>Feature sequence001 299 114 gene locus_tag LOCUS_00010 299 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 728 1339 gene locus_tag LOCUS_00020 728 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_00020 3007 1343 gene locus_tag LOCUS_00030 3007 1343 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_00030 3052 3933 gene locus_tag LOCUS_00040 gene asd 3052 3933 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089371.1 protein_id gnl|my_center|LOCUS_00040 5110 3914 gene locus_tag LOCUS_00050 5110 3914 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_00050 5576 5827 gene locus_tag LOCUS_00060 5576 5827 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250181.1 protein_id gnl|my_center|LOCUS_00060 5829 6119 gene locus_tag LOCUS_00070 5829 6119 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815479.1 protein_id gnl|my_center|LOCUS_00070 6999 6169 gene locus_tag LOCUS_00080 6999 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7744 7025 gene locus_tag LOCUS_00090 7744 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7920 8234 gene locus_tag LOCUS_00100 7920 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 8365 8583 gene locus_tag LOCUS_00110 8365 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9170 8766 gene locus_tag LOCUS_00120 9170 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9426 10286 gene locus_tag LOCUS_00130 gene rpoH 9426 10286 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815756.1 protein_id gnl|my_center|LOCUS_00130 10673 10449 gene locus_tag LOCUS_00140 10673 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12634 10670 gene locus_tag LOCUS_00150 12634 10670 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_00150 12792 13172 gene locus_tag LOCUS_00160 12792 13172 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_00160 13169 13906 gene locus_tag LOCUS_00170 gene ubiE 13169 13906 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217627.1 protein_id gnl|my_center|LOCUS_00170 13903 14475 gene locus_tag LOCUS_00180 13903 14475 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188960.1 protein_id gnl|my_center|LOCUS_00180 14472 16007 gene locus_tag LOCUS_00190 gene ubiB 14472 16007 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_00190 16803 15985 gene locus_tag LOCUS_00200 16803 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17497 18654 gene locus_tag LOCUS_00210 17497 18654 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160754.1 protein_id gnl|my_center|LOCUS_00210 19673 18855 gene locus_tag LOCUS_00220 gene mutM 19673 18855 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925978.1 protein_id gnl|my_center|LOCUS_00220 19924 21078 gene locus_tag LOCUS_00230 19924 21078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522941.1 protein_id gnl|my_center|LOCUS_00230 21078 21872 gene locus_tag LOCUS_00240 21078 21872 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038701.1 protein_id gnl|my_center|LOCUS_00240 21921 22883 gene locus_tag LOCUS_00250 21921 22883 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189757.1 protein_id gnl|my_center|LOCUS_00250 22883 23470 gene locus_tag LOCUS_00260 22883 23470 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189249.1 protein_id gnl|my_center|LOCUS_00260 23470 23991 gene locus_tag LOCUS_00270 23470 23991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 24096 24425 gene locus_tag LOCUS_00280 24096 24425 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200395.1 protein_id gnl|my_center|LOCUS_00280 24429 24812 gene locus_tag LOCUS_00290 24429 24812 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040315.1 protein_id gnl|my_center|LOCUS_00290 24829 25125 gene locus_tag LOCUS_00300 24829 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 25178 25648 gene locus_tag LOCUS_00310 25178 25648 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259432.1 protein_id gnl|my_center|LOCUS_00310 25648 26772 gene locus_tag LOCUS_00320 25648 26772 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290821.1 protein_id gnl|my_center|LOCUS_00320 27704 26826 gene locus_tag LOCUS_00330 27704 26826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 29050 27701 gene locus_tag LOCUS_00340 29050 27701 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_00340 29805 29056 gene locus_tag LOCUS_00350 29805 29056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557338.1 protein_id gnl|my_center|LOCUS_00350 30740 29802 gene locus_tag LOCUS_00360 30740 29802 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_00360 30976 30773 gene locus_tag LOCUS_00370 30976 30773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 30954 32624 gene locus_tag LOCUS_00380 30954 32624 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_00380 32621 33217 gene locus_tag LOCUS_00390 32621 33217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 33214 34059 gene locus_tag LOCUS_00400 gene ispE 33214 34059 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195241.1 protein_id gnl|my_center|LOCUS_00400 34080 34156 gene locus_tag LOCUS_t00010 34080 34156 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 34226 35176 gene locus_tag LOCUS_00410 34226 35176 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_00410 35300 35905 gene locus_tag LOCUS_00420 35300 35905 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808505.1 protein_id gnl|my_center|LOCUS_00420 36018 36605 gene locus_tag LOCUS_00430 gene pth 36018 36605 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_00430 37402 36653 gene locus_tag LOCUS_00440 37402 36653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 38649 37534 gene locus_tag LOCUS_00450 38649 37534 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_00450 40154 38709 gene locus_tag LOCUS_00460 40154 38709 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204841.1 protein_id gnl|my_center|LOCUS_00460 41715 40267 gene locus_tag LOCUS_00470 41715 40267 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107284302.1 protein_id gnl|my_center|LOCUS_00470 43404 41773 gene locus_tag LOCUS_00480 43404 41773 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_00480 43539 43614 gene locus_tag LOCUS_t00020 43539 43614 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43787 44074 gene locus_tag LOCUS_00490 43787 44074 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_00490 44373 44164 gene locus_tag LOCUS_00500 44373 44164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 44943 44410 gene locus_tag LOCUS_00510 44943 44410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 45273 45073 gene locus_tag LOCUS_00520 45273 45073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 46537 45323 gene locus_tag LOCUS_00530 46537 45323 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209929.1 protein_id gnl|my_center|LOCUS_00530 46778 46705 gene locus_tag LOCUS_t00030 46778 46705 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 46843 48909 gene locus_tag LOCUS_00540 gene cstA 46843 48909 CDS product pyruvate/proton symporter CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097628.1 protein_id gnl|my_center|LOCUS_00540 48922 49659 gene locus_tag LOCUS_00550 48922 49659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 49659 49847 gene locus_tag LOCUS_00560 49659 49847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 50242 50904 gene locus_tag LOCUS_00570 50242 50904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 51036 52238 gene locus_tag LOCUS_00580 51036 52238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 52998 52354 gene locus_tag LOCUS_00590 52998 52354 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 protein_id gnl|my_center|LOCUS_00590 54809 52986 gene locus_tag LOCUS_00600 gene edd 54809 52986 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919918.1 protein_id gnl|my_center|LOCUS_00600 55756 54974 gene locus_tag LOCUS_00610 gene lgt 55756 54974 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814606.1 protein_id gnl|my_center|LOCUS_00610 55823 57673 gene locus_tag LOCUS_00620 gene ilvD 55823 57673 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819105.1 protein_id gnl|my_center|LOCUS_00620 57683 58783 gene locus_tag LOCUS_00630 57683 58783 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267245.1 protein_id gnl|my_center|LOCUS_00630 58825 59730 gene locus_tag LOCUS_00640 58825 59730 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269392.1 protein_id gnl|my_center|LOCUS_00640 60742 59801 gene locus_tag LOCUS_00650 60742 59801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 61402 60911 gene locus_tag LOCUS_00660 61402 60911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 61742 61392 gene locus_tag LOCUS_00670 61742 61392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 62268 61780 gene locus_tag LOCUS_00680 62268 61780 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_00680 64160 62277 gene locus_tag LOCUS_00690 64160 62277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 64654 64157 gene locus_tag LOCUS_00700 64654 64157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 65184 64651 gene locus_tag LOCUS_00710 65184 64651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 65717 65181 gene locus_tag LOCUS_00720 65717 65181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 66514 65717 gene locus_tag LOCUS_00730 66514 65717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 68168 66495 gene locus_tag LOCUS_00740 68168 66495 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_00740 69374 68178 gene locus_tag LOCUS_00750 69374 68178 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942428.1 protein_id gnl|my_center|LOCUS_00750 69824 69414 gene locus_tag LOCUS_00760 gene gspG 69824 69414 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465191.1 protein_id gnl|my_center|LOCUS_00760 70659 71744 gene locus_tag LOCUS_00770 gene ychF 70659 71744 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687306.1 protein_id gnl|my_center|LOCUS_00770 71925 73184 gene locus_tag LOCUS_00780 71925 73184 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615166.1 protein_id gnl|my_center|LOCUS_00780 73239 73517 gene locus_tag LOCUS_00790 73239 73517 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_00790 73538 73822 gene locus_tag LOCUS_00800 73538 73822 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_00800 74018 75124 gene locus_tag LOCUS_00810 74018 75124 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_00810 75219 75542 gene locus_tag LOCUS_00820 75219 75542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 76126 76857 gene locus_tag LOCUS_00830 76126 76857 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_00830 76953 77363 gene locus_tag LOCUS_00840 76953 77363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 79517 77370 gene locus_tag LOCUS_00850 79517 77370 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_00850 80813 79641 gene locus_tag LOCUS_00860 80813 79641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 82214 80973 gene locus_tag LOCUS_00870 82214 80973 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_00870 82593 82207 gene locus_tag LOCUS_00880 82593 82207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 82946 82590 gene locus_tag LOCUS_00890 82946 82590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 84189 82963 gene locus_tag LOCUS_00900 gene fabF 84189 82963 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_00900 84428 84189 gene locus_tag LOCUS_00910 84428 84189 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287614.1 protein_id gnl|my_center|LOCUS_00910 85295 84438 gene locus_tag LOCUS_00920 85295 84438 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 protein_id gnl|my_center|LOCUS_00920 86678 85305 gene locus_tag LOCUS_00930 86678 85305 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_00930 87471 86803 gene locus_tag LOCUS_00940 87471 86803 CDS product MtnX-like HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816647.1 protein_id gnl|my_center|LOCUS_00940 87604 88737 gene locus_tag LOCUS_00950 87604 88737 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265760.1 protein_id gnl|my_center|LOCUS_00950 88737 89480 gene locus_tag LOCUS_00960 88737 89480 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_00960 89473 90387 gene locus_tag LOCUS_00970 89473 90387 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919953.1 protein_id gnl|my_center|LOCUS_00970 90387 91505 gene locus_tag LOCUS_00980 90387 91505 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040568.1 protein_id gnl|my_center|LOCUS_00980 91505 92173 gene locus_tag LOCUS_00990 91505 92173 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_00990 92170 93573 gene locus_tag LOCUS_01000 92170 93573 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136386085.1 protein_id gnl|my_center|LOCUS_01000 93977 94177 gene locus_tag LOCUS_01010 93977 94177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 94225 94485 gene locus_tag LOCUS_01020 94225 94485 CDS product DUF5062 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072217.1 protein_id gnl|my_center|LOCUS_01020 95394 94636 gene locus_tag LOCUS_01030 95394 94636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 95834 95364 gene locus_tag LOCUS_01040 95834 95364 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870334.1 protein_id gnl|my_center|LOCUS_01040 96820 95891 gene locus_tag LOCUS_01050 96820 95891 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_01050 97011 97325 gene locus_tag LOCUS_01060 gene rplU 97011 97325 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_01060 97353 97610 gene locus_tag LOCUS_01070 gene rpmA 97353 97610 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212328.1 protein_id gnl|my_center|LOCUS_01070 97734 98783 gene locus_tag LOCUS_01080 gene obgE 97734 98783 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_01080 98780 99898 gene locus_tag LOCUS_01090 gene proB 98780 99898 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_01090 100077 100577 gene locus_tag LOCUS_01100 gene purE 100077 100577 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_01100 100574 101704 gene locus_tag LOCUS_01110 100574 101704 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930406.1 protein_id gnl|my_center|LOCUS_01110 102198 101932 gene locus_tag LOCUS_01120 gene rpsT 102198 101932 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212556.1 protein_id gnl|my_center|LOCUS_01120 102320 103858 gene locus_tag LOCUS_01130 gene murJ 102320 103858 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_01130 103855 104769 gene locus_tag LOCUS_01140 103855 104769 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_01140 104868 107669 gene locus_tag LOCUS_01150 gene ileS 104868 107669 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225664.1 protein_id gnl|my_center|LOCUS_01150 107662 108120 gene locus_tag LOCUS_01160 gene lspA 107662 108120 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_01160 108600 108130 gene locus_tag LOCUS_01170 108600 108130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 109242 108697 gene locus_tag LOCUS_01180 109242 108697 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400057.1 protein_id gnl|my_center|LOCUS_01180 110549 109239 gene locus_tag LOCUS_01190 110549 109239 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_01190 110684 113263 gene locus_tag LOCUS_01200 gene clpB 110684 113263 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_01200 113447 113884 gene locus_tag LOCUS_01210 113447 113884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 114244 113939 gene locus_tag LOCUS_01220 gene hsbA 114244 113939 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_01220 114624 114427 gene locus_tag LOCUS_01230 114624 114427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 115326 114835 gene locus_tag LOCUS_01240 115326 114835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 115496 115819 gene locus_tag LOCUS_01250 115496 115819 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_01250 115888 116766 gene locus_tag LOCUS_01260 115888 116766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01260 117313 116777 gene locus_tag LOCUS_01270 117313 116777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 119292 117547 gene locus_tag LOCUS_01280 119292 117547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 119483 120637 gene locus_tag LOCUS_01290 119483 120637 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037813.1 protein_id gnl|my_center|LOCUS_01290 120708 123797 gene locus_tag LOCUS_01300 gene acrB 120708 123797 CDS product multidrug efflux RND transporter permease subunit AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 protein_id gnl|my_center|LOCUS_01300 123794 125215 gene locus_tag LOCUS_01310 gene adeC 123794 125215 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153304094.1 protein_id gnl|my_center|LOCUS_01310 125325 125804 gene locus_tag LOCUS_01320 125325 125804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 125791 126534 gene locus_tag LOCUS_01330 125791 126534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 >Feature sequence002 294 1019 gene locus_tag LOCUS_01340 294 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3069 1084 gene locus_tag LOCUS_01350 3069 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 3330 3545 gene locus_tag LOCUS_01360 3330 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4388 3585 gene locus_tag LOCUS_01370 4388 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4977 5810 gene locus_tag LOCUS_01380 4977 5810 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405327.1 protein_id gnl|my_center|LOCUS_01380 5877 7280 gene locus_tag LOCUS_01390 5877 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 8413 7421 gene locus_tag LOCUS_01400 8413 7421 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_01400 8592 9467 gene locus_tag LOCUS_01410 8592 9467 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_01410 9479 14437 gene locus_tag LOCUS_01420 9479 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 14461 14628 gene locus_tag LOCUS_01430 14461 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 14645 15988 gene locus_tag LOCUS_01440 gene rsxC 14645 15988 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_01440 15985 17019 gene locus_tag LOCUS_01450 15985 17019 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_01450 17016 17690 gene locus_tag LOCUS_01460 17016 17690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 17687 18337 gene locus_tag LOCUS_01470 17687 18337 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_01470 18334 18921 gene locus_tag LOCUS_01480 gene rsxA 18334 18921 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_01480 18918 19112 gene locus_tag LOCUS_01490 18918 19112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 19651 19824 gene locus_tag LOCUS_01500 19651 19824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 20000 20203 gene locus_tag LOCUS_01510 20000 20203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 20331 20780 gene locus_tag LOCUS_01520 20331 20780 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_01520 20786 21229 gene locus_tag LOCUS_01530 20786 21229 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 protein_id gnl|my_center|LOCUS_01530 21449 22294 gene locus_tag LOCUS_01540 21449 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 22380 23336 gene locus_tag LOCUS_01550 22380 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 24680 23799 gene locus_tag LOCUS_01560 24680 23799 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_01560 25894 25127 gene locus_tag LOCUS_01570 25894 25127 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265660.1 protein_id gnl|my_center|LOCUS_01570 26468 26061 gene locus_tag LOCUS_01580 26468 26061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 28909 26636 gene locus_tag LOCUS_01590 28909 26636 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_01590 30392 29343 gene locus_tag LOCUS_01600 30392 29343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 30906 31988 gene locus_tag LOCUS_01610 30906 31988 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_01610 31991 33787 gene locus_tag LOCUS_01620 31991 33787 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089679.1 protein_id gnl|my_center|LOCUS_01620 33800 34504 gene locus_tag LOCUS_01630 gene cybH 33800 34504 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089678.1 protein_id gnl|my_center|LOCUS_01630 34608 34859 gene locus_tag LOCUS_01640 34608 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 34973 35641 gene locus_tag LOCUS_01650 34973 35641 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338268.1 protein_id gnl|my_center|LOCUS_01650 35644 35949 gene locus_tag LOCUS_01660 35644 35949 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089676.1 protein_id gnl|my_center|LOCUS_01660 35949 36425 gene locus_tag LOCUS_01670 gene hyaE 35949 36425 CDS product hydrogenase-1 operon protein HyaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262577.1 protein_id gnl|my_center|LOCUS_01670 36434 37309 gene locus_tag LOCUS_01680 36434 37309 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338271.1 protein_id gnl|my_center|LOCUS_01680 37306 37524 gene locus_tag LOCUS_01690 37306 37524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01690 37521 38057 gene locus_tag LOCUS_01700 37521 38057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01700 38060 39136 gene locus_tag LOCUS_01710 38060 39136 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388922.1 protein_id gnl|my_center|LOCUS_01710 39129 39470 gene locus_tag LOCUS_01720 gene hypA 39129 39470 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_01720 39483 40406 gene locus_tag LOCUS_01730 gene hypB 39483 40406 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337646.1 protein_id gnl|my_center|LOCUS_01730 40416 42719 gene locus_tag LOCUS_01740 gene hypF 40416 42719 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089668.1 protein_id gnl|my_center|LOCUS_01740 42732 42986 gene locus_tag LOCUS_01750 42732 42986 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089667.1 protein_id gnl|my_center|LOCUS_01750 42983 44125 gene locus_tag LOCUS_01760 gene hypD 42983 44125 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_01760 44227 45276 gene locus_tag LOCUS_01770 gene hypE 44227 45276 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_01770 45276 46721 gene locus_tag LOCUS_01780 45276 46721 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089663.1 protein_id gnl|my_center|LOCUS_01780 46718 47722 gene locus_tag LOCUS_01790 46718 47722 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_01790 47719 49167 gene locus_tag LOCUS_01800 47719 49167 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089681.1 protein_id gnl|my_center|LOCUS_01800 49331 49164 gene locus_tag LOCUS_01810 49331 49164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 51887 49488 gene locus_tag LOCUS_01820 51887 49488 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 protein_id gnl|my_center|LOCUS_01820 52402 51884 gene locus_tag LOCUS_01830 52402 51884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01830 52811 52314 gene locus_tag LOCUS_01840 52811 52314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01840 53506 52811 gene locus_tag LOCUS_01850 53506 52811 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038231.1 protein_id gnl|my_center|LOCUS_01850 54909 53683 gene locus_tag LOCUS_01860 54909 53683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 55032 55220 gene locus_tag LOCUS_01870 55032 55220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 55364 55576 gene locus_tag LOCUS_01880 55364 55576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 55802 57574 gene locus_tag LOCUS_01890 55802 57574 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928981.1 protein_id gnl|my_center|LOCUS_01890 57723 59069 gene locus_tag LOCUS_01900 57723 59069 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089662.1 protein_id gnl|my_center|LOCUS_01900 60033 59125 gene locus_tag LOCUS_01910 gene ftsX 60033 59125 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084508.1 protein_id gnl|my_center|LOCUS_01910 60683 60030 gene locus_tag LOCUS_01920 gene ftsE 60683 60030 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369317.1 protein_id gnl|my_center|LOCUS_01920 61633 60680 gene locus_tag LOCUS_01930 61633 60680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 61751 63097 gene locus_tag LOCUS_01940 61751 63097 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_01940 63084 64400 gene locus_tag LOCUS_01950 63084 64400 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_01950 64435 64935 gene locus_tag LOCUS_01960 gene rsmD 64435 64935 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 protein_id gnl|my_center|LOCUS_01960 64925 65401 gene locus_tag LOCUS_01970 gene coaD 64925 65401 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_01970 65424 65678 gene locus_tag LOCUS_01980 65424 65678 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_01980 66319 65816 gene locus_tag LOCUS_01990 66319 65816 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_01990 66337 67800 gene locus_tag LOCUS_02000 gene ubiD 66337 67800 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161496900.1 protein_id gnl|my_center|LOCUS_02000 67956 67816 gene locus_tag LOCUS_02010 67956 67816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 68478 68014 gene locus_tag LOCUS_02020 68478 68014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 69935 68523 gene locus_tag LOCUS_02030 gene dacB 69935 68523 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809423.1 protein_id gnl|my_center|LOCUS_02030 71317 69932 gene locus_tag LOCUS_02040 gene bioA 71317 69932 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189232.1 protein_id gnl|my_center|LOCUS_02040 71943 71386 gene locus_tag LOCUS_02050 71943 71386 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_02050 72556 71972 gene locus_tag LOCUS_02060 72556 71972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 73125 72553 gene locus_tag LOCUS_02070 73125 72553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 73327 75903 gene locus_tag LOCUS_02080 gene mutS 73327 75903 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_02080 76447 75968 gene locus_tag LOCUS_02090 76447 75968 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688300.1 protein_id gnl|my_center|LOCUS_02090 76908 76447 gene locus_tag LOCUS_02100 76908 76447 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_02100 76986 78104 gene locus_tag LOCUS_02110 76986 78104 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_02110 78393 78650 gene locus_tag LOCUS_02120 78393 78650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 79418 78642 gene locus_tag LOCUS_02130 79418 78642 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_02130 80703 79435 gene locus_tag LOCUS_02140 gene bamC 80703 79435 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_02140 81599 80712 gene locus_tag LOCUS_02150 gene dapA 81599 80712 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_02150 81874 82452 gene locus_tag LOCUS_02160 gene rsxA 81874 82452 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_02160 82454 83008 gene locus_tag LOCUS_02170 gene rsxB 82454 83008 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072472.1 protein_id gnl|my_center|LOCUS_02170 83005 84609 gene locus_tag LOCUS_02180 gene rsxC 83005 84609 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144393375.1 protein_id gnl|my_center|LOCUS_02180 84738 85754 gene locus_tag LOCUS_02190 gene rsxD 84738 85754 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046050901.1 protein_id gnl|my_center|LOCUS_02190 85747 86400 gene locus_tag LOCUS_02200 gene rsxG 85747 86400 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_02200 86393 87067 gene locus_tag LOCUS_02210 86393 87067 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 protein_id gnl|my_center|LOCUS_02210 87080 87718 gene locus_tag LOCUS_02220 gene nth 87080 87718 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092050.1 protein_id gnl|my_center|LOCUS_02220 87715 88803 gene locus_tag LOCUS_02230 87715 88803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 88790 89227 gene locus_tag LOCUS_02240 88790 89227 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_02240 89683 89489 gene locus_tag LOCUS_02250 gene iscX 89683 89489 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222472.1 protein_id gnl|my_center|LOCUS_02250 90759 89680 gene locus_tag LOCUS_02260 90759 89680 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113836.1 protein_id gnl|my_center|LOCUS_02260 92411 90906 gene locus_tag LOCUS_02270 92411 90906 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944465.1 protein_id gnl|my_center|LOCUS_02270 93451 92612 gene locus_tag LOCUS_02280 93451 92612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 93684 94934 gene locus_tag LOCUS_02290 93684 94934 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225269.1 protein_id gnl|my_center|LOCUS_02290 94998 95447 gene locus_tag LOCUS_02300 gene nrdR 94998 95447 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_02300 95453 96541 gene locus_tag LOCUS_02310 gene ribD 95453 96541 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527563.1 protein_id gnl|my_center|LOCUS_02310 96522 97325 gene locus_tag LOCUS_02320 96522 97325 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_02320 97826 97668 gene locus_tag LOCUS_02330 97826 97668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 97908 98264 gene locus_tag LOCUS_02340 97908 98264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 98267 98452 gene locus_tag LOCUS_02350 98267 98452 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123298.1 protein_id gnl|my_center|LOCUS_02350 98454 99479 gene locus_tag LOCUS_02360 98454 99479 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_02360 99490 101289 gene locus_tag LOCUS_02370 gene uvrC 99490 101289 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229553.1 protein_id gnl|my_center|LOCUS_02370 101289 101855 gene locus_tag LOCUS_02380 gene pgsA 101289 101855 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_02380 101924 101999 gene locus_tag LOCUS_t00040 101924 101999 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 103563 102187 gene locus_tag LOCUS_02390 103563 102187 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690828.1 protein_id gnl|my_center|LOCUS_02390 104876 103632 gene locus_tag LOCUS_02400 104876 103632 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_02400 105113 106483 gene locus_tag LOCUS_02410 gene hemN 105113 106483 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403512.1 protein_id gnl|my_center|LOCUS_02410 107697 106465 gene locus_tag LOCUS_02420 107697 106465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_02420 109514 107697 gene locus_tag LOCUS_02430 109514 107697 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_02430 110320 109514 gene locus_tag LOCUS_02440 110320 109514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 112119 110317 gene locus_tag LOCUS_02450 112119 110317 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 protein_id gnl|my_center|LOCUS_02450 112401 113210 gene locus_tag LOCUS_02460 112401 113210 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_02460 113284 113688 gene locus_tag LOCUS_02470 113284 113688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 113721 115094 gene locus_tag LOCUS_02480 gene fliD 113721 115094 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816592.1 protein_id gnl|my_center|LOCUS_02480 115148 115597 gene locus_tag LOCUS_02490 gene fliS 115148 115597 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203429.1 protein_id gnl|my_center|LOCUS_02490 115584 115910 gene locus_tag LOCUS_02500 115584 115910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 115891 116127 gene locus_tag LOCUS_02510 115891 116127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 116259 116636 gene locus_tag LOCUS_02520 116259 116636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 116633 117928 gene locus_tag LOCUS_02530 116633 117928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 117921 118214 gene locus_tag LOCUS_02540 117921 118214 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523065.1 protein_id gnl|my_center|LOCUS_02540 118344 119738 gene locus_tag LOCUS_02550 gene gltX 118344 119738 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040543.1 protein_id gnl|my_center|LOCUS_02550 120494 119745 gene locus_tag LOCUS_02560 120494 119745 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_02560 120886 120491 gene locus_tag LOCUS_02570 120886 120491 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_02570 122212 120887 gene locus_tag LOCUS_02580 gene hpnE 122212 120887 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040124.1 protein_id gnl|my_center|LOCUS_02580 123015 122179 gene locus_tag LOCUS_02590 gene hpnD 123015 122179 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_02590 123854 123012 gene locus_tag LOCUS_02600 gene hpnC 123854 123012 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 protein_id gnl|my_center|LOCUS_02600 123925 124671 gene locus_tag LOCUS_02610 123925 124671 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_02610 124661 125191 gene locus_tag LOCUS_02620 gene def 124661 125191 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence003 224 538 gene locus_tag LOCUS_02630 224 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 535 867 gene locus_tag LOCUS_02640 535 867 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312649.1 protein_id gnl|my_center|LOCUS_02640 860 1069 gene locus_tag LOCUS_02650 860 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1317 1655 gene locus_tag LOCUS_02660 1317 1655 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105450.1 protein_id gnl|my_center|LOCUS_02660 1659 1979 gene locus_tag LOCUS_02670 1659 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2154 3206 gene locus_tag LOCUS_02680 2154 3206 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071718.1 protein_id gnl|my_center|LOCUS_02680 3224 3358 gene locus_tag LOCUS_02690 3224 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 4035 4565 gene locus_tag LOCUS_02700 4035 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4639 5145 gene locus_tag LOCUS_02710 4639 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 5456 6145 gene locus_tag LOCUS_02720 5456 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 6434 6592 gene locus_tag LOCUS_02730 6434 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 6596 6970 gene locus_tag LOCUS_02740 6596 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 7163 9724 gene locus_tag LOCUS_02750 gene acnB 7163 9724 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797887.1 protein_id gnl|my_center|LOCUS_02750 11107 9764 gene locus_tag LOCUS_02760 11107 9764 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_02760 12971 11151 gene locus_tag LOCUS_02770 12971 11151 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_02770 13236 14150 gene locus_tag LOCUS_02780 gene pqqB 13236 14150 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763801.1 protein_id gnl|my_center|LOCUS_02780 14210 14968 gene locus_tag LOCUS_02790 gene pqqC 14210 14968 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_02790 14946 15236 gene locus_tag LOCUS_02800 gene pqqD 14946 15236 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_02800 15229 16407 gene locus_tag LOCUS_02810 gene pqqE 15229 16407 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 protein_id gnl|my_center|LOCUS_02810 17514 16411 gene locus_tag LOCUS_02820 gene amrS 17514 16411 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_02820 18130 17588 gene locus_tag LOCUS_02830 18130 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 18930 18127 gene locus_tag LOCUS_02840 gene amrB 18930 18127 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_02840 19018 19983 gene locus_tag LOCUS_02850 19018 19983 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_02850 20278 20012 gene locus_tag LOCUS_02860 20278 20012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 20763 20329 gene locus_tag LOCUS_02870 20763 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 22125 21346 gene locus_tag LOCUS_02880 22125 21346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 22417 22130 gene locus_tag LOCUS_02890 22417 22130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 22498 25938 gene locus_tag LOCUS_02900 22498 25938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 26473 26399 gene locus_tag LOCUS_t00050 26473 26399 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27463 26582 gene locus_tag LOCUS_02910 27463 26582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 28221 27553 gene locus_tag LOCUS_02920 28221 27553 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 protein_id gnl|my_center|LOCUS_02920 29880 28495 gene locus_tag LOCUS_02930 29880 28495 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942194.1 protein_id gnl|my_center|LOCUS_02930 31078 29867 gene locus_tag LOCUS_02940 31078 29867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_02940 31413 31078 gene locus_tag LOCUS_02950 gene fdx 31413 31078 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_02950 31565 32386 gene locus_tag LOCUS_02960 31565 32386 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198065.1 protein_id gnl|my_center|LOCUS_02960 32716 32940 gene locus_tag LOCUS_02970 32716 32940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02970 32962 34350 gene locus_tag LOCUS_02980 32962 34350 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02980 34431 35270 gene locus_tag LOCUS_02990 gene kdsA 34431 35270 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193658.1 protein_id gnl|my_center|LOCUS_02990 35363 36646 gene locus_tag LOCUS_03000 gene eno 35363 36646 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 protein_id gnl|my_center|LOCUS_03000 36659 36970 gene locus_tag LOCUS_03010 36659 36970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 37554 38060 gene locus_tag LOCUS_03020 37554 38060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 38659 38354 gene locus_tag LOCUS_03030 38659 38354 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390183.1 protein_id gnl|my_center|LOCUS_03030 38847 38668 gene locus_tag LOCUS_03040 38847 38668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 40013 39024 gene locus_tag LOCUS_03050 40013 39024 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_03050 40082 40516 gene locus_tag LOCUS_03060 40082 40516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 41759 40530 gene locus_tag LOCUS_03070 41759 40530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 42431 41805 gene locus_tag LOCUS_03080 42431 41805 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_03080 45862 42428 gene locus_tag LOCUS_03090 gene mfd 45862 42428 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_03090 46350 45952 gene locus_tag LOCUS_03100 46350 45952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 47914 46436 gene locus_tag LOCUS_03110 gene tldD 47914 46436 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_03110 48901 48032 gene locus_tag LOCUS_03120 48901 48032 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931197.1 protein_id gnl|my_center|LOCUS_03120 52781 48954 gene locus_tag LOCUS_03130 52781 48954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 54965 52989 gene locus_tag LOCUS_03140 gene acs 54965 52989 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_03140 56733 55150 gene locus_tag LOCUS_03150 56733 55150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03150 57519 56737 gene locus_tag LOCUS_03160 57519 56737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03160 59500 57602 gene locus_tag LOCUS_03170 59500 57602 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553869.1 protein_id gnl|my_center|LOCUS_03170 59594 59827 gene locus_tag LOCUS_03180 59594 59827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 61818 59830 gene locus_tag LOCUS_03190 61818 59830 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524472.1 protein_id gnl|my_center|LOCUS_03190 61957 62220 gene locus_tag LOCUS_03200 61957 62220 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923260.1 protein_id gnl|my_center|LOCUS_03200 62259 62615 gene locus_tag LOCUS_03210 62259 62615 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_03210 62707 64371 gene locus_tag LOCUS_03220 gene ettA 62707 64371 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_03220 64657 64478 gene locus_tag LOCUS_03230 64657 64478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 65045 64755 gene locus_tag LOCUS_03240 65045 64755 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_03240 65216 66265 gene locus_tag LOCUS_03250 gene nagZ 65216 66265 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_03250 66378 67067 gene locus_tag LOCUS_03260 66378 67067 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521332.1 protein_id gnl|my_center|LOCUS_03260 68216 67749 gene locus_tag LOCUS_03270 gene tadA 68216 67749 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552523.1 protein_id gnl|my_center|LOCUS_03270 70153 68213 gene locus_tag LOCUS_03280 gene tgpA 70153 68213 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_03280 71100 70150 gene locus_tag LOCUS_03290 71100 70150 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_03290 72001 71105 gene locus_tag LOCUS_03300 72001 71105 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887266.1 protein_id gnl|my_center|LOCUS_03300 73538 72030 gene locus_tag LOCUS_03310 73538 72030 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193193.1 protein_id gnl|my_center|LOCUS_03310 73720 76437 gene locus_tag LOCUS_03320 73720 76437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 76447 77127 gene locus_tag LOCUS_03330 76447 77127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_03330 77340 77864 gene locus_tag LOCUS_03340 77340 77864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 78787 77882 gene locus_tag LOCUS_03350 78787 77882 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966458.1 protein_id gnl|my_center|LOCUS_03350 78897 79727 gene locus_tag LOCUS_03360 78897 79727 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 protein_id gnl|my_center|LOCUS_03360 79720 79953 gene locus_tag LOCUS_03370 79720 79953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 80084 81160 gene locus_tag LOCUS_03380 80084 81160 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_03380 81249 82235 gene locus_tag LOCUS_03390 81249 82235 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 protein_id gnl|my_center|LOCUS_03390 82232 82702 gene locus_tag LOCUS_03400 82232 82702 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038959.1 protein_id gnl|my_center|LOCUS_03400 82699 84864 gene locus_tag LOCUS_03410 82699 84864 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_03410 84848 85462 gene locus_tag LOCUS_03420 84848 85462 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_03420 85472 86071 gene locus_tag LOCUS_03430 85472 86071 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198059.1 protein_id gnl|my_center|LOCUS_03430 86178 87119 gene locus_tag LOCUS_03440 86178 87119 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_03440 87116 90196 gene locus_tag LOCUS_03450 87116 90196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 90261 90629 gene locus_tag LOCUS_03460 gene trxA 90261 90629 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_03460 91000 90659 gene locus_tag LOCUS_03470 91000 90659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 92037 91033 gene locus_tag LOCUS_03480 92037 91033 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 protein_id gnl|my_center|LOCUS_03480 92696 92034 gene locus_tag LOCUS_03490 92696 92034 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_03490 93424 92687 gene locus_tag LOCUS_03500 gene surE 93424 92687 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811017.1 protein_id gnl|my_center|LOCUS_03500 93801 93439 gene locus_tag LOCUS_03510 93801 93439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 94520 93798 gene locus_tag LOCUS_03520 94520 93798 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_03520 95110 94517 gene locus_tag LOCUS_03530 gene wrbA 95110 94517 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958310.1 protein_id gnl|my_center|LOCUS_03530 96480 95110 gene locus_tag LOCUS_03540 gene purB 96480 95110 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224850.