 7047 7400 gene locus_tag LOCUS_09640 7047 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 9041 7557 gene locus_tag LOCUS_09650 9041 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 10426 9092 gene locus_tag LOCUS_09660 10426 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 11366 10437 gene locus_tag LOCUS_09670 11366 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 12099 11707 gene locus_tag LOCUS_09680 gene tagD 12099 11707 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646390.1 protein_id gnl|my_center|LOCUS_09680 12882 12145 gene locus_tag LOCUS_09690 12882 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 13985 12879 gene locus_tag LOCUS_09700 13985 12879 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224434606.1 protein_id gnl|my_center|LOCUS_09700 14771 14013 gene locus_tag LOCUS_09710 14771 14013 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 protein_id gnl|my_center|LOCUS_09710 15500 15426 gene locus_tag LOCUS_t00230 15500 15426 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15622 15696 gene locus_tag LOCUS_t00240 15622 15696 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 15717 15791 gene locus_tag LOCUS_t00250 15717 15791 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15924 18002 gene locus_tag LOCUS_09720 15924 18002 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390373.1 protein_id gnl|my_center|LOCUS_09720 19962 18109 gene locus_tag LOCUS_09730 gene argS 19962 18109 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_09730 21366 20212 gene locus_tag LOCUS_09740 21366 20212 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_09740 21895 21566 gene locus_tag LOCUS_09750 21895 21566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 23011 22112 gene locus_tag LOCUS_09760 23011 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 24465 23026 gene locus_tag LOCUS_09770 24465 23026 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460825.1 protein_id gnl|my_center|LOCUS_09770 25505 24756 gene locus_tag LOCUS_09780 25505 24756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 27585 25636 gene locus_tag LOCUS_09790 27585 25636 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068199.1 protein_id gnl|my_center|LOCUS_09790 27728 28186 gene locus_tag LOCUS_09800 27728 28186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 29347 28955 gene locus_tag LOCUS_09810 29347 28955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 29589 29356 gene locus_tag LOCUS_09820 29589 29356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 29888 30211 gene locus_tag LOCUS_09830 29888 30211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 30937 30248 gene locus_tag LOCUS_09840 30937 30248 CDS product Ltp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674335.1 protein_id gnl|my_center|LOCUS_09840 31200 31015 gene locus_tag LOCUS_09850 31200 31015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 31677 31601 gene locus_tag LOCUS_t00260 31677 31601 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35525 31749 gene locus_tag LOCUS_09860 35525 31749 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994283.1 protein_id gnl|my_center|LOCUS_09860 36198 35764 gene locus_tag LOCUS_09870 gene queD 36198 35764 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949100.1 protein_id gnl|my_center|LOCUS_09870 38909 36537 gene locus_tag LOCUS_09880 38909 36537 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_09880 39319 38912 gene locus_tag LOCUS_09890 39319 38912 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_09890 41374 39482 gene locus_tag LOCUS_09900 41374 39482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 42359 41577 gene locus_tag LOCUS_09910 42359 41577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 44003 42363 gene locus_tag LOCUS_09920 44003 42363 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_09920 46800 44092 gene locus_tag LOCUS_09930 46800 44092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 47507 46806 gene locus_tag LOCUS_09940 47507 46806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994591.1 protein_id gnl|my_center|LOCUS_09940 47697 48389 gene locus_tag LOCUS_09950 47697 48389 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_09950 48396 49403 gene locus_tag LOCUS_09960 48396 49403 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence16 2 77 gene locus_tag LOCUS_t00270 2 77 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 131 204 gene locus_tag LOCUS_t00280 131 204 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 283 357 gene locus_tag LOCUS_t00290 283 357 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1033 422 gene locus_tag LOCUS_09970 1033 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2084 1305 gene locus_tag LOCUS_09980 2084 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2297 3277 gene locus_tag LOCUS_09990 2297 3277 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693866.1 protein_id gnl|my_center|LOCUS_09990 4325 3411 gene locus_tag LOCUS_10000 4325 3411 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_10000 4474 5610 gene locus_tag LOCUS_10010 gene rnd 4474 5610 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_10010 5750 6427 gene locus_tag LOCUS_10020 5750 6427 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_10020 6433 7950 gene locus_tag LOCUS_10030 gene xseA 6433 7950 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946562.1 protein_id gnl|my_center|LOCUS_10030 7950 8267 gene locus_tag LOCUS_10040 7950 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 8368 8781 gene locus_tag LOCUS_10050 8368 8781 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_10050 9049 10068 gene locus_tag LOCUS_10060 9049 10068 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_10060 11399 10065 gene locus_tag LOCUS_10070 11399 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 11519 12661 gene locus_tag LOCUS_10080 11519 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 12951 15773 gene locus_tag LOCUS_10090 gene ileS 12951 15773 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_10090 15905 16312 gene locus_tag LOCUS_10100 15905 16312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 16336 17379 gene locus_tag LOCUS_10110 16336 17379 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830176.1 protein_id gnl|my_center|LOCUS_10110 17451 18455 gene locus_tag LOCUS_10120 gene hemH 17451 18455 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059263.1 protein_id gnl|my_center|LOCUS_10120 18530 19801 gene locus_tag LOCUS_10130 gene coaBC 18530 19801 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475839.1 protein_id gnl|my_center|LOCUS_10130 19909 19985 gene locus_tag LOCUS_t00300 19909 19985 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20138 22057 gene locus_tag LOCUS_10140 20138 22057 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_10140 22070 22945 gene locus_tag LOCUS_10150 22070 22945 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_10150 22955 23515 gene locus_tag LOCUS_10160 22955 23515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 23519 24049 gene locus_tag LOCUS_10170 23519 24049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 24053 25141 gene locus_tag LOCUS_10180 24053 25141 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_10180 25146 25535 gene locus_tag LOCUS_10190 25146 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 25651 26388 gene locus_tag LOCUS_10200 25651 26388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 26611 27918 gene locus_tag LOCUS_10210 26611 27918 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_10210 27915 28352 gene locus_tag LOCUS_10220 27915 28352 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_10220 28345 29772 gene locus_tag LOCUS_10230 gene dacF 28345 29772 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_10230 29841 30299 gene locus_tag LOCUS_10240 29841 30299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 30499 32250 gene locus_tag LOCUS_10250 gene iorA 30499 32250 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_10250 32251 32856 gene locus_tag LOCUS_10260 32251 32856 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_10260 33127 33945 gene locus_tag LOCUS_10270 gene gluQRS 33127 33945 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_10270 34987 33986 gene locus_tag LOCUS_10280 34987 33986 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015663.1 protein_id gnl|my_center|LOCUS_10280 35229 35065 gene locus_tag LOCUS_10290 35229 35065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 36489 35302 gene locus_tag LOCUS_10300 36489 35302 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054224.1 protein_id gnl|my_center|LOCUS_10300 36570 38261 gene locus_tag LOCUS_10310 36570 38261 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_10310 38524 39516 gene locus_tag LOCUS_10320 38524 39516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 43608 39934 gene locus_tag LOCUS_10330 43608 39934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 44120 43686 gene locus_tag LOCUS_10340 gene dut 44120 43686 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908085.1 protein_id gnl|my_center|LOCUS_10340 44576 44133 gene locus_tag LOCUS_10350 gene nrdR 44576 44133 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 protein_id gnl|my_center|LOCUS_10350 45239 45880 gene locus_tag LOCUS_10360 gene lexA 45239 45880 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_10360 46477 45905 gene locus_tag LOCUS_10370 46477 45905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10370 47228 46380 gene locus_tag LOCUS_10380 47228 46380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10380 <47800 47263 gene locus_tag LOCUS_10390 <47800 47263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202959.1:diaminopimelate epimerase >Feature sequence17 <1 611 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttaattaccagccaaaatgacgctgcaccaaaac 612 621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 714 1473 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttaattaccagccaaaatgacgctgcaccaaaac 2214 1528 gene locus_tag LOCUS_10400 2214 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2519 2211 gene locus_tag LOCUS_10410 gene cas2 2519 2211 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_10410 3415 2537 gene locus_tag LOCUS_10420 gene cas1 3415 2537 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_10420 7819 3425 gene locus_tag LOCUS_10430 gene cas9 7819 3425 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263549.1 protein_id gnl|my_center|LOCUS_10430 8716 8153 gene locus_tag LOCUS_10440 8716 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 9048 8854 gene locus_tag LOCUS_10450 9048 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 9111 10904 gene locus_tag LOCUS_10460 gene pepF 9111 10904 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_10460 12001 11123 gene locus_tag LOCUS_10470 gene nrfD 12001 11123 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811186.1 protein_id gnl|my_center|LOCUS_10470 12547 12008 gene locus_tag LOCUS_10480 12547 12008 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943482.1 protein_id gnl|my_center|LOCUS_10480 14721 12547 gene locus_tag LOCUS_10490 14721 12547 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391988.1 protein_id gnl|my_center|LOCUS_10490 15600 14872 gene locus_tag LOCUS_10500 15600 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 16429 15638 gene locus_tag LOCUS_10510 16429 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 16845 18962 gene locus_tag LOCUS_10520 16845 18962 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273518.1 protein_id gnl|my_center|LOCUS_10520 20567 19044 gene locus_tag LOCUS_10530 20567 19044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 20891 21964 gene locus_tag LOCUS_10540 20891 21964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 22016 22672 gene locus_tag LOCUS_10550 22016 22672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 22973 24052 gene locus_tag LOCUS_10560 22973 24052 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460845.1 protein_id gnl|my_center|LOCUS_10560 24049 24831 gene locus_tag LOCUS_10570 24049 24831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816411.1 protein_id gnl|my_center|LOCUS_10570 24844 26019 gene locus_tag LOCUS_10580 24844 26019 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816413.1 protein_id gnl|my_center|LOCUS_10580 28085 26208 gene locus_tag LOCUS_10590 28085 26208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 28749 28285 gene locus_tag LOCUS_10600 28749 28285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 28989 29879 gene locus_tag LOCUS_10610 28989 29879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 29866 30690 gene locus_tag LOCUS_10620 29866 30690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 32782 30782 gene locus_tag LOCUS_10630 32782 30782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 33875 32793 gene locus_tag LOCUS_10640 33875 32793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 34346 38107 gene locus_tag LOCUS_10650 34346 38107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 38125 38781 gene locus_tag LOCUS_10660 38125 38781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 38785 39684 gene locus_tag LOCUS_10670 38785 39684 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809896.1 protein_id gnl|my_center|LOCUS_10670 39867 40694 gene locus_tag LOCUS_10680 39867 40694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence18 2269 221 gene locus_tag LOCUS_10690 gene rnr 2269 221 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391817.1 protein_id gnl|my_center|LOCUS_10690 3730 2420 gene locus_tag LOCUS_10700 3730 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4752 3838 gene locus_tag LOCUS_10710 gene ftsX 4752 3838 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_10710 5623 4745 gene locus_tag LOCUS_10720 gene ftsE 5623 4745 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_10720 6653 5682 gene locus_tag LOCUS_10730 6653 5682 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_10730 7497 6646 gene locus_tag LOCUS_10740 7497 6646 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_10740 8740 7616 gene locus_tag LOCUS_10750 gene prfB 8740 7616 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_10750 11686 8876 gene locus_tag LOCUS_10760 gene secA 11686 8876 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390085.1 protein_id gnl|my_center|LOCUS_10760 14393 11991 gene locus_tag LOCUS_10770 14393 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 15100 15173 gene locus_tag LOCUS_t00310 15100 15173 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15179 15255 gene locus_tag LOCUS_t00320 15179 15255 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16313 15345 gene locus_tag LOCUS_10780 16313 15345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 17366 16326 gene locus_tag LOCUS_10790 17366 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 17441 18946 gene locus_tag LOCUS_10800 17441 18946 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_10800 20649 18934 gene locus_tag LOCUS_10810 gene recN 20649 18934 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660689.1 protein_id gnl|my_center|LOCUS_10810 20805 21692 gene locus_tag LOCUS_10820 20805 21692 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_10820 21815 22309 gene locus_tag LOCUS_10830 gene dtd 21815 22309 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_10830 22906 22397 gene locus_tag LOCUS_10840 22906 22397 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_10840 23315 24244 gene locus_tag LOCUS_10850 gene cysK 23315 24244 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965533.1 protein_id gnl|my_center|LOCUS_10850 24486 26132 gene locus_tag LOCUS_10860 24486 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 28322 26193 gene locus_tag LOCUS_10870 gene uvrB 28322 26193 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_10870 29030 28380 gene locus_tag LOCUS_10880 gene coaE 29030 28380 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_10880 30429 29200 gene locus_tag LOCUS_10890 30429 29200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 31498 30662 gene locus_tag LOCUS_10900 31498 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 32819 31524 gene locus_tag LOCUS_10910 32819 31524 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_10910 34740 32842 gene locus_tag LOCUS_10920 gene dxs 34740 32842 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_10920 35108 34752 gene locus_tag LOCUS_10930 35108 34752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 35679 35101 gene locus_tag LOCUS_10940 35679 35101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 36033 35683 gene locus_tag LOCUS_10950 36033 35683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 36508 37857 gene locus_tag LOCUS_10960 gene sstT 36508 37857 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_10960 38103 39440 gene locus_tag LOCUS_10970 gene sstT 38103 39440 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence19 87 1904 gene locus_tag LOCUS_10980 gene lepA 87 1904 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288355.1 protein_id gnl|my_center|LOCUS_10980 1901 2095 gene locus_tag LOCUS_10990 1901 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2254 3243 gene locus_tag LOCUS_11000 gene dusB 2254 3243 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_11000 3240 4349 gene locus_tag LOCUS_11010 gene hemW 3240 4349 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_11010 4419 4589 gene locus_tag LOCUS_11020 4419 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5067 6083 gene locus_tag LOCUS_11030 gene hrcA 5067 6083 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_11030 6132 7253 gene locus_tag LOCUS_11040 