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence004 2955 2140 gene locus_tag LOCUS_03550 2955 2140 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206895.1 protein_id gnl|my_center|LOCUS_03550 3734 4501 gene locus_tag LOCUS_03560 gene xth 3734 4501 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_03560 5885 4530 gene locus_tag LOCUS_03570 5885 4530 CDS product DUF3391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349264.1 protein_id gnl|my_center|LOCUS_03570 8277 6361 gene locus_tag LOCUS_03580 8277 6361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 8494 8421 gene locus_tag LOCUS_t00060 8494 8421 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8552 8758 gene locus_tag LOCUS_03590 gene thiS 8552 8758 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_03590 8765 9553 gene locus_tag LOCUS_03600 8765 9553 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_03600 9568 9951 gene locus_tag LOCUS_03610 gene apaG 9568 9951 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815381.1 protein_id gnl|my_center|LOCUS_03610 9965 11251 gene locus_tag LOCUS_03620 9965 11251 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_03620 11389 12894 gene locus_tag LOCUS_03630 gene zwf 11389 12894 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_03630 13145 12957 gene locus_tag LOCUS_03640 13145 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 13372 13208 gene locus_tag LOCUS_03650 13372 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 13571 14332 gene locus_tag LOCUS_03660 gene tpiA 13571 14332 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_03660 15742 14369 gene locus_tag LOCUS_03670 15742 14369 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_03670 15853 16650 gene locus_tag LOCUS_03680 15853 16650 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_03680 16650 17300 gene locus_tag LOCUS_03690 16650 17300 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390541.1 protein_id gnl|my_center|LOCUS_03690 17325 19652 gene locus_tag LOCUS_03700 17325 19652 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808566.1 protein_id gnl|my_center|LOCUS_03700 19676 20710 gene locus_tag LOCUS_03710 gene mutY 19676 20710 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927127.1 protein_id gnl|my_center|LOCUS_03710 20916 21758 gene locus_tag LOCUS_03720 20916 21758 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173753.1 protein_id gnl|my_center|LOCUS_03720 22148 24940 gene locus_tag LOCUS_03730 22148 24940 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044884.1 protein_id gnl|my_center|LOCUS_03730 25244 28186 gene locus_tag LOCUS_03740 25244 28186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 28951 28397 gene locus_tag LOCUS_03750 gene fae 28951 28397 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 protein_id gnl|my_center|LOCUS_03750 29459 29019 gene locus_tag LOCUS_03760 29459 29019 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143392.1 protein_id gnl|my_center|LOCUS_03760 29634 29443 gene locus_tag LOCUS_03770 29634 29443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 29708 30091 gene locus_tag LOCUS_03780 29708 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 30700 30092 gene locus_tag LOCUS_03790 30700 30092 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063917.1 protein_id gnl|my_center|LOCUS_03790 31623 30697 gene locus_tag LOCUS_03800 gene ispH 31623 30697 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 protein_id gnl|my_center|LOCUS_03800 32534 31623 gene locus_tag LOCUS_03810 32534 31623 CDS product CobD/CbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195964.1 protein_id gnl|my_center|LOCUS_03810 33049 32531 gene locus_tag LOCUS_03820 33049 32531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 33130 33984 gene locus_tag LOCUS_03830 gene purU 33130 33984 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933485.1 protein_id gnl|my_center|LOCUS_03830 34189 34046 gene locus_tag LOCUS_03840 34189 34046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 35565 34318 gene locus_tag LOCUS_03850 gene lysA 35565 34318 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_03850 36357 35716 gene locus_tag LOCUS_03860 36357 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 36849 36358 gene locus_tag LOCUS_03870 36849 36358 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869101.1 protein_id gnl|my_center|LOCUS_03870 37246 36863 gene locus_tag LOCUS_03880 37246 36863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 38252 37221 gene locus_tag LOCUS_03890 38252 37221 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191102.1 protein_id gnl|my_center|LOCUS_03890 39181 38237 gene locus_tag LOCUS_03900 gene gshB 39181 38237 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455768.1 protein_id gnl|my_center|LOCUS_03900 39553 39185 gene locus_tag LOCUS_03910 39553 39185 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969154.1 protein_id gnl|my_center|LOCUS_03910 39771 39550 gene locus_tag LOCUS_03920 39771 39550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 41095 39818 gene locus_tag LOCUS_03930 gene gshA 41095 39818 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_03930 42103 41357 gene locus_tag LOCUS_03940 42103 41357 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 protein_id gnl|my_center|LOCUS_03940 42227 45007 gene locus_tag LOCUS_03950 gene ppc 42227 45007 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_03950 45145 45942 gene locus_tag LOCUS_03960 45145 45942 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_03960 45947 46801 gene locus_tag LOCUS_03970 45947 46801 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_03970 47199 47504 gene locus_tag LOCUS_03980 47199 47504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 47667 48044 gene locus_tag LOCUS_03990 47667 48044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 48970 48254 gene locus_tag LOCUS_04000 48970 48254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 50056 49607 gene locus_tag LOCUS_04010 50056 49607 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_04010 53374 50063 gene locus_tag LOCUS_04020 53374 50063 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_04020 54606 53371 gene locus_tag LOCUS_04030 54606 53371 CDS product lpg1639 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947366.1 protein_id gnl|my_center|LOCUS_04030 55418 54621 gene locus_tag LOCUS_04040 55418 54621 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267290.1 protein_id gnl|my_center|LOCUS_04040 56389 55442 gene locus_tag LOCUS_04050 56389 55442 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 protein_id gnl|my_center|LOCUS_04050 57816 56383 gene locus_tag LOCUS_04060 57816 56383 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_04060 58671 57970 gene locus_tag LOCUS_04070 58671 57970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 60170 58917 gene locus_tag LOCUS_04080 60170 58917 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530988.1 protein_id gnl|my_center|LOCUS_04080 62218 60890 gene locus_tag LOCUS_04090 gene hipA 62218 60890 CDS product type II toxin-antitoxin system toxin serine/threonine-protein kinase HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071024.1 protein_id gnl|my_center|LOCUS_04090 62499 62221 gene locus_tag LOCUS_04100 62499 62221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 64364 63018 gene locus_tag LOCUS_04110 64364 63018 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 protein_id gnl|my_center|LOCUS_04110 65083 64400 gene locus_tag LOCUS_04120 65083 64400 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762866.1 protein_id gnl|my_center|LOCUS_04120 65967 65071 gene locus_tag LOCUS_04130 65967 65071 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762867.1 protein_id gnl|my_center|LOCUS_04130 67323 65989 gene locus_tag LOCUS_04140 gene glnT 67323 65989 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_04140 67805 67335 gene locus_tag LOCUS_04150 67805 67335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 70633 67802 gene locus_tag LOCUS_04160 70633 67802 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267520.1 protein_id gnl|my_center|LOCUS_04160 70884 70630 gene locus_tag LOCUS_04170 70884 70630 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267521.1 protein_id gnl|my_center|LOCUS_04170 72127 70886 gene locus_tag LOCUS_04180 72127 70886 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246879.1 protein_id gnl|my_center|LOCUS_04180 72231 72854 gene locus_tag LOCUS_04190 72231 72854 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348330.1 protein_id gnl|my_center|LOCUS_04190 72851 73306 gene locus_tag LOCUS_04200 72851 73306 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754241.1 protein_id gnl|my_center|LOCUS_04200 75274 73403 gene locus_tag LOCUS_04210 gene thiC 75274 73403 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807441.1 protein_id gnl|my_center|LOCUS_04210 75527 76000 gene locus_tag LOCUS_04220 75527 76000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 76033 76836 gene locus_tag LOCUS_04230 76033 76836 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970102.1 protein_id gnl|my_center|LOCUS_04230 76844 77494 gene locus_tag LOCUS_04240 76844 77494 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 protein_id gnl|my_center|LOCUS_04240 77532 78194 gene locus_tag LOCUS_04250 77532 78194 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185654.1 protein_id gnl|my_center|LOCUS_04250 79606 78218 gene locus_tag LOCUS_04260 gene ntrC 79606 78218 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_04260 80688 79603 gene locus_tag LOCUS_04270 gene glnL 80688 79603 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135202727.1 protein_id gnl|my_center|LOCUS_04270 81199 80723 gene locus_tag LOCUS_04280 81199 80723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 82837 81680 gene locus_tag LOCUS_04290 gene clsB 82837 81680 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807044.1 protein_id gnl|my_center|LOCUS_04290 83586 82834 gene locus_tag LOCUS_04300 83586 82834 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010204659.1 protein_id gnl|my_center|LOCUS_04300 84701 83601 gene locus_tag LOCUS_04310 gene nadA 84701 83601 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_04310 85338 84871 gene locus_tag LOCUS_04320 gene nudB 85338 84871 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 protein_id gnl|my_center|LOCUS_04320 85753 85331 gene locus_tag LOCUS_04330 85753 85331 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142378.1 protein_id gnl|my_center|LOCUS_04330 86004 85750 gene locus_tag LOCUS_04340 86004 85750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 88265 86475 gene locus_tag LOCUS_04350 gene aspS 88265 86475 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 protein_id gnl|my_center|LOCUS_04350 88928 88302 gene locus_tag LOCUS_04360 88928 88302 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189093.1 protein_id gnl|my_center|LOCUS_04360 89202 88936 gene locus_tag LOCUS_04370 89202 88936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 90210 89305 gene locus_tag LOCUS_04380 gene truB 90210 89305 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_04380 90573 90211 gene locus_tag LOCUS_04390 gene rbfA 90573 90211 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377505.1 protein_id gnl|my_center|LOCUS_04390 93320 90573 gene locus_tag LOCUS_04400 gene infB 93320 90573 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025871401.1 protein_id gnl|my_center|LOCUS_04400 94780 93308 gene locus_tag LOCUS_04410 gene nusA 94780 93308 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_04410 95228 94794 gene locus_tag LOCUS_04420 gene rimP 95228 94794 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence005 1399 1061 gene locus_tag LOCUS_04430 1399 1061 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_04430 2319 1693 gene locus_tag LOCUS_04440 gene ureG 2319 1693 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_04440 3025 2342 gene locus_tag LOCUS_04450 3025 2342 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446466.1 protein_id gnl|my_center|LOCUS_04450 3509 3018 gene locus_tag LOCUS_04460 gene ureE 3509 3018 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_04460 5212 3509 gene locus_tag LOCUS_04470 gene ureC 5212 3509 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269033.1 protein_id gnl|my_center|LOCUS_04470 5534 5226 gene locus_tag LOCUS_04480 5534 5226 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084271.1 protein_id gnl|my_center|LOCUS_04480 5850 5548 gene locus_tag LOCUS_04490 gene ureA 5850 5548 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317023.1 protein_id gnl|my_center|LOCUS_04490 6697 5873 gene locus_tag LOCUS_04500 6697 5873 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269030.1 protein_id gnl|my_center|LOCUS_04500 7433 6735 gene locus_tag LOCUS_04510 gene urtE 7433 6735 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_04510 8256 7435 gene locus_tag LOCUS_04520 gene urtD 8256 7435 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 protein_id gnl|my_center|LOCUS_04520 9356 8253 gene locus_tag LOCUS_04530 gene urtC 9356 8253 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522271.1 protein_id gnl|my_center|LOCUS_04530 10957 9365 gene locus_tag LOCUS_04540 gene urtB 10957 9365 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210793.1 protein_id gnl|my_center|LOCUS_04540 12367 11087 gene locus_tag LOCUS_04550 gene urtA 12367 11087 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_04550 13542 12406 gene locus_tag LOCUS_04560 13542 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 13700 14206 gene locus_tag LOCUS_04570 13700 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 15164 14226 gene locus_tag LOCUS_04580 15164 14226 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_04580 18522 15151 gene locus_tag LOCUS_04590 18522 15151 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044393613.1 protein_id gnl|my_center|LOCUS_04590 19165 20778 gene locus_tag LOCUS_04600 gene nifA 19165 20778 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084834.1 protein_id gnl|my_center|LOCUS_04600 20967 22535 gene locus_tag LOCUS_04610 gene nifB 20967 22535 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_04610 22576 22797 gene locus_tag LOCUS_04620 22576 22797 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084569.1 protein_id gnl|my_center|LOCUS_04620 22807 23193 gene locus_tag LOCUS_04630 22807 23193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 23198 23710 gene locus_tag LOCUS_04640 23198 23710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 23703 24467 gene locus_tag LOCUS_04650 23703 24467 CDS product 4Fe4S-binding leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338306.1 protein_id gnl|my_center|LOCUS_04650 24460 24774 gene locus_tag LOCUS_04660 24460 24774 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 protein_id gnl|my_center|LOCUS_04660 24761 25000 gene locus_tag LOCUS_04670 24761 25000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 24997 25353 gene locus_tag LOCUS_04680 24997 25353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 25350 26495 gene locus_tag LOCUS_04690 gene nifS 25350 26495 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_04690 26523 26732 gene locus_tag LOCUS_04700 gene nifT 26523 26732 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 protein_id gnl|my_center|LOCUS_04700 26734 26994 gene locus_tag LOCUS_04710 26734 26994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 26996 28147 gene locus_tag LOCUS_04720 26996 28147 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_04720 28178 29032 gene locus_tag LOCUS_04730 28178 29032 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338304.1 protein_id gnl|my_center|LOCUS_04730 30392 29829 gene locus_tag LOCUS_04740 30392 29829 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_04740 30790 31191 gene locus_tag LOCUS_04750 30790 31191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 31951 31211 gene locus_tag LOCUS_04760 31951 31211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 32010 32288 gene locus_tag LOCUS_04770 32010 32288 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847047.1 protein_id gnl|my_center|LOCUS_04770 32325 32654 gene locus_tag LOCUS_04780 32325 32654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 33268 32873 gene locus_tag LOCUS_04790 33268 32873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_04790 34149 33265 gene locus_tag LOCUS_04800 gene draG 34149 33265 CDS product ADP-ribosyl-[dinitrogen reductase] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388763.1 protein_id gnl|my_center|LOCUS_04800 34960 34133 gene locus_tag LOCUS_04810 34960 34133 CDS product NAD(+)--dinitrogen-reductase ADP-D-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626076.1 protein_id gnl|my_center|LOCUS_04810 35591 35001 gene locus_tag LOCUS_04820 35591 35001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497969.1 protein_id gnl|my_center|LOCUS_04820 36041 35598 gene locus_tag LOCUS_04830 36041 35598 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965250.1 protein_id gnl|my_center|LOCUS_04830 36482 37357 gene locus_tag LOCUS_04840 gene nifH 36482 37357 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084578.1 protein_id gnl|my_center|LOCUS_04840 37517 38974 gene locus_tag LOCUS_04850 gene nifD 37517 38974 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_04850 38986 40545 gene locus_tag LOCUS_04860 gene nifK 38986 40545 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_04860 40628 40975 gene locus_tag LOCUS_04870 40628 40975 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563670.1 protein_id gnl|my_center|LOCUS_04870 41159 42250 gene locus_tag LOCUS_04880 gene ribBA 41159 42250 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186115.1 protein_id gnl|my_center|LOCUS_04880 42377 42982 gene locus_tag LOCUS_04890 42377 42982 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536681.1 protein_id gnl|my_center|LOCUS_04890 43041 43931 gene locus_tag LOCUS_04900 43041 43931 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035954.1 protein_id gnl|my_center|LOCUS_04900 44070 45767 gene locus_tag LOCUS_04910 44070 45767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 45764 47128 gene locus_tag LOCUS_04920 45764 47128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 47284 47105 gene locus_tag LOCUS_04930 47284 47105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 47299 48756 gene locus_tag LOCUS_04940 gene nifE 47299 48756 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_04940 48749 50161 gene locus_tag LOCUS_04950 gene nifN 48749 50161 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084555.1 protein_id gnl|my_center|LOCUS_04950 50182 50586 gene locus_tag LOCUS_04960 gene nifX 50182 50586 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 protein_id gnl|my_center|LOCUS_04960 50618 51094 gene locus_tag LOCUS_04970 50618 51094 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084557.1 protein_id gnl|my_center|LOCUS_04970 51107 51304 gene locus_tag LOCUS_04980 51107 51304 CDS product CCE_0567 family metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970913.1 protein_id gnl|my_center|LOCUS_04980 51306 51611 gene locus_tag LOCUS_04990 gene fdxB 51306 51611 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_04990 51631 52023 gene locus_tag LOCUS_05000 51631 52023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 52023 53681 gene locus_tag LOCUS_05010 52023 53681 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 protein_id gnl|my_center|LOCUS_05010 53678 54463 gene locus_tag LOCUS_05020 53678 54463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 54766 54470 gene locus_tag LOCUS_05030 gene fdx 54766 54470 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820620.1 protein_id gnl|my_center|LOCUS_05030 55632 55093 gene locus_tag LOCUS_05040 55632 55093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 56366 55860 gene locus_tag LOCUS_05050 56366 55860 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_05050 56656 56369 gene locus_tag LOCUS_05060 56656 56369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 56773 56928 gene locus_tag LOCUS_05070 56773 56928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 57502 57179 gene locus_tag LOCUS_05080 57502 57179 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085147429.1 protein_id gnl|my_center|LOCUS_05080 58188 58490 gene locus_tag LOCUS_05090 58188 58490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 58582 58863 gene locus_tag LOCUS_05100 58582 58863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 59038 59466 gene locus_tag LOCUS_05110 59038 59466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 60437 59559 gene locus_tag LOCUS_05120 60437 59559 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_05120 61269 60595 gene locus_tag LOCUS_05130 gene modB 61269 60595 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_05130 61663 61259 gene locus_tag LOCUS_05140 61663 61259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 62421 61660 gene locus_tag LOCUS_05150 gene modA 62421 61660 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_05150 63962 62454 gene locus_tag LOCUS_05160 63962 62454 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967062.1 protein_id gnl|my_center|LOCUS_05160 64842 64033 gene locus_tag LOCUS_05170 64842 64033 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190826.1 protein_id gnl|my_center|LOCUS_05170 65374 65015 gene locus_tag LOCUS_05180 65374 65015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 65856 65371 gene locus_tag LOCUS_05190 65856 65371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 66169 65846 gene locus_tag LOCUS_05200 66169 65846 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_05200 66474 66190 gene locus_tag LOCUS_05210 66474 66190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 66843 66484 gene locus_tag LOCUS_05220 66843 66484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 68143 66848 gene locus_tag LOCUS_05230 68143 66848 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140334.1 protein_id gnl|my_center|LOCUS_05230 68455 68159 gene locus_tag LOCUS_05240 68455 68159 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389919.1 protein_id gnl|my_center|LOCUS_05240 69756 68452 gene locus_tag LOCUS_05250 69756 68452 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389920.1 protein_id gnl|my_center|LOCUS_05250 70874 69753 gene locus_tag LOCUS_05260 70874 69753 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389921.1 protein_id gnl|my_center|LOCUS_05260 71709 70864 gene locus_tag LOCUS_05270 71709 70864 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389922.1 protein_id gnl|my_center|LOCUS_05270 72179 71844 gene locus_tag LOCUS_05280 72179 71844 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_05280 72937 72200 gene locus_tag LOCUS_05290 gene cysE 72937 72200 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_05290 74088 72946 gene locus_tag LOCUS_05300 gene nifV 74088 72946 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_05300 74943 74407 gene locus_tag LOCUS_05310 gene fae 74943 74407 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 protein_id gnl|my_center|LOCUS_05310 75432 75094 gene locus_tag LOCUS_05320 gene fdx 75432 75094 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124474.1 protein_id gnl|my_center|LOCUS_05320 77306 75429 gene locus_tag LOCUS_05330 gene hscA 77306 75429 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193590.1 protein_id gnl|my_center|LOCUS_05330 77905 77306 gene locus_tag LOCUS_05340 gene hscB 77905 77306 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219110.1 protein_id gnl|my_center|LOCUS_05340 78158 77835 gene locus_tag LOCUS_05350 gene iscA 78158 77835 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482998.1 protein_id gnl|my_center|LOCUS_05350 78521 78174 gene locus_tag LOCUS_05360 gene erpA 78521 78174 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016875.1 protein_id gnl|my_center|LOCUS_05360 78957 78538 gene locus_tag LOCUS_05370 gene iscU 78957 78538 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_05370 80310 79060 gene locus_tag LOCUS_05380 80310 79060 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812462.1 protein_id gnl|my_center|LOCUS_05380 80739 80557 gene locus_tag LOCUS_05390 80739 80557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 80875 83037 gene locus_tag LOCUS_05400 80875 83037 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_05400 85736 83484 gene locus_tag LOCUS_05410 85736 83484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 86740 85748 gene locus_tag LOCUS_05420 86740 85748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 87461 87066 gene locus_tag LOCUS_05430 87461 87066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 88059 87445 gene locus_tag LOCUS_05440 88059 87445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 88691 89641 gene locus_tag LOCUS_05450 88691 89641 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832012.1 protein_id gnl|my_center|LOCUS_05450 89641 92640 gene locus_tag LOCUS_05460 89641 92640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 92637 93533 gene locus_tag LOCUS_05470 92637 93533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence006 96 626 gene locus_tag LOCUS_05480 96 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 610 927 gene locus_tag LOCUS_05490 610 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 943 1467 gene locus_tag LOCUS_05500 943 1467 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140136.1 protein_id gnl|my_center|LOCUS_05500 1464 1688 gene locus_tag LOCUS_05510 1464 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1807 2253 gene locus_tag LOCUS_05520 1807 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2240 2602 gene locus_tag LOCUS_05530 2240 2602 CDS product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619864.1 protein_id gnl|my_center|LOCUS_05530 3491 2982 gene locus_tag LOCUS_05540 3491 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 4738 3554 gene locus_tag LOCUS_05550 4738 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5643 4735 gene locus_tag LOCUS_05560 5643 4735 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_05560 7443 5647 gene locus_tag LOCUS_05570 gene mshL 7443 5647 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456314.1 protein_id gnl|my_center|LOCUS_05570 7900 7451 gene locus_tag LOCUS_05580 7900 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 8520 7885 gene locus_tag LOCUS_05590 8520 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 9257 8583 gene locus_tag LOCUS_05600 9257 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 10189 9254 gene locus_tag LOCUS_05610 10189 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 10941 10519 gene locus_tag LOCUS_05620 10941 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 11762 10974 gene locus_tag LOCUS_05630 11762 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 12337 11798 gene locus_tag LOCUS_05640 12337 11798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 12810 12334 gene locus_tag LOCUS_05650 gene mshC 12810 12334 CDS product MSHA fimbrial minor subunit MshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704372.1 protein_id gnl|my_center|LOCUS_05650 16569 12811 gene locus_tag LOCUS_05660 16569 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 17160 16729 gene locus_tag LOCUS_05670 17160 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 17755 17195 gene locus_tag LOCUS_05680 17755 17195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 19224 17995 gene locus_tag LOCUS_05690 19224 17995 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_05690 19669 19307 gene locus_tag LOCUS_05700 19669 19307 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_05700 21465 19762 gene locus_tag LOCUS_05710 gene mshE 21465 19762 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_05710 23046 21583 gene locus_tag LOCUS_05720 23046 21583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 25882 23477 gene locus_tag LOCUS_05730 25882 23477 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_05730 26478 25885 gene locus_tag LOCUS_05740 26478 25885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 27910 26480 gene locus_tag LOCUS_05750 gene ccoG 27910 26480 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268426.1 protein_id gnl|my_center|LOCUS_05750 28940 28011 gene locus_tag LOCUS_05760 gene ccoP 28940 28011 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524999.1 protein_id gnl|my_center|LOCUS_05760 29119 28937 gene locus_tag LOCUS_05770 29119 28937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 29884 29132 gene locus_tag LOCUS_05780 gene ccoO 29884 29132 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971696.1 protein_id gnl|my_center|LOCUS_05780 31345 29912 gene locus_tag LOCUS_05790 gene ccoN 31345 29912 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_05790 32100 31465 gene locus_tag LOCUS_05800 32100 31465 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_05800 32834 32127 gene locus_tag LOCUS_05810 32834 32127 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173596.1 protein_id gnl|my_center|LOCUS_05810 33907 33047 gene locus_tag LOCUS_05820 33907 33047 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966070.1 protein_id gnl|my_center|LOCUS_05820 33993 34925 gene locus_tag LOCUS_05830 33993 34925 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_05830 34935 35129 gene locus_tag LOCUS_05840 34935 35129 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_05840 36058 35240 gene locus_tag LOCUS_05850 gene murI 36058 35240 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_05850 37155 36055 gene locus_tag LOCUS_05860 37155 36055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 37477 38784 gene locus_tag LOCUS_05870 37477 38784 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103336.1 protein_id gnl|my_center|LOCUS_05870 38879 40219 gene locus_tag LOCUS_05880 gene pcnB 38879 40219 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194112.1 protein_id gnl|my_center|LOCUS_05880 40224 40703 gene locus_tag LOCUS_05890 gene folK 40224 40703 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687713.1 protein_id gnl|my_center|LOCUS_05890 40700 41350 gene locus_tag LOCUS_05900 40700 41350 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_05900 41347 42132 gene locus_tag LOCUS_05910 gene panB 41347 42132 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687894.1 protein_id gnl|my_center|LOCUS_05910 42132 42962 gene locus_tag LOCUS_05920 gene panC 42132 42962 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687896.1 protein_id gnl|my_center|LOCUS_05920 43010 43378 gene locus_tag LOCUS_05930 43010 43378 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_05930 43953 43531 gene locus_tag LOCUS_05940 43953 43531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 45312 44155 gene locus_tag LOCUS_05950 45312 44155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 46232 45552 gene locus_tag LOCUS_05960 gene bioD 46232 45552 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530983.1 protein_id gnl|my_center|LOCUS_05960 47098 46229 gene locus_tag LOCUS_05970 47098 46229 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_05970 47855 47088 gene locus_tag LOCUS_05980 gene bioH 47855 47088 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704304.1 protein_id gnl|my_center|LOCUS_05980 49030 47852 gene locus_tag LOCUS_05990 gene bioF 49030 47852 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269172.1 protein_id gnl|my_center|LOCUS_05990 50102 49116 gene locus_tag LOCUS_06000 gene bioB 50102 49116 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926132.1 protein_id gnl|my_center|LOCUS_06000 50523 50095 gene locus_tag LOCUS_06010 50523 50095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 50426 51277 gene locus_tag LOCUS_06020 50426 51277 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_06020 51293 51757 gene locus_tag LOCUS_06030 gene trmL 51293 51757 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 protein_id gnl|my_center|LOCUS_06030 52812 51826 gene locus_tag LOCUS_06040 52812 51826 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_06040 53255 52809 gene locus_tag LOCUS_06050 53255 52809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 53724 53239 gene locus_tag LOCUS_06060 gene secB 53724 53239 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_06060 54046 53789 gene locus_tag LOCUS_06070 gene grxC 54046 53789 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_06070 54462 54046 gene locus_tag LOCUS_06080 54462 54046 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158897.1 protein_id gnl|my_center|LOCUS_06080 54826 54518 gene locus_tag LOCUS_06090 54826 54518 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_06090 54928 56532 gene locus_tag LOCUS_06100 gene gpmI 54928 56532 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_06100 56522 57748 gene locus_tag LOCUS_06110 56522 57748 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_06110 57797 58765 gene locus_tag LOCUS_06120 gene rfaD 57797 58765 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_06120 58779 59336 gene locus_tag LOCUS_06130 58779 59336 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_06130 59340 60803 gene locus_tag LOCUS_06140 gene rfaE1 59340 60803 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942727.1 protein_id gnl|my_center|LOCUS_06140 60800 61831 gene locus_tag LOCUS_06150 gene waaF 60800 61831 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_06150 61828 62691 gene locus_tag LOCUS_06160 61828 62691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 62688 63683 gene locus_tag LOCUS_06170 62688 63683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 63865 64677 gene locus_tag LOCUS_06180 63865 64677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 64718 65494 gene locus_tag LOCUS_06190 64718 65494 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_06190 65469 66611 gene locus_tag LOCUS_06200 65469 66611 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958355.1 protein_id gnl|my_center|LOCUS_06200 66608 67864 gene locus_tag LOCUS_06210 gene waaL-ps 66608 67864 CDS product O-antigen polysaccharide ligase WaaL-ps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815492.1 protein_id gnl|my_center|LOCUS_06210 67851 68873 gene locus_tag LOCUS_06220 gene rfaQ 67851 68873 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 protein_id gnl|my_center|LOCUS_06220 71084 68892 gene locus_tag LOCUS_06230 71084 68892 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195838.1 protein_id gnl|my_center|LOCUS_06230 71129 72844 gene locus_tag LOCUS_06240 gene argS 71129 72844 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648220.1 protein_id gnl|my_center|LOCUS_06240 72853 73470 gene locus_tag LOCUS_06250 72853 73470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 73484 74119 gene locus_tag LOCUS_06260 gene dsbA 73484 74119 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_06260 74119 74907 gene locus_tag LOCUS_06270 74119 74907 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190175.1 protein_id gnl|my_center|LOCUS_06270 75615 74914 gene locus_tag LOCUS_06280 75615 74914 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_06280 75936 79208 gene locus_tag LOCUS_06290 75936 79208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 79752 79366 gene locus_tag LOCUS_06300 79752 79366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 80646 79756 gene locus_tag LOCUS_06310 80646 79756 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_06310 82030 80738 gene locus_tag LOCUS_06320 gene glgC 82030 80738 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_06320 82319 83371 gene locus_tag LOCUS_06330 gene moaA 82319 83371 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317890.1 protein_id gnl|my_center|LOCUS_06330 83373 83945 gene locus_tag LOCUS_06340 gene mobA 83373 83945 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_06340 83942 84487 gene locus_tag LOCUS_06350 gene mobB 83942 84487 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907623.1 protein_id gnl|my_center|LOCUS_06350 84484 85755 gene locus_tag LOCUS_06360 84484 85755 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039620.1 protein_id gnl|my_center|LOCUS_06360 85894 88137 gene locus_tag LOCUS_06370 85894 88137 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113760.1 protein_id gnl|my_center|LOCUS_06370 88151 88372 gene locus_tag LOCUS_06380 88151 88372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 88778 90226 gene locus_tag LOCUS_06390 88778 90226 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929660.1 protein_id gnl|my_center|LOCUS_06390 90333 91397 gene locus_tag LOCUS_06400 90333 91397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence007 253 177 gene locus_tag LOCUS_t00070 253 177 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2139 652 gene locus_tag LOCUS_06410 2139 652 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965116.1 protein_id gnl|my_center|LOCUS_06410 2488 2150 gene locus_tag LOCUS_06420 2488 2150 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_06420 3482 2565 gene locus_tag LOCUS_06430 3482 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3725 3970 gene locus_tag LOCUS_06440 3725 3970 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030003521.1 protein_id gnl|my_center|LOCUS_06440 3970 5460 gene locus_tag LOCUS_06450 3970 5460 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697442.1 protein_id gnl|my_center|LOCUS_06450 5450 6502 gene locus_tag LOCUS_06460 5450 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 7725 6598 gene locus_tag LOCUS_06470 7725 6598 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 protein_id gnl|my_center|LOCUS_06470 8798 7722 gene locus_tag LOCUS_06480 gene aroB 8798 7722 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_06480 9287 8799 gene locus_tag LOCUS_06490 9287 8799 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_06490 11455 9368 gene locus_tag LOCUS_06500 gene pilQ 11455 9368 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946666.1 protein_id gnl|my_center|LOCUS_06500 12025 11471 gene locus_tag LOCUS_06510 12025 11471 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 protein_id gnl|my_center|LOCUS_06510 12669 12022 gene locus_tag LOCUS_06520 gene pilO 12669 12022 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403037.1 protein_id gnl|my_center|LOCUS_06520 13253 12666 gene locus_tag LOCUS_06530 13253 12666 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214520.1 protein_id gnl|my_center|LOCUS_06530 14323 13253 gene locus_tag LOCUS_06540 14323 13253 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_06540 14489 16825 gene locus_tag LOCUS_06550 14489 16825 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_06550 16841 17455 gene locus_tag LOCUS_06560 16841 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195097.1 protein_id gnl|my_center|LOCUS_06560 17452 18213 gene locus_tag LOCUS_06570 17452 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 19031 18879 gene locus_tag LOCUS_06580 19031 18879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 20113 19109 gene locus_tag LOCUS_06590 gene hemB 20113 19109 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 protein_id gnl|my_center|LOCUS_06590 20965 20174 gene locus_tag LOCUS_06600 gene trpC 20965 20174 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_06600 21589 20975 gene locus_tag LOCUS_06610 21589 20975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 22620 21586 gene locus_tag LOCUS_06620 gene trpD 22620 21586 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186823.1 protein_id gnl|my_center|LOCUS_06620 23186 22620 gene locus_tag LOCUS_06630 23186 22620 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_06630 24405 23188 gene locus_tag LOCUS_06640 gene fabB 24405 23188 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769613.1 protein_id gnl|my_center|LOCUS_06640 24933 24418 gene locus_tag LOCUS_06650 gene fabA 24933 24418 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921547.1 protein_id gnl|my_center|LOCUS_06650 27702 25003 gene locus_tag LOCUS_06660 27702 25003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 29185 27704 gene locus_tag LOCUS_06670 gene trpE 29185 27704 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219345.1 protein_id gnl|my_center|LOCUS_06670 29988 29299 gene locus_tag LOCUS_06680 29988 29299 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_06680 30362 29991 gene locus_tag LOCUS_06690 30362 29991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 31066 30368 gene locus_tag LOCUS_06700 gene rpe 31066 30368 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522003.1 protein_id gnl|my_center|LOCUS_06700 31181 32425 gene locus_tag LOCUS_06710 gene hemA 31181 32425 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521984.1 protein_id gnl|my_center|LOCUS_06710 32422 33507 gene locus_tag LOCUS_06720 gene prfA 32422 33507 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 protein_id gnl|my_center|LOCUS_06720 33605 34456 gene locus_tag LOCUS_06730 gene prmC 33605 34456 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 protein_id gnl|my_center|LOCUS_06730 34648 35103 gene locus_tag LOCUS_06740 34648 35103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 35204 35803 gene locus_tag LOCUS_06750 gene umuD 35204 35803 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069871.1 protein_id gnl|my_center|LOCUS_06750 35800 37071 gene locus_tag LOCUS_06760 gene umuC 35800 37071 CDS product DNA polymerase V catalytic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457644.1 protein_id gnl|my_center|LOCUS_06760 37628 37068 gene locus_tag LOCUS_06770 37628 37068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 38224 37661 gene locus_tag LOCUS_06780 38224 37661 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461433.1 protein_id gnl|my_center|LOCUS_06780 38246 39370 gene locus_tag LOCUS_06790 38246 39370 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_06790 39367 39996 gene locus_tag LOCUS_06800 gene metW 39367 39996 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815252.1 protein_id gnl|my_center|LOCUS_06800 40706 40044 gene locus_tag LOCUS_06810 40706 40044 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214027.1 protein_id gnl|my_center|LOCUS_06810 40754 42070 gene locus_tag LOCUS_06820 40754 42070 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_06820 42163 42537 gene locus_tag LOCUS_06830 42163 42537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 43809 42595 gene locus_tag LOCUS_06840 43809 42595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 44770 43997 gene locus_tag LOCUS_06850 44770 43997 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_06850 44796 45440 gene locus_tag LOCUS_06860 gene pyrE 44796 45440 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_06860 45455 46102 gene locus_tag LOCUS_06870 45455 46102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 47575 46109 gene locus_tag LOCUS_06880 gene gatB 47575 46109 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_06880 49028 47577 gene locus_tag LOCUS_06890 gene gatA 49028 47577 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_06890 49342 49028 gene locus_tag LOCUS_06900 gene gatC 49342 49028 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_06900 49432 50475 gene locus_tag LOCUS_06910 49432 50475 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_06910 50562 51476 gene locus_tag LOCUS_06920 gene mreC 50562 51476 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189331.1 protein_id gnl|my_center|LOCUS_06920 51457 51933 gene locus_tag LOCUS_06930 gene mreD 51457 51933 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308115.1 protein_id gnl|my_center|LOCUS_06930 51943 53865 gene locus_tag LOCUS_06940 gene mrdA 51943 53865 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_06940 53858 54952 gene locus_tag LOCUS_06950 gene mrdB 53858 54952 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_06950 54949 55887 gene locus_tag LOCUS_06960 54949 55887 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_06960 55898 57025 gene locus_tag LOCUS_06970 55898 57025 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_06970 57074 57931 gene locus_tag LOCUS_06980 57074 57931 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189800.1 protein_id gnl|my_center|LOCUS_06980 57924 58190 gene locus_tag LOCUS_06990 57924 58190 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189266.1 protein_id gnl|my_center|LOCUS_06990 58194 58799 gene locus_tag LOCUS_07000 gene lipB 58194 58799 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097593.1 protein_id gnl|my_center|LOCUS_07000 58919 59860 gene locus_tag LOCUS_07010 gene lipA 58919 59860 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189177.1 protein_id gnl|my_center|LOCUS_07010 59894 60151 gene locus_tag LOCUS_07020 59894 60151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186603.1 protein_id gnl|my_center|LOCUS_07020 60713 60210 gene locus_tag LOCUS_07030 60713 60210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 61022 60798 gene locus_tag LOCUS_07040 61022 60798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 61439 61158 gene locus_tag LOCUS_07050 61439 61158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 61683 61814 gene locus_tag LOCUS_07060 61683 61814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 62055 61822 gene locus_tag LOCUS_07070 62055 61822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 62874 62185 gene locus_tag LOCUS_07080 62874 62185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 63071 63397 gene locus_tag LOCUS_07090 63071 63397 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_07090 64702 63476 gene locus_tag LOCUS_07100 64702 63476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 protein_id gnl|my_center|LOCUS_07100 65571 64699 gene locus_tag LOCUS_07110 65571 64699 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_07110 66569 65577 gene locus_tag LOCUS_07120 66569 65577 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267127.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07120 66477 67022 gene locus_tag LOCUS_07130 66477 67022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 67022 68869 gene locus_tag LOCUS_07140 67022 68869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208115026.1 protein_id gnl|my_center|LOCUS_07140 68949 69371 gene locus_tag LOCUS_07150 68949 69371 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975895.1 protein_id gnl|my_center|LOCUS_07150 70865 69432 gene locus_tag LOCUS_07160 70865 69432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 72127 70862 gene locus_tag LOCUS_07170 gene waaA 72127 70862 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_07170 72972 72232 gene locus_tag LOCUS_07180 72972 72232 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_07180 73332 73060 gene locus_tag LOCUS_07190 73332 73060 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_07190 73583 74224 gene locus_tag LOCUS_07200 73583 74224 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567218.1 protein_id gnl|my_center|LOCUS_07200 74224 75285 gene locus_tag LOCUS_07210 gene mexJ 74224 75285 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_07210 75282 78338 gene locus_tag LOCUS_07220 75282 78338 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 protein_id gnl|my_center|LOCUS_07220 78415 78663 gene locus_tag LOCUS_07230 78415 78663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 79162 80508 gene locus_tag LOCUS_07240 gene hflX 79162 80508 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261607.1 protein_id gnl|my_center|LOCUS_07240 81065 80538 gene locus_tag LOCUS_07250 81065 80538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 82552 81065 gene locus_tag LOCUS_07260 82552 81065 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_07260 83173 82622 gene locus_tag LOCUS_07270 83173 82622 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_07270 83933 83175 gene locus_tag LOCUS_07280 gene hoxU 83933 83175 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_07280 85698 83890 gene locus_tag LOCUS_07290 85698 83890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 86690 85815 gene locus_tag LOCUS_07300 gene motD 86690 85815 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_07300 86942 87310 gene locus_tag LOCUS_07310 86942 87310 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770186.1 protein_id gnl|my_center|LOCUS_07310 87417 88373 gene locus_tag LOCUS_07320 87417 88373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 88875 88417 gene locus_tag LOCUS_07330 88875 88417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 89782 89315 gene locus_tag LOCUS_07340 89782 89315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence008 1989 73 gene locus_tag LOCUS_07350 1989 73 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388687.1 protein_id gnl|my_center|LOCUS_07350 2269 3789 gene locus_tag LOCUS_07360 2269 3789 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_07360 3929 4312 gene locus_tag LOCUS_07370 3929 4312 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_07370 4668 5405 gene locus_tag LOCUS_07380 4668 5405 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096597.1 protein_id gnl|my_center|LOCUS_07380 5402 6751 gene locus_tag LOCUS_07390 5402 6751 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615703.1 protein_id gnl|my_center|LOCUS_07390 6901 7311 gene locus_tag LOCUS_07400 6901 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 7330 7914 gene locus_tag LOCUS_07410 7330 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8199 8975 gene locus_tag LOCUS_07420 8199 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 9227 10057 gene locus_tag LOCUS_07430 gene pabC 9227 10057 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_07430 10104 11036 gene locus_tag LOCUS_07440 gene mltG 10104 11036 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191597.1 protein_id gnl|my_center|LOCUS_07440 11036 11638 gene locus_tag LOCUS_07450 gene tmk 11036 11638 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193022.1 protein_id gnl|my_center|LOCUS_07450 11635 12645 gene locus_tag LOCUS_07460 11635 12645 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_07460 12642 13037 gene locus_tag LOCUS_07470 12642 13037 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_07470 13072 13848 gene locus_tag LOCUS_07480 13072 13848 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448020.1 protein_id gnl|my_center|LOCUS_07480 13839 14615 gene locus_tag LOCUS_07490 13839 14615 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_07490 14658 15032 gene locus_tag LOCUS_07500 14658 15032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 15160 15585 gene locus_tag LOCUS_07510 gene ndk 15160 15585 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193561.1 protein_id gnl|my_center|LOCUS_07510 15601 16686 gene locus_tag LOCUS_07520 gene rlmN 15601 16686 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_07520 16704 17426 gene locus_tag LOCUS_07530 gene pilW 16704 17426 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477819.1 protein_id gnl|my_center|LOCUS_07530 17429 18391 gene locus_tag LOCUS_07540 17429 18391 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193926.1 protein_id gnl|my_center|LOCUS_07540 18431 19669 gene locus_tag LOCUS_07550 gene ispG 18431 19669 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_07550 19791 21050 gene locus_tag LOCUS_07560 gene hisS 19791 21050 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191559.1 protein_id gnl|my_center|LOCUS_07560 21055 21876 gene locus_tag LOCUS_07570 21055 21876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 21973 22785 gene locus_tag LOCUS_07580 21973 22785 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_07580 22795 23421 gene locus_tag LOCUS_07590 22795 23421 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 protein_id gnl|my_center|LOCUS_07590 23424 24584 gene locus_tag LOCUS_07600 gene bamB 23424 24584 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_07600 24584 26023 gene locus_tag LOCUS_07610 gene der 24584 26023 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_07610 26917 26114 gene locus_tag LOCUS_07620 26917 26114 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687645.1 protein_id gnl|my_center|LOCUS_07620 26957 28003 gene locus_tag LOCUS_07630 gene rluD 26957 28003 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247551.1 protein_id gnl|my_center|LOCUS_07630 28003 28734 gene locus_tag LOCUS_07640 gene yfiH 28003 28734 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209471.1 protein_id gnl|my_center|LOCUS_07640 29001 28798 gene locus_tag LOCUS_07650 29001 28798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 29016 30332 gene locus_tag LOCUS_07660 gene rimO 29016 30332 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064698.1 protein_id gnl|my_center|LOCUS_07660 30697 30350 gene locus_tag LOCUS_07670 30697 30350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 31187 30744 gene locus_tag LOCUS_07680 31187 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550170.1 protein_id gnl|my_center|LOCUS_07680 32008 32511 gene locus_tag LOCUS_07690 32008 32511 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_07690 32508 33539 gene locus_tag LOCUS_07700 gene arsB 32508 33539 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_07700 33760 34122 gene locus_tag LOCUS_07710 gene arsD 33760 34122 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 protein_id gnl|my_center|LOCUS_07710 34137 35894 gene locus_tag LOCUS_07720 gene arsA 34137 35894 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 protein_id gnl|my_center|LOCUS_07720 36365 37051 gene locus_tag LOCUS_07730 36365 37051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 39398 37296 gene locus_tag LOCUS_07740 gene recD 39398 37296 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114993.1 protein_id gnl|my_center|LOCUS_07740 43117 39395 gene locus_tag LOCUS_07750 gene recB 43117 39395 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 protein_id gnl|my_center|LOCUS_07750 46767 43114 gene locus_tag LOCUS_07760 gene recC 46767 43114 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_07760 47550 49736 gene locus_tag LOCUS_07770 47550 49736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 49836 50870 gene locus_tag LOCUS_07780 49836 50870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 50894 54388 gene locus_tag LOCUS_07790 50894 54388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 54385 55419 gene locus_tag LOCUS_07800 54385 55419 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085128.1 protein_id gnl|my_center|LOCUS_07800 57014 55923 gene locus_tag LOCUS_07810 57014 55923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 57645 57112 gene locus_tag LOCUS_07820 57645 57112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 58094 57675 gene locus_tag LOCUS_07830 58094 57675 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_07830 58137 61646 gene locus_tag LOCUS_07840 gene smc 58137 61646 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114484320.1 protein_id gnl|my_center|LOCUS_07840 61688 62983 gene locus_tag LOCUS_07850 61688 62983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 62988 65039 gene locus_tag LOCUS_07860 gene ligA 62988 65039 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937986.1 protein_id gnl|my_center|LOCUS_07860 65179 65952 gene locus_tag LOCUS_07870 gene cysQ 65179 65952 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 protein_id gnl|my_center|LOCUS_07870 65965 66882 gene locus_tag LOCUS_07880 65965 66882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 67159 66962 gene locus_tag LOCUS_07890 67159 66962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 67719 67132 gene locus_tag LOCUS_07900 gene rnhB 67719 67132 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 protein_id gnl|my_center|LOCUS_07900 68852 67716 gene locus_tag LOCUS_07910 gene lpxB 68852 67716 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266979.1 protein_id gnl|my_center|LOCUS_07910 69786 69016 gene locus_tag LOCUS_07920 gene lpxA 69786 69016 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690038.1 protein_id gnl|my_center|LOCUS_07920 70229 69783 gene locus_tag LOCUS_07930 gene fabZ 70229 69783 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_07930 71266 70226 gene locus_tag LOCUS_07940 gene lpxD 71266 70226 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139282.1 protein_id gnl|my_center|LOCUS_07940 71804 71301 gene locus_tag LOCUS_07950 71804 71301 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_07950 74181 71830 gene locus_tag LOCUS_07960 gene bamA 74181 71830 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_07960 75546 74191 gene locus_tag LOCUS_07970 gene rseP 75546 74191 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705099.1 protein_id gnl|my_center|LOCUS_07970 76730 75543 gene locus_tag LOCUS_07980 gene ispC 76730 75543 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_07980 77554 76727 gene locus_tag LOCUS_07990 gene cdsA 77554 76727 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 protein_id gnl|my_center|LOCUS_07990 78302 77541 gene locus_tag LOCUS_08000 78302 77541 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690027.1 protein_id gnl|my_center|LOCUS_08000 78989 78432 gene locus_tag LOCUS_08010 gene frr 78989 78432 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192143.1 protein_id gnl|my_center|LOCUS_08010 79720 79004 gene locus_tag LOCUS_08020 gene pyrH 79720 79004 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_08020 80641 79760 gene locus_tag LOCUS_08030 gene tsf 80641 79760 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926570.1 protein_id gnl|my_center|LOCUS_08030 81491 80739 gene locus_tag LOCUS_08040 gene rpsB 81491 80739 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686861.1 protein_id gnl|my_center|LOCUS_08040 81655 82455 gene locus_tag LOCUS_08050 gene map 81655 82455 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_08050 82455 85007 gene locus_tag LOCUS_08060 82455 85007 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_08060 86151 85015 gene locus_tag LOCUS_08070 86151 85015 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence009 560 66 gene locus_tag LOCUS_08080 560 66 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_08080 975 664 gene locus_tag LOCUS_08090 975 664 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115102.1 protein_id gnl|my_center|LOCUS_08090 2131 1067 gene locus_tag LOCUS_08100 gene leuB 2131 1067 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_08100 2866 2228 gene locus_tag LOCUS_08110 gene leuD 2866 2228 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_08110 4285 2876 gene locus_tag LOCUS_08120 gene leuC 4285 2876 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951104.1 protein_id gnl|my_center|LOCUS_08120 4412 5233 gene locus_tag LOCUS_08130 4412 5233 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192784.1 protein_id gnl|my_center|LOCUS_08130 7021 5438 gene locus_tag LOCUS_08140 gene cimA 7021 5438 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_08140 8249 7026 gene locus_tag LOCUS_08150 8249 7026 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_08150 9426 8503 gene locus_tag LOCUS_08160 gene argF 9426 8503 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_08160 10603 9437 gene locus_tag LOCUS_08170 10603 9437 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064106.1 protein_id gnl|my_center|LOCUS_08170 11177 10686 gene locus_tag LOCUS_08180 11177 10686 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_08180 11570 12676 gene locus_tag LOCUS_08190 11570 12676 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_08190 12749 13630 gene locus_tag LOCUS_08200 12749 13630 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_08200 13659 14009 gene locus_tag LOCUS_08210 13659 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 14011 14634 gene locus_tag LOCUS_08220 14011 14634 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978773.1 protein_id gnl|my_center|LOCUS_08220 14639 15244 gene locus_tag LOCUS_08230 14639 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 15710 15246 gene locus_tag LOCUS_08240 15710 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 15901 16281 gene locus_tag LOCUS_08250 15901 16281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 16295 17140 gene locus_tag LOCUS_08260 gene rlmJ 16295 17140 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538077.1 protein_id gnl|my_center|LOCUS_08260 18249 17152 gene locus_tag LOCUS_08270 gene hisC 18249 17152 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_08270 19475 18408 gene locus_tag LOCUS_08280 gene pheA 19475 18408 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_08280 20651 19551 gene locus_tag LOCUS_08290 gene serC 20651 19551 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189993.1 protein_id gnl|my_center|LOCUS_08290 23295 20653 gene locus_tag LOCUS_08300 gene gyrA 23295 20653 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_08300 23541 24143 gene locus_tag LOCUS_08310 23541 24143 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_08310 24506 25219 gene locus_tag LOCUS_08320 24506 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 25585 25229 gene locus_tag LOCUS_08330 25585 25229 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_08330 25883 25575 gene locus_tag LOCUS_08340 25883 25575 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_08340 27047 26250 gene locus_tag LOCUS_08350 gene fliR 27047 26250 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201278.1 protein_id gnl|my_center|LOCUS_08350 27329 27057 gene locus_tag LOCUS_08360 gene fliQ 27329 27057 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211131.1 protein_id gnl|my_center|LOCUS_08360 28072 27326 gene locus_tag LOCUS_08370 gene fliP 28072 27326 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 protein_id gnl|my_center|LOCUS_08370 28526 28062 gene locus_tag LOCUS_08380 28526 28062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 28978 28523 gene locus_tag LOCUS_08390 28978 28523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 29986 28994 gene locus_tag LOCUS_08400 gene fliM 29986 28994 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524547.1 protein_id gnl|my_center|LOCUS_08400 30546 30013 gene locus_tag LOCUS_08410 30546 30013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 31337 30933 gene locus_tag LOCUS_08420 31337 30933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 31660 31860 gene locus_tag LOCUS_08430 31660 31860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 32800 32351 gene locus_tag LOCUS_08440 32800 32351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 34212 32800 gene locus_tag LOCUS_08450 gene fliI 34212 32800 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_08450 34879 34205 gene locus_tag LOCUS_08460 gene fliH 34879 34205 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197166.1 protein_id gnl|my_center|LOCUS_08460 35884 34886 gene locus_tag LOCUS_08470 gene fliG 35884 34886 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_08470 37542 35881 gene locus_tag LOCUS_08480 gene fliF 37542 35881 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_08480 38537 37692 gene locus_tag LOCUS_08490 38537 37692 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_08490 39008 38541 gene locus_tag LOCUS_08500 39008 38541 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766044.1 protein_id gnl|my_center|LOCUS_08500 39682 39005 gene locus_tag LOCUS_08510 39682 39005 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144308590.1 protein_id gnl|my_center|LOCUS_08510 42224 39756 gene locus_tag LOCUS_08520 42224 39756 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_08520 44393 42495 gene locus_tag LOCUS_08530 gene htpG 44393 42495 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929604.1 protein_id gnl|my_center|LOCUS_08530 44982 44563 gene locus_tag LOCUS_08540 44982 44563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 45090 45758 gene locus_tag LOCUS_08550 45090 45758 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174863573.1 protein_id gnl|my_center|LOCUS_08550 46395 45760 gene locus_tag LOCUS_08560 46395 45760 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_08560 47467 46382 gene locus_tag LOCUS_08570 gene mtnA 47467 46382 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388113.1 protein_id gnl|my_center|LOCUS_08570 47834 48562 gene locus_tag LOCUS_08580 47834 48562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 48688 48894 gene locus_tag LOCUS_08590 48688 48894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 49058 49249 gene locus_tag LOCUS_08600 49058 49249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 49773 49285 gene locus_tag LOCUS_08610 49773 49285 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103775.1 protein_id gnl|my_center|LOCUS_08610 49923 50744 gene locus_tag LOCUS_08620 49923 50744 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_08620 50965 50810 gene locus_tag LOCUS_08630 50965 50810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 53253 50995 gene locus_tag LOCUS_08640 53253 50995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 54191 53280 gene locus_tag LOCUS_08650 54191 53280 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668256.1 protein_id gnl|my_center|LOCUS_08650 55113 54766 gene locus_tag LOCUS_08660 55113 54766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 55773 55222 gene locus_tag LOCUS_08670 55773 55222 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040134.1 protein_id gnl|my_center|LOCUS_08670 57486 56035 gene locus_tag LOCUS_08680 gene nuoN 57486 56035 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_08680 58987 57488 gene locus_tag LOCUS_08690 58987 57488 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_08690 61136 59133 gene locus_tag LOCUS_08700 gene nuoL 61136 59133 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_08700 61468 61160 gene locus_tag LOCUS_08710 gene nuoK 61468 61160 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_08710 62100 61465 gene locus_tag LOCUS_08720 62100 61465 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_08720 62600 62109 gene locus_tag LOCUS_08730 gene nuoI 62600 62109 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_08730 63676 62597 gene locus_tag LOCUS_08740 gene nuoH 63676 62597 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769061.1 protein_id gnl|my_center|LOCUS_08740 66066 63676 gene locus_tag LOCUS_08750 gene nuoG 66066 63676 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543813.1 protein_id gnl|my_center|LOCUS_08750 67484 66210 gene locus_tag LOCUS_08760 gene nuoF 67484 66210 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689949.1 protein_id gnl|my_center|LOCUS_08760 67957 67484 gene locus_tag LOCUS_08770 gene nuoE 67957 67484 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224830.1 protein_id gnl|my_center|LOCUS_08770 69221 67968 gene locus_tag LOCUS_08780 69221 67968 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_08780 69807 69214 gene locus_tag LOCUS_08790 69807 69214 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_08790 70283 69804 gene locus_tag LOCUS_08800 70283 69804 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_08800 70630 70274 gene locus_tag LOCUS_08810 70630 70274 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_08810 72473 71127 gene locus_tag LOCUS_08820 72473 71127 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_08820 74284 72470 gene locus_tag LOCUS_08830 74284 72470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 74308 75330 gene locus_tag LOCUS_08840 74308 75330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 75330 75806 gene locus_tag LOCUS_08850 75330 75806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 75994 76707 gene locus_tag LOCUS_08860 75994 76707 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706992.1 protein_id gnl|my_center|LOCUS_08860 76704 78194 gene locus_tag LOCUS_08870 76704 78194 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_08870 78191 78844 gene locus_tag LOCUS_08880 78191 78844 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_08880 78841 79641 gene locus_tag LOCUS_08890 78841 79641 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_08890 79661 80335 gene locus_tag LOCUS_08900 79661 80335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_08900 80472 80672 gene locus_tag LOCUS_08910 80472 80672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 <81398 80825 gene locus_tag LOCUS_08920 <81398 80825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005467215.1:nucleotide sugar dehydrogenase >Feature sequence010 <1 1196 gene locus_tag LOCUS_08930 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_213605796.1:type II secretion system secretin GspD 2940 1189 gene locus_tag LOCUS_08940 2940 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4070 2973 gene locus_tag LOCUS_08950 4070 2973 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193389.1 protein_id gnl|my_center|LOCUS_08950 8292 4234 gene locus_tag LOCUS_08960 8292 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241405.1 protein_id gnl|my_center|LOCUS_08960 9500 8523 gene locus_tag LOCUS_08970 9500 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 10053 9517 gene locus_tag LOCUS_08980 10053 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 11024 10044 gene locus_tag LOCUS_08990 11024 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 11963 11025 gene locus_tag LOCUS_09000 11963 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 12829 11966 gene locus_tag LOCUS_09010 12829 11966 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_09010 14003 12981 gene locus_tag LOCUS_09020 14003 12981 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_09020 14753 14193 gene locus_tag LOCUS_09030 14753 14193 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_09030 15547 14768 gene locus_tag LOCUS_09040 15547 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 15997 15629 gene locus_tag LOCUS_09050 15997 15629 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_09050 16074 17306 gene locus_tag LOCUS_09060 16074 17306 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_09060 17382 18695 gene locus_tag LOCUS_09070 17382 18695 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193856.1 protein_id gnl|my_center|LOCUS_09070 18762 20192 gene locus_tag LOCUS_09080 gene thrC 18762 20192 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192708.1 protein_id gnl|my_center|LOCUS_09080 20269 21063 gene locus_tag LOCUS_09090 20269 21063 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_09090 22170 21103 gene locus_tag LOCUS_09100 22170 21103 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 protein_id gnl|my_center|LOCUS_09100 22367 22870 gene locus_tag LOCUS_09110 gene folA 22367 22870 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_09110 25077 22849 gene locus_tag LOCUS_09120 25077 22849 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 protein_id gnl|my_center|LOCUS_09120 25318 25091 gene locus_tag LOCUS_09130 25318 25091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689624.1 protein_id gnl|my_center|LOCUS_09130 25854 25315 gene locus_tag LOCUS_09140 gene dcd 25854 25315 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224592.1 protein_id gnl|my_center|LOCUS_09140 26137 27036 gene locus_tag LOCUS_09150 26137 27036 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266746.1 protein_id gnl|my_center|LOCUS_09150 29764 28676 gene locus_tag LOCUS_09160 gene aroG 29764 28676 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_09160 30951 29863 gene locus_tag LOCUS_09170 gene apbC 30951 29863 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_09170 31389 31018 gene locus_tag LOCUS_09180 31389 31018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_09180 31782 31414 gene locus_tag LOCUS_09190 31782 31414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 32006 32182 gene locus_tag LOCUS_09200 32006 32182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 32368 32712 gene locus_tag LOCUS_09210 32368 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 32709 33161 gene locus_tag LOCUS_09220 32709 33161 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038704.1 protein_id gnl|my_center|LOCUS_09220 33173 34465 gene locus_tag LOCUS_09230 33173 34465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 34568 36898 gene locus_tag LOCUS_09240 34568 36898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 37057 39150 gene locus_tag LOCUS_09250 gene metG 37057 39150 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538477.1 protein_id gnl|my_center|LOCUS_09250 39528 39205 gene locus_tag LOCUS_09260 39528 39205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 40447 39695 gene locus_tag LOCUS_09270 40447 39695 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071993.1 protein_id gnl|my_center|LOCUS_09270 41269 40553 gene locus_tag LOCUS_09280 gene pyrF 41269 40553 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_09280 42423 41266 gene locus_tag LOCUS_09290 gene lapB 42423 41266 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_09290 42693 42433 gene locus_tag LOCUS_09300 42693 42433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 43031 42708 gene locus_tag LOCUS_09310 43031 42708 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_09310 44474 43188 gene locus_tag LOCUS_09320 44474 43188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 45472 44570 gene locus_tag LOCUS_09330 gene cysD 45472 44570 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499613.1 protein_id gnl|my_center|LOCUS_09330 46248 45562 gene locus_tag LOCUS_09340 46248 45562 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_09340 46910 46248 gene locus_tag LOCUS_09350 46910 46248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 48571 46910 gene locus_tag LOCUS_09360 48571 46910 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_09360 49462 48680 gene locus_tag LOCUS_09370 49462 48680 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_09370 49588 50514 gene locus_tag LOCUS_09380 49588 50514 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 protein_id gnl|my_center|LOCUS_09380 50731 51297 gene locus_tag LOCUS_09390 50731 51297 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_09390 51367 52275 gene locus_tag LOCUS_09400 51367 52275 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_09400 53169 52282 gene locus_tag LOCUS_09410 53169 52282 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670448.1 protein_id gnl|my_center|LOCUS_09410 53224 53715 gene locus_tag LOCUS_09420 53224 53715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 54819 54430 gene locus_tag LOCUS_09430 54819 54430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 55019 55174 gene locus_tag LOCUS_09440 55019 55174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 55174 56892 gene locus_tag LOCUS_09450 55174 56892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 56889 57527 gene locus_tag LOCUS_09460 gene uvrY 56889 57527 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 protein_id gnl|my_center|LOCUS_09460 59412 57541 gene locus_tag LOCUS_09470 59412 57541 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_09470 59487 60419 gene locus_tag LOCUS_09480 59487 60419 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085861.1 protein_id gnl|my_center|LOCUS_09480 60416 61384 gene locus_tag LOCUS_09490 gene ybiB 60416 61384 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210242.1 protein_id gnl|my_center|LOCUS_09490 61381 62337 gene locus_tag LOCUS_09500 gene rlmF 61381 62337 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092887.1 protein_id gnl|my_center|LOCUS_09500 62359 62640 gene locus_tag LOCUS_09510 62359 62640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 62616 63791 gene locus_tag LOCUS_09520 62616 63791 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535007.1 protein_id gnl|my_center|LOCUS_09520 64278 63817 gene locus_tag LOCUS_09530 64278 63817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 64925 64314 gene locus_tag LOCUS_09540 64925 64314 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_09540 66100 64994 gene locus_tag LOCUS_09550 66100 64994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 67382 66576 gene locus_tag LOCUS_09560 67382 66576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 68287 67379 gene locus_tag LOCUS_09570 gene fhcD 68287 67379 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532026.1 protein_id gnl|my_center|LOCUS_09570 70028 68352 gene locus_tag LOCUS_09580 70028 68352 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922276.1 protein_id gnl|my_center|LOCUS_09580 71318 70038 gene locus_tag LOCUS_09590 71318 70038 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_09590 71496 72464 gene locus_tag LOCUS_09600 71496 72464 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532030.1 protein_id gnl|my_center|LOCUS_09600 72543 73445 gene locus_tag LOCUS_09610 72543 73445 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_09610 73450 74538 gene locus_tag LOCUS_09620 73450 74538 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_09620 74581 75570 gene locus_tag LOCUS_09630 gene mch 74581 75570 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532033.1 protein_id gnl|my_center|LOCUS_09630 75654 76574 gene locus_tag LOCUS_09640 75654 76574 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532034.1 protein_id gnl|my_center|LOCUS_09640 76583 77431 gene locus_tag LOCUS_09650 76583 77431 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827560.1 protein_id gnl|my_center|LOCUS_09650 77503 78453 gene locus_tag LOCUS_09660 gene tal 77503 78453 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066347.1 protein_id gnl|my_center|LOCUS_09660 78572 79213 gene locus_tag LOCUS_09670 78572 79213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 79270 79899 gene locus_tag LOCUS_09680 79270 79899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 80036 80575 gene locus_tag LOCUS_09690 gene hxlB 80036 80575 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879292.1 protein_id gnl|my_center|LOCUS_09690 80866 81372 gene locus_tag LOCUS_09700 80866 81372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence011 734 15 gene locus_tag LOCUS_09710 734 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1818 907 gene locus_tag LOCUS_09720 1818 907 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966742.1 protein_id gnl|my_center|LOCUS_09720 2026 2625 gene locus_tag LOCUS_09730 2026 2625 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_09730 3500 2703 gene locus_tag LOCUS_09740 3500 2703 CDS product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532068.1 protein_id gnl|my_center|LOCUS_09740 5673 3607 gene locus_tag LOCUS_09750 gene flhA 5673 3607 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_09750 6815 5673 gene locus_tag LOCUS_09760 gene flhB 6815 5673 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_09760 7764 9269 gene locus_tag LOCUS_09770 gene malQ 7764 9269 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094267720.1 protein_id gnl|my_center|LOCUS_09770 9781 11442 gene locus_tag LOCUS_09780 9781 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 12950 11487 gene locus_tag LOCUS_09790 gene glgA 12950 11487 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_09790 14579 12996 gene locus_tag LOCUS_09800 14579 12996 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_09800 15842 14586 gene locus_tag LOCUS_09810 15842 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 17321 15954 gene locus_tag LOCUS_09820 17321 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 19626 17404 gene locus_tag LOCUS_09830 gene glgB 19626 17404 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_09830 20871 19792 gene locus_tag LOCUS_09840 20871 19792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 21595 24879 gene locus_tag LOCUS_09850 21595 24879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 24920 28522 gene locus_tag LOCUS_09860 24920 28522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 28524 29549 gene locus_tag LOCUS_09870 28524 29549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 31299 29692 gene locus_tag LOCUS_09880 31299 29692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 32057 31356 gene locus_tag LOCUS_09890 32057 31356 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185598.1 protein_id gnl|my_center|LOCUS_09890 32144 32917 gene locus_tag LOCUS_09900 32144 32917 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191284.1 protein_id gnl|my_center|LOCUS_09900 33789 32914 gene locus_tag LOCUS_09910 gene hslO 33789 32914 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550203.1 protein_id gnl|my_center|LOCUS_09910 34158 34643 gene locus_tag LOCUS_09920 34158 34643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 35623 34733 gene locus_tag LOCUS_09930 gene gluQRS 35623 34733 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951304.1 protein_id gnl|my_center|LOCUS_09930 35947 35627 gene locus_tag LOCUS_09940 35947 35627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 37145 35952 gene locus_tag LOCUS_09950 37145 35952 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_09950 38356 37142 gene locus_tag LOCUS_09960 38356 37142 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_09960 40266 38398 gene locus_tag LOCUS_09970 40266 38398 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_09970 41078 40299 gene locus_tag LOCUS_09980 41078 40299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 41482 41090 gene locus_tag LOCUS_09990 gene cheY 41482 41090 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367338.1 protein_id gnl|my_center|LOCUS_09990 42446 41511 gene locus_tag LOCUS_10000 42446 41511 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315817.1 protein_id gnl|my_center|LOCUS_10000 43422 42466 gene locus_tag LOCUS_10010 43422 42466 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098100.1 protein_id gnl|my_center|LOCUS_10010 44596 43469 gene locus_tag LOCUS_10020 44596 43469 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 protein_id gnl|my_center|LOCUS_10020 44706 45866 gene locus_tag LOCUS_10030 gene fleS 44706 45866 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_10030 45863 47191 gene locus_tag LOCUS_10040 45863 47191 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103783.1 protein_id gnl|my_center|LOCUS_10040 47301 47618 gene locus_tag LOCUS_10050 gene fliE 47301 47618 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160376.1 protein_id gnl|my_center|LOCUS_10050 47915 50368 gene locus_tag LOCUS_10060 47915 50368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 51312 50446 gene locus_tag LOCUS_10070 51312 50446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 51454 55338 gene locus_tag LOCUS_10080 gene purL 51454 55338 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266924.1 protein_id gnl|my_center|LOCUS_10080 55378 55869 gene locus_tag LOCUS_10090 55378 55869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 56011 56331 gene locus_tag LOCUS_10100 56011 56331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 56332 57588 gene locus_tag LOCUS_10110 56332 57588 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_10110 57549 58793 gene locus_tag LOCUS_10120 57549 58793 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_10120 58790 59365 gene locus_tag LOCUS_10130 58790 59365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 59457 60305 gene locus_tag LOCUS_10140 59457 60305 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963694.1 protein_id gnl|my_center|LOCUS_10140 61063 60380 gene locus_tag LOCUS_10150 gene flgA 61063 60380 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930322.1 protein_id gnl|my_center|LOCUS_10150 61138 62922 gene locus_tag LOCUS_10160 61138 62922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 63172 62939 gene locus_tag LOCUS_10170 63172 62939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 63221 63625 gene locus_tag LOCUS_10180 gene flgB 63221 63625 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884708.1 protein_id gnl|my_center|LOCUS_10180 63625 64038 gene locus_tag LOCUS_10190 gene flgC 63625 64038 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197251.1 protein_id gnl|my_center|LOCUS_10190 64054 64704 gene locus_tag LOCUS_10200 64054 64704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 64723 66063 gene locus_tag LOCUS_10210 gene flgE 64723 66063 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_10210 66122 66862 gene locus_tag LOCUS_10220 gene flgF 66122 66862 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_10220 66881 67663 gene locus_tag LOCUS_10230 gene flgG 66881 67663 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367325.1 protein_id gnl|my_center|LOCUS_10230 67674 68402 gene locus_tag LOCUS_10240 67674 68402 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447174.1 protein_id gnl|my_center|LOCUS_10240 68412 69485 gene locus_tag LOCUS_10250 68412 69485 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550967.1 protein_id gnl|my_center|LOCUS_10250 69485 70399 gene locus_tag LOCUS_10260 gene flgJ 69485 70399 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 protein_id gnl|my_center|LOCUS_10260 70456 72384 gene locus_tag LOCUS_10270 gene flgK 70456 72384 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_10270 72398 73633 gene locus_tag LOCUS_10280 gene flgL 72398 73633 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200262.1 protein_id gnl|my_center|LOCUS_10280 74375 73614 gene locus_tag LOCUS_10290 gene serB 74375 73614 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_10290 74577 75740 gene locus_tag LOCUS_10300 gene sucC 74577 75740 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048602.1 protein_id gnl|my_center|LOCUS_10300 75830 76705 gene locus_tag LOCUS_10310 gene sucD 75830 76705 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946282.1 protein_id gnl|my_center|LOCUS_10310 76760 77695 gene locus_tag LOCUS_10320 76760 77695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 77692 79302 gene locus_tag LOCUS_10330 77692 79302 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526341.1 protein_id gnl|my_center|LOCUS_10330 81175 79631 gene locus_tag LOCUS_10340 gene oprO 81175 79631 CDS product outer membrane porin OprO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104423.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence012 362 63 gene locus_tag LOCUS_10350 362 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 633 791 gene locus_tag LOCUS_10360 633 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 822 1046 gene locus_tag LOCUS_10370 822 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2644 1202 gene locus_tag LOCUS_10380 2644 1202 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538266.1 protein_id gnl|my_center|LOCUS_10380 3957 2641 gene locus_tag LOCUS_10390 gene rlmD 3957 2641 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_10390 4847 4074 gene locus_tag LOCUS_10400 4847 4074 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_10400 5739 4852 gene locus_tag LOCUS_10410 gene cysM 5739 4852 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_10410 6237 5740 gene locus_tag LOCUS_10420 6237 5740 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 protein_id gnl|my_center|LOCUS_10420 6288 7487 gene locus_tag LOCUS_10430 gene xseA 6288 7487 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 protein_id gnl|my_center|LOCUS_10430 7590 9473 gene locus_tag LOCUS_10440 7590 9473 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_10440 9532 9882 gene locus_tag LOCUS_10450 9532 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 9898 10731 gene locus_tag LOCUS_10460 9898 10731 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244107.1 protein_id gnl|my_center|LOCUS_10460 10794 11372 gene locus_tag LOCUS_10470 10794 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_10470 11447 12268 gene locus_tag LOCUS_10480 gene dapD 11447 12268 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_10480 12338 12685 gene locus_tag LOCUS_10490 12338 12685 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_10490 12682 13818 gene locus_tag LOCUS_10500 gene dapE 12682 13818 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521179.1 protein_id gnl|my_center|LOCUS_10500 13941 14861 gene locus_tag LOCUS_10510 gene prmB 13941 14861 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002235090.1 protein_id gnl|my_center|LOCUS_10510 15885 14965 gene locus_tag LOCUS_10520 gene fdhE 15885 14965 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188802.1 protein_id gnl|my_center|LOCUS_10520 16523 15885 gene locus_tag LOCUS_10530 16523 15885 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095316.1 protein_id gnl|my_center|LOCUS_10530 17386 16520 gene locus_tag LOCUS_10540 gene fdxH 17386 16520 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528944.1 protein_id gnl|my_center|LOCUS_10540 20559 17389 gene locus_tag LOCUS_10550 gene fdnG 20559 17389 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528945.1 protein_id gnl|my_center|LOCUS_10550 21721 20672 gene locus_tag LOCUS_10560 gene mnmH 21721 20672 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526161.1 protein_id gnl|my_center|LOCUS_10560 22639 21785 gene locus_tag LOCUS_10570 gene fdhD 22639 21785 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 protein_id gnl|my_center|LOCUS_10570 23684 22719 gene locus_tag LOCUS_10580 23684 22719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 24394 23837 gene locus_tag LOCUS_10590 24394 23837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 25160 24381 gene locus_tag LOCUS_10600 25160 24381 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192594.1 protein_id gnl|my_center|LOCUS_10600 26362 25160 gene locus_tag LOCUS_10610 26362 25160 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_10610 27041 26373 gene locus_tag LOCUS_10620 27041 26373 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_10620 27673 27038 gene locus_tag LOCUS_10630 27673 27038 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_10630 28605 27754 gene locus_tag LOCUS_10640 28605 27754 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812407.1 protein_id gnl|my_center|LOCUS_10640 28700 29233 gene locus_tag LOCUS_10650 28700 29233 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_10650 29233 29535 gene locus_tag LOCUS_10660 29233 29535 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_10660 29535 29795 gene locus_tag LOCUS_10670 29535 29795 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199503.1 protein_id gnl|my_center|LOCUS_10670 29831 30637 gene locus_tag LOCUS_10680 29831 30637 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821314.1 protein_id gnl|my_center|LOCUS_10680 30762 31013 gene locus_tag LOCUS_10690 30762 31013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 31147 32934 gene locus_tag LOCUS_10700 gene feoB 31147 32934 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057288.1 protein_id gnl|my_center|LOCUS_10700 33001 33879 gene locus_tag LOCUS_10710 33001 33879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10710 33883 35178 gene locus_tag LOCUS_10720 33883 35178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10720 35635 35339 gene locus_tag LOCUS_10730 35635 35339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 35528 35998 gene locus_tag LOCUS_10740 35528 35998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 36091 37797 gene locus_tag LOCUS_10750 gene rpsA 36091 37797 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_10750 37802 38095 gene locus_tag LOCUS_10760 37802 38095 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_10760 38316 38873 gene locus_tag LOCUS_10770 38316 38873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 38920 42060 gene locus_tag LOCUS_10780 38920 42060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 42531 43691 gene locus_tag LOCUS_10790 42531 43691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 45311 44124 gene locus_tag LOCUS_10800 45311 44124 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 protein_id gnl|my_center|LOCUS_10800 45475 45828 gene locus_tag LOCUS_10810 45475 45828 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403950.1 protein_id gnl|my_center|LOCUS_10810 45913 48570 gene locus_tag LOCUS_10820 gene pepN 45913 48570 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189239.1 protein_id gnl|my_center|LOCUS_10820 50203 48596 gene locus_tag LOCUS_10830 50203 48596 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_10830 50416 51138 gene locus_tag LOCUS_10840 gene trmJ 50416 51138 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947473.1 protein_id gnl|my_center|LOCUS_10840 53844 51139 gene locus_tag LOCUS_10850 gene glnE 53844 51139 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224816.1 protein_id gnl|my_center|LOCUS_10850 53854 54660 gene locus_tag LOCUS_10860 53854 54660 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063753.1 protein_id gnl|my_center|LOCUS_10860 55210 54758 gene locus_tag LOCUS_10870 55210 54758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 55401 55213 gene locus_tag LOCUS_10880 55401 55213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 55601 57247 gene locus_tag LOCUS_10890 55601 57247 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018013007.1 protein_id gnl|my_center|LOCUS_10890 57375 57890 gene locus_tag LOCUS_10900 57375 57890 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337154.1 protein_id gnl|my_center|LOCUS_10900 57887 58492 gene locus_tag LOCUS_10910 57887 58492 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_10910 58521 60116 gene locus_tag LOCUS_10920 58521 60116 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_10920 60723 60322 gene locus_tag LOCUS_10930 gene vapC 60723 60322 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 protein_id gnl|my_center|LOCUS_10930 61019 60723 gene locus_tag LOCUS_10940 61019 60723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 61713 61114 gene locus_tag LOCUS_10950 61713 61114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 66035 61752 gene locus_tag LOCUS_10960 66035 61752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 67923 65995 gene locus_tag LOCUS_10970 67923 65995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 68450 67998 gene locus_tag LOCUS_10980 68450 67998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 69526 68465 gene locus_tag LOCUS_10990 69526 68465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 70170 69535 gene locus_tag LOCUS_11000 70170 69535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 70811 70167 gene locus_tag LOCUS_11010 70811 70167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 71218 70811 gene locus_tag LOCUS_11020 71218 70811 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266587.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence013 680 886 gene locus_tag LOCUS_11030 680 886 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_11030 1019 1294 gene locus_tag LOCUS_11040 gene infA 1019 1294 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809486.1 protein_id gnl|my_center|LOCUS_11040 1555 1343 gene locus_tag LOCUS_11050 1555 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2345 1641 gene locus_tag LOCUS_11060 2345 1641 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_11060 2881 2342 gene locus_tag LOCUS_11070 2881 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2898 4136 gene locus_tag LOCUS_11080 gene icd 2898 4136 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814059.1 protein_id gnl|my_center|LOCUS_11080 5246 4161 gene locus_tag LOCUS_11090 5246 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389361.1 protein_id gnl|my_center|LOCUS_11090 5288 6175 gene locus_tag LOCUS_11100 5288 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6776 6255 gene locus_tag LOCUS_11110 6776 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7541 6951 gene locus_tag LOCUS_11120 7541 6951 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_11120 9244 7538 gene locus_tag LOCUS_11130 9244 7538 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_11130 10322 9426 gene locus_tag LOCUS_11140 10322 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 10780 10319 gene locus_tag LOCUS_11150 gene rimI 10780 10319 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095025.1 protein_id gnl|my_center|LOCUS_11150 11460 10777 gene locus_tag LOCUS_11160 gene tsaB 11460 10777 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816515.1 protein_id gnl|my_center|LOCUS_11160 11906 11499 gene locus_tag LOCUS_11170 gene arfB 11906 11499 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_11170 12124 12507 gene locus_tag LOCUS_11180 12124 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 14661 12532 gene locus_tag LOCUS_11190 gene uvrD 14661 12532 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980762.1 protein_id gnl|my_center|LOCUS_11190 15383 15072 gene locus_tag LOCUS_11200 15383 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 17179 15530 gene locus_tag LOCUS_11210 gene groL 17179 15530 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214867.1 protein_id gnl|my_center|LOCUS_11210 17494 17204 gene locus_tag LOCUS_11220 gene groES 17494 17204 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_11220 19036 17972 gene locus_tag LOCUS_11230 gene fba 19036 17972 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_11230 20504 19068 gene locus_tag LOCUS_11240 gene pyk 20504 19068 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_11240 21795 20587 gene locus_tag LOCUS_11250 21795 20587 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_11250 22900 21902 gene locus_tag LOCUS_11260 gene gap 22900 21902 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_11260 25081 23093 gene locus_tag LOCUS_11270 gene tkt 25081 23093 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 protein_id gnl|my_center|LOCUS_11270 25831 25277 gene locus_tag LOCUS_11280 25831 25277 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_11280 25896 26627 gene locus_tag LOCUS_11290 25896 26627 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_11290 27709 26699 gene locus_tag LOCUS_11300 27709 26699 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534868.1 protein_id gnl|my_center|LOCUS_11300 29079 27709 gene locus_tag LOCUS_11310 gene cysS 29079 27709 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225718.1 protein_id gnl|my_center|LOCUS_11310 29182 30279 gene locus_tag LOCUS_11320 29182 30279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 30290 31540 gene locus_tag LOCUS_11330 30290 31540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 31524 32216 gene locus_tag LOCUS_11340 31524 32216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 32218 32709 gene locus_tag LOCUS_11350 32218 32709 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_11350 32733 33437 gene locus_tag LOCUS_11360 gene lpxH 32733 33437 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212239.1 protein_id gnl|my_center|LOCUS_11360 34179 33427 gene locus_tag LOCUS_11370 34179 33427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 35133 34276 gene locus_tag LOCUS_11380 35133 34276 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142527.1 protein_id gnl|my_center|LOCUS_11380 35764 35198 gene locus_tag LOCUS_11390 35764 35198 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_11390 36385 35804 gene locus_tag LOCUS_11400 36385 35804 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_11400 36948 36388 gene locus_tag LOCUS_11410 36948 36388 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_11410 37044 37952 gene locus_tag LOCUS_11420 37044 37952 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_11420 39163 38054 gene locus_tag LOCUS_11430 gene dnaJ 39163 38054 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_11430 41177 39255 gene locus_tag LOCUS_11440 gene dnaK 41177 39255 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194034.1 protein_id gnl|my_center|LOCUS_11440 41880 41347 gene locus_tag LOCUS_11450 gene grpE 41880 41347 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_11450 41879 42064 gene locus_tag LOCUS_11460 41879 42064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 42089 44602 gene locus_tag LOCUS_11470 42089 44602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 44613 45539 gene locus_tag LOCUS_11480 44613 45539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 45812 45447 gene locus_tag LOCUS_11490 45812 45447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 45843 47138 gene locus_tag LOCUS_11500 45843 47138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 48418 47405 gene locus_tag LOCUS_11510 48418 47405 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_11510 52032 48421 gene locus_tag LOCUS_11520 gene nifJ 52032 48421 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_11520 53291 52338 gene locus_tag LOCUS_11530 53291 52338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 54067 53453 gene locus_tag LOCUS_11540 gene cheZ 54067 53453 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096065.1 protein_id gnl|my_center|LOCUS_11540 55503 54076 gene locus_tag LOCUS_11550 55503 54076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 56390 55500 gene locus_tag LOCUS_11560 gene prmA 56390 55500 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931932.1 protein_id gnl|my_center|LOCUS_11560 57739 56390 gene locus_tag LOCUS_11570 gene accC 57739 56390 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_11570 58209 57754 gene locus_tag LOCUS_11580 gene accB 58209 57754 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210070.1 protein_id gnl|my_center|LOCUS_11580 58676 58224 gene locus_tag LOCUS_11590 gene aroQ 58676 58224 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_11590 59325 58786 gene locus_tag LOCUS_11600 59325 58786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 61127 59301 gene locus_tag LOCUS_11610 gene dsbD 61127 59301 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_11610 61444 61127 gene locus_tag LOCUS_11620 61444 61127 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806936.1 protein_id gnl|my_center|LOCUS_11620 61462 61839 gene locus_tag LOCUS_11630 61462 61839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 61911 62927 gene locus_tag LOCUS_11640 61911 62927 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_11640 63236 66511 gene locus_tag LOCUS_11650 63236 66511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 66603 67322 gene locus_tag LOCUS_11660 66603 67322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_11660 67890 70340 gene locus_tag LOCUS_11670 67890 70340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443220.1 protein_id gnl|my_center|LOCUS_11670 70610 70242 gene locus_tag LOCUS_11680 70610 70242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 70727 72079 gene locus_tag LOCUS_11690 70727 72079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence014 105 473 gene locus_tag LOCUS_11700 105 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 519 902 gene locus_tag LOCUS_11710 519 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 992 2833 gene locus_tag LOCUS_11720 992 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3387 3312 gene locus_tag LOCUS_t00080 3387 3312 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3656 5107 gene locus_tag LOCUS_11730 3656 5107 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_11730 5755 5138 gene locus_tag LOCUS_11740 gene cobO 5755 5138 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_11740 6314 5748 gene locus_tag LOCUS_11750 6314 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 protein_id gnl|my_center|LOCUS_11750 8348 6384 gene locus_tag LOCUS_11760 8348 6384 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087534.1 protein_id gnl|my_center|LOCUS_11760 8757 8987 gene locus_tag LOCUS_11770 8757 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8984 9289 gene locus_tag LOCUS_11780 8984 9289 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814611.1 protein_id gnl|my_center|LOCUS_11780 9750 10226 gene locus_tag LOCUS_11790 9750 10226 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_11790 11378 10227 gene locus_tag LOCUS_11800 11378 10227 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_11800 11753 11385 gene locus_tag LOCUS_11810 11753 11385 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766041.1 protein_id gnl|my_center|LOCUS_11810 12690 11935 gene locus_tag LOCUS_11820 12690 11935 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215821.1 protein_id gnl|my_center|LOCUS_11820 14338 12827 gene locus_tag LOCUS_11830 gene ilvA 14338 12827 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_11830 14404 15066 gene locus_tag LOCUS_11840 gene rpiA 14404 15066 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247432.1 protein_id gnl|my_center|LOCUS_11840 15111 15833 gene locus_tag LOCUS_11850 gene phoU 15111 15833 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853444.1 protein_id gnl|my_center|LOCUS_11850 15995 17479 gene locus_tag LOCUS_11860 gene ppx 15995 17479 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_11860 19544 17460 gene locus_tag LOCUS_11870 gene ppk1 19544 17460 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225804.1 protein_id gnl|my_center|LOCUS_11870 19911 19639 gene locus_tag LOCUS_11880 19911 19639 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_11880 20173 22140 gene locus_tag LOCUS_11890 20173 22140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 22167 22664 gene locus_tag LOCUS_11900 22167 22664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 22939 24351 gene locus_tag LOCUS_11910 22939 24351 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403196.1 protein_id gnl|my_center|LOCUS_11910 24933 24427 gene locus_tag LOCUS_11920 24933 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 26989 24947 gene locus_tag LOCUS_11930 26989 24947 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035825.1 protein_id gnl|my_center|LOCUS_11930 27703 27272 gene locus_tag LOCUS_11940 27703 27272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 28008 27688 gene locus_tag LOCUS_11950 28008 27688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 28470 28141 gene locus_tag LOCUS_11960 28470 28141 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_11960 30200 28488 gene locus_tag LOCUS_11970 gene ptsP 30200 28488 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_11970 30553 30281 gene locus_tag LOCUS_11980 30553 30281 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_11980 30953 30543 gene locus_tag LOCUS_11990 30953 30543 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 protein_id gnl|my_center|LOCUS_11990 31850 30993 gene locus_tag LOCUS_12000 gene rapZ 31850 30993 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530937.1 protein_id gnl|my_center|LOCUS_12000 32796 31834 gene locus_tag LOCUS_12010 gene hprK 32796 31834 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225452.1 protein_id gnl|my_center|LOCUS_12010 33285 32959 gene locus_tag LOCUS_12020 gene raiA 33285 32959 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377554.1 protein_id gnl|my_center|LOCUS_12020 34736 33306 gene locus_tag LOCUS_12030 34736 33306 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_12030 35458 34736 gene locus_tag LOCUS_12040 gene lptB 35458 34736 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_12040 36028 35468 gene locus_tag LOCUS_12050 36028 35468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 36798 36025 gene locus_tag LOCUS_12060 36798 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 37336 36809 gene locus_tag LOCUS_12070 37336 36809 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 protein_id gnl|my_center|LOCUS_12070 38307 37333 gene locus_tag LOCUS_12080 38307 37333 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_12080 38476 40449 gene locus_tag LOCUS_12090 38476 40449 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_12090 40449 41495 gene locus_tag LOCUS_12100 gene thiO 40449 41495 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_12100 43954 41576 gene locus_tag LOCUS_12110 43954 41576 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_12110 44890 44009 gene locus_tag LOCUS_12120 44890 44009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 45272 44976 gene locus_tag LOCUS_12130 45272 44976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 45602 45282 gene locus_tag LOCUS_12140 45602 45282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 45803 46756 gene locus_tag LOCUS_12150 45803 46756 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210140.1 protein_id gnl|my_center|LOCUS_12150 49187 46977 gene locus_tag LOCUS_12160 49187 46977 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213681071.1 protein_id gnl|my_center|LOCUS_12160 49678 49451 gene locus_tag LOCUS_12170 49678 49451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 50967 49846 gene locus_tag LOCUS_12180 50967 49846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 52156 50957 gene locus_tag LOCUS_12190 52156 50957 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_12190 55999 52157 gene locus_tag LOCUS_12200 55999 52157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 58653 56173 gene locus_tag LOCUS_12210 58653 56173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 59396 58782 gene locus_tag LOCUS_12220 59396 58782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 59599 59453 gene locus_tag LOCUS_12230 59599 59453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 64477 59705 gene locus_tag LOCUS_12240 64477 59705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 68701 64715 gene locus_tag LOCUS_12250 68701 64715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 70030 68786 gene locus_tag LOCUS_12260 70030 68786 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202285.