gene dnaJ 6132 7253 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_11040 7392 8168 gene locus_tag LOCUS_11050 7392 8168 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_11050 8300 9589 gene locus_tag LOCUS_11060 gene mtaB 8300 9589 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_11060 9586 10719 gene locus_tag LOCUS_11070 9586 10719 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_11070 10710 11168 gene locus_tag LOCUS_11080 gene ybeY 10710 11168 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565667.1 protein_id gnl|my_center|LOCUS_11080 11165 11551 gene locus_tag LOCUS_11090 11165 11551 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_11090 11594 12514 gene locus_tag LOCUS_11100 gene era 11594 12514 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412224.1 protein_id gnl|my_center|LOCUS_11100 12831 12565 gene locus_tag LOCUS_11110 12831 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 12778 13332 gene locus_tag LOCUS_11120 12778 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 13677 13411 gene locus_tag LOCUS_11130 13677 13411 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_11130 14016 15482 gene locus_tag LOCUS_11140 14016 15482 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545853.1 protein_id gnl|my_center|LOCUS_11140 15485 16504 gene locus_tag LOCUS_11150 gene cydB 15485 16504 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880873.1 protein_id gnl|my_center|LOCUS_11150 16782 17069 gene locus_tag LOCUS_11160 gene rpsO 16782 17069 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_11160 17255 19477 gene locus_tag LOCUS_11170 gene pnp 17255 19477 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_11170 19518 20252 gene locus_tag LOCUS_11180 19518 20252 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_11180 22011 20350 gene locus_tag LOCUS_11190 22011 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 22314 23144 gene locus_tag LOCUS_11200 gene rplB 22314 23144 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_11200 23168 23434 gene locus_tag LOCUS_11210 gene rpsS 23168 23434 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_11210 23440 23781 gene locus_tag LOCUS_11220 gene rplV 23440 23781 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_11220 23785 24513 gene locus_tag LOCUS_11230 gene rpsC 23785 24513 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_11230 24513 24953 gene locus_tag LOCUS_11240 gene rplP 24513 24953 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_11240 24940 25134 gene locus_tag LOCUS_11250 gene rpmC 24940 25134 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_11250 25168 25428 gene locus_tag LOCUS_11260 gene rpsQ 25168 25428 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_11260 25465 25833 gene locus_tag LOCUS_11270 gene rplN 25465 25833 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_11270 25849 26166 gene locus_tag LOCUS_11280 gene rplX 25849 26166 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002447331.1 protein_id gnl|my_center|LOCUS_11280 26297 26845 gene locus_tag LOCUS_11290 gene rplE 26297 26845 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_11290 26890 27075 gene locus_tag LOCUS_11300 26890 27075 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_11300 27181 27579 gene locus_tag LOCUS_11310 gene rpsH 27181 27579 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_11310 27596 28141 gene locus_tag LOCUS_11320 gene rplF 27596 28141 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_11320 28162 28530 gene locus_tag LOCUS_11330 gene rplR 28162 28530 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987751.1 protein_id gnl|my_center|LOCUS_11330 28543 29094 gene locus_tag LOCUS_11340 gene rpsE 28543 29094 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_11340 29081 29275 gene locus_tag LOCUS_11350 gene rpmD 29081 29275 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_11350 29494 29943 gene locus_tag LOCUS_11360 gene rplO 29494 29943 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356221.1 protein_id gnl|my_center|LOCUS_11360 29937 31217 gene locus_tag LOCUS_11370 gene secY 29937 31217 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_11370 31229 31855 gene locus_tag LOCUS_11380 31229 31855 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_11380 32114 34291 gene locus_tag LOCUS_11390 32114 34291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_11390 34521 38081 gene locus_tag LOCUS_11400 gene nifJ 34521 38081 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_11400 38775 38185 gene locus_tag LOCUS_11410 38775 38185 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence20 584 1450 gene locus_tag LOCUS_11420 584 1450 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 protein_id gnl|my_center|LOCUS_11420 2071 2316 gene locus_tag LOCUS_11430 2071 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2415 3158 gene locus_tag LOCUS_11440 2415 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3393 4313 gene locus_tag LOCUS_11450 3393 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4600 4310 gene locus_tag LOCUS_11460 4600 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 6031 4622 gene locus_tag LOCUS_11470 6031 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 7472 6114 gene locus_tag LOCUS_11480 7472 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 8622 7570 gene locus_tag LOCUS_11490 8622 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 9841 8900 gene locus_tag LOCUS_11500 9841 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 10522 10031 gene locus_tag LOCUS_11510 10522 10031 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 protein_id gnl|my_center|LOCUS_11510 10666 10592 gene locus_tag LOCUS_t00330 10666 10592 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11315 10881 gene locus_tag LOCUS_11520 11315 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322028.1 protein_id gnl|my_center|LOCUS_11520 12403 11312 gene locus_tag LOCUS_11530 12403 11312 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645635.1 protein_id gnl|my_center|LOCUS_11530 12704 13516 gene locus_tag LOCUS_11540 12704 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 13503 16391 gene locus_tag LOCUS_11550 13503 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 16638 16988 gene locus_tag LOCUS_11560 16638 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 18384 17044 gene locus_tag LOCUS_11570 18384 17044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 21136 19133 gene locus_tag LOCUS_11580 21136 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 21648 21292 gene locus_tag LOCUS_11590 gene rplT 21648 21292 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_11590 21863 21666 gene locus_tag LOCUS_11600 gene rpmI 21863 21666 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_11600 22382 21867 gene locus_tag LOCUS_11610 22382 21867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 23584 22709 gene locus_tag LOCUS_11620 23584 22709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 24181 23657 gene locus_tag LOCUS_11630 24181 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 25373 24225 gene locus_tag LOCUS_11640 25373 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 26597 25794 gene locus_tag LOCUS_11650 26597 25794 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 protein_id gnl|my_center|LOCUS_11650 28066 26747 gene locus_tag LOCUS_11660 28066 26747 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_11660 29160 28489 gene locus_tag LOCUS_11670 29160 28489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 29478 29405 gene locus_tag LOCUS_t00340 29478 29405 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29571 29495 gene locus_tag LOCUS_t00350 29571 29495 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30274 29672 gene locus_tag LOCUS_11680 30274 29672 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_11680 31339 30383 gene locus_tag LOCUS_11690 gene murI 31339 30383 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_11690 31672 33582 gene locus_tag LOCUS_11700 31672 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 34435 33575 gene locus_tag LOCUS_11710 34435 33575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 34557 35213 gene locus_tag LOCUS_11720 34557 35213 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_11720 36340 35396 gene locus_tag LOCUS_11730 gene bsh 36340 35396 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389832.1 protein_id gnl|my_center|LOCUS_11730 36701 38191 gene locus_tag LOCUS_11740 36701 38191 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143598.1 protein_id gnl|my_center|LOCUS_11740 38200 38733 gene locus_tag LOCUS_11750 38200 38733 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence21 1163 438 gene locus_tag LOCUS_11760 gene pyrF 1163 438 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460654.1 protein_id gnl|my_center|LOCUS_11760 2134 1157 