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence015 785 363 gene locus_tag LOCUS_12270 785 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1042 958 gene locus_tag LOCUS_t00090 1042 958 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1423 1085 gene locus_tag LOCUS_12280 gene secG 1423 1085 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_12280 2209 1430 gene locus_tag LOCUS_12290 gene tpiA 2209 1430 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_12290 4004 2316 gene locus_tag LOCUS_12300 gene recJ 4004 2316 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_12300 5146 4121 gene locus_tag LOCUS_12310 5146 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193226.1 protein_id gnl|my_center|LOCUS_12310 5206 5658 gene locus_tag LOCUS_12320 gene sixA 5206 5658 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197673.1 protein_id gnl|my_center|LOCUS_12320 5664 6284 gene locus_tag LOCUS_12330 5664 6284 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_12330 6301 7821 gene locus_tag LOCUS_12340 6301 7821 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_12340 9302 7872 gene locus_tag LOCUS_12350 9302 7872 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_12350 10743 9295 gene locus_tag LOCUS_12360 10743 9295 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706228.1 protein_id gnl|my_center|LOCUS_12360 10930 12108 gene locus_tag LOCUS_12370 10930 12108 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965610.1 protein_id gnl|my_center|LOCUS_12370 12176 12958 gene locus_tag LOCUS_12380 12176 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 13123 15789 gene locus_tag LOCUS_12390 gene aceE 13123 15789 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_12390 15881 17212 gene locus_tag LOCUS_12400 gene aceF 15881 17212 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_12400 17300 19087 gene locus_tag LOCUS_12410 gene lpdA 17300 19087 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_12410 19307 20746 gene locus_tag LOCUS_12420 19307 20746 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_12420 21123 21683 gene locus_tag LOCUS_12430 gene msrA 21123 21683 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_12430 22743 21667 gene locus_tag LOCUS_12440 gene corA 22743 21667 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_12440 22934 22740 gene locus_tag LOCUS_12450 22934 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 24140 22938 gene locus_tag LOCUS_12460 24140 22938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_12460 25350 24142 gene locus_tag LOCUS_12470 25350 24142 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_12470 26047 25361 gene locus_tag LOCUS_12480 26047 25361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141998.1 protein_id gnl|my_center|LOCUS_12480 27200 26052 gene locus_tag LOCUS_12490 27200 26052 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_12490 27963 27256 gene locus_tag LOCUS_12500 27963 27256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 28087 29013 gene locus_tag LOCUS_12510 28087 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 30821 29043 gene locus_tag LOCUS_12520 30821 29043 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820957.1 protein_id gnl|my_center|LOCUS_12520 31049 32026 gene locus_tag LOCUS_12530 gene birA 31049 32026 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707707.1 protein_id gnl|my_center|LOCUS_12530 32023 32760 gene locus_tag LOCUS_12540 32023 32760 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196311.1 protein_id gnl|my_center|LOCUS_12540 32764 33420 gene locus_tag LOCUS_12550 32764 33420 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115071.1 protein_id gnl|my_center|LOCUS_12550 33647 33958 gene locus_tag LOCUS_12560 33647 33958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 33974 34429 gene locus_tag LOCUS_12570 gene flgN 33974 34429 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197547.1 protein_id gnl|my_center|LOCUS_12570 34971 34426 gene locus_tag LOCUS_12580 34971 34426 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694420.1 protein_id gnl|my_center|LOCUS_12580 36891 34990 gene locus_tag LOCUS_12590 36891 34990 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185930.1 protein_id gnl|my_center|LOCUS_12590 37350 36964 gene locus_tag LOCUS_12600 37350 36964 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_12600 37593 37351 gene locus_tag LOCUS_12610 37593 37351 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_12610 38615 37635 gene locus_tag LOCUS_12620 38615 37635 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_12620 40810 38699 gene locus_tag LOCUS_12630 40810 38699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 42008 40824 gene locus_tag LOCUS_12640 42008 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 42720 42016 gene locus_tag LOCUS_12650 42720 42016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 44012 42717 gene locus_tag LOCUS_12660 44012 42717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 44956 44012 gene locus_tag LOCUS_12670 44956 44012 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_12670 45981 44956 gene locus_tag LOCUS_12680 45981 44956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 46377 45991 gene locus_tag LOCUS_12690 46377 45991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 46906 46571 gene locus_tag LOCUS_12700 46906 46571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 48087 47413 gene locus_tag LOCUS_12710 48087 47413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 49366 48080 gene locus_tag LOCUS_12720 49366 48080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 50800 49661 gene locus_tag LOCUS_12730 50800 49661 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_12730 51270 50836 gene locus_tag LOCUS_12740 51270 50836 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_12740 51518 51270 gene locus_tag LOCUS_12750 51518 51270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 52880 51699 gene locus_tag LOCUS_12760 gene gmd 52880 51699 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863514.1 protein_id gnl|my_center|LOCUS_12760 53673 52945 gene locus_tag LOCUS_12770 53673 52945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 54692 53691 gene locus_tag LOCUS_12780 54692 53691 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_12780 55140 54859 gene locus_tag LOCUS_12790 55140 54859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12790 56732 55425 gene locus_tag LOCUS_12800 gene phoR 56732 55425 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_12800 57490 56804 gene locus_tag LOCUS_12810 gene phoB 57490 56804 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_12810 58301 57546 gene locus_tag LOCUS_12820 gene tcdA 58301 57546 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190050.1 protein_id gnl|my_center|LOCUS_12820 58675 58298 gene locus_tag LOCUS_12830 gene acpS 58675 58298 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_12830 59437 58694 gene locus_tag LOCUS_12840 gene pdxJ 59437 58694 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550143.1 protein_id gnl|my_center|LOCUS_12840 60159 59434 gene locus_tag LOCUS_12850 gene recO 60159 59434 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524618.1 protein_id gnl|my_center|LOCUS_12850 61078 60173 gene locus_tag LOCUS_12860 gene era 61078 60173 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_12860 61746 61075 gene locus_tag LOCUS_12870 gene rnc 61746 61075 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853248.1 protein_id gnl|my_center|LOCUS_12870 62142 61756 gene locus_tag LOCUS_12880 62142 61756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 62898 62152 gene locus_tag LOCUS_12890 gene lepB 62898 62152 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444404.1 protein_id gnl|my_center|LOCUS_12890 64816 63023 gene locus_tag LOCUS_12900 gene lepA 64816 63023 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_12900 65048 66277 gene locus_tag LOCUS_12910 65048 66277 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772645.1 protein_id gnl|my_center|LOCUS_12910 66310 66861 gene locus_tag LOCUS_12920 66310 66861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 66917 67135 gene locus_tag LOCUS_12930 66917 67135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 67132 67689 gene locus_tag LOCUS_12940 67132 67689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 67679 69280 gene locus_tag LOCUS_12950 67679 69280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 69560 69991 gene locus_tag LOCUS_12960 69560 69991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence016 1539 628 gene locus_tag LOCUS_12970 1539 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4322 1725 gene locus_tag LOCUS_12980 4322 1725 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372678.1 protein_id gnl|my_center|LOCUS_12980 5023 4796 gene locus_tag LOCUS_12990 5023 4796 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_12990 5128 6288 gene locus_tag LOCUS_13000 5128 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 8405 6990 gene locus_tag LOCUS_13010 8405 6990 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192020.1 protein_id gnl|my_center|LOCUS_13010 8879 8406 gene locus_tag LOCUS_13020 8879 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 9865 8900 gene locus_tag LOCUS_13030 9865 8900 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524615.1 protein_id gnl|my_center|LOCUS_13030 10341 9865 gene locus_tag LOCUS_13040 10341 9865 CDS product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 protein_id gnl|my_center|LOCUS_13040 10940 10341 gene locus_tag LOCUS_13050 gene rpoE 10940 10341 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_13050 11059 12690 gene locus_tag LOCUS_13060 gene nadB 11059 12690 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_13060 12687 13076 gene locus_tag LOCUS_13070 12687 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 13410 13084 gene locus_tag LOCUS_13080 13410 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 13727 15922 gene locus_tag LOCUS_13090 gene pvuA 13727 15922 CDS product TonB-dependent siderophore vibrioferrin receptor PvuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460644.1 protein_id gnl|my_center|LOCUS_13090 15996 16664 gene locus_tag LOCUS_13100 15996 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 16666 17064 gene locus_tag LOCUS_13110 16666 17064 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_13110 17078 17761 gene locus_tag LOCUS_13120 17078 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 17779 19209 gene locus_tag LOCUS_13130 17779 19209 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205594.1 protein_id gnl|my_center|LOCUS_13130 19213 19983 gene locus_tag LOCUS_13140 19213 19983 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706486.1 protein_id gnl|my_center|LOCUS_13140 20313 20765 gene locus_tag LOCUS_13150 20313 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 20762 22315 gene locus_tag LOCUS_13160 20762 22315 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064348.1 protein_id gnl|my_center|LOCUS_13160 22327 25194 gene locus_tag LOCUS_13170 gene fdhF 22327 25194 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809310.1 protein_id gnl|my_center|LOCUS_13170 25310 25519 gene locus_tag LOCUS_13180 25310 25519 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965706.1 protein_id gnl|my_center|LOCUS_13180 25572 25760 gene locus_tag LOCUS_13190 25572 25760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 25750 26187 gene locus_tag LOCUS_13200 25750 26187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 26795 27910 gene locus_tag LOCUS_13210 26795 27910 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115336.1 protein_id gnl|my_center|LOCUS_13210 28231 27959 gene locus_tag LOCUS_13220 28231 27959 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_13220 28644 29324 gene locus_tag LOCUS_13230 28644 29324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 29402 30322 gene locus_tag LOCUS_13240 29402 30322 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206608.1 protein_id gnl|my_center|LOCUS_13240 30326 30754 gene locus_tag LOCUS_13250 30326 30754 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_13250 30786 31214 gene locus_tag LOCUS_13260 30786 31214 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206607.1 protein_id gnl|my_center|LOCUS_13260 31243 32133 gene locus_tag LOCUS_13270 gene yghX 31243 32133 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 protein_id gnl|my_center|LOCUS_13270 32522 33004 gene locus_tag LOCUS_13280 32522 33004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 33039 33467 gene locus_tag LOCUS_13290 33039 33467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 33513 34319 gene locus_tag LOCUS_13300 33513 34319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 34388 35377 gene locus_tag LOCUS_13310 34388 35377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 35849 36349 gene locus_tag LOCUS_13320 35849 36349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141315.1 protein_id gnl|my_center|LOCUS_13320 36395 36871 gene locus_tag LOCUS_13330 36395 36871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 36903 37466 gene locus_tag LOCUS_13340 36903 37466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 37837 40752 gene locus_tag LOCUS_13350 37837 40752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 40869 41390 gene locus_tag LOCUS_13360 40869 41390 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705368.1 protein_id gnl|my_center|LOCUS_13360 41510 41271 gene locus_tag LOCUS_13370 41510 41271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 41682 42404 gene locus_tag LOCUS_13380 41682 42404 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_13380 42452 42916 gene locus_tag LOCUS_13390 42452 42916 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263284.1 protein_id gnl|my_center|LOCUS_13390 43314 44804 gene locus_tag LOCUS_13400 43314 44804 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_13400 44814 47909 gene locus_tag LOCUS_13410 gene muxB 44814 47909 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_13410 47906 50998 gene locus_tag LOCUS_13420 gene mdtC 47906 50998 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 protein_id gnl|my_center|LOCUS_13420 51013 52455 gene locus_tag LOCUS_13430 51013 52455 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 protein_id gnl|my_center|LOCUS_13430 52614 53600 gene locus_tag LOCUS_13440 52614 53600 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087175.1 protein_id gnl|my_center|LOCUS_13440 54080 53652 gene locus_tag LOCUS_13450 54080 53652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689388.1 protein_id gnl|my_center|LOCUS_13450 55021 54077 gene locus_tag LOCUS_13460 55021 54077 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_13460 55875 55018 gene locus_tag LOCUS_13470 55875 55018 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_13470 56996 55875 gene locus_tag LOCUS_13480 gene argJ 56996 55875 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_13480 56904 57128 gene locus_tag LOCUS_13490 56904 57128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 57227 59566 gene locus_tag LOCUS_13500 57227 59566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 60050 59652 gene locus_tag LOCUS_13510 60050 59652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 60449 60273 gene locus_tag LOCUS_13520 60449 60273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 61626 62255 gene locus_tag LOCUS_13530 gene dhaL 61626 62255 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000397.1 protein_id gnl|my_center|LOCUS_13530 62272 63261 gene locus_tag LOCUS_13540 gene dhaK 62272 63261 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528089.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence017 623 880 gene locus_tag LOCUS_13550 623 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2674 920 gene locus_tag LOCUS_13560 2674 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2839 2763 gene locus_tag LOCUS_t00100 2839 2763 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2924 3790 gene locus_tag LOCUS_13570 gene folD 2924 3790 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367875.1 protein_id gnl|my_center|LOCUS_13570 4537 3782 gene locus_tag LOCUS_13580 4537 3782 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_13580 4641 5060 gene locus_tag LOCUS_13590 gene dksA 4641 5060 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_13590 7260 5131 gene locus_tag LOCUS_13600 gene pnp 7260 5131 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_13600 7688 7419 gene locus_tag LOCUS_13610 gene rpsO 7688 7419 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 protein_id gnl|my_center|LOCUS_13610 8811 7810 gene locus_tag LOCUS_13620 8811 7810 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_13620 8829 9398 gene locus_tag LOCUS_13630 gene ampD 8829 9398 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_13630 10031 9486 gene locus_tag LOCUS_13640 10031 9486 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 protein_id gnl|my_center|LOCUS_13640 11250 10018 gene locus_tag LOCUS_13650 11250 10018 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207754.1 protein_id gnl|my_center|LOCUS_13650 12865 11270 gene locus_tag LOCUS_13660 12865 11270 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_13660 13581 12973 gene locus_tag LOCUS_13670 13581 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 13604 14023 gene locus_tag LOCUS_13680 13604 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 14710 14027 gene locus_tag LOCUS_13690 14710 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 15801 14740 gene locus_tag LOCUS_13700 gene purM 15801 14740 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_13700 16078 16704 gene locus_tag LOCUS_13710 gene hda 16078 16704 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 protein_id gnl|my_center|LOCUS_13710 16726 17010 gene locus_tag LOCUS_13720 16726 17010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 17450 18259 gene locus_tag LOCUS_13730 17450 18259 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_13730 18971 18495 gene locus_tag LOCUS_13740 gene moaC 18971 18495 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_13740 19012 20436 gene locus_tag LOCUS_13750 19012 20436 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_13750 20446 20889 gene locus_tag LOCUS_13760 gene soxY 20446 20889 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119460.1 protein_id gnl|my_center|LOCUS_13760 20889 21206 gene locus_tag LOCUS_13770 gene soxZ 20889 21206 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932697.1 protein_id gnl|my_center|LOCUS_13770 22571 21225 gene locus_tag LOCUS_13780 22571 21225 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193177.1 protein_id gnl|my_center|LOCUS_13780 24038 22689 gene locus_tag LOCUS_13790 24038 22689 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_13790 25626 24031 gene locus_tag LOCUS_13800 25626 24031 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_13800 25841 25623 gene locus_tag LOCUS_13810 25841 25623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 25962 26522 gene locus_tag LOCUS_13820 25962 26522 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_13820 26522 26917 gene locus_tag LOCUS_13830 26522 26917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 26890 27330 gene locus_tag LOCUS_13840 26890 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 27320 27733 gene locus_tag LOCUS_13850 27320 27733 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035894.1 protein_id gnl|my_center|LOCUS_13850 28873 27803 gene locus_tag LOCUS_13860 gene lptG 28873 27803 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_13860 29937 28870 gene locus_tag LOCUS_13870 gene lptF 29937 28870 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_13870 30020 31510 gene locus_tag LOCUS_13880 gene pepA 30020 31510 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_13880 31519 31941 gene locus_tag LOCUS_13890 31519 31941 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 protein_id gnl|my_center|LOCUS_13890 31944 32441 gene locus_tag LOCUS_13900 31944 32441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 32940 32428 gene locus_tag LOCUS_13910 gene tpx 32940 32428 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210984.1 protein_id gnl|my_center|LOCUS_13910 33391 33011 gene locus_tag LOCUS_13920 gene gcvH 33391 33011 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266273.1 protein_id gnl|my_center|LOCUS_13920 33553 34566 gene locus_tag LOCUS_13930 33553 34566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 37185 34630 gene locus_tag LOCUS_13940 37185 34630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 38166 37264 gene locus_tag LOCUS_13950 gene ttcA 38166 37264 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 protein_id gnl|my_center|LOCUS_13950 38984 38232 gene locus_tag LOCUS_13960 38984 38232 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_13960 39044 40195 gene locus_tag LOCUS_13970 39044 40195 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064710.1 protein_id gnl|my_center|LOCUS_13970 40223 40894 gene locus_tag LOCUS_13980 gene trmB 40223 40894 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527577.1 protein_id gnl|my_center|LOCUS_13980 41671 41036 gene locus_tag LOCUS_13990 gene yihA 41671 41036 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248759.1 protein_id gnl|my_center|LOCUS_13990 41791 42393 gene locus_tag LOCUS_14000 41791 42393 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_14000 42648 43277 gene locus_tag LOCUS_14010 42648 43277 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_14010 43375 44181 gene locus_tag LOCUS_14020 43375 44181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_14020 44174 44962 gene locus_tag LOCUS_14030 gene mlaE 44174 44962 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931637.1 protein_id gnl|my_center|LOCUS_14030 44971 45447 gene locus_tag LOCUS_14040 gene mlaD 44971 45447 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_14040 45450 46076 gene locus_tag LOCUS_14050 45450 46076 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_14050 46076 46375 gene locus_tag LOCUS_14060 46076 46375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 46409 47308 gene locus_tag LOCUS_14070 46409 47308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_14070 47305 48060 gene locus_tag LOCUS_14080 47305 48060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_14080 48065 48310 gene locus_tag LOCUS_14090 48065 48310 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_14090 48322 48630 gene locus_tag LOCUS_14100 gene grxD 48322 48630 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687762.1 protein_id gnl|my_center|LOCUS_14100 48644 49894 gene locus_tag LOCUS_14110 gene murA 48644 49894 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_14110 50034 50669 gene locus_tag LOCUS_14120 gene hisG 50034 50669 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261539.1 protein_id gnl|my_center|LOCUS_14120 50678 51985 gene locus_tag LOCUS_14130 gene hisD 50678 51985 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931641.1 protein_id gnl|my_center|LOCUS_14130 51988 53058 gene locus_tag LOCUS_14140 gene hisC 51988 53058 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766530.1 protein_id gnl|my_center|LOCUS_14140 53360 53539 gene locus_tag LOCUS_14150 53360 53539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 53685 55373 gene locus_tag LOCUS_14160 53685 55373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 55412 56419 gene locus_tag LOCUS_14170 55412 56419 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_14170 56455 56817 gene locus_tag LOCUS_14180 56455 56817 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948127.1 protein_id gnl|my_center|LOCUS_14180 56828 57043 gene locus_tag LOCUS_14190 56828 57043 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191306.1 protein_id gnl|my_center|LOCUS_14190 57066 57281 gene locus_tag LOCUS_14200 57066 57281 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555770.1 protein_id gnl|my_center|LOCUS_14200 57289 57537 gene locus_tag LOCUS_14210 57289 57537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 57539 57811 gene locus_tag LOCUS_14220 gene tusA 57539 57811 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_14220 57973 58947 gene locus_tag LOCUS_14230 gene cysK 57973 58947 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706833.1 protein_id gnl|my_center|LOCUS_14230 58944 59846 gene locus_tag LOCUS_14240 58944 59846 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_14240 60138 61058 gene locus_tag LOCUS_14250 60138 61058 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_14250 61045 62520 gene locus_tag LOCUS_14260 61045 62520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 62713 62507 gene locus_tag LOCUS_14270 62713 62507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence018 <1 565 gene locus_tag LOCUS_14280 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001105137.1:chemotaxis protein CheB 562 2646 gene locus_tag LOCUS_14290 562 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3142 2684 gene locus_tag LOCUS_14300 3142 2684 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_14300 3429 3139 gene locus_tag LOCUS_14310 3429 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3875 3552 gene locus_tag LOCUS_14320 3875 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 5119 3878 gene locus_tag LOCUS_14330 5119 3878 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_14330 5336 5887 gene locus_tag LOCUS_14340 gene orn 5336 5887 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535917.1 protein_id gnl|my_center|LOCUS_14340 7484 6006 gene locus_tag LOCUS_14350 gene glgA 7484 6006 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369346.1 protein_id gnl|my_center|LOCUS_14350 7660 9147 gene locus_tag LOCUS_14360 gene zwf 7660 9147 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_14360 9165 9548 gene locus_tag LOCUS_14370 gene crcB 9165 9548 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818609.1 protein_id gnl|my_center|LOCUS_14370 9553 9870 gene locus_tag LOCUS_14380 9553 9870 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 protein_id gnl|my_center|LOCUS_14380 10717 9932 gene locus_tag LOCUS_14390 10717 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 10893 11276 gene locus_tag LOCUS_14400 gene rpsF 10893 11276 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688967.1 protein_id gnl|my_center|LOCUS_14400 11277 11576 gene locus_tag LOCUS_14410 gene priB 11277 11576 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192181.1 protein_id gnl|my_center|LOCUS_14410 11580 11807 gene locus_tag LOCUS_14420 gene rpsR 11580 11807 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213306.1 protein_id gnl|my_center|LOCUS_14420 11820 12269 gene locus_tag LOCUS_14430 gene rplI 11820 12269 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191711.1 protein_id gnl|my_center|LOCUS_14430 12415 13179 gene locus_tag LOCUS_14440 12415 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 13261 14634 gene locus_tag LOCUS_14450 13261 14634 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_14450 14652 15719 gene locus_tag LOCUS_14460 gene alr 14652 15719 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191260.1 protein_id gnl|my_center|LOCUS_14460 15712 17064 gene locus_tag LOCUS_14470 gene radA 15712 17064 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193568.1 protein_id gnl|my_center|LOCUS_14470 17201 18361 gene locus_tag LOCUS_14480 17201 18361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 18467 19384 gene locus_tag LOCUS_14490 18467 19384 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_14490 20043 19468 gene locus_tag LOCUS_14500 20043 19468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 20229 27212 gene locus_tag LOCUS_14510 20229 27212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 27526 27245 gene locus_tag LOCUS_14520 27526 27245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 28466 29551 gene locus_tag LOCUS_14530 gene ribBA 28466 29551 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009921779.1 protein_id gnl|my_center|LOCUS_14530 29707 30267 gene locus_tag LOCUS_14540 29707 30267 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_14540 30260 30700 gene locus_tag LOCUS_14550 gene ruvX 30260 30700 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706124.1 protein_id gnl|my_center|LOCUS_14550 30687 31184 gene locus_tag LOCUS_14560 gene pyrR 30687 31184 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_14560 31352 31134 gene locus_tag LOCUS_14570 31352 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 31311 32270 gene locus_tag LOCUS_14580 31311 32270 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_14580 32267 33559 gene locus_tag LOCUS_14590 32267 33559 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_14590 34004 33774 gene locus_tag LOCUS_14600 34004 33774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 34740 34021 gene locus_tag LOCUS_14610 34740 34021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 35124 35495 gene locus_tag LOCUS_14620 35124 35495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943168.1 protein_id gnl|my_center|LOCUS_14620 36093 35623 gene locus_tag LOCUS_14630 36093 35623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 37356 36220 gene locus_tag LOCUS_14640 37356 36220 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_14640 38426 37380 gene locus_tag LOCUS_14650 38426 37380 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_14650 38485 39180 gene locus_tag LOCUS_14660 38485 39180 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_14660 39254 40063 gene locus_tag LOCUS_14670 gene proC 39254 40063 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_14670 40132 40707 gene locus_tag LOCUS_14680 40132 40707 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_14680 40749 42665 gene locus_tag LOCUS_14690 40749 42665 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_14690 44177 42729 gene locus_tag LOCUS_14700 gene rng 44177 42729 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_14700 44764 44174 gene locus_tag LOCUS_14710 44764 44174 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813200.1 protein_id gnl|my_center|LOCUS_14710 45786 44833 gene locus_tag LOCUS_14720 45786 44833 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_14720 46439 45894 gene locus_tag LOCUS_14730 46439 45894 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_14730 46504 47142 gene locus_tag LOCUS_14740 46504 47142 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_14740 47187 47630 gene locus_tag LOCUS_14750 47187 47630 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_14750 47671 48747 gene locus_tag LOCUS_14760 gene mnmA 47671 48747 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_14760 48864 49391 gene locus_tag LOCUS_14770 48864 49391 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383720.1 protein_id gnl|my_center|LOCUS_14770 50136 49492 gene locus_tag LOCUS_14780 50136 49492 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_14780 50149 51009 gene locus_tag LOCUS_14790 gene nadC 50149 51009 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_14790 51006 52790 gene locus_tag LOCUS_14800 51006 52790 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_14800 53033 54739 gene locus_tag LOCUS_14810 53033 54739 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_14810 54739 55230 gene locus_tag LOCUS_14820 gene ilvN 54739 55230 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_14820 55328 56344 gene locus_tag LOCUS_14830 gene ilvC 55328 56344 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218988.1 protein_id gnl|my_center|LOCUS_14830 56457 57092 gene locus_tag LOCUS_14840 56457 57092 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_14840 57679 57155 gene locus_tag LOCUS_14850 57679 57155 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_14850 57824 58801 gene locus_tag LOCUS_14860 57824 58801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 58838 59359 gene locus_tag LOCUS_14870 58838 59359 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087475.1 protein_id gnl|my_center|LOCUS_14870 59947 59594 gene locus_tag LOCUS_14880 59947 59594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 60523 60972 gene locus_tag LOCUS_14890 60523 60972 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769527.1 protein_id gnl|my_center|LOCUS_14890 61063 62718 gene locus_tag LOCUS_14900 61063 62718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence019 1839 862 gene locus_tag LOCUS_14910 1839 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2785 2291 gene locus_tag LOCUS_14920 2785 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3117 2782 gene locus_tag LOCUS_14930 3117 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3885 3199 gene locus_tag LOCUS_14940 3885 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4885 3875 gene locus_tag LOCUS_14950 4885 3875 CDS product TIGR03790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009545347.1 protein_id gnl|my_center|LOCUS_14950 5622 5380 gene locus_tag LOCUS_14960 5622 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 6922 5705 gene locus_tag LOCUS_14970 6922 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 7493 6954 gene locus_tag LOCUS_14980 7493 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 8010 8789 gene locus_tag LOCUS_14990 8010 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 8803 10215 gene locus_tag LOCUS_15000 8803 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 11026 10589 gene locus_tag LOCUS_15010 11026 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 11799 11209 gene locus_tag LOCUS_15020 11799 11209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 12450 14630 gene locus_tag LOCUS_15030 12450 14630 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463958.1 protein_id gnl|my_center|LOCUS_15030 15649 14693 gene locus_tag LOCUS_15040 15649 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 17504 15885 gene locus_tag LOCUS_15050 17504 15885 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_15050 17733 18539 gene locus_tag LOCUS_15060 17733 18539 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070071255.1 protein_id gnl|my_center|LOCUS_15060 19228 18647 gene locus_tag LOCUS_15070 19228 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 19841 19263 gene locus_tag LOCUS_15080 gene slmA 19841 19263 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_15080 20500 19850 gene locus_tag LOCUS_15090 20500 19850 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815194.1 protein_id gnl|my_center|LOCUS_15090 21521 20637 gene locus_tag LOCUS_15100 gene argB 21521 20637 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_15100 23324 21756 gene locus_tag LOCUS_15110 gene argA 23324 21756 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_15110 24349 23384 gene locus_tag LOCUS_15120 gene rfaC 24349 23384 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094906.1 protein_id gnl|my_center|LOCUS_15120 25586 24369 gene locus_tag LOCUS_15130 25586 24369 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197240.1 protein_id gnl|my_center|LOCUS_15130 27663 25726 gene locus_tag LOCUS_15140 27663 25726 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197235.1 protein_id gnl|my_center|LOCUS_15140 27918 27736 gene locus_tag LOCUS_15150 27918 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 28857 27943 gene locus_tag LOCUS_15160 gene lpxC 28857 27943 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194158.1 protein_id gnl|my_center|LOCUS_15160 30098 28929 gene locus_tag LOCUS_15170 gene ftsZ 30098 28929 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_15170 31417 30179 gene locus_tag LOCUS_15180 gene ftsA 31417 30179 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_15180 32162 31446 gene locus_tag LOCUS_15190 32162 31446 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522020.1 protein_id gnl|my_center|LOCUS_15190 33057 32152 gene locus_tag LOCUS_15200 33057 32152 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194254.1 protein_id gnl|my_center|LOCUS_15200 34004 33126 gene locus_tag LOCUS_15210 gene murB 34004 33126 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_15210 35395 34001 gene locus_tag LOCUS_15220 gene murC 35395 34001 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_15220 36465 35392 gene locus_tag LOCUS_15230 gene murG 36465 35392 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_15230 36710 36465 gene locus_tag LOCUS_15240 36710 36465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 37870 36710 gene locus_tag LOCUS_15250 gene ftsW 37870 36710 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_15250 39228 37870 gene locus_tag LOCUS_15260 gene murD 39228 37870 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_15260 40328 39225 gene locus_tag LOCUS_15270 gene mraY 40328 39225 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247664.1 protein_id gnl|my_center|LOCUS_15270 41679 40318 gene locus_tag LOCUS_15280 41679 40318 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_15280 43109 41676 gene locus_tag LOCUS_15290 43109 41676 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705692.1 protein_id gnl|my_center|LOCUS_15290 44863 43106 gene locus_tag LOCUS_15300 44863 43106 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195138.1 protein_id gnl|my_center|LOCUS_15300 45120 44860 gene locus_tag LOCUS_15310 gene ftsL 45120 44860 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739040.1 protein_id gnl|my_center|LOCUS_15310 46052 45117 gene locus_tag LOCUS_15320 gene rsmH 46052 45117 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697441.1 protein_id gnl|my_center|LOCUS_15320 46495 46049 gene locus_tag LOCUS_15330 gene mraZ 46495 46049 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 protein_id gnl|my_center|LOCUS_15330 48365 47133 gene locus_tag LOCUS_15340 48365 47133 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_15340 49381 48347 gene locus_tag LOCUS_15350 gene pyrC 49381 48347 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_15350 50328 49474 gene locus_tag LOCUS_15360 gene rsmI 50328 49474 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016568902.1 protein_id gnl|my_center|LOCUS_15360 50320 51933 gene locus_tag LOCUS_15370 50320 51933 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_15370 51930 52286 gene locus_tag LOCUS_15380 51930 52286 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 protein_id gnl|my_center|LOCUS_15380 53416 52355 gene locus_tag LOCUS_15390 gene ydiK 53416 52355 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_15390 53745 54515 gene locus_tag LOCUS_15400 53745 54515 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009041028.1 protein_id gnl|my_center|LOCUS_15400 54891 54538 gene locus_tag LOCUS_15410 gene folB 54891 54538 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 protein_id gnl|my_center|LOCUS_15410 54932 55543 gene locus_tag LOCUS_15420 gene plsY 54932 55543 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811015.1 protein_id gnl|my_center|LOCUS_15420 56669 55644 gene locus_tag LOCUS_15430 gene tsaD 56669 55644 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_15430 56763 56975 gene locus_tag LOCUS_15440 gene rpsU 56763 56975 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190342.1 protein_id gnl|my_center|LOCUS_15440 56988 57434 gene locus_tag LOCUS_15450 56988 57434 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173892.1 protein_id gnl|my_center|LOCUS_15450 57518 59284 gene locus_tag LOCUS_15460 gene dnaG 57518 59284 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225052.1 protein_id gnl|my_center|LOCUS_15460 59335 61239 gene locus_tag LOCUS_15470 gene rpoD 59335 61239 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190933.1 protein_id gnl|my_center|LOCUS_15470 61252 61328 gene locus_tag LOCUS_t00110 61252 61328 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 1726 698 gene locus_tag LOCUS_15480 gene queA 1726 698 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930156.1 protein_id gnl|my_center|LOCUS_15480 1806 1890 gene locus_tag LOCUS_t00120 1806 1890 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2149 2832 gene locus_tag LOCUS_15490 2149 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4571 2913 gene locus_tag LOCUS_15500 4571 2913 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010361207.1 protein_id gnl|my_center|LOCUS_15500 4880 4680 gene locus_tag LOCUS_15510 gene rpmE 4880 4680 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946387.1 protein_id gnl|my_center|LOCUS_15510 6218 4959 gene locus_tag LOCUS_15520 gene rho 6218 4959 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_15520 6684 6358 gene locus_tag LOCUS_15530 gene trxA 6684 6358 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_15530 8332 6770 gene locus_tag LOCUS_15540 8332 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 8625 8996 gene locus_tag LOCUS_15550 8625 8996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 9304 9005 gene locus_tag LOCUS_15560 9304 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 9911 9345 gene locus_tag LOCUS_15570 9911 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 10501 9911 gene locus_tag LOCUS_15580 10501 9911 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620308.1 protein_id gnl|my_center|LOCUS_15580 10728 11147 gene locus_tag LOCUS_15590 10728 11147 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_15590 11148 12494 gene locus_tag LOCUS_15600 gene yegQ 11148 12494 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_15600 12925 12491 gene locus_tag LOCUS_15610 12925 12491 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_15610 13013 13927 gene locus_tag LOCUS_15620 13013 13927 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706023.1 protein_id gnl|my_center|LOCUS_15620 14204 14602 gene locus_tag LOCUS_15630 14204 14602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 15635 14778 gene locus_tag LOCUS_15640 15635 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 16874 15879 gene locus_tag LOCUS_15650 16874 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 17047 18786 gene locus_tag LOCUS_15660 17047 18786 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109316.1 protein_id gnl|my_center|LOCUS_15660 19860 18826 gene locus_tag LOCUS_15670 19860 18826 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_15670 20005 20730 gene locus_tag LOCUS_15680 20005 20730 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689207.1 protein_id gnl|my_center|LOCUS_15680 20829 21365 gene locus_tag LOCUS_15690 gene ruvC 20829 21365 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_15690 21362 21949 gene locus_tag LOCUS_15700 gene ruvA 21362 21949 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194029.1 protein_id gnl|my_center|LOCUS_15700 22062 22304 gene locus_tag LOCUS_15710 22062 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 22301 22438 gene locus_tag LOCUS_15720 22301 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 22512 22751 gene locus_tag LOCUS_15730 22512 22751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 22751 23134 gene locus_tag LOCUS_15740 22751 23134 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_15740 23139 24176 gene locus_tag LOCUS_15750 gene ruvB 23139 24176 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_15750 24169 24579 gene locus_tag LOCUS_15760 gene ybgC 24169 24579 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_15760 24579 25253 gene locus_tag LOCUS_15770 gene tolQ 24579 25253 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_15770 25253 25663 gene locus_tag LOCUS_15780 gene tolR 25253 25663 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194863.1 protein_id gnl|my_center|LOCUS_15780 25672 26454 gene locus_tag LOCUS_15790 25672 26454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 26561 27847 gene locus_tag LOCUS_15800 gene tolB 26561 27847 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533572.1 protein_id gnl|my_center|LOCUS_15800 27901 28449 gene locus_tag LOCUS_15810 27901 28449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 28453 29316 gene locus_tag LOCUS_15820 28453 29316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 29320 29955 gene locus_tag LOCUS_15830 gene queE 29320 29955 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_15830 30321 31721 gene locus_tag LOCUS_15840 gene ahcY 30321 31721 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942520.1 protein_id gnl|my_center|LOCUS_15840 31770 32597 gene locus_tag LOCUS_15850 gene metF 31770 32597 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_15850 33075 32617 gene locus_tag LOCUS_15860 33075 32617 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704269.1 protein_id gnl|my_center|LOCUS_15860 34189 33101 gene locus_tag LOCUS_15870 gene dprA 34189 33101 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929874.1 protein_id gnl|my_center|LOCUS_15870 35325 34189 gene locus_tag LOCUS_15880 35325 34189 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_15880 35414 35917 gene locus_tag LOCUS_15890 gene def 35414 35917 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201745.1 protein_id gnl|my_center|LOCUS_15890 36002 36919 gene locus_tag LOCUS_15900 gene fmt 36002 36919 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549892.1 protein_id gnl|my_center|LOCUS_15900 37003 38271 gene locus_tag LOCUS_15910 gene rsmB 37003 38271 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951361.1 protein_id gnl|my_center|LOCUS_15910 38321 38812 gene locus_tag LOCUS_15920 38321 38812 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_15920 38813 40930 gene locus_tag LOCUS_15930 38813 40930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_15930 40927 42192 gene locus_tag LOCUS_15940 40927 42192 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 protein_id gnl|my_center|LOCUS_15940 44087 42219 gene locus_tag LOCUS_15950 44087 42219 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_15950 44542 44177 gene locus_tag LOCUS_15960 44542 44177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 44964 45674 gene locus_tag LOCUS_15970 44964 45674 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947508.1 protein_id gnl|my_center|LOCUS_15970 46052 45744 gene locus_tag LOCUS_15980 46052 45744 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_15980 47008 46052 gene locus_tag LOCUS_15990 47008 46052 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_15990 48375 47005 gene locus_tag LOCUS_16000 gene mpl 48375 47005 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688594.1 protein_id gnl|my_center|LOCUS_16000 49242 48463 gene locus_tag LOCUS_16010 49242 48463 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892495.1 protein_id gnl|my_center|LOCUS_16010 49512 50480 gene locus_tag LOCUS_16020 49512 50480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 54352 50486 gene locus_tag LOCUS_16030 gene metH 54352 50486 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence021 1619 654 gene locus_tag LOCUS_16040 1619 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 3117 1678 gene locus_tag LOCUS_16050 gene ccoG 3117 1678 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244349.1 protein_id gnl|my_center|LOCUS_16050 4732 3332 gene locus_tag LOCUS_16060 4732 3332 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_16060 4954 4745 gene locus_tag LOCUS_16070 4954 4745 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_16070 8152 4973 gene locus_tag LOCUS_16080 8152 4973 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_16080 9155 8163 gene locus_tag LOCUS_16090 9155 8163 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706768.1 protein_id gnl|my_center|LOCUS_16090 9295 9657 gene locus_tag LOCUS_16100 9295 9657 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_16100 9859 12342 gene locus_tag LOCUS_16110 9859 12342 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918008.1 protein_id gnl|my_center|LOCUS_16110 12632 13486 gene locus_tag LOCUS_16120 12632 13486 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 protein_id gnl|my_center|LOCUS_16120 13470 14117 gene locus_tag LOCUS_16130 gene thiE 13470 14117 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040557.1 protein_id gnl|my_center|LOCUS_16130 14114 15388 gene locus_tag LOCUS_16140 gene hemL 14114 15388 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_16140 15553 20148 gene locus_tag LOCUS_16150 15553 20148 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_16150 20148 21575 gene locus_tag LOCUS_16160 20148 21575 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527896.1 protein_id gnl|my_center|LOCUS_16160 21708 22784 gene locus_tag LOCUS_16170 gene hemE 21708 22784 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 protein_id gnl|my_center|LOCUS_16170 22987 23062 gene locus_tag LOCUS_t00130 22987 23062 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23683 23297 gene locus_tag LOCUS_16180 23683 23297 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_16180 23922 23683 gene locus_tag LOCUS_16190 23922 23683 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106997.1 protein_id gnl|my_center|LOCUS_16190 24479 25087 gene locus_tag LOCUS_16200 24479 25087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 25417 25611 gene locus_tag LOCUS_16210 25417 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 25595 25909 gene locus_tag LOCUS_16220 25595 25909 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_16220 27626 26331 gene locus_tag LOCUS_16230 27626 26331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 29895 28186 gene locus_tag LOCUS_16240 29895 28186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 30578 29892 gene locus_tag LOCUS_16250 30578 29892 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812818.1 protein_id gnl|my_center|LOCUS_16250 31416 32606 gene locus_tag LOCUS_16260 31416 32606 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191662.