gene locus_tag LOCUS_11770 2134 1157 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_11770 2934 2134 gene locus_tag LOCUS_11780 2934 2134 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_11780 6161 2943 gene locus_tag LOCUS_11790 gene carB 6161 2943 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_11790 7632 6154 gene locus_tag LOCUS_11800 gene carA 7632 6154 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081322.1 protein_id gnl|my_center|LOCUS_11800 8918 7629 gene locus_tag LOCUS_11810 8918 7629 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_11810 9846 8902 gene locus_tag LOCUS_11820 9846 8902 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_11820 10538 9846 gene locus_tag LOCUS_11830 gene pyrR 10538 9846 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_11830 11164 11781 gene locus_tag LOCUS_11840 11164 11781 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_11840 12073 13272 gene locus_tag LOCUS_11850 gene metK 12073 13272 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564111.1 protein_id gnl|my_center|LOCUS_11850 13297 15489 gene locus_tag LOCUS_11860 13297 15489 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_11860 15486 18143 gene locus_tag LOCUS_11870 15486 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 19279 18296 gene locus_tag LOCUS_11880 19279 18296 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_11880 20402 19347 gene locus_tag LOCUS_11890 20402 19347 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_11890 21288 20839 gene locus_tag LOCUS_11900 21288 20839 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392728.1 protein_id gnl|my_center|LOCUS_11900 22156 21311 gene locus_tag LOCUS_11910 gene amrS 22156 21311 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_11910 23806 22376 gene locus_tag LOCUS_11920 gene amrA 23806 22376 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_11920 24099 24512 gene locus_tag LOCUS_11930 24099 24512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 27001 24602 gene locus_tag LOCUS_11940 27001 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 28286 27312 gene locus_tag LOCUS_11950 gene glpX 28286 27312 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919260.1 protein_id gnl|my_center|LOCUS_11950 29847 28357 gene locus_tag LOCUS_11960 29847 28357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 30899 29844 gene locus_tag LOCUS_11970 30899 29844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 31491 30961 gene locus_tag LOCUS_11980 gene def 31491 30961 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378195.1 protein_id gnl|my_center|LOCUS_11980 33579 31558 gene locus_tag LOCUS_11990 33579 31558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 34714 33785 gene locus_tag LOCUS_12000 gene ribF 34714 33785 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769259.1 protein_id gnl|my_center|LOCUS_12000 35717 34692 gene locus_tag LOCUS_12010 35717 34692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 36704 35721 gene locus_tag LOCUS_12020 36704 35721 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_12020 37050 36688 gene locus_tag LOCUS_12030 gene rbfA 37050 36688 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325039.1 protein_id gnl|my_center|LOCUS_12030 38108 37182 gene locus_tag LOCUS_12040 38108 37182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence22 1055 1363 gene locus_tag LOCUS_12050 gene trxA 1055 1363 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_12050 1373 2290 gene locus_tag LOCUS_12060 gene trxB 1373 2290 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_12060 2537 3616 gene locus_tag LOCUS_12070 gene prfA 2537 3616 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_12070 3699 4670 gene locus_tag LOCUS_12080 gene prmC 3699 4670 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_12080 4684 5544 gene locus_tag LOCUS_12090 4684 5544 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462308.1 protein_id gnl|my_center|LOCUS_12090 7369 5555 gene locus_tag LOCUS_12100 gene ade 7369 5555 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948084.1 protein_id gnl|my_center|LOCUS_12100 8184 7534 gene locus_tag LOCUS_12110 8184 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 8627 9385 gene locus_tag LOCUS_12120 8627 9385 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461748.1 protein_id gnl|my_center|LOCUS_12120 9400 10284 gene locus_tag LOCUS_12130 9400 10284 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461747.1 protein_id gnl|my_center|LOCUS_12130 10317 11624 gene locus_tag LOCUS_12140 10317 11624 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461742.1 protein_id gnl|my_center|LOCUS_12140 11621 11920 gene locus_tag LOCUS_12150 11621 11920 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081072.1 protein_id gnl|my_center|LOCUS_12150 12077 13255 gene locus_tag LOCUS_12160 12077 13255 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813989.1 protein_id gnl|my_center|LOCUS_12160 13264 14361 gene locus_tag LOCUS_12170 13264 14361 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993557.1 protein_id gnl|my_center|LOCUS_12170 14358 16478 gene locus_tag LOCUS_12180 14358 16478 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_12180 16478 16945 gene locus_tag LOCUS_12190 16478 16945 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964019.1 protein_id gnl|my_center|LOCUS_12190 16966 17661 gene locus_tag LOCUS_12200 16966 17661 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_12200 17720 18886 gene locus_tag LOCUS_12210 gene trpS 17720 18886 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_12210 18899 19660 gene locus_tag LOCUS_12220 18899 19660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 19661 20527 gene locus_tag LOCUS_12230 19661 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 20524 21435 gene locus_tag LOCUS_12240 20524 21435 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_12240 21496 22830 gene locus_tag LOCUS_12250 gene aroA 21496 22830 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067654.1 protein_id gnl|my_center|LOCUS_12250 22827 23522 gene locus_tag LOCUS_12260 gene cmk 22827 23522 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074539.1 protein_id gnl|my_center|LOCUS_12260 23519 24388 gene locus_tag LOCUS_12270 23519 24388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 24454 25290 gene locus_tag LOCUS_12280 gene ispH 24454 25290 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_12280 25446 27044 gene locus_tag LOCUS_12290 25446 27044 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_12290 27044 28360 gene locus_tag LOCUS_12300 gene der 27044 28360 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_12300 28365 29024 gene locus_tag LOCUS_12310 gene plsY 28365 29024 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087861.1 protein_id gnl|my_center|LOCUS_12310 29069 30082 gene locus_tag LOCUS_12320 29069 30082 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_12320 30164 30640 gene locus_tag LOCUS_12330 30164 30640 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086236.1 protein_id gnl|my_center|LOCUS_12330 30689 31438 gene locus_tag LOCUS_12340 gene rpe 30689 31438 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164332.1 protein_id gnl|my_center|LOCUS_12340 31566 32801 gene locus_tag LOCUS_12350 gene nifS 31566 32801 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_12350 32927 33826 gene locus_tag LOCUS_12360 32927 33826 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_12360 33885 34610 gene locus_tag LOCUS_12370 33885 34610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 34847 35626 gene locus_tag LOCUS_12380 34847 35626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 35620 35958 gene locus_tag LOCUS_12390 35620 35958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence23 229 654 gene locus_tag LOCUS_12400 229 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 916 1275 gene locus_tag LOCUS_12410 916 1275 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836732.1 protein_id gnl|my_center|LOCUS_12410 1451 2440 gene locus_tag LOCUS_12420 1451 2440 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182588488.1 protein_id gnl|my_center|LOCUS_12420 4005 2590 gene locus_tag LOCUS_12430 4005 2590 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_12430 7114 4163 gene locus_tag LOCUS_12440 7114 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 8071 7229 gene locus_tag LOCUS_12450 gene menB 8071 7229 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132444.1 protein_id gnl|my_center|LOCUS_12450 9087 8068 gene locus_tag LOCUS_12460 gene menH 9087 8068 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905534.1 protein_id gnl|my_center|LOCUS_12460 11215 9335 gene locus_tag LOCUS_12470 gene menD 11215 9335 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 protein_id gnl|my_center|LOCUS_12470 11319 11795 gene locus_tag LOCUS_12480 11319 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 13244 11973 gene locus_tag LOCUS_12490 13244 11973 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616720.1 protein_id gnl|my_center|LOCUS_12490 16051 13253 gene locus_tag LOCUS_12500 16051 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 17376 16159 gene locus_tag LOCUS_12510 17376 16159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 17591 17517 gene locus_tag LOCUS_t00360 17591 17517 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17876 17715 gene locus_tag LOCUS_12520 17876 17715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 22858 18080 gene locus_tag LOCUS_12530 22858 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 26075 23022 gene locus_tag LOCUS_12540 26075 23022 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_12540 26208 26858 gene locus_tag LOCUS_12550 26208 26858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 27812 26859 gene locus_tag LOCUS_12560 27812 26859 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_12560 27922 28989 gene locus_tag LOCUS_12570 gene rlmN 27922 28989 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_12570 30460 29255 gene locus_tag LOCUS_12580 30460 29255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 31574 30453 gene locus_tag LOCUS_12590 31574 30453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 32470 31805 gene locus_tag LOCUS_12600 gene rsmG 32470 31805 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921980.1 protein_id gnl|my_center|LOCUS_12600 33280 32645 gene locus_tag LOCUS_12610 33280 32645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 34114 33338 gene locus_tag LOCUS_12620 34114 33338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 34678 34433 gene locus_tag LOCUS_12630 34678 34433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 34901 34767 gene locus_tag LOCUS_12640 gene rpmH 34901 34767 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131818.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence24 703 1827 gene locus_tag LOCUS_12650 703 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1840 2835 gene locus_tag LOCUS_12660 1840 2835 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036831.1 protein_id gnl|my_center|LOCUS_12660 2825 3613 gene locus_tag LOCUS_12670 2825 3613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403758.1 protein_id gnl|my_center|LOCUS_12670 6037 3764 gene locus_tag LOCUS_12680 6037 3764 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593905.1 protein_id gnl|my_center|LOCUS_12680 7041 6037 gene locus_tag LOCUS_12690 7041 6037 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_12690 7183 8562 gene locus_tag LOCUS_12700 7183 8562 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_12700 10084 8798 gene locus_tag LOCUS_12710 10084 8798 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_12710 10449 13181 gene locus_tag LOCUS_12720 10449 13181 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_12720 13222 13680 gene locus_tag LOCUS_12730 13222 13680 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404673.1 protein_id gnl|my_center|LOCUS_12730 13969 13748 gene locus_tag LOCUS_12740 13969 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 17371 14183 gene locus_tag LOCUS_12750 17371 14183 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476308.1 protein_id gnl|my_center|LOCUS_12750 18520 17372 gene locus_tag LOCUS_12760 18520 17372 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476309.1 protein_id gnl|my_center|LOCUS_12760 20214 18793 gene locus_tag LOCUS_12770 20214 18793 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_12770 20681 20217 gene locus_tag LOCUS_12780 20681 20217 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_12780 21471 20959 gene locus_tag LOCUS_12790 21471 20959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 21797 21723 gene locus_tag LOCUS_t00370 21797 21723 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22521 21973 gene locus_tag LOCUS_12800 22521 21973 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_12800 23416 22655 gene locus_tag LOCUS_12810 23416 22655 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_12810 24085 23432 gene locus_tag LOCUS_12820 24085 23432 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811435.1 protein_id gnl|my_center|LOCUS_12820 25134 24280 gene locus_tag LOCUS_12830 25134 24280 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759187.1 protein_id gnl|my_center|LOCUS_12830 26560 25415 gene locus_tag LOCUS_12840 26560 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 27971 26667 gene locus_tag LOCUS_12850 27971 26667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 29990 28107 gene locus_tag LOCUS_12860 29990 28107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence25 1565 882 gene locus_tag LOCUS_12870 1565 882 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_12870 2234 3244 gene locus_tag LOCUS_12880 2234 3244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_12880 3527 5011 gene locus_tag LOCUS_12890 3527 5011 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 protein_id gnl|my_center|LOCUS_12890 5292 6158 gene locus_tag LOCUS_12900 5292 6158 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_12900 6398 6622 gene locus_tag LOCUS_12910 6398 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6758 7750 gene locus_tag LOCUS_12920 gene pta 6758 7750 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_12920 9237 7978 gene locus_tag LOCUS_12930 9237 7978 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_12930 9718 10923 gene locus_tag LOCUS_12940 9718 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 10961 11722 gene locus_tag LOCUS_12950 10961 11722 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861566.1 protein_id gnl|my_center|LOCUS_12950 13057 11777 gene locus_tag LOCUS_12960 13057 11777 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_12960 13287 13066 gene locus_tag LOCUS_12970 13287 13066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 13520 14278 gene locus_tag LOCUS_12980 13520 14278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_12980 14293 16632 gene locus_tag LOCUS_12990 14293 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 16970 17638 gene locus_tag LOCUS_13000 16970 17638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 17751 18158 gene locus_tag LOCUS_13010 17751 18158 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_13010 18590 19369 gene locus_tag LOCUS_13020 18590 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 20238 19795 gene locus_tag LOCUS_13030 20238 19795 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_13030 20531 20235 gene locus_tag LOCUS_13040 20531 20235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 20920 21597 gene locus_tag LOCUS_13050 20920 21597 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074366.1 protein_id gnl|my_center|LOCUS_13050 22958 22107 gene locus_tag LOCUS_13060 22958 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 23097 23411 gene locus_tag LOCUS_13070 23097 23411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 23567 23800 gene locus_tag LOCUS_13080 23567 23800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 23748 24650 gene locus_tag LOCUS_13090 23748 24650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 25733 25158 gene locus_tag LOCUS_13100 25733 25158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 26086 26373 gene locus_tag LOCUS_13110 26086 26373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 26395 26616 gene locus_tag LOCUS_13120 26395 26616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 27072 26632 gene locus_tag LOCUS_13130 27072 26632 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence26 147 230 gene locus_tag LOCUS_t00380 147 230 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1117 512 gene locus_tag LOCUS_13140 1117 512 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_13140 2012 1167 gene locus_tag LOCUS_13150 2012 1167 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_13150 3181 2237 gene locus_tag LOCUS_13160 3181 2237 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_13160 3762 3322 gene locus_tag LOCUS_13170 3762 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 4825 3845 gene locus_tag LOCUS_13180 4825 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 6254 4830 gene locus_tag LOCUS_13190 6254 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 6812 6321 gene locus_tag LOCUS_13200 6812 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 8118 7138 gene locus_tag LOCUS_13210 8118 7138 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_13210 8624 8154 gene locus_tag LOCUS_13220 8624 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 9173 8625 gene locus_tag LOCUS_13230 9173 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 10675 9380 gene locus_tag LOCUS_13240 gene serS 10675 9380 