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16260 34090 32660 gene locus_tag LOCUS_16270 34090 32660 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_16270 37235 34083 gene locus_tag LOCUS_16280 37235 34083 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_16280 38496 37249 gene locus_tag LOCUS_16290 38496 37249 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_16290 39919 38735 gene locus_tag LOCUS_16300 39919 38735 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_16300 40953 39916 gene locus_tag LOCUS_16310 40953 39916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16310 41729 40953 gene locus_tag LOCUS_16320 41729 40953 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948434.1 protein_id gnl|my_center|LOCUS_16320 42663 41722 gene locus_tag LOCUS_16330 gene hemC 42663 41722 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217854.1 protein_id gnl|my_center|LOCUS_16330 43602 42868 gene locus_tag LOCUS_16340 43602 42868 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 protein_id gnl|my_center|LOCUS_16340 44670 43645 gene locus_tag LOCUS_16350 44670 43645 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012777536.1 protein_id gnl|my_center|LOCUS_16350 44701 46083 gene locus_tag LOCUS_16360 gene argH 44701 46083 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704829.1 protein_id gnl|my_center|LOCUS_16360 46333 48954 gene locus_tag LOCUS_16370 46333 48954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 49145 51394 gene locus_tag LOCUS_16380 gene glgX 49145 51394 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_16380 52970 51477 gene locus_tag LOCUS_16390 52970 51477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence022 127 708 gene locus_tag LOCUS_16400 127 708 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_16400 826 1866 gene locus_tag LOCUS_16410 826 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_16410 2258 1887 gene locus_tag LOCUS_16420 2258 1887 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_16420 3431 2262 gene locus_tag LOCUS_16430 3431 2262 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224938.1 protein_id gnl|my_center|LOCUS_16430 3823 3428 gene locus_tag LOCUS_16440 3823 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4627 3833 gene locus_tag LOCUS_16450 4627 3833 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225376.1 protein_id gnl|my_center|LOCUS_16450 6473 4635 gene locus_tag LOCUS_16460 6473 4635 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691900.1 protein_id gnl|my_center|LOCUS_16460 6645 6720 gene locus_tag LOCUS_t00140 6645 6720 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6738 6813 gene locus_tag LOCUS_t00150 6738 6813 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7425 7676 gene locus_tag LOCUS_16470 7425 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 9028 7790 gene locus_tag LOCUS_16480 gene fabF 9028 7790 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_16480 9304 9062 gene locus_tag LOCUS_16490 gene acpP 9304 9062 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215574.1 protein_id gnl|my_center|LOCUS_16490 10145 9408 gene locus_tag LOCUS_16500 gene fabG 10145 9408 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_16500 11085 10147 gene locus_tag LOCUS_16510 gene fabD 11085 10147 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225819.1 protein_id gnl|my_center|LOCUS_16510 12068 11115 gene locus_tag LOCUS_16520 12068 11115 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_16520 13102 12068 gene locus_tag LOCUS_16530 gene plsX 13102 12068 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_16530 13338 13159 gene locus_tag LOCUS_16540 gene rpmF 13338 13159 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813827.1 protein_id gnl|my_center|LOCUS_16540 13856 13371 gene locus_tag LOCUS_16550 13856 13371 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951421.1 protein_id gnl|my_center|LOCUS_16550 13910 15328 gene locus_tag LOCUS_16560 13910 15328 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_16560 15357 17192 gene locus_tag LOCUS_16570 gene oadA 15357 17192 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105539.1 protein_id gnl|my_center|LOCUS_16570 17210 17788 gene locus_tag LOCUS_16580 17210 17788 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_16580 17972 18682 gene locus_tag LOCUS_16590 17972 18682 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_16590 18697 19869 gene locus_tag LOCUS_16600 gene patB 18697 19869 CDS product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 protein_id gnl|my_center|LOCUS_16600 20503 19928 gene locus_tag LOCUS_16610 20503 19928 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948185.1 protein_id gnl|my_center|LOCUS_16610 21411 20533 gene locus_tag LOCUS_16620 gene motA 21411 20533 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_16620 22669 21443 gene locus_tag LOCUS_16630 22669 21443 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_16630 23063 22686 gene locus_tag LOCUS_16640 23063 22686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 26274 23053 gene locus_tag LOCUS_16650 26274 23053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 27077 26445 gene locus_tag LOCUS_16660 27077 26445 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839307.1 protein_id gnl|my_center|LOCUS_16660 27785 27081 gene locus_tag LOCUS_16670 27785 27081 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_16670 28995 28033 gene locus_tag LOCUS_16680 gene arsS 28995 28033 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_16680 29637 29002 gene locus_tag LOCUS_16690 29637 29002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 31169 29706 gene locus_tag LOCUS_16700 31169 29706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 31816 31181 gene locus_tag LOCUS_16710 gene msrA 31816 31181 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_16710 32313 31813 gene locus_tag LOCUS_16720 32313 31813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 35721 32593 gene locus_tag LOCUS_16730 35721 32593 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087698.1 protein_id gnl|my_center|LOCUS_16730 37111 35723 gene locus_tag LOCUS_16740 37111 35723 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087697.1 protein_id gnl|my_center|LOCUS_16740 38346 37108 gene locus_tag LOCUS_16750 38346 37108 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_16750 39071 41173 gene locus_tag LOCUS_16760 gene ovoA 39071 41173 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_16760 41594 43975 gene locus_tag LOCUS_16770 41594 43975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 46249 44045 gene locus_tag LOCUS_16780 46249 44045 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_16780 46929 48146 gene locus_tag LOCUS_16790 46929 48146 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598615.1 protein_id gnl|my_center|LOCUS_16790 48665 48844 gene locus_tag LOCUS_16800 48665 48844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 48903 49379 gene locus_tag LOCUS_16810 48903 49379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 49514 49678 gene locus_tag LOCUS_16820 49514 49678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence023 168 614 gene locus_tag LOCUS_16830 168 614 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809189.1 protein_id gnl|my_center|LOCUS_16830 1370 621 gene locus_tag LOCUS_16840 1370 621 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_16840 1721 1512 gene locus_tag LOCUS_16850 1721 1512 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689029.1 protein_id gnl|my_center|LOCUS_16850 3261 1756 gene locus_tag LOCUS_16860 gene lysS 3261 1756 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192783.1 protein_id gnl|my_center|LOCUS_16860 3716 3258 gene locus_tag LOCUS_16870 3716 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3946 3716 gene locus_tag LOCUS_16880 3946 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 5071 4028 gene locus_tag LOCUS_16890 gene prfB 5071 4028 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926448.1 protein_id gnl|my_center|LOCUS_16890 6486 5191 gene locus_tag LOCUS_16900 6486 5191 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_16900 6627 7646 gene locus_tag LOCUS_16910 gene pstS 6627 7646 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_16910 7726 8679 gene locus_tag LOCUS_16920 gene pstC 7726 8679 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809636.1 protein_id gnl|my_center|LOCUS_16920 8676 9530 gene locus_tag LOCUS_16930 gene pstA 8676 9530 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_16930 9590 10351 gene locus_tag LOCUS_16940 gene pstB 9590 10351 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063118.1 protein_id gnl|my_center|LOCUS_16940 10620 10348 gene locus_tag LOCUS_16950 10620 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 10555 12249 gene locus_tag LOCUS_16960 10555 12249 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_16960 12378 14585 gene locus_tag LOCUS_16970 12378 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 15606 14650 gene locus_tag LOCUS_16980 15606 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 20121 15613 gene locus_tag LOCUS_16990 20121 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 20796 20143 gene locus_tag LOCUS_17000 20796 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 21881 20790 gene locus_tag LOCUS_17010 21881 20790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 22349 21891 gene locus_tag LOCUS_17020 22349 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 22978 22349 gene locus_tag LOCUS_17030 22978 22349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 23364 22972 gene locus_tag LOCUS_17040 23364 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 24029 23712 gene locus_tag LOCUS_17050 24029 23712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 24189 25085 gene locus_tag LOCUS_17060 24189 25085 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_17060 25082 25696 gene locus_tag LOCUS_17070 gene coaE 25082 25696 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772796.1 protein_id gnl|my_center|LOCUS_17070 25738 26496 gene locus_tag LOCUS_17080 gene zapD 25738 26496 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_17080 26867 26595 gene locus_tag LOCUS_17090 gene hupB 26867 26595 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_17090 27225 28016 gene locus_tag LOCUS_17100 27225 28016 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_17100 29733 28129 gene locus_tag LOCUS_17110 29733 28129 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_17110 30581 29739 gene locus_tag LOCUS_17120 30581 29739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 31417 30578 gene locus_tag LOCUS_17130 gene prpC 31417 30578 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_17130 32146 31673 gene locus_tag LOCUS_17140 gene nusB 32146 31673 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808599.1 protein_id gnl|my_center|LOCUS_17140 32591 32139 gene locus_tag LOCUS_17150 gene ribH 32591 32139 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186056.1 protein_id gnl|my_center|LOCUS_17150 33174 32602 gene locus_tag LOCUS_17160 33174 32602 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957925.1 protein_id gnl|my_center|LOCUS_17160 33767 33171 gene locus_tag LOCUS_17170 33767 33171 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_17170 33837 34184 gene locus_tag LOCUS_17180 33837 34184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 34177 34416 gene locus_tag LOCUS_17190 34177 34416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 34540 34409 gene locus_tag LOCUS_17200 34540 34409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 35961 34552 gene locus_tag LOCUS_17210 35961 34552 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_17210 37679 36024 gene locus_tag LOCUS_17220 gene recN 37679 36024 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550021.1 protein_id gnl|my_center|LOCUS_17220 38545 37682 gene locus_tag LOCUS_17230 38545 37682 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533590.1 protein_id gnl|my_center|LOCUS_17230 38608 39639 gene locus_tag LOCUS_17240 gene hrcA 38608 39639 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_17240 39727 40818 gene locus_tag LOCUS_17250 gene hemH 39727 40818 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527679.1 protein_id gnl|my_center|LOCUS_17250 41697 40870 gene locus_tag LOCUS_17260 gene motD 41697 40870 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 protein_id gnl|my_center|LOCUS_17260 42464 41712 gene locus_tag LOCUS_17270 42464 41712 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_17270 43159 42461 gene locus_tag LOCUS_17280 43159 42461 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_17280 43977 43168 gene locus_tag LOCUS_17290 gene fleN 43977 43168 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083064.1 protein_id gnl|my_center|LOCUS_17290 45565 43970 gene locus_tag LOCUS_17300 gene flhF 45565 43970 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535477.1 protein_id gnl|my_center|LOCUS_17300 46025 45741 gene locus_tag LOCUS_17310 46025 45741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 46615 46031 gene locus_tag LOCUS_17320 46615 46031 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220007.1 protein_id gnl|my_center|LOCUS_17320 47251 46742 gene locus_tag LOCUS_17330 47251 46742 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_17330 47692 47339 gene locus_tag LOCUS_17340 47692 47339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 48165 47713 gene locus_tag LOCUS_17350 48165 47713 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187137.1 protein_id gnl|my_center|LOCUS_17350 48415 48152 gene locus_tag LOCUS_17360 48415 48152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence024 155 487 gene locus_tag LOCUS_17370 155 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 841 3762 gene locus_tag LOCUS_17380 841 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4680 4507 gene locus_tag LOCUS_17390 4680 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 4732 6465 gene locus_tag LOCUS_17400 4732 6465 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857748.1 protein_id gnl|my_center|LOCUS_17400 6548 6808 gene locus_tag LOCUS_17410 6548 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 9151 7004 gene locus_tag LOCUS_17420 9151 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 9788 9186 gene locus_tag LOCUS_17430 9788 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 10373 9789 gene locus_tag LOCUS_17440 10373 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 11977 12453 gene locus_tag LOCUS_17450 11977 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 12509 13267 gene locus_tag LOCUS_17460 12509 13267 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_17460 13522 14085 gene locus_tag LOCUS_17470 13522 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 14128 14916 gene locus_tag LOCUS_17480 14128 14916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 14985 15302 gene locus_tag LOCUS_17490 14985 15302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 16026 15403 gene locus_tag LOCUS_17500 16026 15403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 16329 16117 gene locus_tag LOCUS_17510 16329 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 18013 16451 gene locus_tag LOCUS_17520 18013 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 19068 18043 gene locus_tag LOCUS_17530 19068 18043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 19440 19168 gene locus_tag LOCUS_17540 19440 19168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 20342 19710 gene locus_tag LOCUS_17550 20342 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 21662 20343 gene locus_tag LOCUS_17560 21662 20343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 22065 21691 gene locus_tag LOCUS_17570 22065 21691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 23337 22774 gene locus_tag LOCUS_17580 23337 22774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 23775 23392 gene locus_tag LOCUS_17590 23775 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 24621 24076 gene locus_tag LOCUS_17600 24621 24076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 24903 24649 gene locus_tag LOCUS_17610 24903 24649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 26119 26664 gene locus_tag LOCUS_17620 26119 26664 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122280.1 protein_id gnl|my_center|LOCUS_17620 28114 26822 gene locus_tag LOCUS_17630 28114 26822 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967584.1 protein_id gnl|my_center|LOCUS_17630 28259 30052 gene locus_tag LOCUS_17640 28259 30052 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668011.1 protein_id gnl|my_center|LOCUS_17640 30205 30678 gene locus_tag LOCUS_17650 30205 30678 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_17650 30675 31925 gene locus_tag LOCUS_17660 30675 31925 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_17660 31922 35041 gene locus_tag LOCUS_17670 gene muxB 31922 35041 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_17670 35038 38127 gene locus_tag LOCUS_17680 gene mdtC 35038 38127 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815800.1 protein_id gnl|my_center|LOCUS_17680 38161 39615 gene locus_tag LOCUS_17690 gene opmB 38161 39615 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_17690 39655 40512 gene locus_tag LOCUS_17700 39655 40512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 41194 40736 gene locus_tag LOCUS_17710 41194 40736 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 protein_id gnl|my_center|LOCUS_17710 43429 42410 gene locus_tag LOCUS_17720 43429 42410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence025 1105 1533 gene locus_tag LOCUS_17730 1105 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1546 3057 gene locus_tag LOCUS_17740 1546 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3061 5700 gene locus_tag LOCUS_17750 3061 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5730 6071 gene locus_tag LOCUS_17760 5730 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 6083 6610 gene locus_tag LOCUS_17770 6083 6610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 6607 6861 gene locus_tag LOCUS_17780 6607 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 6854 7333 gene locus_tag LOCUS_17790 6854 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 7347 7685 gene locus_tag LOCUS_17800 7347 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 7685 8161 gene locus_tag LOCUS_17810 7685 8161 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061070701.1 protein_id gnl|my_center|LOCUS_17810 8158 8682 gene locus_tag LOCUS_17820 8158 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 8685 8894 gene locus_tag LOCUS_17830 8685 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 10101 9058 gene locus_tag LOCUS_17840 10101 9058 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104854.1 protein_id gnl|my_center|LOCUS_17840 10319 10098 gene locus_tag LOCUS_17850 10319 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 10525 10316 gene locus_tag LOCUS_17860 10525 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 10914 10522 gene locus_tag LOCUS_17870 10914 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 12590 10911 gene locus_tag LOCUS_17880 12590 10911 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816510.1 protein_id gnl|my_center|LOCUS_17880 12790 12584 gene locus_tag LOCUS_17890 12790 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 13386 12787 gene locus_tag LOCUS_17900 13386 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268017.1 protein_id gnl|my_center|LOCUS_17900 14084 13383 gene locus_tag LOCUS_17910 14084 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 14275 14087 gene locus_tag LOCUS_17920 14275 14087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 14765 14316 gene locus_tag LOCUS_17930 14765 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 15101 14844 gene locus_tag LOCUS_17940 15101 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 15934 15098 gene locus_tag LOCUS_17950 15934 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 16529 15927 gene locus_tag LOCUS_17960 16529 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 17447 16530 gene locus_tag LOCUS_17970 17447 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 17820 17497 gene locus_tag LOCUS_17980 17820 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 17987 17817 gene locus_tag LOCUS_17990 17987 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 18238 17984 gene locus_tag LOCUS_18000 18238 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 18816 18409 gene locus_tag LOCUS_18010 18816 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 19454 18843 gene locus_tag LOCUS_18020 19454 18843 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055009277.1 protein_id gnl|my_center|LOCUS_18020 19514 19777 gene locus_tag LOCUS_18030 19514 19777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 19904 20116 gene locus_tag LOCUS_18040 19904 20116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 20113 20433 gene locus_tag LOCUS_18050 20113 20433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 20433 20726 gene locus_tag LOCUS_18060 20433 20726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 20723 21556 gene locus_tag LOCUS_18070 20723 21556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 21553 21996 gene locus_tag LOCUS_18080 21553 21996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 22061 22261 gene locus_tag LOCUS_18090 22061 22261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 22258 22602 gene locus_tag LOCUS_18100 22258 22602 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744232.1 protein_id gnl|my_center|LOCUS_18100 22705 23106 gene locus_tag LOCUS_18110 22705 23106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 23045 23215 gene locus_tag LOCUS_18120 23045 23215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 23212 23808 gene locus_tag LOCUS_18130 23212 23808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 23771 24469 gene locus_tag LOCUS_18140 23771 24469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18140 24466 24900 gene locus_tag LOCUS_18150 24466 24900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 24884 26338 gene locus_tag LOCUS_18160 gene terL 24884 26338 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_18160 26384 27790 gene locus_tag LOCUS_18170 26384 27790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 27865 28566 gene locus_tag LOCUS_18180 27865 28566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 28719 29981 gene locus_tag LOCUS_18190 28719 29981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951062.1 protein_id gnl|my_center|LOCUS_18190 30040 31686 gene locus_tag LOCUS_18200 30040 31686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951063.1 protein_id gnl|my_center|LOCUS_18200 31764 31976 gene locus_tag LOCUS_18210 31764 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 31960 32133 gene locus_tag LOCUS_18220 31960 32133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 32137 32697 gene locus_tag LOCUS_18230 32137 32697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 32694 33164 gene locus_tag LOCUS_18240 32694 33164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 33161 33586 gene locus_tag LOCUS_18250 33161 33586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689076.1 protein_id gnl|my_center|LOCUS_18250 33600 34358 gene locus_tag LOCUS_18260 33600 34358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691416.1 protein_id gnl|my_center|LOCUS_18260 34416 34745 gene locus_tag LOCUS_18270 34416 34745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689072.1 protein_id gnl|my_center|LOCUS_18270 34742 34978 gene locus_tag LOCUS_18280 34742 34978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 35026 37497 gene locus_tag LOCUS_18290 35026 37497 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951073.1 protein_id gnl|my_center|LOCUS_18290 37494 38114 gene locus_tag LOCUS_18300 37494 38114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 38117 38974 gene locus_tag LOCUS_18310 38117 38974 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951065.1 protein_id gnl|my_center|LOCUS_18310 38971 39411 gene locus_tag LOCUS_18320 38971 39411 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689064.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence026 <1 1992 gene locus_tag LOCUS_18330 <1 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943516.1:PKD domain-containing protein 2047 4377 gene locus_tag LOCUS_18340 2047 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 4444 6393 gene locus_tag LOCUS_18350 4444 6393 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_18350 6390 6824 gene locus_tag LOCUS_18360 6390 6824 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 protein_id gnl|my_center|LOCUS_18360 6821 7504 gene locus_tag LOCUS_18370 6821 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 7570 7893 gene locus_tag LOCUS_18380 7570 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 8609 7908 gene locus_tag LOCUS_18390 8609 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 9386 8619 gene locus_tag LOCUS_18400 9386 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 10235 9405 gene locus_tag LOCUS_18410 10235 9405 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945656.1 protein_id gnl|my_center|LOCUS_18410 10854 10381 gene locus_tag LOCUS_18420 10854 10381 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_18420 13136 10851 gene locus_tag LOCUS_18430 13136 10851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_18430 13254 15467 gene locus_tag LOCUS_18440 gene cphA 13254 15467 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_18440 15480 18050 gene locus_tag LOCUS_18450 gene cphA 15480 18050 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 protein_id gnl|my_center|LOCUS_18450 18176 18415 gene locus_tag LOCUS_18460 gene hfq 18176 18415 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810707.1 protein_id gnl|my_center|LOCUS_18460 18412 19539 gene locus_tag LOCUS_18470 gene hflX 18412 19539 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_18470 19562 20740 gene locus_tag LOCUS_18480 gene hflK 19562 20740 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_18480 20737 21612 gene locus_tag LOCUS_18490 gene hflC 20737 21612 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063928.1 protein_id gnl|my_center|LOCUS_18490 21609 21794 gene locus_tag LOCUS_18500 21609 21794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 21801 22961 gene locus_tag LOCUS_18510 21801 22961 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192327.1 protein_id gnl|my_center|LOCUS_18510 22976 24289 gene locus_tag LOCUS_18520 22976 24289 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_18520 24292 24843 gene locus_tag LOCUS_18530 24292 24843 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532041.1 protein_id gnl|my_center|LOCUS_18530 24819 26219 gene locus_tag LOCUS_18540 24819 26219 CDS product DUF6513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532040.1 protein_id gnl|my_center|LOCUS_18540 26216 26791 gene locus_tag LOCUS_18550 26216 26791 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532039.1 protein_id gnl|my_center|LOCUS_18550 26788 27492 gene locus_tag LOCUS_18560 26788 27492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 27585 28706 gene locus_tag LOCUS_18570 gene ompA 27585 28706 CDS product porin OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707503.1 protein_id gnl|my_center|LOCUS_18570 28772 30097 gene locus_tag LOCUS_18580 28772 30097 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957634.1 protein_id gnl|my_center|LOCUS_18580 30064 30783 gene locus_tag LOCUS_18590 30064 30783 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_18590 30780 31454 gene locus_tag LOCUS_18600 gene gph 30780 31454 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_18600 31468 32796 gene locus_tag LOCUS_18610 31468 32796 CDS product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895623.1 protein_id gnl|my_center|LOCUS_18610 33010 34905 gene locus_tag LOCUS_18620 33010 34905 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191640.1 protein_id gnl|my_center|LOCUS_18620 36010 34934 gene locus_tag LOCUS_18630 36010 34934 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200023.1 protein_id gnl|my_center|LOCUS_18630 36645 36031 gene locus_tag LOCUS_18640 gene cheD 36645 36031 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_18640 37514 36642 gene locus_tag LOCUS_18650 37514 36642 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832274.1 protein_id gnl|my_center|LOCUS_18650 40422 37702 gene locus_tag LOCUS_18660 40422 37702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 40938 40441 gene locus_tag LOCUS_18670 gene cheW 40938 40441 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811919.1 protein_id gnl|my_center|LOCUS_18670 41066 40941 gene locus_tag LOCUS_18680 41066 40941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence027 467 72 gene locus_tag LOCUS_18690 467 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1438 617 gene locus_tag LOCUS_18700 1438 617 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529072.1 protein_id gnl|my_center|LOCUS_18700 3604 1568 gene locus_tag LOCUS_18710 gene uvrB 3604 1568 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199587.1 protein_id gnl|my_center|LOCUS_18710 7354 3686 gene locus_tag LOCUS_18720 7354 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 7816 7625 gene locus_tag LOCUS_18730 7816 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7852 8547 gene locus_tag LOCUS_18740 7852 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 8552 9241 gene locus_tag LOCUS_18750 8552 9241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 9381 10424 gene locus_tag LOCUS_18760 9381 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 11303 10545 gene locus_tag LOCUS_18770 11303 10545 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197265.1 protein_id gnl|my_center|LOCUS_18770 11622 12053 gene locus_tag LOCUS_18780 11622 12053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 12520 12975 gene locus_tag LOCUS_18790 12520 12975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 13297 15816 gene locus_tag LOCUS_18800 13297 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 16486 18885 gene locus_tag LOCUS_18810 16486 18885 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_18810 19313 18897 gene locus_tag LOCUS_18820 19313 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 19634 19852 gene locus_tag LOCUS_18830 19634 19852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 21765 19846 gene locus_tag LOCUS_18840 21765 19846 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704972.1 protein_id gnl|my_center|LOCUS_18840 22425 21877 gene locus_tag LOCUS_18850 22425 21877 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404609.1 protein_id gnl|my_center|LOCUS_18850 22541 23527 gene locus_tag LOCUS_18860 22541 23527 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_18860 23993 23547 gene locus_tag LOCUS_18870 gene rnhA 23993 23547 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_18870 24708 23983 gene locus_tag LOCUS_18880 24708 23983 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_18880 24709 25458 gene locus_tag LOCUS_18890 gene gloB 24709 25458 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705462.1 protein_id gnl|my_center|LOCUS_18890 25558 27267 gene locus_tag LOCUS_18900 25558 27267 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192263.1 protein_id gnl|my_center|LOCUS_18900 27290 28888 gene locus_tag LOCUS_18910 27290 28888 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_18910 29005 30018 gene locus_tag LOCUS_18920 29005 30018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_18920 30018 30842 gene locus_tag LOCUS_18930 30018 30842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_18930 30989 31774 gene locus_tag LOCUS_18940 gene fabI 30989 31774 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087936.1 protein_id gnl|my_center|LOCUS_18940 33433 31835 gene locus_tag LOCUS_18950 33433 31835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 33653 35335 gene locus_tag LOCUS_18960 33653 35335 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103785.1 protein_id gnl|my_center|LOCUS_18960 35431 35736 gene locus_tag LOCUS_18970 gene hsbA 35431 35736 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_18970 35775 37007 gene locus_tag LOCUS_18980 gene cttP 35775 37007 CDS product trichloroethylene chemotactic transducer CttP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106690.1 protein_id gnl|my_center|LOCUS_18980 37071 37436 gene locus_tag LOCUS_18990 37071 37436 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence028 1340 48 gene locus_tag LOCUS_19000 1340 48 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_19000 1482 1787 gene locus_tag LOCUS_19010 1482 1787 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102761837.1 protein_id gnl|my_center|LOCUS_19010 1784 2119 gene locus_tag LOCUS_19020 1784 2119 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_19020 3163 2126 gene locus_tag LOCUS_19030 3163 2126 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488759.1 protein_id gnl|my_center|LOCUS_19030 3444 3166 gene locus_tag LOCUS_19040 3444 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4477 3530 gene locus_tag LOCUS_19050 gene ylqF 4477 3530 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072540.1 protein_id gnl|my_center|LOCUS_19050 4901 8773 gene locus_tag LOCUS_19060 gene hrpA 4901 8773 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813236.1 protein_id gnl|my_center|LOCUS_19060 9086 9268 gene locus_tag LOCUS_19070 9086 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 9265 9693 gene locus_tag LOCUS_19080 9265 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 11550 9856 gene locus_tag LOCUS_19090 11550 9856 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268952.1 protein_id gnl|my_center|LOCUS_19090 11543 12865 gene locus_tag LOCUS_19100 11543 12865 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_19100 12966 13142 gene locus_tag LOCUS_19110 12966 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 13143 13397 gene locus_tag LOCUS_19120 gene moaD 13143 13397 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193789.1 protein_id gnl|my_center|LOCUS_19120 13403 13861 gene locus_tag LOCUS_19130 gene moaE 13403 13861 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_19130 13861 16275 gene locus_tag LOCUS_19140 13861 16275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869728.1 protein_id gnl|my_center|LOCUS_19140 16272 16679 gene locus_tag LOCUS_19150 gene hslR 16272 16679 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660485.1 protein_id gnl|my_center|LOCUS_19150 16904 16686 gene locus_tag LOCUS_19160 16904 16686 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 protein_id gnl|my_center|LOCUS_19160 17737 17030 gene locus_tag LOCUS_19170 17737 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 19379 17742 gene locus_tag LOCUS_19180 19379 17742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 19831 19376 gene locus_tag LOCUS_19190 19831 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 21201 20059 gene locus_tag LOCUS_19200 21201 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 22624 21419 gene locus_tag LOCUS_19210 22624 21419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 23973 22672 gene locus_tag LOCUS_19220 23973 22672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 24127 26193 gene locus_tag LOCUS_19230 24127 26193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 26552 26292 gene locus_tag LOCUS_19240 26552 26292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 26811 27092 gene locus_tag LOCUS_19250 26811 27092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 27089 27601 gene locus_tag LOCUS_19260 27089 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 27615 28292 gene locus_tag LOCUS_19270 27615 28292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 28310 29566 gene locus_tag LOCUS_19280 28310 29566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 29579 30196 gene locus_tag LOCUS_19290 29579 30196 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207859.1 protein_id gnl|my_center|LOCUS_19290 30375 30464 gene locus_tag LOCUS_t00160 30375 30464 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31165 31797 gene locus_tag LOCUS_19300 31165 31797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 31797 34139 gene locus_tag LOCUS_19310 31797 34139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 34391 34666 gene locus_tag LOCUS_19320 34391 34666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 34795 35067 gene locus_tag LOCUS_19330 34795 35067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 35294 35935 gene locus_tag LOCUS_19340 35294 35935 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence029 129 461 gene locus_tag LOCUS_19350 129 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1291 1217 gene locus_tag LOCUS_t00170 1291 1217 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2695 1343 gene locus_tag LOCUS_19360 gene ffh 2695 1343 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929607.1 protein_id gnl|my_center|LOCUS_19360 2738 3538 gene locus_tag LOCUS_19370 gene ccsA 2738 3538 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 protein_id gnl|my_center|LOCUS_19370 4197 3535 gene locus_tag LOCUS_19380 4197 3535 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_19380 5811 4276 gene locus_tag LOCUS_19390 5811 4276 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_19390 6847 6065 gene locus_tag LOCUS_19400 gene pssA 6847 6065 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_19400 7984 6911 gene locus_tag LOCUS_19410 7984 6911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 8117 9217 gene locus_tag LOCUS_19420 gene tgt 8117 9217 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208672.1 protein_id gnl|my_center|LOCUS_19420 9269 9586 gene locus_tag LOCUS_19430 gene yajC 9269 9586 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_19430 9629 11458 gene locus_tag LOCUS_19440 gene secD 9629 11458 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064324.1 protein_id gnl|my_center|LOCUS_19440 11475 12410 gene locus_tag LOCUS_19450 gene secF 11475 12410 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064325.1 protein_id gnl|my_center|LOCUS_19450 12431 13738 gene locus_tag LOCUS_19460 12431 13738 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194395.1 protein_id gnl|my_center|LOCUS_19460 13876 14121 gene locus_tag LOCUS_19470 gene clpS 13876 14121 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064083.1 protein_id gnl|my_center|LOCUS_19470 14118 16406 gene locus_tag LOCUS_19480 gene clpA 14118 16406 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_19480 18002 16425 gene locus_tag LOCUS_19490 18002 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 18497 18039 gene locus_tag LOCUS_19500 18497 18039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 19428 18484 gene locus_tag LOCUS_19510 19428 18484 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_19510 20562 19462 gene locus_tag LOCUS_19520 gene aroC 20562 19462 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_19520 20667 23390 gene locus_tag LOCUS_19530 20667 23390 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_19530 23543 24550 gene locus_tag LOCUS_19540 23543 24550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 25067 24573 gene locus_tag LOCUS_19550 25067 24573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 25735 25175 gene locus_tag LOCUS_19560 25735 25175 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086163.1 protein_id gnl|my_center|LOCUS_19560 25935 26396 gene locus_tag LOCUS_19570 25935 26396 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_19570 26430 27857 gene locus_tag LOCUS_19580 26430 27857 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_19580 28764 27934 gene locus_tag LOCUS_19590 28764 27934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 30627 28798 gene locus_tag LOCUS_19600 gene glmS 30627 28798 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 protein_id gnl|my_center|LOCUS_19600 31999 30629 gene locus_tag LOCUS_19610 gene glmU 31999 30629 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818080.1 protein_id gnl|my_center|LOCUS_19610 33335 32019 gene locus_tag LOCUS_19620 33335 32019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 34564 33332 gene locus_tag LOCUS_19630 34564 33332 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226185.1 protein_id gnl|my_center|LOCUS_19630 35520 34579 gene locus_tag LOCUS_19640 gene pip 35520 34579 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence030 <1 2093 gene locus_tag LOCUS_19650 <1 2093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072186.1:methyl-accepting chemotaxis protein 4661 2226 gene locus_tag LOCUS_19660 4661 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 8050 4661 gene locus_tag LOCUS_19670 8050 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 8688 8047 gene locus_tag LOCUS_19680 8688 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 10405 8714 gene locus_tag LOCUS_19690 10405 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 12061 10466 gene locus_tag LOCUS_19700 12061 10466 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_19700 12553 12460 gene locus_tag LOCUS_t00180 12553 12460 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14010 12784 gene locus_tag LOCUS_19710 14010 12784 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_19710 16653 14029 gene locus_tag LOCUS_19720 gene alaS 16653 14029 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_19720 17298 16849 gene locus_tag LOCUS_19730 17298 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 18313 17279 gene locus_tag LOCUS_19740 gene recA 18313 17279 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_19740 18860 18360 gene locus_tag LOCUS_19750 gene pncC 18860 18360 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_19750 19327 18839 gene locus_tag LOCUS_19760 19327 18839 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_19760 20264 19311 gene locus_tag LOCUS_19770 gene thiL 20264 19311 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194308.1 protein_id gnl|my_center|LOCUS_19770 20848 20264 gene locus_tag LOCUS_19780 gene mog 20848 20264 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295414.1 protein_id gnl|my_center|LOCUS_19780 20892 21689 gene locus_tag LOCUS_19790 20892 21689 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566336.1 protein_id gnl|my_center|LOCUS_19790 22238 21726 gene locus_tag LOCUS_19800 gene yjgA 22238 21726 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101581.1 protein_id gnl|my_center|LOCUS_19800 22278 23618 gene locus_tag LOCUS_19810 gene pmbA 22278 23618 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 protein_id gnl|my_center|LOCUS_19810 24508 23693 gene locus_tag LOCUS_19820 24508 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 24608 25612 gene locus_tag LOCUS_19830 24608 25612 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381390.1 protein_id gnl|my_center|LOCUS_19830 25666 26811 gene locus_tag LOCUS_19840 25666 26811 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_19840 27020 27631 gene locus_tag LOCUS_19850 27020 27631 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_19850 28587 27784 gene locus_tag LOCUS_19860 gene folE2 28587 27784 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_19860 30475 28631 gene locus_tag LOCUS_19870 gene dxs 30475 28631 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_19870 31365 30475 gene locus_tag LOCUS_19880 31365 30475 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 protein_id gnl|my_center|LOCUS_19880 31588 31358 gene locus_tag LOCUS_19890 gene xseB 31588 31358 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393512.1 protein_id gnl|my_center|LOCUS_19890 32341 31646 gene locus_tag LOCUS_19900 32341 31646 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 protein_id gnl|my_center|LOCUS_19900 32436 34679 gene locus_tag LOCUS_19910 32436 34679 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_19910 34890 35654 gene locus_tag LOCUS_19920 34890 35654 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence031 703 1179 gene locus_tag LOCUS_19930 703 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1228 2280 gene locus_tag LOCUS_19940 1228 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2291 2644 gene locus_tag LOCUS_19950 2291 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2647 3066 gene locus_tag LOCUS_19960 2647 3066 CDS product DUF1320 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225240.1 protein_id gnl|my_center|LOCUS_19960 3066 3497 gene locus_tag LOCUS_19970 3066 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3497 3664 gene locus_tag LOCUS_19980 3497 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3668 4834 gene locus_tag LOCUS_19990 3668 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 4843 5184 gene locus_tag LOCUS_20000 4843 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5289 5537 gene locus_tag LOCUS_20010 5289 5537 CDS product DUF1799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019249324.1 protein_id gnl|my_center|LOCUS_20010 5530 9630 gene locus_tag LOCUS_20020 5530 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 9627 11204 gene locus_tag LOCUS_20030 9627 11204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 11206 12066 gene locus_tag LOCUS_20040 11206 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 12063 13310 gene locus_tag LOCUS_20050 12063 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 13323 14039 gene locus_tag LOCUS_20060 13323 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 14042 14431 gene locus_tag LOCUS_20070 14042 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 15979 15269 gene locus_tag LOCUS_20080 15979 15269 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189715.1 protein_id gnl|my_center|LOCUS_20080 16683 15976 gene locus_tag LOCUS_20090 16683 15976 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_20090 17236 16694 gene locus_tag LOCUS_20100 gene gmhB 17236 16694 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_20100 19335 17233 gene locus_tag LOCUS_20110 gene glyS 19335 17233 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189008.1 protein_id gnl|my_center|LOCUS_20110 20371 19436 gene locus_tag LOCUS_20120 gene glyQ 20371 19436 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_20120 21882 20407 gene locus_tag LOCUS_20130 gene lnt 21882 20407 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244059.1 protein_id gnl|my_center|LOCUS_20130 22750 21905 gene locus_tag LOCUS_20140 22750 21905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 22875 23306 gene locus_tag LOCUS_20150 gene mscL 22875 23306 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192898.1 protein_id gnl|my_center|LOCUS_20150 24157 23312 gene locus_tag LOCUS_20160 24157 23312 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_20160 24611 24147 gene locus_tag LOCUS_20170 gene ybeY 24611 24147 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191149949.1 protein_id gnl|my_center|LOCUS_20170 25564 24608 gene locus_tag LOCUS_20180 25564 24608 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064328.1 protein_id gnl|my_center|LOCUS_20180 27001 25664 gene locus_tag LOCUS_20190 gene miaB 27001 25664 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809403.1 protein_id gnl|my_center|LOCUS_20190 27169 27245 gene locus_tag LOCUS_t00190 27169 27245 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27318 29234 gene locus_tag LOCUS_20200 gene thrS 27318 29234 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_20200 29319 29786 gene locus_tag LOCUS_20210 gene infC 29319 29786 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_20210 29860 30057 gene locus_tag LOCUS_20220 gene rpmI 29860 30057 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 protein_id gnl|my_center|LOCUS_20220 30071 30433 gene locus_tag LOCUS_20230 gene rplT 30071 30433 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225461.1 protein_id gnl|my_center|LOCUS_20230 30503 31486 gene locus_tag LOCUS_20240 gene pheS 30503 31486 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951025.1 protein_id gnl|my_center|LOCUS_20240 31751 34105 gene locus_tag LOCUS_20250 gene pheT 31751 34105 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193113.1 protein_id gnl|my_center|LOCUS_20250 34115 34417 gene locus_tag LOCUS_20260 34115 34417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 34401 34814 gene locus_tag LOCUS_20270 34401 34814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 34893 34969 gene locus_tag LOCUS_t00200 34893 34969 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence032 834 1043 gene locus_tag LOCUS_20280 834 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1043 1321 gene locus_tag LOCUS_20290 1043 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2048 1638 gene locus_tag LOCUS_20300 2048 1638 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810818.1 protein_id gnl|my_center|LOCUS_20300 2323 2045 gene locus_tag LOCUS_20310 2323 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 2780 2406 gene locus_tag LOCUS_20320 2780 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2980 3543 gene locus_tag LOCUS_20330 2980 3543 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_20330 3872 3663 gene locus_tag LOCUS_20340 3872 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4773 4030 gene locus_tag LOCUS_20350 gene phbB 4773 4030 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813586.1 protein_id gnl|my_center|LOCUS_20350 5975 4800 gene locus_tag LOCUS_20360 5975 4800 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_20360 7200 6043 gene locus_tag LOCUS_20370 7200 6043 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_20370 8222 7197 gene locus_tag LOCUS_20380 8222 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 8653 8303 gene locus_tag LOCUS_20390 8653 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 9138 8701 gene locus_tag LOCUS_20400 9138 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 9522 9139 gene locus_tag LOCUS_20410 9522 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 11123 9714 gene locus_tag LOCUS_20420 gene glnA 11123 9714 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192601.1 protein_id gnl|my_center|LOCUS_20420 11354 11815 gene locus_tag LOCUS_20430 11354 11815 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_20430 11818 12624 gene locus_tag LOCUS_20440 gene aroE 11818 12624 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_20440 12621 13307 gene locus_tag LOCUS_20450 gene mtgA 12621 13307 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814960.1 protein_id gnl|my_center|LOCUS_20450 13432 13758 gene locus_tag LOCUS_20460 13432 13758 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084133.1 protein_id gnl|my_center|LOCUS_20460 13759 13989 gene locus_tag LOCUS_20470 13759 13989 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690730.1 protein_id gnl|my_center|LOCUS_20470 13992 14459 gene locus_tag LOCUS_20480 13992 14459 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_20480 17334 14524 gene locus_tag LOCUS_20490 17334 14524 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_20490 18302 17541 gene locus_tag LOCUS_20500 gene moeB 18302 17541 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_20500 18998 18315 gene locus_tag LOCUS_20510 18998 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 19972 19034 gene locus_tag LOCUS_20520 19972 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 20431 19976 gene locus_tag LOCUS_20530 20431 19976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 21039 20428 gene locus_tag LOCUS_20540 21039 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 22616 21036 gene locus_tag LOCUS_20550 22616 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 23826 22621 gene locus_tag LOCUS_20560 23826 22621 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_20560 25546 23837 gene locus_tag LOCUS_20570 25546 23837 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_20570 26723 25551 gene locus_tag LOCUS_20580 26723 25551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 28530 26707 gene locus_tag LOCUS_20590 28530 26707 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_20590 28957 29400 gene locus_tag LOCUS_20600 28957 29400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 34038 29944 gene locus_tag LOCUS_20610 34038 29944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 34573 34292 gene locus_tag LOCUS_20620 34573 34292 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_20620 34651 35016 gene locus_tag LOCUS_20630 34651 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence033 2209 98 gene locus_tag LOCUS_20640 2209 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918991.1 protein_id gnl|my_center|LOCUS_20640 2554 3900 gene locus_tag LOCUS_20650 gene yjjJ 2554 3900 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_20650 5376 4012 gene locus_tag LOCUS_20660 5376 4012 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086404.1 protein_id gnl|my_center|LOCUS_20660 5788 5982 gene locus_tag LOCUS_20670 5788 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 6609 5974 gene locus_tag LOCUS_20680 6609 5974 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_20680 6608 7294 gene locus_tag LOCUS_20690 6608 7294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_20690 7421 9823 gene locus_tag LOCUS_20700 7421 9823 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_20700 10525 9863 gene locus_tag LOCUS_20710 10525 9863 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_20710 11850 10498 gene locus_tag LOCUS_20720 11850 10498 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966731.1 protein_id gnl|my_center|LOCUS_20720 12025 14346 gene locus_tag LOCUS_20730 12025 14346 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372678.1 protein_id gnl|my_center|LOCUS_20730 14452 15651 gene locus_tag LOCUS_20740 gene purT 14452 15651 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522466.1 protein_id gnl|my_center|LOCUS_20740 15648 16040 gene locus_tag LOCUS_20750 15648 16040 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_20750 17570 16206 gene locus_tag LOCUS_20760 17570 16206 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_20760 19049 17679 gene locus_tag LOCUS_20770 19049 17679 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941159.1 protein_id gnl|my_center|LOCUS_20770 19338 21155 gene locus_tag LOCUS_20780 gene typA 19338 21155 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688609.1 protein_id gnl|my_center|LOCUS_20780 21816 21352 gene locus_tag LOCUS_20790 21816 21352 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521490.1 protein_id gnl|my_center|LOCUS_20790 22654 21887 gene locus_tag LOCUS_20800 22654 21887 CDS product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508790.1 protein_id gnl|my_center|LOCUS_20800 23501 22638 gene locus_tag LOCUS_20810 23501 22638 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706877.1 protein_id gnl|my_center|LOCUS_20810 23791 23522 gene locus_tag LOCUS_20820 23791 23522 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458571.1 protein_id gnl|my_center|LOCUS_20820 24079 24492 gene locus_tag LOCUS_20830 24079 24492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 24734 26941 gene locus_tag LOCUS_20840 24734 26941 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_20840 26938 28356 gene locus_tag LOCUS_20850 26938 28356 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_20850 28353 28991 gene locus_tag LOCUS_20860 28353 28991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence034 341 69 gene locus_tag LOCUS_20870 gene hupB 341 69 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_20870 2890 461 gene locus_tag LOCUS_20880 gene lon 2890 461 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_20880 4419 3151 gene locus_tag LOCUS_20890 gene clpX 4419 3151 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_20890 5081 4452 gene locus_tag LOCUS_20900 gene clpP 5081 4452 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_20900 6388 5081 gene locus_tag LOCUS_20910 gene tig 6388 5081 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997321.1 protein_id gnl|my_center|LOCUS_20910 6514 6430 gene locus_tag LOCUS_t00210 6514 6430 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6679 6924 gene locus_tag LOCUS_20920 6679 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 7286 8638 gene locus_tag LOCUS_20930 7286 8638 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_20930 8635 9699 gene locus_tag LOCUS_20940 8635 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 9874 12975 gene locus_tag LOCUS_20950 9874 12975 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_20950 14788 13022 gene locus_tag LOCUS_20960 14788 13022 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000371.1 protein_id gnl|my_center|LOCUS_20960 15350 14826 gene locus_tag LOCUS_20970 15350 14826 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 protein_id gnl|my_center|LOCUS_20970 15389 17323 gene locus_tag LOCUS_20980 gene mnmC 15389 17323 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268624.1 protein_id gnl|my_center|LOCUS_20980 17334 19133 gene locus_tag LOCUS_20990 17334 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 19194 20282 gene locus_tag LOCUS_21000 19194 20282 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_21000 21160 20279 gene locus_tag LOCUS_21010 21160 20279 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_21010 21222 22436 gene locus_tag LOCUS_21020 gene dapC 21222 22436 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198896.1 protein_id gnl|my_center|LOCUS_21020 23463 22531 gene locus_tag LOCUS_21030 gene miaA 23463 22531 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704863.1 protein_id gnl|my_center|LOCUS_21030 24725 23463 gene locus_tag LOCUS_21040 24725 23463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113829.1 protein_id gnl|my_center|LOCUS_21040 26578 24722 gene locus_tag LOCUS_21050 gene mutL 26578 24722 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_21050 27627 26587 gene locus_tag LOCUS_21060 gene selD 27627 26587 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201158.1 protein_id gnl|my_center|LOCUS_21060 27980 30451 gene locus_tag LOCUS_21070 27980 30451 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence035 <1 2373 gene locus_tag LOCUS_21080 <1 2373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein 2439 3326 gene locus_tag LOCUS_21090 2439 3326 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_21090 3329 3928 gene locus_tag LOCUS_21100 gene cysC 3329 3928 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175284159.1 protein_id gnl|my_center|LOCUS_21100 6741 4048 gene locus_tag LOCUS_21110 6741 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 8717 6750 gene locus_tag LOCUS_21120 8717 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 11300 8751 gene locus_tag LOCUS_21130 11300 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 11674 11306 gene locus_tag LOCUS_21140 11674 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 12531 11680 gene locus_tag LOCUS_21150 12531 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 13257 12640 gene locus_tag LOCUS_21160 13257 12640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 13754 13386 gene locus_tag LOCUS_21170 13754 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 13920 15134 gene locus_tag LOCUS_21180 13920 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 15131 18433 gene locus_tag LOCUS_21190 15131 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 18430 19575 gene locus_tag LOCUS_21200 18430 19575 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_21200 19677 20540 gene locus_tag LOCUS_21210 19677 20540 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268833.1 protein_id gnl|my_center|LOCUS_21210 20569 22377 gene locus_tag LOCUS_21220 20569 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 22641 23231 gene locus_tag LOCUS_21230 22641 23231 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213963.1 protein_id gnl|my_center|LOCUS_21230 23284 25170 gene locus_tag LOCUS_21240 gene ftsH 23284 25170 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_21240 25255 26082 gene locus_tag LOCUS_21250 gene folP 25255 26082 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809626.1 protein_id gnl|my_center|LOCUS_21250 26079 27449 gene locus_tag LOCUS_21260 gene glmM 26079 27449 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_21260 27446 27748 gene locus_tag LOCUS_21270 27446 27748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 27750 28871 gene locus_tag LOCUS_21280 27750 28871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 29200 28994 gene locus_tag LOCUS_21290 29200 28994 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391951.