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_13240 10813 11088 gene locus_tag LOCUS_13250 10813 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 11171 12028 gene locus_tag LOCUS_13260 11171 12028 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813634.1 protein_id gnl|my_center|LOCUS_13260 14311 12149 gene locus_tag LOCUS_13270 14311 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 14469 14555 gene locus_tag LOCUS_t00390 14469 14555 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14966 16300 gene locus_tag LOCUS_13280 14966 16300 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_13280 16451 17590 gene locus_tag LOCUS_13290 16451 17590 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222008.1 protein_id gnl|my_center|LOCUS_13290 17693 18106 gene locus_tag LOCUS_13300 17693 18106 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907472.1 protein_id gnl|my_center|LOCUS_13300 18106 19488 gene locus_tag LOCUS_13310 18106 19488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 19485 21215 gene locus_tag LOCUS_13320 19485 21215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 21172 22254 gene locus_tag LOCUS_13330 21172 22254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13330 21186 21195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22330 24414 gene locus_tag LOCUS_13340 gene pknB 22330 24414 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222003.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence27 1859 363 gene locus_tag LOCUS_13350 1859 363 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233725.1 protein_id gnl|my_center|LOCUS_13350 2102 3712 gene locus_tag LOCUS_13360 2102 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5207 3789 gene locus_tag LOCUS_13370 5207 3789 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_13370 6603 5383 gene locus_tag LOCUS_13380 6603 5383 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_13380 9623 6711 gene locus_tag LOCUS_13390 gene fdhF 9623 6711 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371207.1 protein_id gnl|my_center|LOCUS_13390 11469 9616 gene locus_tag LOCUS_13400 11469 9616 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_13400 12394 11672 gene locus_tag LOCUS_13410 12394 11672 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_13410 12626 14173 gene locus_tag LOCUS_13420 gene hcp 12626 14173 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_13420 14571 15134 gene locus_tag LOCUS_13430 gene apt 14571 15134 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005052987.1 protein_id gnl|my_center|LOCUS_13430 15958 15275 gene locus_tag LOCUS_13440 15958 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 16694 16128 gene locus_tag LOCUS_13450 16694 16128 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_13450 18079 16904 gene locus_tag LOCUS_13460 18079 16904 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_13460 19076 18072 gene locus_tag LOCUS_13470 19076 18072 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_13470 19151 19483 gene locus_tag LOCUS_13480 19151 19483 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_13480 20065 21378 gene locus_tag LOCUS_13490 20065 21378 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence28 9 3320 gene locus_tag LOCUS_13500 9 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3833 8485 gene locus_tag LOCUS_13510 3833 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 8794 9246 gene locus_tag LOCUS_13520 8794 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9525 9941 gene locus_tag LOCUS_13530 9525 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 10057 10422 gene locus_tag LOCUS_13540 10057 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 10834 10607 gene locus_tag LOCUS_13550 10834 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 12817 11066 gene locus_tag LOCUS_13560 12817 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 13286 14230 gene locus_tag LOCUS_13570 13286 14230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_13570 14230 15327 gene locus_tag LOCUS_13580 14230 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 15441 17027 gene locus_tag LOCUS_13590 15441 17027 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901104.1 protein_id gnl|my_center|LOCUS_13590 17051 17869 gene locus_tag LOCUS_13600 17051 17869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 protein_id gnl|my_center|LOCUS_13600 17866 18891 gene locus_tag LOCUS_13610 17866 18891 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400031.1 protein_id gnl|my_center|LOCUS_13610 20584 19088 gene locus_tag LOCUS_13620 20584 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 20678 21046 gene locus_tag LOCUS_13630 20678 21046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence29 680 120 gene locus_tag LOCUS_13640 gene nrdG 680 120 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262378.1 protein_id gnl|my_center|LOCUS_13640 2928 703 gene locus_tag LOCUS_13650 gene nrdD 2928 703 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095357.1 protein_id gnl|my_center|LOCUS_13650 5277 3424 gene locus_tag LOCUS_13660 5277 3424 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047743.1 protein_id gnl|my_center|LOCUS_13660 6738 5341 gene locus_tag LOCUS_13670 6738 5341 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047742.1 protein_id gnl|my_center|LOCUS_13670 8272 6908 gene locus_tag LOCUS_13680 8272 6908 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641680.1 protein_id gnl|my_center|LOCUS_13680 9237 8473 gene locus_tag LOCUS_13690 9237 8473 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_13690 9860 9348 gene locus_tag LOCUS_13700 9860 9348 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_13700 9947 10252 gene locus_tag LOCUS_13710 gene gatC 9947 10252 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_13710 10249 11823 gene locus_tag LOCUS_13720 gene gatA 10249 11823 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_13720 11820 13361 gene locus_tag LOCUS_13730 gene gatB 11820 13361 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_13730 13547 14707 gene locus_tag LOCUS_13740 13547 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 14720 15526 gene locus_tag LOCUS_13750 gene larB 14720 15526 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_13750 15664 16974 gene locus_tag LOCUS_13760 15664 16974 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_13760 17480 18541 gene locus_tag LOCUS_13770 gene pheS 17480 18541 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_13770 18588 21044 gene locus_tag LOCUS_13780 gene pheT 18588 21044 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence30 229 975 gene locus_tag LOCUS_13790 229 975 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_13790 1256 1077 gene locus_tag LOCUS_13800 1256 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1498 2256 gene locus_tag LOCUS_13810 1498 2256 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_13810 2451 3215 gene locus_tag LOCUS_13820 2451 3215 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_13820 3368 4006 gene locus_tag LOCUS_13830 3368 4006 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943862.1 protein_id gnl|my_center|LOCUS_13830 4015 8634 gene locus_tag LOCUS_13840 4015 8634 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352208.1 protein_id gnl|my_center|LOCUS_13840 8749 9699 gene locus_tag LOCUS_13850 gene rsmI 8749 9699 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588618.1 protein_id gnl|my_center|LOCUS_13850 9949 10500 gene locus_tag LOCUS_13860 9949 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 10650 11801 gene locus_tag LOCUS_13870 10650 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11872 13461 gene locus_tag LOCUS_13880 gene metG 11872 13461 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_13880 13570 14589 gene locus_tag LOCUS_13890 13570 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 14589 15167 gene locus_tag LOCUS_13900 14589 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 15181 16083 gene locus_tag LOCUS_13910 gene rsmA 15181 16083 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_13910 16212 16571 gene locus_tag LOCUS_13920 16212 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 16645 16720 gene locus_tag LOCUS_t00400 16645 16720 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17718 17029 gene locus_tag LOCUS_13930 17718 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 19397 17751 gene locus_tag LOCUS_13940 19397 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence31 902 535 gene locus_tag LOCUS_tm00010 902 535 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1806 1045 gene locus_tag LOCUS_13950 gene sdhB 1806 1045 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_13950 3569 1821 gene locus_tag LOCUS_13960 gene sdhA 3569 1821 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676737.1 protein_id gnl|my_center|LOCUS_13960 4206 3586 gene locus_tag LOCUS_13970 4206 3586 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079317.1 protein_id gnl|my_center|LOCUS_13970 5988 4501 gene locus_tag LOCUS_13980 gene aspA 5988 4501 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562145.1 protein_id gnl|my_center|LOCUS_13980 7516 6161 gene locus_tag LOCUS_13990 7516 6161 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498698.1 protein_id gnl|my_center|LOCUS_13990 8445 9152 gene locus_tag LOCUS_14000 8445 9152 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_14000 9481 10416 gene locus_tag LOCUS_14010 9481 10416 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_14010 11808 10438 gene locus_tag LOCUS_14020 11808 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 14817 12070 gene locus_tag LOCUS_14030 gene ppdK 14817 12070 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_14030 15838 14942 gene locus_tag LOCUS_14040 15838 14942 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 protein_id gnl|my_center|LOCUS_14040 18064 15983 gene locus_tag LOCUS_14050 gene glyS 18064 15983 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_14050 19007 18066 gene locus_tag LOCUS_14060 19007 18066 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence32 223 522 gene locus_tag LOCUS_14070 223 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 519 989 gene locus_tag LOCUS_14080 519 989 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209627004.1 protein_id gnl|my_center|LOCUS_14080 1691 3025 gene locus_tag LOCUS_14090 1691 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3969 3139 gene locus_tag LOCUS_14100 3969 3139 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903317.1 protein_id gnl|my_center|LOCUS_14100 4237 5235 gene locus_tag LOCUS_14110 4237 5235 CDS product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 protein_id gnl|my_center|LOCUS_14110 6862 5312 gene locus_tag LOCUS_14120 6862 5312 CDS product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 protein_id gnl|my_center|LOCUS_14120 7956 6862 gene locus_tag LOCUS_14130 7956 6862 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721245.1 protein_id gnl|my_center|LOCUS_14130 9417 8047 gene locus_tag LOCUS_14140 9417 8047 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814314.1 protein_id gnl|my_center|LOCUS_14140 9718 10356 gene locus_tag LOCUS_14150 9718 10356 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700625.1 protein_id gnl|my_center|LOCUS_14150 10482 10985 gene locus_tag LOCUS_14160 10482 10985 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_14160 11308 12303 gene locus_tag LOCUS_14170 11308 12303 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_14170 13141 12371 gene locus_tag LOCUS_14180 gene ygiD 13141 12371 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_14180 13427 14545 gene locus_tag LOCUS_14190 13427 14545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 14701 15303 gene locus_tag LOCUS_14200 14701 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 15668 16189 gene locus_tag LOCUS_14210 gene rplJ 15668 16189 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048982.1 protein_id gnl|my_center|LOCUS_14210 16314 16688 gene locus_tag LOCUS_14220 gene rplL 16314 16688 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_14220 17939 16869 gene locus_tag LOCUS_14230 gene aroB 17939 16869 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_14230 18723 17983 gene locus_tag LOCUS_14240 18723 17983 CDS product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681658.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence33 1346 399 gene locus_tag LOCUS_14250 gene miaA 1346 399 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_14250 2897 1422 gene locus_tag LOCUS_14260 gene miaB 2897 1422 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_14260 3522 3118 gene locus_tag LOCUS_14270 3522 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4941 3604 gene locus_tag LOCUS_14280 4941 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 6662 5091 gene locus_tag LOCUS_14290 gene rny 6662 5091 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_14290 7526 6975 gene locus_tag LOCUS_14300 7526 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 8708 7608 gene locus_tag LOCUS_14310 gene recA 8708 7608 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_14310 8792 8992 gene locus_tag LOCUS_14320 8792 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 10209 8941 gene locus_tag LOCUS_14330 10209 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 10968 10219 gene locus_tag LOCUS_14340 10968 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 11532 11125 gene locus_tag LOCUS_14350 11532 11125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 12573 11785 gene locus_tag LOCUS_14360 12573 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 12701 12474 gene locus_tag LOCUS_14370 12701 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 15764 13158 gene locus_tag LOCUS_14380 15764 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 17763 15937 gene locus_tag LOCUS_14390 17763 15937 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence34 116 823 gene locus_tag LOCUS_14400 116 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 899 1117 gene locus_tag LOCUS_14410 gene infA 899 1117 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002316557.1 protein_id gnl|my_center|LOCUS_14410 1394 1756 gene locus_tag LOCUS_14420 gene rpsM 1394 1756 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_14420 1768 2163 gene locus_tag LOCUS_14430 gene rpsK 1768 2163 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_14430 2182 2778 gene locus_tag LOCUS_14440 gene rpsD 2182 2778 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_14440 2811 3767 gene locus_tag LOCUS_14450 2811 3767 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723676.1 protein_id gnl|my_center|LOCUS_14450 3779 4378 gene locus_tag LOCUS_14460 3779 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 4846 4595 gene locus_tag LOCUS_14470 4846 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5160 5235 gene locus_tag LOCUS_t00410 5160 5235 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5489 6919 gene locus_tag LOCUS_14480 gene pepV 5489 6919 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_14480 7398 7078 gene locus_tag LOCUS_14490 7398 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8323 7406 gene locus_tag LOCUS_14500 8323 7406 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_14500 8729 9781 gene locus_tag LOCUS_14510 8729 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 9829 11652 gene locus_tag LOCUS_14520 gene glmS 9829 11652 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_14520 11649 12242 gene locus_tag LOCUS_14530 11649 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 12260 13144 gene locus_tag LOCUS_14540 12260 13144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 13153 13671 gene locus_tag LOCUS_14550 13153 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence35 843 2171 gene locus_tag LOCUS_14560 843 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2350 3894 gene locus_tag LOCUS_14570 gene dnaA 2350 3894 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416782.1 protein_id gnl|my_center|LOCUS_14570 4155 5258 gene locus_tag LOCUS_14580 gene dnaN 4155 5258 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_14580 5274 6509 gene locus_tag LOCUS_14590 gene recF 5274 6509 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831795.1 protein_id gnl|my_center|LOCUS_14590 6583 7104 gene locus_tag LOCUS_14600 6583 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 7427 9364 gene locus_tag LOCUS_14610 gene gyrB 7427 9364 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_14610 9445 12216 gene locus_tag LOCUS_14620 gene gyrA 9445 12216 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_14620 13050 12403 gene locus_tag LOCUS_14630 13050 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence36 608 1354 gene locus_tag LOCUS_14640 608 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1723 1535 gene locus_tag LOCUS_14650 gene rpmB 1723 1535 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_14650 3013 1895 gene locus_tag LOCUS_14660 3013 1895 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021243.1 protein_id gnl|my_center|LOCUS_14660 4048 3125 gene locus_tag LOCUS_14670 4048 3125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965289.1 protein_id gnl|my_center|LOCUS_14670 5201 4050 gene locus_tag LOCUS_14680 5201 4050 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965290.1 protein_id gnl|my_center|LOCUS_14680 5509 5856 gene locus_tag LOCUS_14690 5509 5856 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 protein_id gnl|my_center|LOCUS_14690 5920 7575 gene locus_tag LOCUS_14700 5920 7575 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001868429.1 protein_id gnl|my_center|LOCUS_14700 7636 9849 gene