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence036 1656 271 gene locus_tag LOCUS_21300 gene cysG 1656 271 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_21300 1540 1764 gene locus_tag LOCUS_21310 1540 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1764 3017 gene locus_tag LOCUS_21320 1764 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3249 3325 gene locus_tag LOCUS_t00220 3249 3325 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3592 3813 gene locus_tag LOCUS_21330 3592 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 4162 4347 gene locus_tag LOCUS_21340 4162 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 7087 4715 gene locus_tag LOCUS_21350 7087 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 8167 8445 gene locus_tag LOCUS_21360 8167 8445 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_21360 8454 8738 gene locus_tag LOCUS_21370 8454 8738 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_21370 8837 9091 gene locus_tag LOCUS_21380 8837 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 9712 9867 gene locus_tag LOCUS_21390 9712 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 10102 9938 gene locus_tag LOCUS_21400 10102 9938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 10740 10174 gene locus_tag LOCUS_21410 10740 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 10961 11305 gene locus_tag LOCUS_21420 10961 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 11881 11687 gene locus_tag LOCUS_21430 11881 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 11965 12405 gene locus_tag LOCUS_21440 11965 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 12402 14441 gene locus_tag LOCUS_21450 12402 14441 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225252.1 protein_id gnl|my_center|LOCUS_21450 14496 15227 gene locus_tag LOCUS_21460 14496 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 15224 15583 gene locus_tag LOCUS_21470 15224 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 15576 15899 gene locus_tag LOCUS_21480 15576 15899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 15901 16203 gene locus_tag LOCUS_21490 15901 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 16364 16636 gene locus_tag LOCUS_21500 16364 16636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 16627 17154 gene locus_tag LOCUS_21510 16627 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 17138 17455 gene locus_tag LOCUS_21520 17138 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 17471 17995 gene locus_tag LOCUS_21530 17471 17995 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140136.1 protein_id gnl|my_center|LOCUS_21530 17992 18240 gene locus_tag LOCUS_21540 17992 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 18237 18461 gene locus_tag LOCUS_21550 18237 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 18585 18881 gene locus_tag LOCUS_21560 18585 18881 CDS product Gp49 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999686.1 protein_id gnl|my_center|LOCUS_21560 18905 19186 gene locus_tag LOCUS_21570 18905 19186 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_21570 19249 19653 gene locus_tag LOCUS_21580 19249 19653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 19650 20084 gene locus_tag LOCUS_21590 19650 20084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 20077 20517 gene locus_tag LOCUS_21600 20077 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 20514 20897 gene locus_tag LOCUS_21610 20514 20897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 21007 21348 gene locus_tag LOCUS_21620 21007 21348 CDS product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939967.1 protein_id gnl|my_center|LOCUS_21620 21348 21974 gene locus_tag LOCUS_21630 21348 21974 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939968.1 protein_id gnl|my_center|LOCUS_21630 21965 22579 gene locus_tag LOCUS_21640 21965 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 22815 23144 gene locus_tag LOCUS_21650 22815 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 23141 23452 gene locus_tag LOCUS_21660 23141 23452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_21660 23439 23939 gene locus_tag LOCUS_21670 23439 23939 CDS product DUF1804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939973.1 protein_id gnl|my_center|LOCUS_21670 24098 25723 gene locus_tag LOCUS_21680 gene terL 24098 25723 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 protein_id gnl|my_center|LOCUS_21680 25727 27211 gene locus_tag LOCUS_21690 25727 27211 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090685.1 protein_id gnl|my_center|LOCUS_21690 27211 28542 gene locus_tag LOCUS_21700 27211 28542 CDS product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046893.1 protein_id gnl|my_center|LOCUS_21700 28669 29157 gene locus_tag LOCUS_21710 28669 29157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 29305 29970 gene locus_tag LOCUS_21720 29305 29970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence037 863 1165 gene locus_tag LOCUS_21730 863 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 1196 1576 gene locus_tag LOCUS_21740 1196 1576 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_21740 2071 1652 gene locus_tag LOCUS_21750 2071 1652 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_21750 2996 2109 gene locus_tag LOCUS_21760 2996 2109 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_21760 3131 3406 gene locus_tag LOCUS_21770 3131 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 4562 4374 gene locus_tag LOCUS_21780 4562 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4776 5165 gene locus_tag LOCUS_21790 4776 5165 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096828425.1 protein_id gnl|my_center|LOCUS_21790 5191 6987 gene locus_tag LOCUS_21800 5191 6987 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_21800 7228 8292 gene locus_tag LOCUS_21810 7228 8292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 8828 8340 gene locus_tag LOCUS_21820 8828 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 9094 9597 gene locus_tag LOCUS_21830 gene greB 9094 9597 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_21830 9668 9898 gene locus_tag LOCUS_21840 9668 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 9895 10023 gene locus_tag LOCUS_21850 9895 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 10059 11177 gene locus_tag LOCUS_21860 gene earP 10059 11177 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203004.1 protein_id gnl|my_center|LOCUS_21860 11218 11775 gene locus_tag LOCUS_21870 gene efp 11218 11775 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_21870 12458 11886 gene locus_tag LOCUS_21880 gene pagP 12458 11886 CDS product lipid IV(A) palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170533.1 protein_id gnl|my_center|LOCUS_21880 14186 12801 gene locus_tag LOCUS_21890 14186 12801 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928587.1 protein_id gnl|my_center|LOCUS_21890 14400 14242 gene locus_tag LOCUS_21900 14400 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 14656 14426 gene locus_tag LOCUS_21910 14656 14426 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533227.1 protein_id gnl|my_center|LOCUS_21910 15105 14707 gene locus_tag LOCUS_21920 15105 14707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 15309 15917 gene locus_tag LOCUS_21930 15309 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 15972 16856 gene locus_tag LOCUS_21940 15972 16856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 16892 17041 gene locus_tag LOCUS_21950 16892 17041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 17052 17270 gene locus_tag LOCUS_21960 17052 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 17273 18331 gene locus_tag LOCUS_21970 17273 18331 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 protein_id gnl|my_center|LOCUS_21970 18421 18756 gene locus_tag LOCUS_21980 18421 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 18986 19297 gene locus_tag LOCUS_21990 18986 19297 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210636.1 protein_id gnl|my_center|LOCUS_21990 19735 20475 gene locus_tag LOCUS_22000 19735 20475 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_22000 21090 20512 gene locus_tag LOCUS_22010 21090 20512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 21396 21238 gene locus_tag LOCUS_22020 21396 21238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 21760 23214 gene locus_tag LOCUS_22030 21760 23214 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_22030 23211 24755 gene locus_tag LOCUS_22040 23211 24755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 24752 25492 gene locus_tag LOCUS_22050 24752 25492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_22050 25492 26718 gene locus_tag LOCUS_22060 25492 26718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_22060 27073 27951 gene locus_tag LOCUS_22070 27073 27951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 28176 29666 gene locus_tag LOCUS_22080 28176 29666 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102300.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence038 1785 901 gene locus_tag LOCUS_22090 gene rfbD 1785 901 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186608.1 protein_id gnl|my_center|LOCUS_22090 2324 1782 gene locus_tag LOCUS_22100 gene rfbC 2324 1782 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_22100 3271 2324 gene locus_tag LOCUS_22110 gene rfbA 3271 2324 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_22110 3618 3277 gene locus_tag LOCUS_22120 3618 3277 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_22120 4772 3705 gene locus_tag LOCUS_22130 gene rfbB 4772 3705 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186461.1 protein_id gnl|my_center|LOCUS_22130 7310 4911 gene locus_tag LOCUS_22140 gene parC 7310 4911 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951227.1 protein_id gnl|my_center|LOCUS_22140 9279 7321 gene locus_tag LOCUS_22150 9279 7321 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033451799.1 protein_id gnl|my_center|LOCUS_22150 9476 9865 gene locus_tag LOCUS_22160 gene gloA 9476 9865 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064979.1 protein_id gnl|my_center|LOCUS_22160 10027 11430 gene locus_tag LOCUS_22170 gene cptA 10027 11430 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_22170 11453 12679 gene locus_tag LOCUS_22180 gene glcF 11453 12679 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_22180 12676 13296 gene locus_tag LOCUS_22190 gene coq7 12676 13296 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_22190 13302 13619 gene locus_tag LOCUS_22200 13302 13619 CDS product DUF2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 protein_id gnl|my_center|LOCUS_22200 14823 13648 gene locus_tag LOCUS_22210 14823 13648 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_22210 16414 14870 gene locus_tag LOCUS_22220 gene purF 16414 14870 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811814.1 protein_id gnl|my_center|LOCUS_22220 16924 16436 gene locus_tag LOCUS_22230 16924 16436 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817223.1 protein_id gnl|my_center|LOCUS_22230 17677 16925 gene locus_tag LOCUS_22240 17677 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 18989 17703 gene locus_tag LOCUS_22250 gene folC 18989 17703 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687619.1 protein_id gnl|my_center|LOCUS_22250 19848 18982 gene locus_tag LOCUS_22260 gene accD 19848 18982 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_22260 20661 19858 gene locus_tag LOCUS_22270 gene trpA 20661 19858 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187543.1 protein_id gnl|my_center|LOCUS_22270 21860 20658 gene locus_tag LOCUS_22280 gene trpB 21860 20658 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_22280 22451 21885 gene locus_tag LOCUS_22290 22451 21885 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_22290 23339 22551 gene locus_tag LOCUS_22300 gene truA 23339 22551 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203245.1 protein_id gnl|my_center|LOCUS_22300 23947 23336 gene locus_tag LOCUS_22310 23947 23336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 27251 24039 gene locus_tag LOCUS_22320 gene fimV 27251 24039 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_22320 28472 27360 gene locus_tag LOCUS_22330 gene asd 28472 27360 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence039 3555 4328 gene locus_tag LOCUS_22340 3555 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 7176 4378 gene locus_tag LOCUS_22350 gene polA 7176 4378 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_22350 7207 7935 gene locus_tag LOCUS_22360 7207 7935 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_22360 7996 8337 gene locus_tag LOCUS_22370 7996 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 8407 9357 gene locus_tag LOCUS_22380 8407 9357 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007184747.1 protein_id gnl|my_center|LOCUS_22380 9376 10221 gene locus_tag LOCUS_22390 9376 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 12248 10305 gene locus_tag LOCUS_22400 12248 10305 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_22400 13507 12248 gene locus_tag LOCUS_22410 13507 12248 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522601.1 protein_id gnl|my_center|LOCUS_22410 13609 13833 gene locus_tag LOCUS_22420 13609 13833 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105882.1 protein_id gnl|my_center|LOCUS_22420 14557 13802 gene locus_tag LOCUS_22430 14557 13802 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_22430 15031 14642 gene locus_tag LOCUS_22440 gene rplQ 15031 14642 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197924.1 protein_id gnl|my_center|LOCUS_22440 16031 15042 gene locus_tag LOCUS_22450 gene rpoA 16031 15042 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215457.1 protein_id gnl|my_center|LOCUS_22450 16679 16050 gene locus_tag LOCUS_22460 gene rpsD 16679 16050 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_22460 17097 16708 gene locus_tag LOCUS_22470 gene rpsK 17097 16708 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_22470 17473 17111 gene locus_tag LOCUS_22480 gene rpsM 17473 17111 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_22480 17896 17678 gene locus_tag LOCUS_22490 gene infA 17896 17678 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_22490 19232 17907 gene locus_tag LOCUS_22500 gene secY 19232 17907 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_22500 19672 19238 gene locus_tag LOCUS_22510 gene rplO 19672 19238 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_22510 19873 19673 gene locus_tag LOCUS_22520 gene rpmD 19873 19673 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_22520 20388 19876 gene locus_tag LOCUS_22530 gene rpsE 20388 19876 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806923.1 protein_id gnl|my_center|LOCUS_22530 20754 20401 gene locus_tag LOCUS_22540 gene rplR 20754 20401 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 protein_id gnl|my_center|LOCUS_22540 21297 20764 gene locus_tag LOCUS_22550 gene rplF 21297 20764 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806921.1 protein_id gnl|my_center|LOCUS_22550 21705 21310 gene locus_tag LOCUS_22560 gene rpsH 21705 21310 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_22560 22025 21720 gene locus_tag LOCUS_22570 gene rpsN 22025 21720 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_22570 22572 22033 gene locus_tag LOCUS_22580 gene rplE 22572 22033 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_22580 22899 22582 gene locus_tag LOCUS_22590 gene rplX 22899 22582 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_22590 23278 22910 gene locus_tag LOCUS_22600 gene rplN 23278 22910 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197951.1 protein_id gnl|my_center|LOCUS_22600 23705 23427 gene locus_tag LOCUS_22610 gene rpsQ 23705 23427 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307966.1 protein_id gnl|my_center|LOCUS_22610 23912 23718 gene locus_tag LOCUS_22620 gene rpmC 23912 23718 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199856.1 protein_id gnl|my_center|LOCUS_22620 24331 23915 gene locus_tag LOCUS_22630 gene rplP 24331 23915 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_22630 25025 24315 gene locus_tag LOCUS_22640 gene rpsC 25025 24315 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_22640 25365 25036 gene locus_tag LOCUS_22650 gene rplV 25365 25036 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 protein_id gnl|my_center|LOCUS_22650 25651 25376 gene locus_tag LOCUS_22660 gene rpsS 25651 25376 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_22660 26490 25657 gene locus_tag LOCUS_22670 gene rplB 26490 25657 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_22670 26811 26500 gene locus_tag LOCUS_22680 gene rplW 26811 26500 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806906.1 protein_id gnl|my_center|LOCUS_22680 27437 26808 gene locus_tag LOCUS_22690 gene rplD 27437 26808 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 protein_id gnl|my_center|LOCUS_22690 <28087 27434 gene locus_tag LOCUS_22700 <28087 27434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010925687.1:50S ribosomal protein L3 >Feature sequence040 1435 233 gene locus_tag LOCUS_22710 gene tyrS 1435 233 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_22710 1508 2842 gene locus_tag LOCUS_22720 1508 2842 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814879.1 protein_id gnl|my_center|LOCUS_22720 2854 3951 gene locus_tag LOCUS_22730 2854 3951 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614195.1 protein_id gnl|my_center|LOCUS_22730 4020 5312 gene locus_tag LOCUS_22740 gene gltA 4020 5312 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188362.1 protein_id gnl|my_center|LOCUS_22740 5895 5464 gene locus_tag LOCUS_22750 5895 5464 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_22750 7328 5910 gene locus_tag LOCUS_22760 gene atpD 7328 5910 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815343.1 protein_id gnl|my_center|LOCUS_22760 8371 7508 gene locus_tag LOCUS_22770 gene atpG 8371 7508 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_22770 9927 8386 gene locus_tag LOCUS_22780 gene atpA 9927 8386 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_22780 10473 9937 gene locus_tag LOCUS_22790 gene atpH 10473 9937 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099407.1 protein_id gnl|my_center|LOCUS_22790 10949 10479 gene locus_tag LOCUS_22800 10949 10479 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_22800 11226 10987 gene locus_tag LOCUS_22810 gene atpE 11226 10987 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_22810 12134 11271 gene locus_tag LOCUS_22820 gene atpB 12134 11271 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 protein_id gnl|my_center|LOCUS_22820 12405 12139 gene locus_tag LOCUS_22830 12405 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 13442 12576 gene locus_tag LOCUS_22840 13442 12576 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_22840 14205 13435 gene locus_tag LOCUS_22850 14205 13435 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 protein_id gnl|my_center|LOCUS_22850 14855 14202 gene locus_tag LOCUS_22860 gene rsmG 14855 14202 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690016.1 protein_id gnl|my_center|LOCUS_22860 16771 14852 gene locus_tag LOCUS_22870 gene mnmG 16771 14852 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195816.1 protein_id gnl|my_center|LOCUS_22870 18547 17207 gene locus_tag LOCUS_22880 gene mnmE 18547 17207 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524586.1 protein_id gnl|my_center|LOCUS_22880 20174 18534 gene locus_tag LOCUS_22890 gene yidC 20174 18534 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_22890 20762 20406 gene locus_tag LOCUS_22900 gene rnpA 20762 20406 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223062.1 protein_id gnl|my_center|LOCUS_22900 21146 22519 gene locus_tag LOCUS_22910 gene dnaA 21146 22519 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488867.1 protein_id gnl|my_center|LOCUS_22910 22727 23830 gene locus_tag LOCUS_22920 gene dnaN 22727 23830 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196275.1 protein_id gnl|my_center|LOCUS_22920 23871 26261 gene locus_tag LOCUS_22930 gene gyrB 23871 26261 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_22930 26721 26506 gene locus_tag LOCUS_22940 26721 26506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence041 182 775 gene locus_tag LOCUS_22950 182 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 750 1445 gene locus_tag LOCUS_22960 750 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 1850 1497 gene locus_tag LOCUS_22970 1850 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2131 1847 gene locus_tag LOCUS_22980 2131 1847 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_22980 3876 2299 gene locus_tag LOCUS_22990 3876 2299 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531360.1 protein_id gnl|my_center|LOCUS_22990 6905 4344 gene locus_tag LOCUS_23000 6905 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 7427 7110 gene locus_tag LOCUS_23010 7427 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 7902 7690 gene locus_tag LOCUS_23020 7902 7690 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 protein_id gnl|my_center|LOCUS_23020 8429 7902 gene locus_tag LOCUS_23030 8429 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 9422 8469 gene locus_tag LOCUS_23040 gene trxB 9422 8469 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186294.1 protein_id gnl|my_center|LOCUS_23040 10523 9591 gene locus_tag LOCUS_23050 10523 9591 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_23050 10657 12891 gene locus_tag LOCUS_23060 10657 12891 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_23060 12884 14401 gene locus_tag LOCUS_23070 12884 14401 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_23070 14863 14630 gene locus_tag LOCUS_23080 14863 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 14793 14957 gene locus_tag LOCUS_23090 14793 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 15396 16058 gene locus_tag LOCUS_23100 gene lolA 15396 16058 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222831.1 protein_id gnl|my_center|LOCUS_23100 16091 17410 gene locus_tag LOCUS_23110 16091 17410 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_23110 17540 18829 gene locus_tag LOCUS_23120 gene serS 17540 18829 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_23120 18826 19671 gene locus_tag LOCUS_23130 18826 19671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 21151 19700 gene locus_tag LOCUS_23140 gene mltF 21151 19700 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_23140 21259 21349 gene locus_tag LOCUS_t00230 21259 21349 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25199 21936 gene locus_tag LOCUS_23150 25199 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 25352 25203 gene locus_tag LOCUS_23160 25352 25203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 26158 25784 gene locus_tag LOCUS_23170 26158 25784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence042 450 1670 gene locus_tag LOCUS_23180 gene gspF 450 1670 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_23180 3921 1738 gene locus_tag LOCUS_23190 3921 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 6824 4146 gene locus_tag LOCUS_23200 6824 4146 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040039036.1 protein_id gnl|my_center|LOCUS_23200 6984 8471 gene locus_tag LOCUS_23210 gene pap 6984 8471 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_23210 8676 11063 gene locus_tag LOCUS_23220 8676 11063 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_23220 11222 12277 gene locus_tag LOCUS_23230 11222 12277 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061605.1 protein_id gnl|my_center|LOCUS_23230 12301 12558 gene locus_tag LOCUS_23240 12301 12558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 13467 12661 gene locus_tag LOCUS_23250 13467 12661 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_23250 13698 14444 gene locus_tag LOCUS_23260 gene cysE 13698 14444 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_23260 14505 14981 gene locus_tag LOCUS_23270 gene iscR 14505 14981 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_23270 15025 16170 gene locus_tag LOCUS_23280 15025 16170 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_23280 16183 17400 gene locus_tag LOCUS_23290 16183 17400 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_23290 17503 17919 gene locus_tag LOCUS_23300 gene iscU 17503 17919 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_23300 17930 18253 gene locus_tag LOCUS_23310 gene iscA 17930 18253 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_23310 18321 18845 gene locus_tag LOCUS_23320 gene hscB 18321 18845 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_23320 18981 20849 gene locus_tag LOCUS_23330 gene hscA 18981 20849 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951132.1 protein_id gnl|my_center|LOCUS_23330 20851 21192 gene locus_tag LOCUS_23340 gene fdx 20851 21192 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193872.1 protein_id gnl|my_center|LOCUS_23340 23160 21244 gene locus_tag LOCUS_23350 23160 21244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 24171 23182 gene locus_tag LOCUS_23360 24171 23182 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946516.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence043 366 142 gene locus_tag LOCUS_23370 366 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 918 568 gene locus_tag LOCUS_23380 gene erpA 918 568 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_23380 1365 976 gene locus_tag LOCUS_23390 1365 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2086 1379 gene locus_tag LOCUS_23400 2086 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3117 2083 gene locus_tag LOCUS_23410 gene argC 3117 2083 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_23410 3648 3256 gene locus_tag LOCUS_23420 gene rpsI 3648 3256 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194309.1 protein_id gnl|my_center|LOCUS_23420 4086 3658 gene locus_tag LOCUS_23430 gene rplM 4086 3658 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_23430 5032 4169 gene locus_tag LOCUS_23440 gene ubiA 5032 4169 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_23440 5577 5029 gene locus_tag LOCUS_23450 5577 5029 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926548.1 protein_id gnl|my_center|LOCUS_23450 7644 5605 gene locus_tag LOCUS_23460 gene recG 7644 5605 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917883.1 protein_id gnl|my_center|LOCUS_23460 8048 7665 gene locus_tag LOCUS_23470 8048 7665 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_23470 10262 8073 gene locus_tag LOCUS_23480 10262 8073 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_23480 10491 10282 gene locus_tag LOCUS_23490 gene rpoZ 10491 10282 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_23490 11126 10503 gene locus_tag LOCUS_23500 gene gmk 11126 10503 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185877.1 protein_id gnl|my_center|LOCUS_23500 11952 11218 gene locus_tag LOCUS_23510 11952 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091293.1 protein_id gnl|my_center|LOCUS_23510 12909 12034 gene locus_tag LOCUS_23520 12909 12034 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687657.1 protein_id gnl|my_center|LOCUS_23520 13004 13927 gene locus_tag LOCUS_23530 13004 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 13924 14844 gene locus_tag LOCUS_23540 13924 14844 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_23540 14912 15628 gene locus_tag LOCUS_23550 gene rph 14912 15628 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_23550 15630 16235 gene locus_tag LOCUS_23560 15630 16235 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369727.1 protein_id gnl|my_center|LOCUS_23560 16262 17401 gene locus_tag LOCUS_23570 gene hemW 16262 17401 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_23570 17401 17973 gene locus_tag LOCUS_23580 17401 17973 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390231.1 protein_id gnl|my_center|LOCUS_23580 18076 19122 gene locus_tag LOCUS_23590 18076 19122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 19125 19544 gene locus_tag LOCUS_23600 19125 19544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 19541 21505 gene locus_tag LOCUS_23610 19541 21505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 21535 22572 gene locus_tag LOCUS_23620 21535 22572 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_23620 23677 22580 gene locus_tag LOCUS_23630 23677 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence044 208 2829 gene locus_tag LOCUS_23640 208 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2981 4192 gene locus_tag LOCUS_23650 2981 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4332 4123 gene locus_tag LOCUS_23660 4332 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 5923 4289 gene locus_tag LOCUS_23670 5923 4289 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816975.1 protein_id gnl|my_center|LOCUS_23670 7170 6028 gene locus_tag LOCUS_23680 7170 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 8909 7563 gene locus_tag LOCUS_23690 8909 7563 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_23690 9568 9167 gene locus_tag LOCUS_23700 9568 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 9762 9565 gene locus_tag LOCUS_23710 9762 9565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 10728 10111 gene locus_tag LOCUS_23720 10728 10111 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930126.1 protein_id gnl|my_center|LOCUS_23720 13025 10725 gene locus_tag LOCUS_23730 13025 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 15928 13169 gene locus_tag LOCUS_23740 15928 13169 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023457.1 protein_id gnl|my_center|LOCUS_23740 16690 16235 gene locus_tag LOCUS_23750 16690 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 17083 17274 gene locus_tag LOCUS_23760 17083 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 17322 19889 gene locus_tag LOCUS_23770 17322 19889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 20721 20002 gene locus_tag LOCUS_23780 20721 20002 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039188.1 protein_id gnl|my_center|LOCUS_23780 21451 20729 gene locus_tag LOCUS_23790 gene aat 21451 20729 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence045 746 597 gene locus_tag LOCUS_23800 746 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 3519 805 gene locus_tag LOCUS_23810 gene secA 3519 805 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194125.1 protein_id gnl|my_center|LOCUS_23810 4469 3582 gene locus_tag LOCUS_23820 4469 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 4502 4918 gene locus_tag LOCUS_23830 4502 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 7129 5111 gene locus_tag LOCUS_23840 7129 5111 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_23840 7922 7374 gene locus_tag LOCUS_23850 gene ppa 7922 7374 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812734.1 protein_id gnl|my_center|LOCUS_23850 8647 7988 gene locus_tag LOCUS_23860 8647 7988 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942944.1 protein_id gnl|my_center|LOCUS_23860 9596 8697 gene locus_tag LOCUS_23870 9596 8697 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_23870 9846 10187 gene locus_tag LOCUS_23880 9846 10187 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_23880 10580 10206 gene locus_tag LOCUS_23890 10580 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 10783 10577 gene locus_tag LOCUS_23900 10783 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 13281 11023 gene locus_tag LOCUS_23910 13281 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 14099 13287 gene locus_tag LOCUS_23920 14099 13287 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967671.1 protein_id gnl|my_center|LOCUS_23920 15650 14271 gene locus_tag LOCUS_23930 15650 14271 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_23930 15813 16697 gene locus_tag LOCUS_23940 15813 16697 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_23940 17003 16800 gene locus_tag LOCUS_23950 17003 16800 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_23950 17299 19026 gene locus_tag LOCUS_23960 gene pilB 17299 19026 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_23960 19181 20392 gene locus_tag LOCUS_23970 19181 20392 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_23970 21162 20452 gene locus_tag LOCUS_23980 21162 20452 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214390.1 protein_id gnl|my_center|LOCUS_23980 22349 21174 gene locus_tag LOCUS_23990 22349 21174 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521997.1 protein_id gnl|my_center|LOCUS_23990 23515 22346 gene locus_tag LOCUS_24000 23515 22346 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence046 741 55 gene locus_tag LOCUS_24010 741 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1679 981 gene locus_tag LOCUS_24020 1679 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2080 1679 gene locus_tag LOCUS_24030 2080 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2226 2390 gene locus_tag LOCUS_24040 2226 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 2873 2364 gene locus_tag LOCUS_24050 2873 2364 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24050 5094 2875 gene locus_tag LOCUS_24060 5094 2875 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103760.1 protein_id gnl|my_center|LOCUS_24060 5769 5098 gene locus_tag LOCUS_24070 5769 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 6807 5956 gene locus_tag LOCUS_24080 6807 5956 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_24080 8817 6889 gene locus_tag LOCUS_24090 8817 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 10604 8814 gene locus_tag LOCUS_24100 10604 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 11472 10615 gene locus_tag LOCUS_24110 11472 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 12657 11524 gene locus_tag LOCUS_24120 12657 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 13448 12792 gene locus_tag LOCUS_24130 13448 12792 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_24130 15534 13438 gene locus_tag LOCUS_24140 15534 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 20315 15543 gene locus_tag LOCUS_24150 20315 15543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 20979 21176 gene locus_tag LOCUS_24160 20979 21176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence047 473 162 gene locus_tag LOCUS_24170 473 162 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703181.1 protein_id gnl|my_center|LOCUS_24170 1479 553 gene locus_tag LOCUS_24180 1479 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2115 3521 gene locus_tag LOCUS_24190 gene eat 2115 3521 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388785.1 protein_id gnl|my_center|LOCUS_24190 3531 4931 gene locus_tag LOCUS_24200 3531 4931 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_24200 4921 5718 gene locus_tag LOCUS_24210 gene eutC 4921 5718 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524484.1 protein_id gnl|my_center|LOCUS_24210 6691 5729 gene locus_tag LOCUS_24220 6691 5729 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463394.1 protein_id gnl|my_center|LOCUS_24220 7689 6895 gene locus_tag LOCUS_24230 7689 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 8011 8793 gene locus_tag LOCUS_24240 gene rsmA 8011 8793 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706653.1 protein_id gnl|my_center|LOCUS_24240 8858 9511 gene locus_tag LOCUS_24250 gene adk 8858 9511 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_24250 10490 9600 gene locus_tag LOCUS_24260 10490 9600 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_24260 10648 13239 gene locus_tag LOCUS_24270 gene leuS 10648 13239 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810256.1 protein_id gnl|my_center|LOCUS_24270 13243 13770 gene locus_tag LOCUS_24280 13243 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 13770 14798 gene locus_tag LOCUS_24290 gene holA 13770 14798 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_24290 14909 16165 gene locus_tag LOCUS_24300 14909 16165 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_24300 16169 16399 gene locus_tag LOCUS_24310 16169 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 16396 17358 gene locus_tag LOCUS_24320 16396 17358 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 protein_id gnl|my_center|LOCUS_24320 17355 17585 gene locus_tag LOCUS_24330 17355 17585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 17585 18247 gene locus_tag LOCUS_24340 gene nadD 17585 18247 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_24340 18237 18602 gene locus_tag LOCUS_24350 gene rsfS 18237 18602 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_24350 18609 19082 gene locus_tag LOCUS_24360 gene rlmH 18609 19082 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_24360 19238 20590 gene locus_tag LOCUS_24370 gene chrA 19238 20590 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_24370 20755 20967 gene locus_tag LOCUS_24380 20755 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 20964 22022 gene locus_tag LOCUS_24390 20964 22022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence048 <1 1148 gene locus_tag LOCUS_24400 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941810.1:EAL domain-containing protein 1443 1697 gene locus_tag LOCUS_24410 1443 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1823 2239 gene locus_tag LOCUS_24420 1823 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2695 2270 gene locus_tag LOCUS_24430 2695 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 3546 2695 gene locus_tag LOCUS_24440 3546 2695 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 protein_id gnl|my_center|LOCUS_24440 4850 3543 gene locus_tag LOCUS_24450 4850 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 5930 5013 gene locus_tag LOCUS_24460 5930 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 6857 5949 gene locus_tag LOCUS_24470 6857 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 10756 6857 gene locus_tag LOCUS_24480 10756 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 11225 10830 gene locus_tag LOCUS_24490 11225 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 11713 11180 gene locus_tag LOCUS_24500 11713 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 15692 11775 gene locus_tag LOCUS_24510 15692 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 15978 16574 gene locus_tag LOCUS_24520 15978 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 16787 16969 gene locus_tag LOCUS_24530 16787 16969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 17261 17043 gene locus_tag LOCUS_24540 17261 17043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 17819 17439 gene locus_tag LOCUS_24550 17819 17439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 18197 18448 gene locus_tag LOCUS_24560 18197 18448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 21906 18748 gene locus_tag LOCUS_24570 21906 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence049 127 960 gene locus_tag LOCUS_24580 127 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1161 1994 gene locus_tag LOCUS_24590 gene cysT 1161 1994 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555914.1 protein_id gnl|my_center|LOCUS_24590 1998 2873 gene locus_tag LOCUS_24600 gene cysW 1998 2873 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142072.1 protein_id gnl|my_center|LOCUS_24600 2883 3944 gene locus_tag LOCUS_24610 2883 3944 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027092.1 protein_id gnl|my_center|LOCUS_24610 4078 4770 gene locus_tag LOCUS_24620 4078 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 4877 5464 gene locus_tag LOCUS_24630 gene hisB 4877 5464 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_24630 5543 6184 gene locus_tag LOCUS_24640 gene hisH 5543 6184 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815798.1 protein_id gnl|my_center|LOCUS_24640 6197 6937 gene locus_tag LOCUS_24650 gene hisA 6197 6937 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_24650 6951 7709 gene locus_tag LOCUS_24660 gene hisF 6951 7709 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_24660 7709 8098 gene locus_tag LOCUS_24670 gene hisI 7709 8098 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201279.1 protein_id gnl|my_center|LOCUS_24670 8095 8418 gene locus_tag LOCUS_24680 8095 8418 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815805.1 protein_id gnl|my_center|LOCUS_24680 8534 8869 gene locus_tag LOCUS_24690 8534 8869 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_24690 8880 9098 gene locus_tag LOCUS_24700 gene tatA 8880 9098 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_24700 9105 9431 gene locus_tag LOCUS_24710 9105 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 9428 10150 gene locus_tag LOCUS_24720 gene tatC 9428 10150 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_24720 11474 10173 gene locus_tag LOCUS_24730 11474 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 11928 11449 gene locus_tag LOCUS_24740 11928 11449 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_24740 13237 12092 gene locus_tag LOCUS_24750 13237 12092 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_24750 13351 14097 gene locus_tag LOCUS_24760 13351 14097 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_24760 14418 15017 gene locus_tag LOCUS_24770 gene petA 14418 15017 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_24770 15020 16303 gene locus_tag LOCUS_24780 15020 16303 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_24780 16303 17031 gene locus_tag LOCUS_24790 16303 17031 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_24790 17104 17703 gene locus_tag LOCUS_24800 17104 17703 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_24800 17703 18095 gene locus_tag LOCUS_24810 17703 18095 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815821.1 protein_id gnl|my_center|LOCUS_24810 18291 19091 gene locus_tag LOCUS_24820 18291 19091 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_24820 19387 19653 gene locus_tag LOCUS_24830 19387 19653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 20674 20399 gene locus_tag LOCUS_24840 20674 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 20773 20848 gene locus_tag LOCUS_t00240 20773 20848 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20917 21001 gene locus_tag LOCUS_t00250 20917 21001 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 219 782 gene locus_tag LOCUS_24850 219 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 799 3525 gene locus_tag LOCUS_24860 799 3525 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461064.1 protein_id gnl|my_center|LOCUS_24860 3666 3965 gene locus_tag LOCUS_24870 gene yhbY 3666 3965 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 protein_id gnl|my_center|LOCUS_24870 4424 3972 gene locus_tag LOCUS_24880 4424 3972 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688914.1 protein_id gnl|my_center|LOCUS_24880 4928 4452 gene locus_tag LOCUS_24890 gene greA 4928 4452 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_24890 8335 5129 gene locus_tag LOCUS_24900 gene carB 8335 5129 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809588.1 protein_id gnl|my_center|LOCUS_24900 9591 8404 gene locus_tag LOCUS_24910 gene carA 9591 8404 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_24910 10536 9727 gene locus_tag LOCUS_24920 gene dapB 10536 9727 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557251.1 protein_id gnl|my_center|LOCUS_24920 11683 10688 gene locus_tag LOCUS_24930 11683 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 11753 12178 gene locus_tag LOCUS_24940 gene fur 11753 12178 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_24940 12296 13321 gene locus_tag LOCUS_24950 gene dusB 12296 13321 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_24950 13321 13563 gene locus_tag LOCUS_24960 13321 13563 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_24960 13596 15182 gene locus_tag LOCUS_24970 gene purH 13596 15182 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194285.1 protein_id gnl|my_center|LOCUS_24970 15205 16473 gene locus_tag LOCUS_24980 gene purD 15205 16473 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_24980 16518 17060 gene locus_tag LOCUS_24990 gene tsaC 16518 17060 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310090.1 protein_id gnl|my_center|LOCUS_24990 17065 17970 gene locus_tag LOCUS_25000 gene hemF 17065 17970 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930863.1 protein_id gnl|my_center|LOCUS_25000 18186 19592 gene locus_tag LOCUS_25010 18186 19592 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945788.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence051 <1 981 gene locus_tag LOCUS_25020 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071900.1:decaheme c-type cytochrome MtrA 1004 3484 gene locus_tag LOCUS_25030 1004 3484 CDS product MtrB/PioB family decaheme-associated outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071899.1 protein_id gnl|my_center|LOCUS_25030 3592 4185 gene locus_tag LOCUS_25040 gene napC 3592 4185 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_25040 4334 4948 gene locus_tag LOCUS_25050 gene ccmA 4334 4948 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888541.1 protein_id gnl|my_center|LOCUS_25050 4948 5616 gene locus_tag LOCUS_25060 gene ccmB 4948 5616 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815897.1 protein_id gnl|my_center|LOCUS_25060 5754 6497 gene locus_tag LOCUS_25070 gene ccmC 5754 6497 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_25070 6497 6688 gene locus_tag LOCUS_25080 6497 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 6685 7140 gene locus_tag LOCUS_25090 gene ccmE 6685 7140 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_25090 7277 9238 gene locus_tag LOCUS_25100 7277 9238 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_25100 9235 9765 gene locus_tag LOCUS_25110 9235 9765 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_25110 9762 10217 gene locus_tag LOCUS_25120 9762 10217 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_25120 10217 11419 gene locus_tag LOCUS_25130 gene ccmI 10217 11419 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070639.1 protein_id gnl|my_center|LOCUS_25130 12868 11513 gene locus_tag LOCUS_25140 gene glrR 12868 11513 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047323.1 protein_id gnl|my_center|LOCUS_25140 14171 12876 gene locus_tag LOCUS_25150 14171 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 14415 15194 gene locus_tag LOCUS_25160 14415 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 15198 17201 gene locus_tag LOCUS_25170 15198 17201 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_25170 18368 17625 gene locus_tag LOCUS_25180 18368 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence052 1360 3540 gene locus_tag LOCUS_25190 gene glgB 1360 3540 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_25190 3593 5236 gene locus_tag LOCUS_25200 gene pgi 3593 5236 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790033.1 protein_id gnl|my_center|LOCUS_25200 6658 5303 gene locus_tag LOCUS_25210 6658 5303 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 protein_id gnl|my_center|LOCUS_25210 17795 6741 gene locus_tag LOCUS_25220 17795 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25220 19402 17825 gene locus_tag LOCUS_25230 19402 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence053 162 566 gene locus_tag LOCUS_25240 162 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 576 1037 gene locus_tag LOCUS_25250 576 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 1049 1711 gene locus_tag LOCUS_25260 1049 1711 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 protein_id gnl|my_center|LOCUS_25260 1724 2377 gene locus_tag LOCUS_25270 gene pmrA 1724 2377 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_25270 2383 3723 gene locus_tag LOCUS_25280 2383 3723 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770760.1 protein_id gnl|my_center|LOCUS_25280 4032 5654 gene locus_tag LOCUS_25290 4032 5654 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_25290 6629 5709 gene locus_tag LOCUS_25300 6629 5709 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_25300 7369 6674 gene locus_tag LOCUS_25310 7369 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 8040 7366 gene locus_tag LOCUS_25320 8040 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 9690 8140 gene locus_tag LOCUS_25330 9690 8140 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115028.1 protein_id gnl|my_center|LOCUS_25330 11194 9953 gene locus_tag LOCUS_25340 11194 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 14813 11223 gene locus_tag LOCUS_25350 14813 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 15884 15582 gene locus_tag LOCUS_25360 15884 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 15769 16095 gene locus_tag LOCUS_25370 15769 16095 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_25370 16097 16330 gene locus_tag LOCUS_25380 16097 16330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679683.1 protein_id gnl|my_center|LOCUS_25380 17965 17057 gene locus_tag LOCUS_25390 17965 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 17972 18388 gene locus_tag LOCUS_25400 17972 18388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence054 870 16 gene locus_tag LOCUS_25410 870 16 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463499.1 protein_id gnl|my_center|LOCUS_25410 5143 857 gene locus_tag LOCUS_25420 5143 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 5507 6427 gene locus_tag LOCUS_25430 gene rsgA 5507 6427 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694242.1 protein_id gnl|my_center|LOCUS_25430 6446 7369 gene locus_tag LOCUS_25440 6446 7369 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_25440 9041 7524 gene locus_tag LOCUS_25450 gene gndA 9041 7524 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_25450 9258 9698 gene locus_tag LOCUS_25460 gene queD 9258 9698 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_25460 10404 9691 gene locus_tag LOCUS_25470 gene dnaQ 10404 9691 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_25470 12061 10433 gene locus_tag LOCUS_25480 12061 10433 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941702.1 protein_id gnl|my_center|LOCUS_25480 13485 12130 gene locus_tag LOCUS_25490 13485 12130 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266835.1 protein_id gnl|my_center|LOCUS_25490 14573 13611 gene locus_tag LOCUS_25500 14573 13611 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_25500 16591 14579 gene locus_tag LOCUS_25510 16591 14579 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867300.1 protein_id gnl|my_center|LOCUS_25510 18399 16636 gene locus_tag LOCUS_25520 18399 16636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence055 450 133 gene locus_tag LOCUS_25530 gene nirM 450 133 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_25530 800 1024 gene locus_tag LOCUS_25540 800 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2173 1064 gene locus_tag LOCUS_25550 2173 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2394 4085 gene locus_tag LOCUS_25560 gene glgP 2394 4085 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545636.1 protein_id gnl|my_center|LOCUS_25560 4221 5039 gene locus_tag LOCUS_25570 4221 5039 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948323.1 protein_id gnl|my_center|LOCUS_25570 5052 5312 gene locus_tag LOCUS_25580 5052 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 5318 5785 gene locus_tag LOCUS_25590 5318 5785 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943318.1 protein_id gnl|my_center|LOCUS_25590 7125 5782 gene locus_tag LOCUS_25600 7125 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 7330 7590 gene locus_tag LOCUS_25610 7330 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 8356 7577 gene locus_tag LOCUS_25620 8356 7577 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_25620 9661 8486 gene locus_tag LOCUS_25630 9661 8486 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195769.1 protein_id gnl|my_center|LOCUS_25630 9982 11307 gene locus_tag LOCUS_25640 9982 11307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 11326 11907 gene locus_tag LOCUS_25650 11326 11907 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_25650 12029 12457 gene locus_tag LOCUS_25660 12029 12457 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_25660 12666 13565 gene locus_tag LOCUS_25670 12666 13565 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957810.1 protein_id gnl|my_center|LOCUS_25670 13568 15073 gene locus_tag LOCUS_25680 13568 15073 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_25680 15670 17838 gene locus_tag LOCUS_25690 15670 17838 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence056 376 2007 gene locus_tag LOCUS_25700 376 2007 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_25700 2080 2874 gene locus_tag LOCUS_25710 2080 2874 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821314.1 protein_id gnl|my_center|LOCUS_25710 2949 4109 gene locus_tag LOCUS_25720 2949 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 5007 4120 gene locus_tag LOCUS_25730 5007 4120 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_25730 5861 5004 gene locus_tag LOCUS_25740 5861 5004 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938202.1 protein_id gnl|my_center|LOCUS_25740 7090 5924 gene locus_tag LOCUS_25750 gene motB 7090 5924 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038737.1 protein_id gnl|my_center|LOCUS_25750 7968 7114 gene locus_tag LOCUS_25760 gene motA 7968 7114 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_25760 8180 9574 gene locus_tag LOCUS_25770 8180 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 9574 10386 gene locus_tag LOCUS_25780 9574 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 10625 14074 gene locus_tag LOCUS_25790 gene dnaE 10625 14074 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 protein_id gnl|my_center|LOCUS_25790 14161 15129 gene locus_tag LOCUS_25800 14161 15129 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_25800 15098 16465 gene locus_tag LOCUS_25810 gene tilS 15098 16465 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026262905.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence057 403 327 gene locus_tag LOCUS_t00260 403 327 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 502 642 gene locus_tag LOCUS_25820 502 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 657 1199 gene locus_tag LOCUS_25830 657 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1252 2085 gene locus_tag LOCUS_25840 1252 2085 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929738.1 protein_id gnl|my_center|LOCUS_25840 2818 2000 gene locus_tag LOCUS_25850 2818 2000 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_25850 3783 2842 gene locus_tag LOCUS_25860 3783 2842 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_25860 4111 3836 gene locus_tag LOCUS_25870 4111 3836 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_25870 4380 4240 gene locus_tag LOCUS_25880 4380 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25880 4902 4486 gene locus_tag LOCUS_25890 4902 4486 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201632.1 protein_id gnl|my_center|LOCUS_25890 5526 4924 gene locus_tag LOCUS_25900 5526 4924 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_25900 5576 6829 gene locus_tag LOCUS_25910 5576 6829 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_25910 6822 7499 gene locus_tag LOCUS_25920 gene lolD 6822 7499 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_25920 7504 9891 gene locus_tag LOCUS_25930 7504 9891 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_25930 9926 10531 gene locus_tag LOCUS_25940 9926 10531 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_25940 10547 10975 gene locus_tag LOCUS_25950 10547 10975 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931122.1 protein_id gnl|my_center|LOCUS_25950 10986 12731 gene locus_tag LOCUS_25960 gene msbA 10986 12731 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957851.1 protein_id gnl|my_center|LOCUS_25960 12784 13725 gene locus_tag LOCUS_25970 gene lpxK 12784 13725 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 protein_id gnl|my_center|LOCUS_25970 13725 13907 gene locus_tag LOCUS_25980 13725 13907 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_25980 13909 14673 gene locus_tag LOCUS_25990 gene kdsB 13909 14673 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_25990 14695 15963 gene locus_tag LOCUS_26000 14695 15963 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_26000 16051 16127 gene locus_tag LOCUS_t00270 16051 16127 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence058 3303 1210 gene locus_tag LOCUS_26010 gene fusA 3303 1210 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806902.1 protein_id gnl|my_center|LOCUS_26010 3815 3345 gene locus_tag LOCUS_26020 gene rpsG 3815 3345 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215391.1 protein_id gnl|my_center|LOCUS_26020 4215 3838 gene locus_tag LOCUS_26030 gene rpsL 4215 3838 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218431.1 protein_id gnl|my_center|LOCUS_26030 8537 4299 gene locus_tag LOCUS_26040 gene rpoC 8537 4299 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521902.1 protein_id gnl|my_center|LOCUS_26040 12804 8635 gene locus_tag LOCUS_26050 gene rpoB 12804 8635 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_26050 13304 12924 gene locus_tag LOCUS_26060 gene rplL 13304 12924 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_26060 13862 13338 gene locus_tag LOCUS_26070 gene rplJ 13862 13338 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_26070 14833 14138 gene locus_tag LOCUS_26080 gene rplA 14833 14138 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_26080 15266 14835 gene locus_tag LOCUS_26090 gene rplK 15266 14835 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_26090 15905 15369 gene locus_tag LOCUS_26100 gene nusG 15905 15369 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_26100 16252 15905 gene locus_tag LOCUS_26110 gene secE 16252 15905 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_26110 16355 16280 gene locus_tag LOCUS_t00280 16355 16280 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence059 1498 416 gene locus_tag LOCUS_26120 1498 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 1849 2202 gene locus_tag LOCUS_26130 1849 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2422 2751 gene locus_tag LOCUS_26140 2422 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2885 2682 gene locus_tag LOCUS_26150 2885 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 4378 2924 gene locus_tag LOCUS_26160 4378 2924 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_26160 5085 4375 gene locus_tag LOCUS_26170 5085 4375 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_26170 6289 5087 gene locus_tag LOCUS_26180 6289 5087 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_26180 7437 6286 gene locus_tag LOCUS_26190 7437 6286 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 protein_id gnl|my_center|LOCUS_26190 8042 7437 gene locus_tag LOCUS_26200 gene slmA 8042 7437 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 protein_id gnl|my_center|LOCUS_26200 8728 10239 gene locus_tag LOCUS_26210 gene ccoG 8728 10239 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 protein_id gnl|my_center|LOCUS_26210 10267 11091 gene locus_tag LOCUS_26220 10267 11091 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_26220 11156 11536 gene locus_tag LOCUS_26230 11156 11536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 12044 11655 gene locus_tag LOCUS_26240 12044 11655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 12130 12318 gene locus_tag LOCUS_26250 12130 12318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 13456 13190 gene locus_tag LOCUS_26260 13456 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 13838 13659 gene locus_tag LOCUS_26270 13838 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 13962 14198 gene locus_tag LOCUS_26280 13962 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 15272 14388 gene locus_tag LOCUS_26290 15272 14388 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521366.1 protein_id gnl|my_center|LOCUS_26290 15542 15363 gene locus_tag LOCUS_26300 15542 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence060 5232 3418 gene locus_tag LOCUS_26310 gene treZ 5232 3418 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388264.1 protein_id gnl|my_center|LOCUS_26310 7376 5247 gene locus_tag LOCUS_26320 gene glgX 7376 5247 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113651.1 protein_id gnl|my_center|LOCUS_26320 10832 7464 gene locus_tag LOCUS_26330 gene treS 10832 7464 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389295.1 protein_id gnl|my_center|LOCUS_26330 12845 10842 gene locus_tag LOCUS_26340 12845 10842 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_26340 14758 12842 gene locus_tag LOCUS_26350 gene glgB 14758 12842 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence061 <1 532 gene locus_tag LOCUS_26360 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005679031.1:ADP-ribosylglycohydrolase family protein 571 801 gene locus_tag LOCUS_26370 571 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 975 2633 gene locus_tag LOCUS_26380 975 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 4240 2654 gene locus_tag LOCUS_26390 4240 2654 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212784779.1 protein_id gnl|my_center|LOCUS_26390 5501 4578 gene locus_tag LOCUS_26400 gene pdxA 5501 4578 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_26400 6907 5567 gene locus_tag LOCUS_26410 6907 5567 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079997984.1 protein_id gnl|my_center|LOCUS_26410 9303 6904 gene locus_tag LOCUS_26420 9303 6904 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931411.1 protein_id gnl|my_center|LOCUS_26420 9518 10513 gene locus_tag LOCUS_26430 9518 10513 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064974.1 protein_id gnl|my_center|LOCUS_26430 10674 11333 gene locus_tag LOCUS_26440 10674 11333 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence062 103 315 gene locus_tag LOCUS_26450 103 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 305 454 gene locus_tag LOCUS_26460 305 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 507 692 gene locus_tag LOCUS_26470 507 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 986 1297 gene locus_tag LOCUS_26480 986 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 2206 2832 gene locus_tag LOCUS_26490 2206 2832 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_26490 2829 3113 gene locus_tag LOCUS_26500 2829 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 3489 5324 gene locus_tag LOCUS_26510 gene glsA 3489 5324 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087566.1 protein_id gnl|my_center|LOCUS_26510 6179 5376 gene locus_tag LOCUS_26520 6179 5376 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530212.1 protein_id gnl|my_center|LOCUS_26520 6537 6196 gene locus_tag LOCUS_26530 6537 6196 CDS product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530211.1 protein_id gnl|my_center|LOCUS_26530 7260 6571 gene locus_tag LOCUS_26540 7260 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 7700 9373 gene locus_tag LOCUS_26550 7700 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 9384 9710 gene locus_tag LOCUS_26560 9384 9710 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_26560 9774 10373 gene locus_tag LOCUS_26570 gene recR 9774 10373 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_26570 11206 11517 gene locus_tag LOCUS_26580 11206 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 11519 11743 gene locus_tag LOCUS_26590 11519 11743 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_26590 12186 12110 gene locus_tag LOCUS_t00290 12186 12110 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 42 1058 gene locus_tag LOCUS_26600 42 1058 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463475.1 protein_id gnl|my_center|LOCUS_26600 1324 1719 gene locus_tag LOCUS_26610 1324 1719 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188446.1 protein_id gnl|my_center|LOCUS_26610 1722 3059 gene locus_tag LOCUS_26620 1722 3059 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_26620 3983 3279 gene locus_tag LOCUS_26630 3983 3279 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190878.1 protein_id gnl|my_center|LOCUS_26630 4342 5364 gene locus_tag LOCUS_26640 gene galE 4342 5364 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_26640 6313 5474 gene locus_tag LOCUS_26650 6313 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 7457 6783 gene locus_tag LOCUS_26660 gene radC 7457 6783 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_26660 7507 8721 gene locus_tag LOCUS_26670 gene coaBC 7507 8721 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_26670 8711 9163 gene locus_tag LOCUS_26680 gene dut 8711 9163 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186718.1 protein_id gnl|my_center|LOCUS_26680 9327 9563 gene locus_tag LOCUS_26690 gene rpmB 9327 9563 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810297.1 protein_id gnl|my_center|LOCUS_26690 9576 9731 gene locus_tag LOCUS_26700 gene rpmG 9576 9731 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_26700 9934 11163 gene locus_tag LOCUS_26710 9934 11163 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162518500.1 protein_id gnl|my_center|LOCUS_26710 <11754 11189 gene locus_tag LOCUS_26720 <11754 11189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951146.1:FAD/FMN-binding oxidoreductase >Feature sequence064 264 1346 gene locus_tag LOCUS_26730 264 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2785 1439 gene locus_tag LOCUS_26740 2785 1439 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113107.1 protein_id gnl|my_center|LOCUS_26740 4181 2793 gene locus_tag LOCUS_26750 4181 2793 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_26750 5932 4202 gene locus_tag LOCUS_26760 gene aprD 5932 4202 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_26760 7662 5929 gene locus_tag LOCUS_26770 7662 5929 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387750.1 protein_id gnl|my_center|LOCUS_26770 8291 7659 gene locus_tag LOCUS_26780 8291 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 8875 8378 gene locus_tag LOCUS_26790 8875 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 9684 8893 gene locus_tag LOCUS_26800 9684 8893 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387737.1 protein_id gnl|my_center|LOCUS_26800 10001 9780 gene locus_tag LOCUS_26810 10001 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 10189 10410 gene locus_tag LOCUS_26820 10189 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 10410 10736 gene locus_tag LOCUS_26830 10410 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 11052 11300 gene locus_tag LOCUS_26840 11052 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 >Feature sequence065 803 165 gene locus_tag LOCUS_26850 803 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1237 2106 gene locus_tag LOCUS_26860 1237 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 2420 2283 gene locus_tag LOCUS_26870 2420 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 4489 4767 gene locus_tag LOCUS_26880 4489 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4760 7492 gene locus_tag LOCUS_26890 4760 7492 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_26890 7626 8438 gene locus_tag LOCUS_26900 7626 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 8450 10531 gene locus_tag LOCUS_26910 8450 10531 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_26910 <11574 10565 gene locus_tag LOCUS_26920 <11574 10565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193365322.1:DNA cytosine methyltransferase >Feature sequence066 2003 270 gene locus_tag LOCUS_26930 2003 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 2248 2733 gene locus_tag LOCUS_26940 2248 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 5478 2833 gene locus_tag LOCUS_26950 5478 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 5423 5824 gene locus_tag LOCUS_26960 5423 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 5918 7060 gene locus_tag LOCUS_26970 5918 7060 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_26970 7088 7849 gene locus_tag LOCUS_26980 7088 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 7900 8442 gene locus_tag LOCUS_26990 7900 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 8536 10551 gene locus_tag LOCUS_27000 8536 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 10584 11291 gene locus_tag LOCUS_27010 10584 11291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence067 <1 747 gene locus_tag LOCUS_27020 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097377.1:PIN domain-containing protein 765 3896 gene locus_tag LOCUS_27030 765 3896 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_27030 3893 4687 gene locus_tag LOCUS_27040 3893 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 4697 5494 gene locus_tag LOCUS_27050 4697 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 5858 5529 gene locus_tag LOCUS_27060 5858 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 7230 5809 gene locus_tag LOCUS_27070 7230 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 7655 7227 gene locus_tag LOCUS_27080 7655 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 8848 7673 gene locus_tag LOCUS_27090 8848 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 9827 9072 gene locus_tag LOCUS_27100 9827 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 10205 10020 gene locus_tag LOCUS_27110 10205 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 10377 10192 gene locus_tag LOCUS_27120 10377 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 10351 10713 gene locus_tag LOCUS_27130 10351 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 10834 11271 gene locus_tag LOCUS_27140 10834 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence068 <1 2253 gene locus_tag LOCUS_27150 <1 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113014.1:PAS domain S-box protein note possible pseudo, frameshifted 2253 2930 gene locus_tag LOCUS_27160 2253 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2939 3340 gene locus_tag LOCUS_27170 2939 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 3545 5209 gene locus_tag LOCUS_27180 3545 5209 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943573.1 protein_id gnl|my_center|LOCUS_27180 6553 5327 gene locus_tag LOCUS_27190 6553 5327 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_27190 7723 6560 gene locus_tag LOCUS_27200 gene metK 7723 6560 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_27200 7799 8650 gene locus_tag LOCUS_27210 7799 8650 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_27210 8714 9550 gene locus_tag LOCUS_27220 gene dapF 8714 9550 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_27220 9565 10227 gene locus_tag LOCUS_27230 9565 10227 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807181.1 protein_id gnl|my_center|LOCUS_27230 10228 11103 gene locus_tag LOCUS_27240 gene xerC 10228 11103 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038710.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence069 328 1101 gene locus_tag LOCUS_27250 gene tpiA 328 1101 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813996.1 protein_id gnl|my_center|LOCUS_27250 2037 1186 gene locus_tag LOCUS_27260 2037 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 2996 2079 gene locus_tag LOCUS_27270 2996 2079 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_27270 3313 2993 gene locus_tag LOCUS_27280 3313 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3932 3495 gene locus_tag LOCUS_27290 3932 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 4194 5123 gene locus_tag LOCUS_27300 4194 5123 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192881.1 protein_id gnl|my_center|LOCUS_27300 5595 5062 gene locus_tag LOCUS_27310 5595 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 5778 6440 gene locus_tag LOCUS_27320 5778 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 6484 8163 gene locus_tag LOCUS_27330 gene ubiB 6484 8163 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_27330 8189 8869 gene locus_tag LOCUS_27340 gene ispD 8189 8869 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191584.1 protein_id gnl|my_center|LOCUS_27340 8866 9345 gene locus_tag LOCUS_27350 gene ispF 8866 9345 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_27350 9466 9735 gene locus_tag LOCUS_27360 9466 9735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 10424 10008 gene locus_tag LOCUS_27370 10424 10008 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_27370 10675 10421 gene locus_tag LOCUS_27380 10675 10421 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101799467.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence070 1411 326 gene locus_tag LOCUS_27390 gene cheB 1411 326 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_27390 3492 1408 gene locus_tag LOCUS_27400 3492 1408 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256740.1 protein_id gnl|my_center|LOCUS_27400 4971 3520 gene locus_tag LOCUS_27410 4971 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 6008 4986 gene locus_tag LOCUS_27420 6008 4986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 7413 5977 gene locus_tag LOCUS_27430 7413 5977 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_27430 7725 7558 gene locus_tag LOCUS_27440 7725 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 7711 8808 gene locus_tag LOCUS_27450 7711 8808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 9072 9293 gene locus_tag LOCUS_27460 9072 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 9411 9695 gene locus_tag LOCUS_27470 9411 9695 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_27470 9707 10012 gene locus_tag LOCUS_27480 9707 10012 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113527.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence071 979 398 gene locus_tag LOCUS_27490 979 398 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217433129.1 protein_id gnl|my_center|LOCUS_27490 1060 2037 gene locus_tag LOCUS_27500 1060 2037 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_27500 2030 2227 gene locus_tag LOCUS_27510 2030 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 2416 2141 gene locus_tag LOCUS_27520 2416 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 2512 2793 gene locus_tag LOCUS_27530 2512 2793 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943076.1 protein_id gnl|my_center|LOCUS_27530 3255 3452 gene locus_tag LOCUS_27540 3255 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 4891 3500 gene locus_tag LOCUS_27550 4891 3500 CDS product sensor histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_27550 5565 4888 gene locus_tag LOCUS_27560 5565 4888 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_27560 8401 5588 gene locus_tag LOCUS_27570 gene uvrA 8401 5588 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_27570 8497 9858 gene locus_tag LOCUS_27580 8497 9858 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002251980.1 protein_id gnl|my_center|LOCUS_27580 9861 10346 gene locus_tag LOCUS_27590 gene ssb 9861 10346 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence072 2607 685 gene locus_tag LOCUS_27600 2607 685 CDS product LapD/MoxY N-terminal periplasmic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809044.1 protein_id gnl|my_center|LOCUS_27600 3222 2635 gene locus_tag LOCUS_27610 3222 2635 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809046.1 protein_id gnl|my_center|LOCUS_27610 3395 4834 gene locus_tag LOCUS_27620 3395 4834 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809058.1 protein_id gnl|my_center|LOCUS_27620 4855 5580 gene locus_tag LOCUS_27630 4855 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 6592 5666 gene locus_tag LOCUS_27640 6592 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 6965 6780 gene locus_tag LOCUS_27650 6965 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 7166 7693 gene locus_tag LOCUS_27660 7166 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 7949 8695 gene locus_tag LOCUS_27670 7949 8695 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_27670 8685 9929 gene locus_tag LOCUS_27680 8685 9929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence073 316 1128 gene locus_tag LOCUS_27690 316 1128 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266627.1 protein_id gnl|my_center|LOCUS_27690 1133 1618 gene locus_tag LOCUS_27700 gene cheD 1133 1618 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704960.1 protein_id gnl|my_center|LOCUS_27700 1618 2709 gene locus_tag LOCUS_27710 1618 2709 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704959.1 protein_id gnl|my_center|LOCUS_27710 2729 3316 gene locus_tag LOCUS_27720 gene cheD 2729 3316 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_27720 3835 3347 gene locus_tag LOCUS_27730 3835 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 4403 3966 gene locus_tag LOCUS_27740 4403 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 4616 5029 gene locus_tag LOCUS_27750 4616 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 5119 5490 gene locus_tag LOCUS_27760 5119 5490 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_27760 5490 5969 gene locus_tag LOCUS_27770 5490 5969 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_27770 5989 6897 gene locus_tag LOCUS_27780 5989 6897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_27780 6894 7676 gene locus_tag LOCUS_27790 6894 7676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_27790 9123 7711 gene locus_tag LOCUS_27800 gene dbpA 9123 7711 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203996.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence074 95 406 gene locus_tag LOCUS_27810 95 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 664 3729 gene locus_tag LOCUS_27820 664 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 4207 3899 gene locus_tag LOCUS_27830 4207 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 4474 4782 gene locus_tag LOCUS_27840 4474 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 4898 5119 gene locus_tag LOCUS_27850 4898 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 7523 5157 gene locus_tag LOCUS_27860 7523 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 8048 7527 gene locus_tag LOCUS_27870 gene bcp 8048 7527 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_27870 8351 8426 gene locus_tag LOCUS_t00300 8351 8426 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8913 8617 gene locus_tag LOCUS_27880 8913 8617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 >Feature sequence075 416 159 gene locus_tag LOCUS_27890 416 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 892 2094 gene locus_tag LOCUS_27900 892 2094 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_27900 3799 2201 gene locus_tag LOCUS_27910 3799 2201 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294598.1 protein_id gnl|my_center|LOCUS_27910 5170 3815 gene locus_tag LOCUS_27920 5170 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 6124 5339 gene locus_tag LOCUS_27930 6124 5339 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 protein_id gnl|my_center|LOCUS_27930 6532 6605 gene locus_tag LOCUS_t00310 6532 6605 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7608 7390 gene locus_tag LOCUS_27940 7608 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 7991 7632 gene locus_tag LOCUS_27950 7991 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 8624 8202 gene locus_tag LOCUS_27960 8624 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 8979 9055 gene locus_tag LOCUS_t00320 8979 9055 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 476 1165 gene locus_tag LOCUS_27970 476 1165 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 protein_id gnl|my_center|LOCUS_27970 1425 2201 gene locus_tag LOCUS_27980 1425 2201 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_27980 2703 2978 gene locus_tag LOCUS_27990 2703 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3115 4053 gene locus_tag LOCUS_28000 3115 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 4102 4698 gene locus_tag LOCUS_28010 4102 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 4761 4955 gene locus_tag LOCUS_28020 4761 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 5398 6192 gene locus_tag LOCUS_28030 5398 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 6577 7050 gene locus_tag LOCUS_28040 6577 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 7076 7864 gene locus_tag LOCUS_28050 7076 7864 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207854.1 protein_id gnl|my_center|LOCUS_28050 7872 8504 gene locus_tag LOCUS_28060 7872 8504 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943685.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence077 872 1105 gene locus_tag LOCUS_28070 872 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 4590 1906 gene locus_tag LOCUS_28080 4590 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 4877 4593 gene locus_tag LOCUS_28090 4877 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 5326 5239 gene locus_tag LOCUS_t00330 5326 5239 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7757 5514 gene locus_tag LOCUS_28100 7757 5514 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence078 <1 595 gene locus_tag LOCUS_28110 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947795.1:type-F conjugative transfer system pilin assembly protein TraF 608 2011 gene locus_tag LOCUS_28120 gene traH 608 2011 CDS product conjugal transfer pilus assembly protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309243.1 protein_id gnl|my_center|LOCUS_28120 2014 5424 gene locus_tag LOCUS_28130 2014 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 5777 5493 gene locus_tag LOCUS_28140 5777 5493 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_28140 6100 5807 gene locus_tag LOCUS_28150 6100 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 6359 6084 gene locus_tag LOCUS_28160 6359 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 7147 6521 gene locus_tag LOCUS_28170 7147 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 7428 7186 gene locus_tag LOCUS_28180 7428 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 8069 7431 gene locus_tag LOCUS_28190 8069 7431 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547672.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence079 656 204 gene locus_tag LOCUS_28200 656 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 1223 804 gene locus_tag LOCUS_28210 1223 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 1470 1210 gene locus_tag LOCUS_28220 1470 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1618 1956 gene locus_tag LOCUS_28230 1618 1956 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_28230 1953 2267 gene locus_tag LOCUS_28240 1953 2267 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_28240 2903 2304 gene locus_tag LOCUS_28250 2903 2304 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162012.1 protein_id gnl|my_center|LOCUS_28250 3115 3420 gene locus_tag LOCUS_28260 3115 3420 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211161.1 protein_id gnl|my_center|LOCUS_28260 3417 3779 gene locus_tag LOCUS_28270 3417 3779 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216048.1 protein_id gnl|my_center|LOCUS_28270 3724 3924 gene locus_tag LOCUS_28280 3724 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 4575 3916 gene locus_tag LOCUS_28290 4575 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 5018 5704 gene locus_tag LOCUS_28300 5018 5704 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 protein_id gnl|my_center|LOCUS_28300 5715 6128 gene locus_tag LOCUS_28310 5715 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 7545 6208 gene locus_tag LOCUS_28320 7545 6208 CDS product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194484.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence080 5004 115 gene locus_tag LOCUS_28330 5004 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 6163 5090 gene locus_tag LOCUS_28340 6163 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 7530 6454 gene locus_tag LOCUS_28350 7530 6454 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113001.1 protein_id gnl|my_center|LOCUS_28350 >Feature sequence081 195 2741 gene locus_tag LOCUS_28360 195 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3123 2908 gene locus_tag LOCUS_28370 3123 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3561 3962 gene locus_tag LOCUS_28380 3561 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 3959 6247 gene locus_tag LOCUS_28390 3959 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence082 1190 135 gene locus_tag LOCUS_28400 1190 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 2212 1187 gene locus_tag LOCUS_28410 gene dmpG 2212 1187 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749470.1 protein_id gnl|my_center|LOCUS_28410 3086 2199 gene locus_tag LOCUS_28420 3086 2199 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552044.1 protein_id gnl|my_center|LOCUS_28420 4785 3136 gene locus_tag LOCUS_28430 gene rfbH 4785 3136 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_28430 5002 4775 gene locus_tag LOCUS_28440 5002 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 6006 5008 gene locus_tag LOCUS_28450 gene rfbG 6006 5008 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_28450 6845 6072 gene locus_tag LOCUS_28460 gene rfbF 6845 6072 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_28460 7388 6879 gene locus_tag LOCUS_28470 7388 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence083 516 767 gene locus_tag LOCUS_28480 516 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 764 1222 gene locus_tag LOCUS_28490 764 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1200 1976 gene locus_tag LOCUS_28500 1200 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1973 2707 gene locus_tag LOCUS_28510 1973 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2754 3422 gene locus_tag LOCUS_28520 2754 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 3419 4858 gene locus_tag LOCUS_28530 3419 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 4830 5585 gene locus_tag LOCUS_28540 4830 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 5698 5868 gene locus_tag LOCUS_28550 5698 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 5870 6163 gene locus_tag LOCUS_28560 5870 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 6156 6359 gene locus_tag LOCUS_28570 6156 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 6463 7194 gene locus_tag LOCUS_28580 6463 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence084 174 464 gene locus_tag LOCUS_28590 174 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 461 811 gene locus_tag LOCUS_28600 461 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 1109 1357 gene locus_tag LOCUS_28610 1109 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 1468 1764 gene locus_tag LOCUS_28620 1468 1764 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940838.1 protein_id gnl|my_center|LOCUS_28620 1761 2123 gene locus_tag LOCUS_28630 1761 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 2211 2333 gene locus_tag LOCUS_28640 2211 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 3525 3316 gene locus_tag LOCUS_28650 3525 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3564 3815 gene locus_tag LOCUS_28660 3564 3815 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804328.1 protein_id gnl|my_center|LOCUS_28660 3812 4207 gene locus_tag LOCUS_28670 3812 4207 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036811.1 protein_id gnl|my_center|LOCUS_28670 4459 4265 gene locus_tag LOCUS_28680 4459 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 5238 4810 gene locus_tag LOCUS_28690 5238 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 5477 5241 gene locus_tag LOCUS_28700 5477 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 6129 5899 gene locus_tag LOCUS_28710 6129 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 6198 6644 gene locus_tag LOCUS_28720 6198 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 6641 6916 gene locus_tag LOCUS_28730 6641 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence085 48 245 gene locus_tag LOCUS_28740 48 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 332 868 gene locus_tag LOCUS_28750 332 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1005 1844 gene locus_tag LOCUS_28760 1005 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 4976 1902 gene locus_tag LOCUS_28770 4976 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 6156 4966 gene locus_tag LOCUS_28780 6156 4966 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152802079.1 protein_id gnl|my_center|LOCUS_28780 7041 6166 gene locus_tag LOCUS_28790 7041 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence086 842 1693 gene locus_tag LOCUS_28800 842 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1832 4402 gene locus_tag LOCUS_28810 1832 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 4986 4432 gene locus_tag LOCUS_28820 4986 4432 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 protein_id gnl|my_center|LOCUS_28820 6645 4996 gene locus_tag LOCUS_28830 6645 4996 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770005.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence087 967 1650 gene locus_tag LOCUS_28840 967 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 1747 2316 gene locus_tag LOCUS_28850 1747 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 3452 6568 gene locus_tag LOCUS_28860 3452 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence088 894 3041 gene locus_tag LOCUS_28870 894 3041 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836187.1 protein_id gnl|my_center|LOCUS_28870 3062 4384 gene locus_tag LOCUS_28880 3062 4384 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836186.1 protein_id gnl|my_center|LOCUS_28880 4461 6395 gene locus_tag LOCUS_28890 4461 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 6527 6964 gene locus_tag LOCUS_28900 6527 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 6973 7134 gene locus_tag LOCUS_28910 6973 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 >Feature sequence089 <1 699 gene locus_tag LOCUS_28920 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582972.1:SLBB domain-containing protein 699 2141 gene locus_tag LOCUS_28930 699 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2141 3007 gene locus_tag LOCUS_28940 gene epsG 2141 3007 CDS product chain length determinant protein tyrosine kinase EpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106760242.1 protein_id gnl|my_center|LOCUS_28940 3591 3235 gene locus_tag LOCUS_28950 3591 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 3961 3638 gene locus_tag LOCUS_28960 3961 3638 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_28960 4317 3958 gene locus_tag LOCUS_28970 4317 3958 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_28970 4553 4897 gene locus_tag LOCUS_28980 4553 4897 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669261.1 protein_id gnl|my_center|LOCUS_28980 5418 5699 gene locus_tag LOCUS_28990 5418 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 5809 6660 gene locus_tag LOCUS_29000 gene xrt 5809 6660 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence090 128 820 gene locus_tag LOCUS_29010 gene rpiA 128 820 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_29010 1406 900 gene locus_tag LOCUS_29020 1406 900 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931093.1 protein_id gnl|my_center|LOCUS_29020 1559 2575 gene locus_tag LOCUS_29030 1559 2575 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_29030 2638 3324 gene locus_tag LOCUS_29040 2638 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_29040 4131 3373 gene locus_tag LOCUS_29050 gene rlmB 4131 3373 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191786.1 protein_id gnl|my_center|LOCUS_29050 6467 4128 gene locus_tag LOCUS_29060 gene rnr 6467 4128 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931522.1 protein_id gnl|my_center|LOCUS_29060 6438 6522 gene locus_tag LOCUS_t00340 6438 6522 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 141 1325 gene locus_tag LOCUS_29070 141 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 1956 1381 gene locus_tag LOCUS_29080 1956 1381 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_29080 3025 2081 gene locus_tag LOCUS_29090 3025 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 3804 3385 gene locus_tag LOCUS_29100 3804 3385 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_29100 4040 3801 gene locus_tag LOCUS_29110 4040 3801 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_29110 4522 4157 gene locus_tag LOCUS_29120 4522 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 4937 5161 gene locus_tag LOCUS_29130 4937 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 5158 5835 gene locus_tag LOCUS_29140 5158 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 5851 6375 gene locus_tag LOCUS_29150 5851 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29150 6486 6731 gene locus_tag LOCUS_29160 6486 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 >Feature sequence092 387 1931 gene locus_tag LOCUS_29170 gene vceB 387 1931 CDS product multidrug efflux MFS transporter permease subunit VceB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019055.1 protein_id gnl|my_center|LOCUS_29170 2085 3071 gene locus_tag LOCUS_29180 2085 3071 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_29180 3235 4131 gene locus_tag LOCUS_29190 3235 4131 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942175.1 protein_id gnl|my_center|LOCUS_29190 >Feature sequence093 270 82 gene locus_tag LOCUS_29200 270 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 361 816 gene locus_tag LOCUS_29210 361 816 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443925.1 protein_id gnl|my_center|LOCUS_29210 832 2229 gene locus_tag LOCUS_29220 832 2229 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_29220 2289 3455 gene locus_tag LOCUS_29230 gene lplT 2289 3455 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_29230 4818 3493 gene locus_tag LOCUS_29240 4818 3493 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086508.1 protein_id gnl|my_center|LOCUS_29240 5478 4948 gene locus_tag LOCUS_29250 5478 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 6526 5606 gene locus_tag LOCUS_29260 6526 5606 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174003.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence094 <1 613 gene locus_tag LOCUS_29270 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704392.1:two-component system response regulator 901 641 gene locus_tag LOCUS_29280 gene minE 901 641 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 protein_id gnl|my_center|LOCUS_29280 1720 905 gene locus_tag LOCUS_29290 gene minD 1720 905 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185427.1 protein_id gnl|my_center|LOCUS_29290 2450 1749 gene locus_tag LOCUS_29300 gene minC 2450 1749 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522312.1 protein_id gnl|my_center|LOCUS_29300 3025 4566 gene locus_tag LOCUS_29310 3025 4566 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138513118.1 protein_id gnl|my_center|LOCUS_29310 4594 5172 gene locus_tag LOCUS_29320 4594 5172 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198721.1 protein_id gnl|my_center|LOCUS_29320 5378 5169 gene locus_tag LOCUS_29330 5378 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 6229 5378 gene locus_tag LOCUS_29340 6229 5378 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967264.