locus_tag LOCUS_14710 gene recG 7636 9849 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479810.1 protein_id gnl|my_center|LOCUS_14710 9853 10476 gene locus_tag LOCUS_14720 gene rsmD 9853 10476 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_14720 10473 11066 gene locus_tag LOCUS_14730 gene coaD 10473 11066 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808574.1 protein_id gnl|my_center|LOCUS_14730 11258 11767 gene locus_tag LOCUS_14740 11258 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 11764 12510 gene locus_tag LOCUS_14750 11764 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence37 128 1126 gene locus_tag LOCUS_14760 128 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 1413 1700 gene locus_tag LOCUS_14770 gene groES 1413 1700 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_14770 1761 3398 gene locus_tag LOCUS_14780 gene groL 1761 3398 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288864.1 protein_id gnl|my_center|LOCUS_14780 3776 4630 gene locus_tag LOCUS_14790 3776 4630 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_14790 4705 5574 gene locus_tag LOCUS_14800 4705 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5714 5911 gene locus_tag LOCUS_14810 5714 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 6699 5923 gene locus_tag LOCUS_14820 gene srtB 6699 5923 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086126.1 protein_id gnl|my_center|LOCUS_14820 11167 6869 gene locus_tag LOCUS_14830 11167 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 11415 11340 gene locus_tag LOCUS_t00420 11415 11340 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence38 1077 334 gene locus_tag LOCUS_14840 gene trmD 1077 334 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_14840 1460 1083 gene locus_tag LOCUS_14850 1460 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 1892 1638 gene locus_tag LOCUS_14860 1892 1638 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737401.1 protein_id gnl|my_center|LOCUS_14860 2141 1896 gene locus_tag LOCUS_14870 gene rpsP 2141 1896 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_14870 3773 2382 gene locus_tag LOCUS_14880 gene ffh 3773 2382 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_14880 5182 3773 gene locus_tag LOCUS_14890 5182 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 8977 5270 gene locus_tag LOCUS_14900 gene smc 8977 5270 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 protein_id gnl|my_center|LOCUS_14900 9871 8987 gene locus_tag LOCUS_14910 gene rnc 9871 8987 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_14910 10948 9926 gene locus_tag LOCUS_14920 gene plsX 10948 9926 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232041.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence39 2929 116 gene locus_tag LOCUS_14930 2929 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3810 2929 gene locus_tag LOCUS_14940 3810 2929 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356704.1 protein_id gnl|my_center|LOCUS_14940 3800 4012 gene locus_tag LOCUS_14950 3800 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 4296 4114 gene locus_tag LOCUS_14960 4296 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 7715 4317 gene locus_tag LOCUS_14970 7715 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8489 7881 gene locus_tag LOCUS_14980 gene folE 8489 7881 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_14980 9367 8579 gene locus_tag LOCUS_14990 9367 8579 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence40 <1 842 gene locus_tag LOCUS_15000 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228307.1:lactate utilization iron-sulfur protein LutB 844 1530 gene locus_tag LOCUS_15010 gene lutC 844 1530 CDS product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 protein_id gnl|my_center|LOCUS_15010 2770 1733 gene locus_tag LOCUS_15020 2770 1733 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_15020 4297 2954 gene locus_tag LOCUS_15030 4297 2954 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_15030 4576 6072 gene locus_tag LOCUS_15040 4576 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6246 8159 gene locus_tag LOCUS_15050 6246 8159 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459421.1 protein_id gnl|my_center|LOCUS_15050 8187 9131 gene locus_tag LOCUS_15060 8187 9131 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214307.1 protein_id gnl|my_center|LOCUS_15060 9411 9709 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttaattaccagccaaaatgacgctgcaccaaaac >Feature sequence41 231 581 gene locus_tag LOCUS_15070 gene rplS 231 581 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_15070 663 1451 gene locus_tag LOCUS_15080 663 1451 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130174.1 protein_id gnl|my_center|LOCUS_15080 1714 2529 gene locus_tag LOCUS_15090 1714 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2542 4044 gene locus_tag LOCUS_15100 2542 4044 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_15100 4058 5041 gene locus_tag LOCUS_15110 gene dprA 4058 5041 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227724.1 protein_id gnl|my_center|LOCUS_15110 5108 6532 gene locus_tag LOCUS_15120 gene trmFO 5108 6532 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244725.1 protein_id gnl|my_center|LOCUS_15120 6623 7621 gene locus_tag LOCUS_15130 gene xerC 6623 7621 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_15130 7840 8751 gene locus_tag LOCUS_15140 gene dapA 7840 8751 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence42 182 679 gene locus_tag LOCUS_15150 182 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1844 870 gene locus_tag LOCUS_15160 gene holA 1844 870 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362655.1 protein_id gnl|my_center|LOCUS_15160 4376 1878 gene locus_tag LOCUS_15170 4376 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 5104 4367 gene locus_tag LOCUS_15180 5104 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 6665 5424 gene locus_tag LOCUS_15190 gene thiI 6665 5424 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_15190 6954 6694 gene locus_tag LOCUS_15200 6954 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 7643 7065 gene locus_tag LOCUS_15210 gene gmk 7643 7065 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_15210 7974 7645 gene locus_tag LOCUS_15220 gene mihF 7974 7645 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence43 <1 2620 gene locus_tag LOCUS_15230 <1 2620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein 4720 2783 gene locus_tag LOCUS_15240 gene asnB 4720 2783 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566883.1 protein_id gnl|my_center|LOCUS_15240 5178 6563 gene locus_tag LOCUS_15250 5178 6563 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence44 157 233 gene locus_tag LOCUS_t00430 157 233 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 294 369 gene locus_tag LOCUS_t00440 294 369 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 977 1708 gene locus_tag LOCUS_15260 977 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2023 2613 gene locus_tag LOCUS_15270 gene rimP 2023 2613 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261256.1 protein_id gnl|my_center|LOCUS_15270 2610 3854 gene locus_tag LOCUS_15280 gene nusA 2610 3854 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence45 456 2024 gene locus_tag LOCUS_15290 456 2024 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389450.1 protein_id gnl|my_center|LOCUS_15290 3795 2242 gene locus_tag LOCUS_15300 3795 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4821 4081 gene locus_tag LOCUS_15310 4821 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence46 481 1398 gene locus_tag LOCUS_15320 481 1398 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644197.1 protein_id gnl|my_center|LOCUS_15320 1398 1916 gene locus_tag LOCUS_15330 1398 1916 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_15330 2204 3091 gene locus_tag LOCUS_15340 gene lutA 2204 3091 CDS product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence47 1874 582 gene locus_tag LOCUS_15350 gene tig 1874 582 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583449.1 protein_id gnl|my_center|LOCUS_15350 <3177 1976 gene locus_tag LOCUS_15360 <3177 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003728204.1:IMP dehydrogenase >Feature sequence48 1893 463 gene locus_tag LOCUS_15370 1893 463 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_15370 <2542 2036 gene locus_tag LOCUS_15380 <2542 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548818.1:glycerol-3-phosphate acyltransferase >Feature sequence49 197 448 gene locus_tag LOCUS_15390 197 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 558 649 gene locus_tag LOCUS_t00450 558 649 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 843 1496 gene locus_tag LOCUS_15400 843 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400