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence095 278 556 gene locus_tag LOCUS_29350 278 556 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975041.1 protein_id gnl|my_center|LOCUS_29350 553 867 gene locus_tag LOCUS_29360 553 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 1061 1309 gene locus_tag LOCUS_29370 1061 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1318 2085 gene locus_tag LOCUS_29380 1318 2085 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_29380 2400 2218 gene locus_tag LOCUS_29390 2400 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2444 2701 gene locus_tag LOCUS_29400 2444 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2913 2620 gene locus_tag LOCUS_29410 2913 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 3072 3569 gene locus_tag LOCUS_29420 3072 3569 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046236777.1 protein_id gnl|my_center|LOCUS_29420 3939 3697 gene locus_tag LOCUS_29430 3939 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 4162 3839 gene locus_tag LOCUS_29440 4162 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 4471 4773 gene locus_tag LOCUS_29450 4471 4773 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809515.1 protein_id gnl|my_center|LOCUS_29450 4776 5177 gene locus_tag LOCUS_29460 4776 5177 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809516.1 protein_id gnl|my_center|LOCUS_29460 5179 5328 gene locus_tag LOCUS_29470 5179 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 5490 5750 gene locus_tag LOCUS_29480 5490 5750 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_29480 5766 6029 gene locus_tag LOCUS_29490 5766 6029 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626074.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence096 440 1036 gene locus_tag LOCUS_29500 440 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 1920 1033 gene locus_tag LOCUS_29510 1920 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 2399 1971 gene locus_tag LOCUS_29520 2399 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2733 2512 gene locus_tag LOCUS_29530 2733 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 4474 5526 gene locus_tag LOCUS_29540 4474 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 6031 5633 gene locus_tag LOCUS_29550 6031 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 >Feature sequence097 2086 2841 gene locus_tag LOCUS_29560 2086 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 2867 4411 gene locus_tag LOCUS_29570 2867 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence098 903 142 gene locus_tag LOCUS_29580 903 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1157 1846 gene locus_tag LOCUS_29590 1157 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 2130 3038 gene locus_tag LOCUS_29600 2130 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 3240 4121 gene locus_tag LOCUS_29610 3240 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 4118 5656 gene locus_tag LOCUS_29620 4118 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence099 1204 653 gene locus_tag LOCUS_29630 1204 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 1421 2665 gene locus_tag LOCUS_29640 1421 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2662 3603 gene locus_tag LOCUS_29650 2662 3603 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_29650 3596 4591 gene locus_tag LOCUS_29660 3596 4591 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 protein_id gnl|my_center|LOCUS_29660 5525 4665 gene locus_tag LOCUS_29670 5525 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence100 3733 3939 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggcgcggggtcagttctaa 4553 4104 gene locus_tag LOCUS_29680 4553 4104 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039937.1 protein_id gnl|my_center|LOCUS_29680 5119 4577 gene locus_tag LOCUS_29690 5119 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence101 410 159 gene locus_tag LOCUS_29700 410 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 1043 1549 gene locus_tag LOCUS_29710 1043 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 1719 2558 gene locus_tag LOCUS_29720 1719 2558 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405327.1 protein_id gnl|my_center|LOCUS_29720 3171 2782 gene locus_tag LOCUS_29730 3171 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 5037 3217 gene locus_tag LOCUS_29740 5037 3217 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971127.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence102 578 1852 gene locus_tag LOCUS_29750 578 1852 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975810.1 protein_id gnl|my_center|LOCUS_29750 1869 2447 gene locus_tag LOCUS_29760 1869 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 3616 2657 gene locus_tag LOCUS_29770 3616 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 <5115 3800 gene locus_tag LOCUS_29780 <5115 3800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483023.1:site-specific integrase >Feature sequence103 1476 1030 gene locus_tag LOCUS_29790 gene nuoE 1476 1030 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_29790 4183 1520 gene locus_tag LOCUS_29800 gene fdhF 4183 1520 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_29800 4329 4484 gene locus_tag LOCUS_29810 4329 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence104 259 531 gene locus_tag LOCUS_29820 259 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 654 1193 gene locus_tag LOCUS_29830 654 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1087 1473 gene locus_tag LOCUS_29840 1087 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 1560 2438 gene locus_tag LOCUS_29850 1560 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 2438 4081 gene locus_tag LOCUS_29860 2438 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 4473 4114 gene locus_tag LOCUS_29870 gene tnpB 4473 4114 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385717.1 protein_id gnl|my_center|LOCUS_29870 4889 4470 gene locus_tag LOCUS_29880 4889 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 >Feature sequence105 63 752 gene locus_tag LOCUS_29890 63 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 755 1768 gene locus_tag LOCUS_29900 755 1768 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 protein_id gnl|my_center|LOCUS_29900 2079 3077 gene locus_tag LOCUS_29910 2079 3077 CDS product tripartite tricarboxylate transporter substrate binding protein BugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063889.1 protein_id gnl|my_center|LOCUS_29910 3127 4491 gene locus_tag LOCUS_29920 3127 4491 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_29920 >Feature sequence106 <1 1627 gene locus_tag LOCUS_29930 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein 2463 1882 gene locus_tag LOCUS_29940 gene sodB 2463 1882 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185841.1 protein_id gnl|my_center|LOCUS_29940 2893 3891 gene locus_tag LOCUS_29950 2893 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 4414 3899 gene locus_tag LOCUS_29960 4414 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 >Feature sequence107 360 1334 gene locus_tag LOCUS_29970 360 1334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_29970 1331 2098 gene locus_tag LOCUS_29980 1331 2098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_29980 2107 2709 gene locus_tag LOCUS_29990 2107 2709 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528613.1 protein_id gnl|my_center|LOCUS_29990 2709 2933 gene locus_tag LOCUS_30000 2709 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 3853 2936 gene locus_tag LOCUS_30010 gene panE 3853 2936 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083418.1 protein_id gnl|my_center|LOCUS_30010 3987 4235 gene locus_tag LOCUS_30020 3987 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 >Feature sequence108 444 1274 gene locus_tag LOCUS_30030 444 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 1336 3570 gene locus_tag LOCUS_30040 1336 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence109 447 680 gene locus_tag LOCUS_30050 447 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30050 768 1079 gene locus_tag LOCUS_30060 768 1079 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_30060 2048 2218 gene locus_tag LOCUS_30070 2048 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 2233 2451 gene locus_tag LOCUS_30080 2233 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 2609 3304 gene locus_tag LOCUS_30090 2609 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 3616 3900 gene locus_tag LOCUS_30100 3616 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3888 4181 gene locus_tag LOCUS_30110 3888 4181 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038207.1 protein_id gnl|my_center|LOCUS_30110 4214 4489 gene locus_tag LOCUS_30120 4214 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 >Feature sequence110 3012 2704 gene locus_tag LOCUS_30130 3012 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 4185 3967 gene locus_tag LOCUS_30140 4185 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 4362 4204 gene locus_tag LOCUS_30150 4362 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 >Feature sequence111 1130 78 gene locus_tag LOCUS_30160 1130 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 1238 2320 gene locus_tag LOCUS_30170 1238 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 <4590 2353 gene locus_tag LOCUS_30180 <4590 2353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106726897.1:Ti-type conjugative transfer relaxase TraA >Feature sequence112 27 3116 gene locus_tag LOCUS_30190 27 3116 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_30190 3186 3908 gene locus_tag LOCUS_30200 3186 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence113 689 480 gene locus_tag LOCUS_30210 689 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 844 1584 gene locus_tag LOCUS_30220 844 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1733 2620 gene locus_tag LOCUS_30230 1733 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2957 4063 gene locus_tag LOCUS_30240 2957 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence114 1698 946 gene locus_tag LOCUS_30250 1698 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 2102 3400 gene locus_tag LOCUS_30260 2102 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3490 3858 gene locus_tag LOCUS_30270 3490 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3943 4170 gene locus_tag LOCUS_30280 3943 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence115 453 561 gene locus_tag LOCUS_r00010 453 561 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 809 1441 gene locus_tag LOCUS_30290 809 1441 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118764.1 protein_id gnl|my_center|LOCUS_30290 1442 2887 gene locus_tag LOCUS_30300 gene desA 1442 2887 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_30300 3166 3798 gene locus_tag LOCUS_30310 3166 3798 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105558.1 protein_id gnl|my_center|LOCUS_30310 >Feature sequence116 689 429 gene locus_tag LOCUS_30320 689 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035590.1 protein_id gnl|my_center|LOCUS_30320 1759 689 gene locus_tag LOCUS_30330 1759 689 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_30330 3350 2061 gene locus_tag LOCUS_30340 3350 2061 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_30340 3670 3350 gene locus_tag LOCUS_30350 3670 3350 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence117 118 483 gene locus_tag LOCUS_30360 118 483 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390083.1 protein_id gnl|my_center|LOCUS_30360 486 1763 gene locus_tag LOCUS_30370 486 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 1772 2095 gene locus_tag LOCUS_30380 1772 2095 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704966.1 protein_id gnl|my_center|LOCUS_30380 >Feature sequence118 <1 1737 gene locus_tag LOCUS_30390 <1 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941578.1:aldehyde ferredoxin oxidoreductase family protein 1793 3046 gene locus_tag LOCUS_30400 1793 3046 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_30400 3047 3298 gene locus_tag LOCUS_30410 3047 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 3291 3593 gene locus_tag LOCUS_30420 3291 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence119 413 691 gene locus_tag LOCUS_30430 413 691 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_30430 702 986 gene locus_tag LOCUS_30440 702 986 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_30440 3361 1157 gene locus_tag LOCUS_30450 3361 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 <4179 3403 gene locus_tag LOCUS_30460 <4179 3403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069129909.1:GLUG motif-containing protein >Feature sequence120 1603 1238 gene locus_tag LOCUS_30470 1603 1238 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390083.1 protein_id gnl|my_center|LOCUS_30470 2001 1600 gene locus_tag LOCUS_30480 2001 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 2826 2194 gene locus_tag LOCUS_30490 gene rqpR 2826 2194 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_30490 4040 2823 gene locus_tag LOCUS_30500 4040 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence121 499 801 gene locus_tag LOCUS_30510 499 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 804 1043 gene locus_tag LOCUS_30520 804 1043 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_30520 1776 1135 gene locus_tag LOCUS_30530 1776 1135 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_30530 2125 2889 gene locus_tag LOCUS_30540 2125 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074347.1 protein_id gnl|my_center|LOCUS_30540 2882 3616 gene locus_tag LOCUS_30550 2882 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence122 1248 403 gene locus_tag LOCUS_30560 1248 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1943 1245 gene locus_tag LOCUS_30570 1943 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 3012 2272 gene locus_tag LOCUS_30580 3012 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence123 <1 1011 gene locus_tag LOCUS_30590 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836808.1:DUF2130 domain-containing protein 1911 922 gene locus_tag LOCUS_30600 1911 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 2057 2662 gene locus_tag LOCUS_30610 2057 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 2640 3065 gene locus_tag LOCUS_30620 2640 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3449 3126 gene locus_tag LOCUS_30630 3449 3126 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526806.1 protein_id gnl|my_center|LOCUS_30630 3681 3421 gene locus_tag LOCUS_30640 3681 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence124 283 789 gene locus_tag LOCUS_30650 283 789 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846961.1 protein_id gnl|my_center|LOCUS_30650 859 2301 gene locus_tag LOCUS_30660 859 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30660 2314 3270 gene locus_tag LOCUS_30670 2314 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30670 >Feature sequence125 1940 453 gene locus_tag LOCUS_30680 1940 453 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_30680 3197 1965 gene locus_tag LOCUS_30690 3197 1965 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345374.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence126 <3721 1587 gene locus_tag LOCUS_30700 <3721 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089920.1:multidrug efflux RND transporter permease subunit MuxB >Feature sequence127 1231 236 gene locus_tag LOCUS_30710 1231 236 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_30710 2160 1228 gene locus_tag LOCUS_30720 2160 1228 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_30720 2636 2157 gene locus_tag LOCUS_30730 2636 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence128 77 229 gene locus_tag LOCUS_30740 77 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 599 447 gene locus_tag LOCUS_30750 599 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 693 1694 gene locus_tag LOCUS_30760 693 1694 CDS product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_30760 2552 2187 gene locus_tag LOCUS_30770 2552 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3307 2651 gene locus_tag LOCUS_30780 3307 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence129 880 188 gene locus_tag LOCUS_30790 880 188 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_30790 1599 901 gene locus_tag LOCUS_30800 1599 901 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527730.1 protein_id gnl|my_center|LOCUS_30800 2298 1603 gene locus_tag LOCUS_30810 2298 1603 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194030.1 protein_id gnl|my_center|LOCUS_30810 3207 2332 gene locus_tag LOCUS_30820 3207 2332 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence130 2216 1365 gene locus_tag LOCUS_30830 2216 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 2796 2218 gene locus_tag LOCUS_30840 2796 2218 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082042.1 protein_id gnl|my_center|LOCUS_30840 >Feature sequence131 1225 854 gene locus_tag LOCUS_30850 gene rplL 1225 854 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198366.1 protein_id gnl|my_center|LOCUS_30850 1774 1250 gene locus_tag LOCUS_30860 gene rplJ 1774 1250 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199864.1 protein_id gnl|my_center|LOCUS_30860 2708 2022 gene locus_tag LOCUS_30870 gene rplA 2708 2022 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_30870 3141 2710 gene locus_tag LOCUS_30880 gene rplK 3141 2710 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_30880 3565 3266 gene locus_tag LOCUS_30890 3565 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence132 380 150 gene locus_tag LOCUS_30900 380 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 817 380 gene locus_tag LOCUS_30910 817 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 1926 826 gene locus_tag LOCUS_30920 1926 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence133 536 754 gene locus_tag LOCUS_30930 536 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 1112 837 gene locus_tag LOCUS_30940 1112 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1668 1483 gene locus_tag LOCUS_30950 1668 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 2680 2468 gene locus_tag LOCUS_30960 2680 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 >Feature sequence134 >Feature sequence135 164 412 gene locus_tag LOCUS_30970 164 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 409 732 gene locus_tag LOCUS_30980 409 732 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085147429.1 protein_id gnl|my_center|LOCUS_30980 891 751 gene locus_tag LOCUS_30990 891 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 890 1462 gene locus_tag LOCUS_31000 890 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 1994 2209 gene locus_tag LOCUS_31010 1994 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 2875 2429 gene locus_tag LOCUS_31020 2875 2429 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087269.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence136 1509 70 gene locus_tag LOCUS_31030 1509 70 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_31030 2909 2556 gene locus_tag LOCUS_31040 2909 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 3264 2983 gene locus_tag LOCUS_31050 3264 2983 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010201208.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence137 284 129 gene locus_tag LOCUS_31060 284 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 661 461 gene locus_tag LOCUS_31070 661 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 1931 1101 gene locus_tag LOCUS_31080 1931 1101 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970904.1 protein_id gnl|my_center|LOCUS_31080 >Feature sequence138 70 651 gene locus_tag LOCUS_31090 70 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 681 1652 gene locus_tag LOCUS_31100 681 1652 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931635.1 protein_id gnl|my_center|LOCUS_31100 1680 2573 gene locus_tag LOCUS_31110 1680 2573 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064999.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence139 285 1778 gene locus_tag LOCUS_31120 gene istA 285 1778 CDS product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_31120 1775 2560 gene locus_tag LOCUS_31130 gene istB 1775 2560 CDS product IS21-like element ISBj11 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018270204.1 protein_id gnl|my_center|LOCUS_31130 >Feature sequence140 412 1746 gene locus_tag LOCUS_31140 412 1746 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_31140 1748 2542 gene locus_tag LOCUS_31150 1748 2542 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546779.1 protein_id gnl|my_center|LOCUS_31150 2539 2760 gene locus_tag LOCUS_31160 2539 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 >Feature sequence141 472 837 gene locus_tag LOCUS_31170 472 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1459 917 gene locus_tag LOCUS_31180 1459 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 1458 2555 gene locus_tag LOCUS_31190 1458 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 >Feature sequence142 380 1498 gene locus_tag LOCUS_31200 380 1498 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887812.1 protein_id gnl|my_center|LOCUS_31200 >Feature sequence143 2155 3060 gene locus_tag LOCUS_31210 2155 3060 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102975.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence144 824 1897 gene locus_tag LOCUS_31220 824 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 1936 2610 gene locus_tag LOCUS_31230 1936 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence145 41 874 gene locus_tag LOCUS_31240 41 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 2917 983 gene locus_tag LOCUS_31250 2917 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence146 2121 1825 gene locus_tag LOCUS_31260 2121 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 2669 2223 gene locus_tag LOCUS_31270 2669 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 >Feature sequence147 224 427 gene locus_tag LOCUS_31280 224 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 1511 1383 gene locus_tag LOCUS_31290 1511 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1494 2183 gene locus_tag LOCUS_31300 1494 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence148 870 241 gene locus_tag LOCUS_31310 870 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 <3062 1333 gene locus_tag LOCUS_31320 <3062 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921306.1:ATP-binding protein >Feature sequence149 254 1264 gene locus_tag LOCUS_31330 254 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 1264 2505 gene locus_tag LOCUS_31340 1264 2505 CDS product phage minor head protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939976.1 protein_id gnl|my_center|LOCUS_31340 <3029 2477 gene locus_tag LOCUS_31350 <3029 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939976.1:phage minor head protein >Feature sequence150 305 1498 gene locus_tag LOCUS_31360 305 1498 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 protein_id gnl|my_center|LOCUS_31360 1495 2217 gene locus_tag LOCUS_31370 1495 2217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546252.1 protein_id gnl|my_center|LOCUS_31370 >Feature sequence151 2950 878 gene locus_tag LOCUS_31380 2950 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence152 >Feature sequence153 989 459 gene locus_tag LOCUS_31390 989 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2062 1034 gene locus_tag LOCUS_31400 2062 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence154 <1 1450 gene locus_tag LOCUS_31410 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106726897.1:Ti-type conjugative transfer relaxase TraA 2394 1516 gene locus_tag LOCUS_31420 2394 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence155 471 1460 gene locus_tag LOCUS_31430 471 1460 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924841.1 protein_id gnl|my_center|LOCUS_31430 1432 2466 gene locus_tag LOCUS_31440 1432 2466 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545600.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence156 1787 219 gene locus_tag LOCUS_31450 1787 219 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 protein_id gnl|my_center|LOCUS_31450 2227 1868 gene locus_tag LOCUS_31460 gene tnpB 2227 1868 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971138.1 protein_id gnl|my_center|LOCUS_31460 2409 2203 gene locus_tag LOCUS_31470 2409 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence157 486 1013 gene locus_tag LOCUS_31480 486 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 1097 2092 gene locus_tag LOCUS_31490 1097 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 2119 2661 gene locus_tag LOCUS_31500 2119 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence158 27 2624 gene locus_tag LOCUS_31510 27 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence159 245 1570 gene locus_tag LOCUS_31520 245 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 2334 1549 gene locus_tag LOCUS_31530 2334 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence160 220 591 gene locus_tag LOCUS_31540 220 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 794 657 gene locus_tag LOCUS_31550 794 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 1000 2562 gene locus_tag LOCUS_31560 1000 2562 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698054.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence161 <1 768 gene locus_tag LOCUS_31570 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925084.1:HD-GYP domain-containing protein 836 2608 gene locus_tag LOCUS_31580 836 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 >Feature sequence162 >Feature sequence163 1143 1424 gene locus_tag LOCUS_31590 1143 1424 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_31590 1414 1734 gene locus_tag LOCUS_31600 1414 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 >Feature sequence164 629 1111 gene locus_tag LOCUS_31610 629 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 1152 1382 gene locus_tag LOCUS_31620 1152 1382 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785693.1 protein_id gnl|my_center|LOCUS_31620 1375 1629 gene locus_tag LOCUS_31630 1375 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence165 3 635 gene locus_tag LOCUS_31640 3 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 622 1245 gene locus_tag LOCUS_31650 622 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 1242 2066 gene locus_tag LOCUS_31660 1242 2066 CDS product PRTRC system ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_31660 >Feature sequence166 1629 184 gene locus_tag LOCUS_31670 1629 184 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence167 1070 690 gene locus_tag LOCUS_31680 1070 690 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_31680 1865 1209 gene locus_tag LOCUS_31690 1865 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence168 26 475 gene locus_tag LOCUS_31700 26 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 472 2295 gene locus_tag LOCUS_31710 gene traD 472 2295 CDS product conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205050578.1 protein_id gnl|my_center|LOCUS_31710 >Feature sequence169 >Feature sequence170 57 251 gene locus_tag LOCUS_31720 57 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 549 740 gene locus_tag LOCUS_31730 549 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 1391 1513 gene locus_tag LOCUS_31740 1391 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 1756 1604 gene locus_tag LOCUS_31750 1756 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 2433 1816 gene locus_tag LOCUS_31760 2433 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 >Feature sequence171 155 358 gene locus_tag LOCUS_31770 155 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 1605 427 gene locus_tag LOCUS_31780 1605 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1682 1864 gene locus_tag LOCUS_31790 1682 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence172 258 1355 gene locus_tag LOCUS_31800 258 1355 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_31800 >Feature sequence173 <1 661 gene locus_tag LOCUS_31810 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403969.1:protoporphyrinogen oxidase 1176 895 gene locus_tag LOCUS_31820 1176 895 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693744.1 protein_id gnl|my_center|LOCUS_31820 1460 1882 gene locus_tag LOCUS_31830 1460 1882 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_31830 1879 2118 gene locus_tag LOCUS_31840 1879 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 >Feature sequence174 726 944 gene locus_tag LOCUS_31850 726 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31850 948 1253 gene locus_tag LOCUS_31860 948 1253 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994045.1 protein_id gnl|my_center|LOCUS_31860 1278 1895 gene locus_tag LOCUS_31870 gene cysC 1278 1895 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence175 2327 765 gene locus_tag LOCUS_31880 2327 765 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence176 232 573 gene locus_tag LOCUS_31890 232 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 >Feature sequence177 584 129 gene locus_tag LOCUS_31900 584 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 931 647 gene locus_tag LOCUS_31910 931 647 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_31910 <2489 1262 gene locus_tag LOCUS_31920 <2489 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003410070.1:ATP-binding protein >Feature sequence178 202 2277 gene locus_tag LOCUS_31930 202 2277 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942023.1 protein_id gnl|my_center|LOCUS_31930 >Feature sequence179 420 1640 gene locus_tag LOCUS_31940 420 1640 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921673.1 protein_id gnl|my_center|LOCUS_31940 1722 2435 gene locus_tag LOCUS_31950 1722 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence180 935 378 gene locus_tag LOCUS_31960 935 378 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526464.1 protein_id gnl|my_center|LOCUS_31960 2441 999 gene locus_tag LOCUS_31970 gene nuoN 2441 999 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_31970 >Feature sequence181 1926 877 gene locus_tag LOCUS_31980 1926 877 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118140.1 protein_id gnl|my_center|LOCUS_31980 2452 2078 gene locus_tag LOCUS_31990 2452 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31990 >Feature sequence182 2217 526 gene locus_tag LOCUS_32000 2217 526 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266628.1 protein_id gnl|my_center|LOCUS_32000 2452 2264 gene locus_tag LOCUS_32010 2452 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 >Feature sequence183 734 1129 gene locus_tag LOCUS_32020 734 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence184 633 178 gene locus_tag LOCUS_32030 633 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 2354 684 gene locus_tag LOCUS_32040 2354 684 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104442.1 protein_id gnl|my_center|LOCUS_32040 >Feature sequence185 <1 1377 gene locus_tag LOCUS_32050 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147059.1:type VI secretion system spike protein VgrG1b 1471 1995 gene locus_tag LOCUS_32060 1471 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 >Feature sequence186 242 1165 gene locus_tag LOCUS_32070 gene tsf 242 1165 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_32070 1279 2001 gene locus_tag LOCUS_32080 gene pyrH 1279 2001 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193606.1 protein_id gnl|my_center|LOCUS_32080 >Feature sequence187 2246 375 gene locus_tag LOCUS_32090 2246 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence188 456 1010 gene locus_tag LOCUS_32100 456 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862428.1 protein_id gnl|my_center|LOCUS_32100 1100 900 gene locus_tag LOCUS_32110 1100 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 1649 1167 gene locus_tag LOCUS_32120 1649 1167 CDS product elongation factor GreAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404212.1 protein_id gnl|my_center|LOCUS_32120 2113 1898 gene locus_tag LOCUS_32130 2113 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 2284 2138 gene locus_tag LOCUS_32140 2284 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence189 1721 27 gene locus_tag LOCUS_32150 1721 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence190 48 1994 gene locus_tag LOCUS_32160 48 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 >Feature sequence191 745 128 gene locus_tag LOCUS_32170 745 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 2219 1404 gene locus_tag LOCUS_32180 2219 1404 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095599.1 protein_id gnl|my_center|LOCUS_32180 >Feature sequence192 1549 860 gene locus_tag LOCUS_32190 1549 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 1883 2071 gene locus_tag LOCUS_32200 1883 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence193 276 1175 gene locus_tag LOCUS_32210 276 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 1177 2073 gene locus_tag LOCUS_32220 1177 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence194 699 334 gene locus_tag LOCUS_32230 699 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 1545 727 gene locus_tag LOCUS_32240 1545 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 <2303 1601 gene locus_tag LOCUS_32250 <2303 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331477.1:TraC family protein >Feature sequence195 434 1378 gene locus_tag LOCUS_32260 434 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32260 2247 1540 gene locus_tag LOCUS_32270 2247 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence196 <1 1215 gene locus_tag LOCUS_32280 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917171.1:IS21 family transposase 1224 2012 gene locus_tag LOCUS_32290 gene istB 1224 2012 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_32290 >Feature sequence197 2042 456 gene locus_tag LOCUS_32300 2042 456 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 protein_id gnl|my_center|LOCUS_32300 >Feature sequence198 1198 2028 gene locus_tag LOCUS_32310 1198 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence199 1846 380 gene locus_tag LOCUS_32320 1846 380 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_32320 >Feature sequence200 >Feature sequence201 1400 396 gene locus_tag LOCUS_32330 1400 396 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970282.1 protein_id gnl|my_center|LOCUS_32330 1960 1397 gene locus_tag LOCUS_32340 1960 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence202 <1 949 gene locus_tag LOCUS_32350 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980934.1:iron-regulated protein FrpC 1799 1095 gene locus_tag LOCUS_32360 1799 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence203 707 489 gene locus_tag LOCUS_32370 707 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 2046 976 gene locus_tag LOCUS_32380 2046 976 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114555269.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence204 128 1693 gene locus_tag LOCUS_32390 128 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 1711 2064 gene locus_tag LOCUS_32400 1711 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence205 1055 642 gene locus_tag LOCUS_32410 gene mqsA 1055 642 CDS product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 protein_id gnl|my_center|LOCUS_32410 1356 1048 gene locus_tag LOCUS_32420 1356 1048 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214787.1 protein_id gnl|my_center|LOCUS_32420 >Feature sequence206 1374 118 gene locus_tag LOCUS_32430 1374 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 1749 1384 gene locus_tag LOCUS_32440 1749 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 >Feature sequence207 1072 761 gene locus_tag LOCUS_32450 1072 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 1140 1304 gene locus_tag LOCUS_32460 1140 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 1529 1616 gene locus_tag LOCUS_t00350 1529 1616 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence208 <2149 465 gene locus_tag LOCUS_32470 <2149 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002214693.1:ShlB/FhaC/HecB family hemolysin secretion/activation protein >Feature sequence209 >Feature sequence210 >Feature sequence211 1229 153 gene locus_tag LOCUS_32480 1229 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 1548 1339 gene locus_tag LOCUS_32490 1548 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2024 1563 gene locus_tag LOCUS_32500 2024 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence212 401 105 gene locus_tag LOCUS_32510 401 105 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011809180.1 protein_id gnl|my_center|LOCUS_32510 <2109 745 gene locus_tag LOCUS_32520 <2109 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072642802.1:ISNCY-like element ISRsp17 family transposase >Feature sequence213 366 1157 gene locus_tag LOCUS_32530 366 1157 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence214 78 860 gene locus_tag LOCUS_32540 gene flgG 78 860 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625837.1 protein_id gnl|my_center|LOCUS_32540 888 1568 gene locus_tag LOCUS_32550 gene flgH 888 1568 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523041.1 protein_id gnl|my_center|LOCUS_32550 >Feature sequence215 554 1063 gene locus_tag LOCUS_32560 554 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 >Feature sequence216 1663 260 gene locus_tag LOCUS_32570 1663 260 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_32570 >Feature sequence217 >Feature sequence218 239 406 gene locus_tag LOCUS_32580 239 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 403 576 gene locus_tag LOCUS_32590 403 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 923 1336 gene locus_tag LOCUS_32600 923 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1333 1791 gene locus_tag LOCUS_32610 1333 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence219 181 1176 gene locus_tag LOCUS_32620 181 1176 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224817.1 protein_id gnl|my_center|LOCUS_32620 2052 1219 gene locus_tag LOCUS_32630 2052 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence220 1642 218 gene locus_tag LOCUS_32640 1642 218 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039554.1 protein_id gnl|my_center|LOCUS_32640 >Feature sequence221 1369 917 gene locus_tag LOCUS_32650 1369 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 >Feature sequence222 424 1890 gene locus_tag LOCUS_32660 424 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence223 >Feature sequence224 >Feature sequence225 >Feature sequence226 1995 1369 gene locus_tag LOCUS_32670 1995 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence227 240 1664 gene locus_tag LOCUS_32680 240 1664 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence228 114 959 gene locus_tag LOCUS_32690 114 959 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190826.1 protein_id gnl|my_center|LOCUS_32690 1001 1753 gene locus_tag LOCUS_32700 gene modA 1001 1753 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_32700 >Feature sequence229 267 1610 gene locus_tag LOCUS_32710 267 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 1617 1763 gene locus_tag LOCUS_32720 1617 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence230 335 1195 gene locus_tag LOCUS_32730 335 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 1453 1211 gene locus_tag LOCUS_32740 1453 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence231 <1970 349 gene locus_tag LOCUS_32750 <1970 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence232 786 1205 gene locus_tag LOCUS_32760 786 1205 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403315.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence233 785 264 gene locus_tag LOCUS_32770 785 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 1083 778 gene locus_tag LOCUS_32780 1083 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 1521 1204 gene locus_tag LOCUS_32790 1521 1204 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971265.1 protein_id gnl|my_center|LOCUS_32790 1774 1493 gene locus_tag LOCUS_32800 1774 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence234 1607 483 gene locus_tag LOCUS_32810 1607 483 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence235 <1955 138 gene locus_tag LOCUS_32820 <1955 138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922418.1:type I restriction-modification system subunit M >Feature sequence236 >Feature sequence237 731 147 gene locus_tag LOCUS_32830 gene slmA 731 147 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_32830 1820 930 gene locus_tag LOCUS_32840 gene argB 1820 930 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200214.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence238 345 133 gene locus_tag LOCUS_32850 345 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1136 342 gene locus_tag LOCUS_32860 1136 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 1650 1138 gene locus_tag LOCUS_32870 1650 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence239 30 896 gene locus_tag LOCUS_32880 30 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015381.1 protein_id gnl|my_center|LOCUS_32880 1008 886 gene locus_tag LOCUS_32890 1008 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 1440 1703 gene locus_tag LOCUS_32900 1440 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32900 >Feature sequence240 254 1513 gene locus_tag LOCUS_32910 254 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence241 1541 297 gene locus_tag LOCUS_32920 1541 297 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975595.1 protein_id gnl|my_center|LOCUS_32920 >Feature sequence242 370 1296 gene locus_tag LOCUS_32930 370 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 >Feature sequence243 1741 932 gene locus_tag LOCUS_32940 1741 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence244 <1 843 gene locus_tag LOCUS_32950 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022500.1:PLP-dependent aspartate aminotransferase family protein >Feature sequence245 1056 445 gene locus_tag LOCUS_32960 1056 445 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_32960 1644 1853 gene locus_tag LOCUS_32970 1644 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence246 331 1605 gene locus_tag LOCUS_32980 331 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence247 >Feature sequence248 <1 1785 gene locus_tag LOCUS_32990 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932315.1:magnesium-translocating P-type ATPase >Feature sequence249 247 1608 gene locus_tag LOCUS_33000 247 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence250 691 545 gene locus_tag LOCUS_33010 691 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1144 752 gene locus_tag LOCUS_33020 1144 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence251 327 620 gene locus_tag LOCUS_33030 327 620 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_33030 680 1597 gene locus_tag LOCUS_33040 680 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33040 >Feature sequence252 445 1200 gene locus_tag LOCUS_33050 445 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33050 >Feature sequence253 52 777 gene locus_tag LOCUS_33060 52 777 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_33060 1005 1298 gene locus_tag LOCUS_33070 1005 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence254 >Feature sequence255 1798 548 gene locus_tag LOCUS_33080 1798 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence256 <1 1448 gene locus_tag LOCUS_33090 <1 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545662.1:PBP1A family penicillin-binding protein 1441 1596 gene locus_tag LOCUS_33100 1441 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence257 >Feature sequence258 >Feature sequence259 1732 56 gene locus_tag LOCUS_33110 1732 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 >Feature sequence260 245 1174 gene locus_tag LOCUS_33120 245 1174 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_33120 1211 1287 gene locus_tag LOCUS_t00360 1211 1287 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence261 <1 600 gene locus_tag LOCUS_33130 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529345.1:IS1595 family transposase 597 1415 gene locus_tag LOCUS_33140 597 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 >Feature sequence262 472 963 gene locus_tag LOCUS_33150 472 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 960 1142 gene locus_tag LOCUS_33160 960 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 1139 1510 gene locus_tag LOCUS_33170 1139 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 >Feature sequence263 >Feature sequence264 680 345 gene locus_tag LOCUS_33180 680 345 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219993657.1 protein_id gnl|my_center|LOCUS_33180 1758 853 gene locus_tag LOCUS_33190 1758 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 >Feature sequence265 1054 716 gene locus_tag LOCUS_33200 gene tnpB 1054 716 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090953.1 protein_id gnl|my_center|LOCUS_33200 >Feature sequence266 >Feature sequence267 <1 536 gene locus_tag LOCUS_33210 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038220.1:GNAT family N-acetyltransferase 648 908 gene locus_tag LOCUS_33220 648 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 <1731 913 gene locus_tag LOCUS_33230 <1731 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206724.1:pyrroloquinoline quinone biosynthesis protein PqqE >Feature sequence268 >Feature sequence269 >Feature sequence270 <1 925 gene locus_tag LOCUS_33240 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196385.1:alkaline phosphatase family protein 1107 1334 gene locus_tag LOCUS_33250 1107 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 1315 1638 gene locus_tag LOCUS_33260 1315 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence271 185 1366 gene locus_tag LOCUS_33270 185 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 >Feature sequence272 <1 611 gene locus_tag LOCUS_33280 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003689718.1:DMT family transporter 608 955 gene locus_tag LOCUS_33290 608 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 1619 1131 gene locus_tag LOCUS_33300 1619 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence273 <1 892 gene locus_tag LOCUS_33310 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772652.1:ketoacyl-ACP synthase III 889 1617 gene locus_tag LOCUS_33320 gene fabG 889 1617 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence274 >Feature sequence275 100 1614 gene locus_tag LOCUS_33330 100 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence276 202 411 gene locus_tag LOCUS_33340 202 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 919 533 gene locus_tag LOCUS_33350 919 533 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_33350 1161 916 gene locus_tag LOCUS_33360 1161 916 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_33360 >Feature sequence277 771 1388 gene locus_tag LOCUS_33370 771 1388 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812635.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence278 >Feature sequence279 <1 1515 gene locus_tag LOCUS_33380 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943843.1:cytochrome c3 family protein >Feature sequence280 >Feature sequence281 1414 215 gene locus_tag LOCUS_33390 1414 215 CDS product IS4-like element ISGsu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940926.1 protein_id gnl|my_center|LOCUS_33390 >Feature sequence282 <1 1404 gene locus_tag LOCUS_33400 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119132.1:glycosyltransferase family 4 protein >Feature sequence283 >Feature sequence284 692 477 gene locus_tag LOCUS_33410 692 477 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 protein_id gnl|my_center|LOCUS_33410 782 1414 gene locus_tag LOCUS_33420 782 1414 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_33420 >Feature sequence285 910 359 gene locus_tag LOCUS_33430 910 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 <1630 947 gene locus_tag LOCUS_33440 <1630 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140949.1:MBOAT family protein >Feature sequence286 >Feature sequence287 <1 1202 gene locus_tag LOCUS_33450 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523251.1:cache domain-containing protein 1207 1563 gene locus_tag LOCUS_33460 1207 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence288 1366 1614 gene locus_tag LOCUS_33470 1366 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence289 >Feature sequence290 >Feature sequence291 <1604 672 gene locus_tag LOCUS_33480 <1604 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942128.1:TolC family protein >Feature sequence292 1184 564 gene locus_tag LOCUS_33490 1184 564 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence293 1231 476 gene locus_tag LOCUS_33500 1231 476 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446819.1 protein_id gnl|my_center|LOCUS_33500 >Feature sequence294 1062 1496 gene locus_tag LOCUS_33510 1062 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 >Feature sequence295 >Feature sequence296 >Feature sequence297 1543 131 gene locus_tag LOCUS_33520 1543 131 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_33520 >Feature sequence298 >Feature sequence299 767 576 gene locus_tag LOCUS_33530 767 576 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_33530 <1575 907 gene locus_tag LOCUS_33540 <1575 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186205.1:S53 family peptidase >Feature sequence300 >Feature sequence301 >Feature sequence302 51 794 gene locus_tag LOCUS_33550 51 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 805 1506 gene locus_tag LOCUS_33560 805 1506 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884084.1 protein_id gnl|my_center|LOCUS_33560 >Feature sequence303 >Feature sequence304 2 523 gene locus_tag LOCUS_33570 2 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 586 1101 gene locus_tag LOCUS_33580 586 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 >Feature sequence305 1281 508 gene locus_tag LOCUS_33590 1281 508 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence306 >Feature sequence307 >Feature sequence308 >Feature sequence309 1356 1141 gene locus_tag LOCUS_33600 1356 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 >Feature sequence310 >Feature sequence311 300 1379 gene locus_tag LOCUS_33610 300 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33610 >Feature sequence312 >Feature sequence313 <1 1206 gene locus_tag LOCUS_33620 <1 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087198.1:F-type conjugal transfer pilus assembly protein TraB >Feature sequence314 99 887 gene locus_tag LOCUS_33630 gene istB 99 887 CDS product IS21-like element ISSme2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970475.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence315